Modified HSV-1 vector for heterogeneous expressions of transgenes allowing simultaneous gene deletion and gene replacement

The modified HSV-1 vector allows for distinct kinetic profiles of transgene expression by positioning them in different genomic regions, overcoming limitations of current vectors and enabling diverse therapeutic applications.

WO2026150088A1PCT designated stage Publication Date: 2026-07-16EG 427
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
EG 427
Filing Date
2026-01-09
Publication Date
2026-07-16

AI Technical Summary

Technical Problem

Current viral vectors, such as AAV and lentiviral systems, are limited in their ability to express multiple transgenes with distinct kinetic profiles and safety concerns exist with adenoviruses, necessitating a novel vector for diverse therapeutic strategies.

Method used

A modified HSV-1 vector with multiple transgenes located in different genomic regions, allowing for controllable and distinct expression kinetics, including a first transgene for short-term expression and a second transgene for long-term expression, supported by chromatin insulators, to achieve differentiated gene therapy.

Benefits of technology

Enables simultaneous and controlled expression of multiple transgenes with different durations, addressing the limitations of existing vectors and providing versatile gene therapies for various diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000068_0001_TABLE
    Figure IMGF000068_0001_TABLE
  • Figure 00000058_0000
    Figure 00000058_0000
  • Figure 00000058_0001
    Figure 00000058_0001
Patent Text Reader

Abstract

Compositions and methods discussed herein provide for treatment or prevention of a disease or disorder, or its symptoms, using a modified herpes simplex virus (mHSV) vector comprising at least two transgenes, wherein at least a first transgene encoding a gene-editing system, gene-deletion system, or bridge-editing system is expressed to knock out or delete an endogenous target gene and at least a second transgene encoding a corrected copy of the endogenous targeted gene, wherein the gene product of the second transgene replaces the gene product of the endogenous target gene.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] DESCRIPTION

[0002] TITLE: MODIFIED HSV-1 VECTOR FOR HETEROGENEOUS EXPRESSIONS OF TRANSGENES ALLOWING SIMULTANEOUS GENE DELETION AND GENE REPLACEMENT BACKGROUND

[0003] During the last decade, viral delivery systems for gene delivery have seen a wave of improvement in introducing, replacing, or counteracting genes to treat a variety of human diseases. Adeno-associated virus (AAV) represents the leading platform for gene delivery, but such vectors are not adapted for the expression of large and / or multiple transgenes due to their small genome size, with a maximum transgene size of 4.7 kilobase pairs (kbp). While current herpes simplex virus type 1 (HSV-1) vectors offer alternatives for expressing large transgenes or multiple copies of the same transgene, viral vectors bearing multiple transgenes with distinct and controlled kinetics of expression are missing.

[0004] Various viral vector strategies have been developed. For example, polycistronic mRNA allows to produce multiple protein products from the same single mRNA (Wang et al., “Synthetic polycistronic sequences in eukaryotes” doi: 10.1016 / j.synbio.2021.09.003). However, with this strategy, the resulting proteins share the same stoichiometry and kinetic profile of expression. In addition, viral gene delivery systems have been generated with expression of several transgenes from distinct promoters being all inserted in a unique locus (Yu et al., “Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells,” doi.org / 10.1016 / S1525-0016(03)00104-7), including oncolytic HSV-1 vectors (Haines et al., “ONCR-177, an Oncolytic HSV-1 Designed to Potently Activate Systemic Antitumor Immunity,” doi: 10.1158 / 2326-6066. CIR-20-0609). As a result, although driven by different promoters, the transgenes displayed similar epigenetic regulation, thereby exhibiting common kinetic profiles of expression.

[0005] Adeno-associated virus (AAV)-based vehicles are often used for gene editing therapies due to their ability to deliver genetic material to predefined target cells. However, due to their small DNA cargo capability (4.7kbp), AAV cannot be used for delivering both the editing machinery and a replacement transgene from a single particle. Lentivirus-based delivery systems are not ideal for gene editing because of the integration of their genetic material into the host genome creating insertional mutagenesis. Moreover, genomic integration induces prolonged CRISPR / Cas transgeneexpression that increases the risk of off-target editing. As lentiviral-based systems have a higher genomic size than AAV vectors, such vectors can bear both editing transgenes and replacement transgene(s) (when the replaced gene does not exceed ~3kbp). However, the kinetic of expression of both types of transgenes (i.e. editing machinery and replacement gene) will follow the same dynamic. Even if inducible promoter could be used to transiently express the editing genes only, this solution remains dependent on an inducer and does not rely on the intrinsic properties of the vector itself. Adenoviruses (AdV) are large and non-integrating viruses that could be a potential option for combining both gene editing and gene replacement thanks to their high DNA payload capacity, up to 37kb. However, AdVs trigger strong immune responses, raising safety concerns that limits their use for in vivo therapies.

[0006] Therefore, there is a need to develop a novel viral vector that allows distinct epigenetic regulation to allow differentiated expression kinetics of different transgenes to respond to a diversity of innovative therapeutic strategies.

[0007] SUMMARY OF THE INVENTION

[0008] In French patent application 2408109, filed on July 23, 2024, which is incorporated herein by reference, the Applicant described a modified viral vector that allows different gene products (e.g., a protein) to be expressed from a single viral vector for different durations, which can be used for the treatment of various diseases. Such viral vectors of the invention enable specific kinetics of expressions of specific transgenes allowing a variety of transgenes to be delivered to the same cell and expressed for different durations from a single vector genome. By devising the modified viral vector of the invention comprising multiple transgenes located in selectively different regions along the vector genome, transgenes exhibit controllably distinct kinetic profiles of expression from each other. This viral vector opens the door for versatile gene therapies targeting a broad spectrum of diseases. The viral vector can be designed to deliver multiple transgenes to a cell, such as but not limited to a neuron, an epithelial cell, a muscle cell, or a connective tissue cell, preferably a neuron.

[0009] Preferably, the viral vector is a Herpes Simplex Virus type 1 (HSV-1) vector. Preferably the HSV-1 vector is a non-replicative modified HSV-1 (nrmHSV-1) vector (also referred to herein as the “modified HSV-1 vector”, “nrHSV-1”, or “mHSV-1 vector”). The modified HSV-1 vector comprises at least two transgenes that are expressed with different kinetic profiles. In embodiments, the modified HSV-1 vector comprises a first transgene that is expressed during a first period and a second transgene that is expressed during a second period, that may or may not overlap, partially ortotally, with the first period, after entering a cell. In embodiments, the first period is a short expression period, such as a transient expression period, such as ranging from hours to days or a few weeks. In embodiments, the second period lasts for a long term, such as more than four weeks, or a life-long period of the subject of the delivery.

[0010] The first and second transgenes are located in different regions along the modified HSV-1 vector. In embodiments, the first transgene is located between genes expressed only during the lytic cycle, such as an intergenic region in the unique long (UL) region or the unique short (US) region. In embodiments, the second transgene is located in a region surrounded by chromatin insulators that allow long-term expression, such as but not limited to the latency-associated transcript (LAT) region.

[0011] This invention provides a viral vector that allows different gene products (e.g., a protein, a non-coding RNA) to be expressed from a single viral vector for different durations, which can be used for the treatment of various diseases, including genetic disorders, neurological disorders, and cancers.

[0012] BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Fig- 1 shows a nrmHSV-1 genome with mGreenLantem transgene located in the LAT region and mScarlet transgene located in the unique long (UL) region between UL21 and UL22 genes. AJoint spreads from ICP4 to ICP27.

[0014] Fig- 2 shows a nrHSV-1 genome with mGreenLantem transgene located in the LAT region and mScarlet transgene located in the unique long region (UL) between UL26.5 and UL27 genes.

[0015] Fig- 3 shows a nrHSV-1 genome with mGreenLantem transgene located in the LAT region and mScarlet transgene located in the unique long (UL) region between UL45 and UL46 genes.

[0016] Fig. 4 shows a nrHSV-1 genome with mGreenLantem transgene located in the LAT region and mScarlet transgene located in the unique short (US) region between US1 and US2 genes.

[0017] Fig. 5 shows a nrHSV-1 genome with mGreenLantem transgene located in the LAT region and mScarlet transgene located in the region deleted for the joint region.

[0018] Fig. 6 shows a nrHSV-1 genome with mGreenLantem transgene located in the LAT region and mScarlet transgene located in the long terminal repeat (TLR) between ICP34.5 and ICPO genes. Fig. 7A shows a nrmHSV-1 genome with a first transgene construct encoding the components of a CRISPR / Cas9 system, located in the unique long (UL) region between UL45 and UL46 genes and asecond transgene encoding replacement gene within the LAT region. AJoint spreads from ICP4 to ICP27.

[0019] Fig. 7B is a close-up of the first transgene construct. gRNAs are organized in a tail to tail (T2T) orientation

[0020] Fig. 8A shows a first transgene construct encoding the components of a CRISPR / Cas9 system where two gRNAs are synthetized from a single transcript that is then cleaved by a ribozyme. HH:

[0021] Hammerhead ribozyme. HDV: Hepatitis Delta virus ribozyme. The first transgene construct is located in the unique long (UL) region between UL45 and UL46 genes and a second transgene encoding replacement gene within the LAT region. AJoint spreads from ICP4 to ICP27.

[0022] Fig. 8B is a close-up of the of the first transgene construct.

[0023] Fig. 9A shows a nrmHSV-1 genome with a first transgene construct encoding the components of a CRISPR / Cas9 system, located in the unique long (UL) region between UL45 and UL46 genes and a second transgene encoding replacement gene within the LAT region. AJoint spreads from ICP4 to ICP27.

[0024] Fig. 9B is a close-up of the first transgene construct. gRNAs are organized in a head to tail (H2T) orientation.

[0025] Fig. 10 is a schematic of the eGFP sequence inserted within the HEK genome and targeted by the CRISPR / Cas9 machinery. The sgRNAs cleavage sites induced by the gene editing machinery are depicted. Two primers (“CMV-enh_Fw2” and “eGFP-CRISPR-KO_Rv2”) were used for the amplification of the targeted genomic sequence by PCR, which were then run on an agarose gel to assess the editing system efficacy. DSB: double strand break, i.e., DNA modification induced by recognition and cleavage by the CRISPR / Cas9 system. The table described the sizes of the different PCR products that can be obtained and visualized by agarose electrophoresis.

[0026] FIG. 11 is a schematic of the codon-optimized eGFP sequences inserted in the nrHSV-1 vectors, which are designed to escape recognition by the CRISPR / Cas9 machinery. Two primers (“eGFP-co out Rvl” and eGFP-co_out_Fwl”) were used for the amplification of the targeted genomic sequence by PCR, which was then run on an agarose gel to assess the editing system efficacy. DSB: double strand break, DNA modification induced by recognition and cleavage by the CRISPR / Cas9system. The table described the sizes of the different PCR products that can be obtained and visualized by agarose electrophoresis.

[0027] Fig. 12A and Fig. 12B show agarose electrophoresis of the PCR performed on the genomic DNA of eGFP-expressing HEK cells after infection with different nrmHSV-1 vectors and harvested at either 24 or 48 hours post infection. EG6.11.18 A vectors all express gRNAs and the Cas9 protein for deletion of the eGFP sequence from the genome of HEKs. EG6.11.18A VI (Fig. 12A) and EG6.11.18A V5 (Fig. 12B) have the gRNAs in a head to tail orientation whereas EG6.11.18A V6 (Fig. 12B) has them in a tail to tail orientation. The presence of a band at around 400 bp and corresponding to the cleavage by both gRNAs before DNA repair was only observable in cells infected by nrHSV-1 vectors harboring the CRISPR / Cas9 machinery. This band pattern was observable in a time and MOI-dependent manner. The lighter band observed with the highest MOIs can be explained by the cell death associated with such high MOIs. Altogether, this data demonstrates that editing of the targeted gene has been achieved.

[0028] Fig. 13 depicts expression of eGFP as determined by RT-qPCR after fold change calculation using the 2'AACqmethod. GAPDH was used as housekeeping gene and the constitutive expression of eGFP in non-infected eGFP-expressing HEK cells was used as reference condition. The transcription level of eGFP was determined 24 and 48 hours post infection and the decrease of eGFP RNA level was both time and MOI-dependent. In non-infected cells harvested at 24 and 48 hpi (condition “Ni”), the level of eGFP was comparable to the basal level of expression of the eGFP (TO) illustrating the specific effect of the gene editing machinery expressed from the CRISPR / Cas9 vectors (EG6.11.18A-V1, V5, and V6).

[0029] Fig. 14 depicts expression of the Cas9 protein as determined by RT-qPCR after fold change calculation using the 2'AACqmethod. GAPDH was used as housekeeping gene and the Cas9 expression observed at 48 hours post infection after infection at MOI 0.1 with the EG6.11.18 A-V 1 vector was used as reference condition. The transcription level of Cas9 was determined 24 and 48 hours post infection and appeared to be MOI-dependent. In non-infected cells harvested at TO, 24 and 48 hpi (condition “TO” and “Ni”, respectively) Cas9 was not detected.

[0030] Fig. 15 depicts expression of codon-optimized eGFP as determined by RT-qPCR after fold change calculation using the 2'AACqmethod. GAPDH was used as housekeeping gene and the expression of co-eGFP observed in cells infected with EG6.11.18A-V1 at MOI 0.1 48 hours post infection wasused as reference condition. The transcription level of co-eGFP has been determined 24 and 48 hours post infection and the increase of co-eGFP RNA level was both time and MOI-dependent. In noninfected cells harvested at TO, 24 and 48 hpi (condition “TO” and “Ni”, respectively), no expression of a co-eGFP could be detected.

[0031] Fig. 16A and Fig.l6B depict agarose electrophoresis of the PCR performed on the episomal DNA of nrHSV-1 vectors after infection of eGFP-expressing HEK cells with CRISPR / Cas9 vectors and harvested at either 24 or 48 hours post infection. EG6.11.18 A vectors all express gRNAs and the Cas9 protein for deletion of the native eGFP (i.e., non-codon-optimized) sequence from the genome of HEKs. EG6.11.18 A V 1 (A) and EG6.11.18 A V 5 (A) have the gRNAs in a head to tail orientation whereas EG6.11.18 A V6 (B) has them in a tail to tail orientation. The presence of a unique band at around 850 bp showed that both codon optimizated eGFP sequences (co-eGFP) escaped recognition by the gene editing machinery, regardless of the percentage of homology between the native and the codon-optimized sequences. This band pattern was independent of time and MOI.

[0032] Fig. 17 depicts agarose electrophoresis of the PCR performed on the genomic DNA of eGFP-expressing HEK cells after infection with different nrHSV-1 vectors and harvested 48 hours post infection. EG6.11.18 A vectors all express gRNAs and the Cas9 protein for deletion of the endogene eGFP sequence from the genome of HEKs. EG6.11.18A V 1 and EG6.11.18 A V5 have the gRNAs in a head to tail orientation whereas EG6.11.18 A V6 has them in a tail to tail orientation. The presence of a band at around 400 bp, corresponds to the cleavage by both gRNAs before DNA repair, was only observed in cells infected by nrHSV-1 vectors harboring the CRISPR / Cas9 machinery, and was not present in non-infected cells or cells infected with a vector only expressing the luciferase gene (EG141 A). This band pattern was observable in a MOI-dependent manner. The lighter band observed with the highest MOIs can be explained by the cell death associated with such high MOIs.

[0033] Fig. 18 depicts the expression of eGFP determined by RT-qPCR after fold change calculation using the 2'AACqmethod. GAPDH was used as housekeeping gene and the constitutive expression of eGFP in non-infected eGFP-expressing HEK cells was used as reference condition. The transcription level of eGFP was determined 48 hours post infection and the decrease of eGFP RNA level was MOI-dependent. In cells infected with a luciferase-expressing nrHSV-1 vector (condition “EG141 A”), the level of eGFP was comparable to the basal level of expression of the eGFP (TO) illustrating thespecific effect of the gene editing machinery expressed from the CRISPR / Cas9 vectors (EG6.11.18A-V1, V5, and V6).

[0034] Fig. 19 depicts the expression of the Cas9 protein as determined by RT-qPCR after fold change calculation using the 2'AACqmethod. GAPDH was used as housekeeping gene and the Cas9 expression observed after infection at MOI 0.1 with the EG6.11.18A-V1 vector was used as reference condition. The transcription level of Cas9 was determined 48 hours post infection and appeared to be MOI-dependent. In cells harvested at TO and in cells infected with a luciferaseexpressing nrHSV-1 vector (condition “EG141A”), no expression of a Cas9 was detected.

[0035] Fig. 20 depicts the expression of codon-optimized eGFP determined by RT-qPCR after fold change calculation using the 2'AACqmethod. GAPDH was used as housekeeping gene and the expression of co-eGFP observed in cells infected with EG6.11.18A-V1 at MOI 0.1 was used as reference condition. The transcription level of co-eGFP was determined 48 hours post infection and the increase of co-eGFP RNA level was MOI-dependent. In cells harvested at TO and in cells infected with a luciferase-expressing nrHSV-1 vector (condition “EG141A”), no expression of a co-eGFP could be detected.

[0036] Fig. 21 depicts the agarose electrophoresis of the PCR performed on the episomal DNA of nrHSV-1 vectors after infection of eGFP-expressing HEK cells with CRISPR / Cas9 vectors and harvested at either 24 or 48 hours post infection. EG6.11.18 A vectors all express gRNAs and the Cas9 protein for deletion of the endogene eGFP sequence from the genome of HEKs. EG6.11.18 A V 1 and EG6.11.18A V5 have the gRNAs in a head to tail orientation whereas EG6.11.18A V6 has them in a tail to tail orientation. The presence of a unique band at around 850 bp showed that both codon optimizated eGFP sequences (co-eGFP) escaped recognition by the gene editing machinery, regardless of the percentage of homology between the native and the codon-optimized sequences. This band pattern was independent of MOI. The band observed around 1750 bp resulted from the amplification from the EG141 A vector used as a MOI compensator during infection. Since this vector was not used where CRISPR / Cas9 vectors were directly used at MOI 3, the absence of this band for those conditions was expected.

[0037] DETAILED DESCRIPTION

[0038] Compositions and methods discussed herein provide for treatment or prevention of a disease or disorder, or its symptoms, using a modified herpes simplex virus (mHSV) vector comprising atleast two transgenes, wherein at least a first transgene encoding a gene-editing system, gene-deletion system, or bridge-editing system is expressed to knock out or delete an endogenous target gene and at least a second transgene encoding a corrected copy of the endogenous targeted gene, wherein the gene product of the second transgene replaces the gene product of the endogenous target gene.

[0039] Preferably, the endogenous target gene is a disease-causing endogenous target gene. In embodiments, the nucleotide sequence of the second transgene encoding the corrected copy of the endogenous target gene has been further optimized to avoid knockout by the gene-editing system encoded by the first transgene.

[0040] Disease-causing endogenous target genes include but are not limited to genes encoding dominant diseases or dominant negative mutation responsible for hereditary diseases (also referred to as autosomal dominant disorders), as described herein. The present invention combines gene editing and gene replacement from a single viral vector for treating specific genetic disorders encoded by such disease-causing endogenous target gene, where the discrimination of the genomic sequences between diseased and non-diseased alleles is complex.

[0041] The two or more transgenes delivered by a modified HSV-1 vector can exhibit distinct and controllable kinetic profiles of expression after entering a target cell. This modified HSV-1 vector offers unique advantages over other viral vectors in gene therapy, paving the way for innovative therapeutic strategies that are currently unavailable. The insertion of multiple transgenes respectively into different, selected regions of the HSV-1 genome can provide distinct kinetic profiles of expression for each transgene in various cell types. In the simplest form of this invention, two transgenes are independently inserted into the HSV-1 vector wherein a first transgene is inserted into a region of the genome configured to confer short-term (e.g., transient) expression and a second transgene is inserted into a region of the genome configured to confer long-term expression of the transgene. For example, in embodiments, the first transgene is inserted into a short-expression region, such as between genes expressed only during the lytic cycle (e.g., in an intergenic region in the UL or US region, preferably between lytic genes) of the genome, and the second transgene surrounded by chromatin insulators (e.g., inserted into the LAT region) or protected by at least one chromatin insulator of the genome. In embodiments, the first transgene expresses a gene product (e.g., a protein) for a first period and the second transgene expresses a gene product for a second period. The first and second periods may or may not overlap with each other.The present invention takes advantage of the ambivalence of the HSV-1 epigenetic program to combine gene editing machinery (in a first transgene) and gene replacement (in a second transgene) with different kinetics of expression from the same viral genome. Thus, in neuronal cells, for example, one or more first transgenes coding for the gene-editing machinery can be inserted between lytic genes and can be expressed for a short period of time before their heterochromatinization in order to alter and knockout the endogenous target gene preventing expression of its gene product. From the same vector, a replacement gene product (i.e., a correct copy of the endogenous target gene), encoded by one or more second transgenes, can be inserted in region protected by chromatin insulators, such as the LAT region, and can be expressed for an extended period of time in order to express a gene product (“a replacement gene product”) having non-disease function and / or activity (e.g., normal function and / or activity).

[0042] Similarly, in non-neuronal cells, because non-repl icative, modified HSV-1 (nrmHSV-1) vector fails to launch a lytic phase due to deletion of essential genes, the viral genome enters a latency phase after this failure, hence, the gene-editing system of the one or more first transgenes inserted between lytic genes should be expressed for a short time before repression, while the replacement gene product encoded by the one or more second transgenes inserted in the insulator-protected region should be expressed for long term.

[0043] The nucleotide sequence of the one or more second transgenes can be optimized to escape the recognition by the gene-editing system encoded by the one or more first transgenes.

[0044] The compositions and methods discussed herein treat or prevent a disease or disorder by targeting an endogenous target gene, such as a disease-causing endogenous target gene, within the non-coding region (e.g., the promoter region, regulatory regions, intronic sequence) or coding region (e.g., a transcribed sequence, exonic sequence) for alteration and knockout of expression and replacing the endogenous target gene with a corrected copy of the endogenous target gene. In an embodiment, the coding region of the endogenous target gene is targeted for alteration and knockout of expression. In embodiments, knockout of the endogenous target gene, e.g., to eliminate expression of the endogenous target gene, is achieved by induction of an alteration comprising a deletion or mutation in the endogenous target gene. In an embodiment, the alteration comprises an insertion or deletion or substitution. The sequence of the corrected copy of the endogenous target gene is optimized so that it is not targeted for alteration and knockout of expression. Preferably the endogenous target gene is a disease-causing endogenous target gene.In an aspect, the invention provides a modified HSV-1 vector comprising at least two transgenes inserted within different genomic regions of the modified HSV-1 vector to provide distinct kinetic profiles of expression, wherein a first transgene comprises a nucleotide sequence encoding a gene-editing system directed to a disease-causing endogenous target gene, wherein a second transgene comprises a nucleotide sequence encoding a corrected copy of the endogenous target gene, wherein the first transgene is expressed for a first period and the second transgene is expressed for a second period after entering a cell, and wherein the first period is a shorter period than the second period.

[0045] The modified HSV-1 vector of the invention can be used to treat, for example, Huntington’s disease by deleting endogenous huntingtin alleles (in an allele specific or non-allele specific manner) and expressing, for long-term, a corrected huntingtin gene providing only the functional form of the huntingtin protein. The same approach can be applied to any autosomal dominant disorder or autosomal recessive disorder. Non-limiting examples of such disease-causing endogenous target genes are described herein.

[0046] “Allele specific” refers to the ability to knockout or significantly inhibit expression of one endogenous allele of a gene over another, e.g., when both alleles are present in the same cell. For example, the alleles can differ by one, two, or three or more nucleotides in the target region. In embodiments, one allele is associated with disease causation, e.g., a disease correlated to a dominant gain-of-function mutation, whereas other allele(s) express a gene product of non-pathogenic function or activity. In allele specific knockout of the disease-causing endogenous target gene, the gene editing system of the first transgene specifically targets and knocks out significantly inhibits expression the disease-causing allele. Other endogenous allele(s) expressing a normal functional protein are not knocked out.

[0047] “Non-allele specific” refers to the ability to knockout or significantly inhibit expression of any endogenous allele of a gene whether disease-causing or not. In non-allele specific knockout of the disease-causing endogenous target gene, the gene editing system of the first transgene specifically targets and knocks out significantly inhibits expression any allele of the endogenous target gene. The only normal (non-pathogenic) protein would be expressed from the second transgene of the modified HSV-1 of the invention.Disease-Causing Endogenous Target Genes

[0048] The compositions and methods discussed herein provide for treatment or prevention of a disease or disorder, or its symptoms, caused by an endogenous target gene (a “disease-causing endogenous target gene”). In embodiments, the disease or disorder is a result of a dominant mutation in an endogenous target gene. Such disease-causing endogenous target gene(s) are also referred to as “autosomal dominant disorders” or “autosomal recessive disorders”.

[0049] The endogenous target gene or target allele may specify the amino acid sequence of a mutant protein associated with a pathological condition. For example, the protein may be a gain-of- function (e.g., a dominant gain-of-function) mutant protein. In a preferred aspect, the mutant protein is associated with a disease or disorder which is correlated with expression of a particular gene or allele of a gene, e.g., a dominant gain-of-function mutation. The term "gain-of-function mutation" as used herein, refers to any mutation in a gene in which the protein encoded by said gene (i.e., the mutant protein) acquires a function not normally associated with the protein (i.e., the wild-type protein) that causes or contributes to a disease or disorder. The gain-of-function mutation can be a deletion, insertion, or substitution of a nucleotide or nucleotides in the gene which gives rise to the change in the function of the encoded protein. In one embodiment, the gain-of-function mutation is a point mutation. In one embodiment, the gain-of-function mutation is a translocation.

[0050] In one embodiment, the gain-of-function mutation changes the function of the mutant protein or causes interactions with other proteins. In another embodiment, the gain-of-function mutation causes a decrease in or removal of normal wild-type protein, for example, by interaction of the altered, mutant protein with said normal, wild-type protein. The trait in which the dominant point mutation is involved is not particularly limited and is preferably a trait to be suppressed. Examples thereof include a mutation involved in the onset of a disease and a mutation involved in abnormal morphology. Gain-of-function disorders are a class of diseases or disorders characterized by a gain-of-function mutation. For example, such disorders may include amyotrophic lateral sclerosis, Huntington's disease, Alzheimer's disease, Parkinson's disease, as well as cancer.

[0051] Other examples of gain-of-function mutations include the KIT receptor, which has been linked to a number of gastrointestinal stromal tumors. Naturally occurring mutations in G protein alpha subunits and in G protein-coupled receptors have been linked to a number of human diseases, including endocrine disorders. Germline loss of function mutations in the ubiquitously expressed Gs-alpha gene have been identified as the cause of generalized hormone resistance and dysmorphicfeatures in the inherited disorder pseudohypoparathyroidism type 1A. Somatic gain-of-function mutations in Gs-alpha have been identified as the cause of the McCune-Albright syndrome, a sporadic disorder in which affected individuals have varying combinations of endocrine hyperfunction, cafe-au-lait skin pigmentation, and polyostotic fibrous dysplasia.

[0052] Further, gain-of-function mutations in the thyrotropin receptor (TSHR, a G-protein coupled receptor) are correlated with toxic follicular thyroid adenoma, a condition caused by excessive quantities of thyroid hormones. Gain-of-function mutations in TSH receptor genes have also been linked to hereditary toxic thyroid hyperplasia, another condition caused by excessive quantities of thyroid hormones. Mutations of the superoxide dismutase (SOD) gene have been linked to certain familial forms of ALS. Mutations in protein-tyrosine phosphatase, nonreceptor-type 11 (PTPN11) have been correlated with Noonan syndrome, an autosomal dominant disorder characterized by dysmorphic facial features, proportionate short stature and heart disease. Hereditary pancreatitis is associated with mutations in human cationic trypsinogen. Brachydactyly type B (BDB), an autosomal dominant disorder characterized by terminal deficiency of the fingers and toes, is believed to be associated with dominant gain-of-function mutation in R0R2, which encodes an orphan receptor tyrosine kinase, von Willebrand disease, particularly Type 2A and 2B, is another disease which may be associated with a dominant gain-of-function mutation. A dominant gain-of-function mutation has been described in p53 that results in oncogenic activation of that gene. In addition, Creutzfeldt-Jakob disease has been associated with a dominant gain-of-function mutation in the prion protein gene, the PRNP E200K mutation. Testotoxicosis is an autosomal dominant condition caused by a gain-of-function mutation in the LH receptor.

[0053] In embodiments, the disease or disorder is caused by a mutation of only a single nucleotide, as is the case with certain mutations, for example, point mutations. The term "point mutation" refers to a single-base substitution observed in a target nucleotide sequence (e.g., a target gene or target allele) compared with the corresponding nucleotide sequence of a non-target sequence (e.g., a wildtype allele or normal allele). The term "allele" refers to one of two alternate forms of a gene that can have the same locus on homologous chromosomes. Two different alleles may be responsible for alternative traits, e.g., one allele can be dominant over the other. The term "dominant allele" refers to an allele from which a trait is preferentially manifested as a phenotype.

[0054] In this context, the "wild-type" refers to common naturally occurring genes or alleles in the allele population of the same type of gene, wherein a protein encoded by this gene or allele hasnormal (i.e., non-pathogenic) function and / or activity. The point mutation may be any of congenitally occurring mutations and postnatally acquired mutations. Further point mutations include missense mutations that bring about amino acid substitution, silent mutations that do not result in amino acid substitution but causes change to a degenerate codon, nonsense mutations that leads to the appearance of a stop codon, frameshift mutations, and mutations at a splicing site. In certain embodiments, the point mutation is a dominant point mutation. A "dominant point mutation" refers to a point mutation that confers a dominant trait on the gene or allele, or a dominant mutation-associated (or -linked) point mutation in one transcript.

[0055] In embodiments, the disease-causing endogenous target gene encodes an oncogene, such as BRAF, or a Ras protein such as H-Ras, K-Ras, or N-Ras. These oncogenes contain point mutations responsible for their tumorigenic activity in cells.

[0056] In embodiments, the disease-causing endogenous target gene allele and non-target (wild-type) allele both encode an enzyme, where a mutation, e.g., point mutation, results in stronger activity (or abnormal activity) of the endogenous target gene allele encoded enzyme, as compared to the enzyme encoded by the non-target wild-type allele. For example, the disease-causing endogenous target gene allele and non-target wild-type gene allele may encode a kinase. In various embodiments, the kinase is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase. In embodiments, the kinase is a superoxide dismutase or a triglyceride hydrolase. In still other embodiments, the disease-causing endogenous target gene allele and non-target wild-type gene allele encode a transcriptional activator, such as MYD88. The MYD88 L265P variant is the most prevalent mutation in patients with Waldenstrom's macroglobulinemia (WM), a type of non-Hodgkin's lymphoma. MYD88 L265P often results from a T^C transversion. Signaling studies showed that the mutant protein that is encoded by MYD88 L265P triggers tumor growth through the activation of nuclear factor kappa light-chain enhancer of activated B cells (NF-KB) by Bruton's tyrosine kinase. (Treon et al., MYD88 Mutations and Response to Ibrutinib in Waldenstrom's Macroglobulinemia, N Engl J Med 2015; 373, 584-586 (2015)).

[0057] In certain embodiments, the expressed gene product of a mutant allele results in aggregation of the mutant proteins causing disease. In certain embodiments, the expressed gene product of a mutant allele results in gain of function causing disease. In certain embodiments, genes with an autosomal dominant mutation resulting in a toxic gain of function of the protein are the APP gene encoding amyloid precursor protein involved in Alzheimer's disease (Gene, 371: 68, 2006); the PrPgene encoding prion protein involved in Creutzfeldt-Jakob disease and in fatal familial insomnia (Nat. Med. 1997, 3: 1009); GFAP gene encoding glial fibrillary acidic protein involved in Alexander disease (J. Neurosci. 2006, 26:111623); alpha-synuclein gene encoding alpha-synuclein protein involved in Parkinson's disease (J. Clin. Invest. 2003, 111: 145); SOD-1 gene encoding the SOD-1 protein involved in amyotrophic lateral sclerosis (Science 1998, 281: 1851); atrophin-1 gene encoding atrophin-1 protein involved in dentato-rubral and pallido-luysian atrophy (DRPA) (Trends Mol. Med. 2001, 7: 479); SCA1 gene encoding ataxin-1 protein involved in spino-cerebellar ataxia-1 (SCA1) (Protein Sci. 2003, 12: 953); PLP gene encoding proteolipid protein involved in Pelizaeus-Merzbacher disease (NeuroMol. Med. 2007, 4: 73); DYT1 gene encoding torsinA protein involved in Torsion dystonia (Brain Res. 2000, 877: 379); and alpha-B crystalline gene encoding alpha-B crystalline protein involved in protein aggregation diseases, including cardiomyopathy (Cell 2007, 130: 427); alphal -antitrypsin gene encoding alphal -antitrypsin protein involved in chronic obstructive pulmonary disease (COPD), liver disease and hepatocellular carcinoma (New Engl J. Med. 2002, 346: 45); Ltk gene encoding leukocyte tyrosine kinase protein involved in systemic lupus erythematosus (Hum. Mol. Gen. 2004, 13: 171); PCSK9 gene encoding PCSK9 protein involved in hypercholesterolemia (Hum Mutat. 2009, 30: 520); prolactin receptor gene encoding prolactin receptor protein involved in breast tumors (Proc. Natl. Assoc. Sci. 2008, 105: 4533); CCL5 gene encoding the chemokine CCL5 involved in COPD and asthma (Eur. Respir. J. 2008, 32: 327);

[0058] PTPN22 gene encoding PTPN22 protein involved in Type 1 diabetes, Rheumatoid arthritis, Graves disease, and SLE (Proc. Natl. Assoc. Sci. 2007, 104: 19767); androgen receptor gene encoding the androgen receptor protein involved in spinal and bulbar muscular atrophy or Kennedy's disease (J Steroid Biochem. Mol. Biol. 2008, 108: 245); CHMP4B gene encoding chromatin modifying protein-4B involved in progressive childhood posterior subcapsular cataracts (Am. J. Hum. Genet.

[0059] 2007, 81: 596); FXR / NR1H4 gene encoding Farnesoid X receptor protein involved in cholesterol gallstone disease, arthrosclerosis and diabetes (Mol. Endocrinol. 2007, 21: 1769); ABCA1 gene encoding ABCA1 protein involved in cardiovascular disease (Transl. Res. 2007, 149: 205); CaSR gene encoding the calcium sensing receptor protein involved in primary hypercal ciuria (Kidney Int.

[0060] 2007, 71: 1155); alpha-globin gene encoding alpha-globin protein involved in alpha-thallasemia (Science 2006, 312: 1215); httlpr gene encoding HTTLPR protein involved in obsessive compulsive disorder (Am. J. Hum. Genet. 2006, 78: 815); AVP gene encoding arginine vasopressin protein in stress-related disorders such as anxiety disorders and comorbid depression (CNS Neurol. Disord.Drug Targets 2006, 5: 167); GNAS gene encoding G proteins involved in congenital visual defects, hypertension, metabolic syndrome (Trends Pharmacol. Sci. 2006, 27: 260); APAF1 gene encoding APAF1 protein involved in a predisposition to major depression (Mol. Psychiatry. 2006, 11 : 76); TGF-betal gene encoding TGF-betal protein involved in breast cancer and prostate cancer (Cancer Epidemiol. Biomarkers Prev. 2004, 13: 759); AChR gene encoding acetylcholine receptor involved in congenital myasthenic syndrome (Neurology 2004, 62: 1090); P2Y12 gene encoding adenosine diphosphate (ADP) receptor protein involved in risk of peripheral arterial disease (Circulation 2003, 108: 2971); LQT1 gene encoding LQT1 protein involved in atrial fibrillation (Cardiology 2003, 100: 109); RET protooncogene encoding RET protein involved in sporadic pheochromocytoma (J. Clin. Endocrinol. Metab. 2003, 88: 4911); filamin A gene encoding filamin A protein involved in various congenital malformations (Nat. Genet. 2003, 33: 487); TARDBP gene encoding TDP-43 protein involved in amyotrophic lateral sclerosis (Hum. Mol. Gene.t 2010, 19: 671); SCA3 gene encoding ataxin-3 protein involved in Machado-Joseph disease (PLoS One 2008, 3: e3341); SCA7 gene encoding ataxin-7 protein involved in spino-cerebellar ataxia-7 (PLoS One 2009, 4: e7232); and HTT gene encoding huntingtin protein involved in Huntington's disease (Neurobiol Dis. 1996, 3:183); and the CA4 gene encoding carbonic anhydrase 4 protein, CRX gene encoding cone-rod homeobox transcription factor protein, FSCN2 gene encoding retinal fascin homolog 2 protein, IMPDH1 gene encoding inosine monophosphate dehydrogenase 1 protein, NR2E3 gene encoding nuclear receptor subfamily 2 group E3 protein, NRL gene encoding neural retina leucine zipper protein, PRPF3 (RP18) gene encoding pre-mRNA splicing factor 3 protein, PRPF8 (RP13) gene encoding pre-mRNA splicing factor 8 protein, PRPF31 (RP11) gene encoding pre-mRNA splicing factor 31 protein, RDS gene encoding peripherin 2 protein, R0M1 gene encoding rod outer membrane protein 1 protein, RHO gene encoding rhodopsin protein, RP1 gene encoding RP1 protein, RPGR gene encoding retinitis pigmentosa GTPase regulator protein, all of which are involved in Autosomal Dominant Retinitis Pigmentosa disease (Adv Exp Med. Biol. 2008, 613:203).

[0061] In certain embodiments, the disease-causing endogenous target gene or allele is associated with any disease from the group consisting of Alzheimer's disease, Creutzfeldt-Jakob disease, fatal familial insomnia, Alexander disease, Parkinson's disease, amyotrophic lateral sclerosis, dentato-rubral and pallido-luysian atrophy DRPA, spino-cerebellar ataxia, Torsion dystonia, cardiomyopathy, chronic obstructive pulmonary disease (COPD), liver disease, hepatocellular carcinoma, systemiclupus erythematosus, hypercholesterolemia, breast cancer, asthma, Type 1 diabetes, Rheumatoid arthritis, Graves disease, systemic lupus erythemethosus (SLE), spinal and bulbar muscular atrophy, Kennedy's disease, progressive childhood posterior subcapsular cataracts, cholesterol gallstone disease, arthrosclerosis, cardiovascular disease, primary hypercalciuria, alpha-thallassemia, obsessive compulsive disorder, Anxiety, comorbid depression, congenital visual defects, hypertension, metabolic syndrome, prostate cancer, congenital myasthenic syndrome, peripheral arterial disease, atrial fibrillation, sporadic pheochromocytoma, congenital malformations, Machado-Joseph disease, Huntington's disease, and Autosomal Dominant Retinitis Pigmentosa disease.

[0062] First Transgene(s)

[0063] The first transgene comprises a nucleotide sequence that encodes a gene-editing system. The gene-editing system comprises one or more gene products that target the genomic loci of the diseasecausing endogenous target gene or allele (also referred to herein as “an endogenous target gene”) encoding one or more disease-causing endogenous target gene products (also referred to herein as “an endogenous target gene products”) and cleaves the genomic loci of the endogenous target gene or allele encoding the one or more endogenous target gene products, whereby expression of the one or more endogenous target gene products is altered. In embodiments, the gene-editing system induces an alteration (i.e., a deletion, insertion or mutation) of the endogenous target gene that results in a knockout of the endogenous target gene.

[0064] Any gene-editing system known in the art can be used including, but not limited to, clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9), transcription activator-like effector nucleases (TALENs), zinc-finger nucleases (ZFNs), homing endonucleases (or meganucleases), bridge-RNA and transposase systems including but not limited to the IS110 bridge recombination system.

[0065] In embodiments, the gene-editing system comprises (i) a nucleotide sequence allowing transcription of a non-coding DNA-targeting RNA; and (ii) a nucleotide sequence encoding a site-directed modifying polypeptide. In embodiments, the DNA-targeting RNA comprises: (a) a first segment comprising a nucleotide sequence that is complementary to a target sequence in genomic loci of the endogenous target gene; and (b) a second segment that interacts with the site-directed modifying polypeptide. In embodiments, the site-directed modifying polypeptide comprises: (a) an RNA-binding portion that interacts with the DNA-targeting RNA; and (b) an activity portion thatexhibits site-directed enzymatic activity, wherein the site of enzymatic activity is determined by the DNA-targeting RNA.

[0066] In embodiments, the first transgene comprises (i) one or more nucleotide sequences encoding DNA-targeting RNAs that are complementary to and hybridize with target sequences in the genomic loci of endogenous target genes encoding one or more gene products; and (ii) a nucleotide sequence encoding a site-directed modifying polypeptide, whereby the DNA-targeting RNAs target the genomic loci of the endogenous target genes encoding the one or more gene products and the site-directed modifying polypeptide cleaves the genomic loci of the endogenous target genes encoding the one or more gene products, whereby expression of the one or more gene products is altered. In embodiments, the DNA-targeting RNA and the site-directed modifying polypeptide do not naturally occur together.

[0067] The invention comprehends the expression of one or more gene products being altered. The invention comprehends the modified HSV-1 vectors of the invention further comprising one or more nuclear localization signal(s) (NLS(s)).

[0068] The invention comprehends that the DNA-targeting RNA and the site-directed modifying polypeptide do not naturally occur together.

[0069] The invention further comprehends the site-directed modifying polypeptide being codon optimized for expression in the eukaryotic cell. In a preferred embodiment the eukaryotic cell is a mammalian cell or a human cell.

[0070] In a further embodiment of the invention, the expression of one or more of the endogenous target gene products is decreased. In aspects of the invention cleaving a DNA duplex at the genomic loci of the endogenous target gene encoding the gene product encompasses cleaving either one or both strands of the DNA duplex.

[0071] In embodiments, the first transgene comprises (i) a nucleotide sequence expressing a DNA-targeting RNA that is complementary to and hybridizes with a target sequence in the genomic loci of an endogenous target gene encoding a gene product; (ii) a nucleotide sequence encoding a site-directed modifying polypeptide, whereby the DNA-targeting RNA targets the genomic loci of the endogenous target gene encoding the gene products and the site-directed modifying polypeptide cleaves the genomic loci of the endogenous target gene encoding the gene product, whereby expression of the gene product is altered.In embodiments, the first transgene comprises (i) one or more nucleotide sequences expressing DNA-targeting RNAs, the DNA-targeting RNAs comprising: (a) a first segment comprising a nucleotide sequence that is complementary to target sequences in the genomic loci of the endogenous target genes; and (b) a second segment that interacts with a site-directed modifying polypeptide; and (ii) a nucleotide sequence encoding the site-directed modifying polypeptide, the site-directed modifying polypeptide comprising: (a) an RNA-binding portion that interacts with the one or more DNA-targeting RNAs; and (b) an activity portion that exhibits site-directed enzymatic activity, wherein the site of enzymatic activity is determined by the one or more DNA-targeting RNAs.

[0072] In embodiments, the first transgene comprises (i) a nucleotide sequence expressing a DNA-targeting RNA, the DNA-targeting RNA comprising: (a) a first segment comprising a nucleotide sequence that is complementary to a target sequence in the genomic loci of the endogenous target gene; and (b) a second segment that interacts with a site-directed modifying polypeptide; and (ii) a nucleotide sequence encoding the site-directed modifying polypeptide, the site-directed modifying polypeptide comprising: (a) an RNA-binding portion that interacts with the DNA-targeting RNA; and (b) an activity portion that exhibits site-directed enzymatic activity, wherein the site of enzymatic activity is determined by the DNA-targeting RNA.

[0073] In some of any embodiment herein, the nucleotide sequence expressing the DNA-targeting RNA and the nucleotide sequence encoding the site-directed modifying polypeptide are operably linked to, and under the same control of, the same regulatory element. Preferably, the regulatory element is operable in a eukaryotic cell.

[0074] In some of any embodiment herein, the nucleotide sequence expressing the DNA-targeting RNA is operably linked to a first regulatory element and the nucleotide sequence encoding the site-directed modifying polypeptide operably linked to a second regulatory element. The first and second regulatory elements can be the same or different. Preferably, the first and second regulatory elements are operable in a eukaryotic cell.

[0075] The diverse array of genetic outcomes made possible by these gene-editing systems is the result, in large part, of their ability to efficiently induce targeted DNA double-strand breaks (DSBs). These DNA breaks then drive activation of cellular DNA repair pathways and facilitate the introduction of site-specific genomic modifications. This process is most often used to achieve geneknockout via random base insertions and / or deletions that can be introduced by nonhomologous end joining (NHEJ).

[0076] The target sequence in the genomic loci of the endogenous target gene which is complementary to the DNA-targeting RNA is also referred to as a “target position”. “Target position” as used herein, refers to a position with the endogenous target gene, which if altered, for example by NHEJ-mediated alteration, results in reduction or elimination of expression of a functional endogenous target gene product.

[0077] In some of any embodiment herein, the gene-editing system provides a targeted knockout approach mediated by NHEJ using a CRISPR / Cas system, wherein the first transgene encodes a guide RNA (gRNA) molecule which is complementary to a target sequence in the genomic loci of the endogenous target gene; and a Cas molecule.

[0078] In embodiments, the first transgene comprises one or more guide RNAs that hybridize with target sequences in genomic loci of the endogenous target genes encoding the one or more gene products, and a Cas molecule, whereby the Cas molecule cleaves the genomic loci of the endogenous target genes encoding the one or more gene products, whereby expression of the one or more gene products is altered.

[0079] In some of any embodiment herein, the first transgene comprises a guide RNA that hybridizes with a target sequence in genomic loci of the endogenous target gene, a gene product, and a Cas molecule, whereby the Cas molecule cleaves the genomic loci of the endogenous target gene, whereby expression of the gene product is altered.

[0080] In some of any embodiment herein, the first transgene comprises a) a first regulatory element operably linked to one or more CRISPR / Cas system guide RNAs that hybridize with target sequences in genomic loci of endogenous target genes encoding one or more gene products, b) a second regulatory element operably linked to a Cas molecule, whereby the guide RNAs target the genomic loci of the endogenous target genes encoding the one or more gene products in a eukaryotic cell and the Cas molecule cleaves the genomic loci of the endogenous target genes encoding the one or more gene products, whereby expression of the one or more gene products is altered.

[0081] In embodiments, two or more “first” transgenes can be used to encode the components of the gene-editing system. For example, a “first transgene A” can express the gRNA and another “first” transgene, e.g., “first transgene B” can encode the Cas9 molecule. The invention comprehends the guide RNAs comprising a guide sequence fused to a tracr sequence.In general, a DNA-targeting RNA (e.g. a guide RNA) is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a DNA-targeting RNA / site-directed modifying polypeptide complex to the target sequence. In embodiments, the degree of complementarity between a DNA-targeting RNA and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.

[0082] In embodiments, a DNA-targeting RNA (e.g., the guideRNA) is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In embodiments, the DNA-targeting RNA (e.g., the guideRNA) sequence is at least 15, 16, 17, 18, 19, 20, 27 nucleotides, or between 10-30, or between 15-27, nucleotides in length.

[0083] The DNA-targeting RNA may be selected to target any target sequence. In embodiments, the target sequence is a sequence within a genome of a cell. Exemplary target sequences include those that are unique in the target genome. Further exemplary target sequences include those that result in an autosomal dominant disorder as described herein.

[0084] In embodiments, the Cas molecule can be a wild-type Cas9 molecule or any Cas9 variant molecule known in the art. Non-limiting examples of Cas molecules include Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Casll, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2. Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are known; for example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2.

[0085] In embodiments, the Cas molecule directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and / or within the complement of the target sequence. In embodiments, the Cas molecule directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence. Typically, in the context of a CRISPR system, formation of a CRISPR complex (comprising a guide RNA hybridized to a target sequence and complexed with oneor more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or 50) the target sequence.

[0086] Preferably, the Cas molecule is Cas9. In embodiments, the Cas9 may be Cas9 from S. pyogenes or S. pneumoniae.

[0087] In embodiments, a Cas9 nickase may be used in combination with guide sequence(s), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce NHEJ.

[0088] As discussed further herein, the first transgene (or two or more first transgenes) is introduced into the mHSV vector in a location that provides for short-term, i.e., transient, expression of the first transgene. Transient expression of gene editing system is desirable as it lowers the risk of off-target editing. It is a key advantage of the vector of invention to offer this combined with a long-term replacement with a corrected copy of the endogenous target gene encoded by the second transgene.

[0089] As discussed further herein, the first transgene (or two or more first transgenes) can be part of an expression cassette.

[0090] Second Transgene(s)

[0091] The second transgene encodes a “replacement gene”, i.e., a corrected (i.e., non-disease causing) copy of the disease-causing endogenous target gene targeted for knockout by the geneediting system encoded by the first transgene. In this way, the gene product of the second transgene replaces the gene product encoded by the disease-causing endogenous target gene with a non-disease causing protein, i.e., a protein that has its normal (non-pathogenic) function and / or activity.

[0092] The nucleotide sequence of the second transgene is further codon optimized so that it is not recognized by the gene-editing system of the first transgene. In other words, the DNA-targeting RNA does not hybridize to the nucleotide sequence of the second transgene. For example, where the first transgene encodes a CRISPR-Cas system, the nucleotide sequence of the second transgene is codon optimized to not be recognized by the guide RNA (gRNA) expressed from the first transgene.

[0093] This modified HSV-1 vector of the invention allows for the silencing (knockout) of the disease-causing allele (endogenous target gene) and replacement with a non-disease-causing allele encoded by the second transgene. The current invention also contemplates knocking out all endogenous target alleles (disease-causing or not; i.e., non-allele specific) and relying on thereplacement gene product (e.g., protein) encoded by the second transgene to provide the desired function and / or activity and / or phenotype.

[0094] In embodiments, two or more “second” transgenes can be used to encode the replacement gene. For example, a “second transgene A” can encode the corrected (i.e., non-disease causing) copy of the endogenous target gene and another “second” transgene, e.g., “second transgene B” can encode another corrected (i.e., non-disease causing) copy of the endogenous target gene. The corrected copies of the endogenous target gene can be the same or different.

[0095] As discussed further herein, the second transgene (or two or more second transgenes) is introduced into the mHSV vector of the invention in a location that provides for long-term expression of the second transgene.

[0096] As discussed further herein, the second transgene (or two or more second transgenes) can be part of an expression cassette.

[0097] Modified HSV Vector

[0098] The Herpes simplex virus (HSV) is a complex, non-integrating DNA virus capable of infecting a very wide range of human and animal cells. HSV encompasses two serotypes, herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2). The genome of HSV-1 has a size of approximately 152-kbp. It contains about 80 protein-encoding genes and more than 20 microRNAs. The HSV-1 genome is composed of two unique segments, UL and US, each flanked by inverted repeats that encode critical genes present in two copies.

[0099] A large part of the HSV-1 genome encodes non-essential genes that could, in principle, be individually deleted without significantly perturbing virus multiplication and packaging in cultured cells. In addition, one or more essential genes can also be deleted, but in this case the virus will only multiply in the presence of a complementing system, such as a complementing cell line, that provides the proteins not expressed by the vector genome. Therefore, the genome of HSV-1 can be modified such that non-essential genes, essential genes, or combinations thereof can be deleted. Altogether, these deletions can create a vast genomic space allowing the introduction and delivery of very large foreign pieces of DNA.

[0100] Preferably, the modified HSV-1 (mHSV-1) vector is a non-replicative HSV-1 vector (nrHSV-1). nrHSV-1 vectors are engineered to lack essential viral genes required for replication, typically theimmediate-early genes such as ICP4 (both copies), ICP27, and ICPO (one or both copies). These vectors can express transgenes but cannot produce new virions.

[0101] In embodiments, the modified HSV-1 vector begins as a HSV-1 pre-vector, wherein non-essential genes, essential genes, or combinations thereof have been deleted from the HSV-1 genome to provide a genome backbone comprising less than 130 kbp and greater than 75 kbp of the original HSV-1 genome. HSV-1 pre-vectors are described with the understanding that, as "backbones," it is contemplated that one or more nucleic acids, with or without extraneous control elements, can be inserted therein.

[0102] According to the invention, the qualifier “essential” in the expression “essential genes” or “non-essential genes”, means that the given gene is essential (or not) for achieving multiplication and packaging of the virus genome, thus generating infectious progeny virus particles. HSV-1 essential genes include ULI, UL5-UL9, UL12, UL14, ULI 5, UL17-UL19, UL22, UL25-UL38, UL42, UL48, UL49, UL52, UL54, US6, ICP4 (2 copies). HSV-1 non-essential genes include ICP34.5 (2 copies), ICPO (2 copies), LAT (2 copies), UL2-UL4, UL10, ULI 1, UL13, UL16, UL20, UL21, UL23, UL24, UL39, UL40, UL41, UL43-UL47, UL50, UL51, UL53, UL55, UL56, US1-US5, US7-US12.

[0103] In embodiments, clusters of genes that could be deleted include, but are not limited to, genes UL2, UL3, UL4 (10.200 - 12.600); genes UL10, ULI 1 (23.200 - 25.200); gene UL16 (30.200 -31.400); genes UL20, UL21 (40.800 - 43.700); genes UL23, UL24 (46.700 - 48.600); genes UL39, UL40, UL41 (86.400 -92.700); genes UL43 to UL47 (94.700 - 103.200); genes UL50, UL51 (107.700 - 109.100); genes UL55, UL56 (115.400 - 117.100); one copy of genes LAT, ICPO, UL34.5 (IRL) (118.700 - 126.100); genes US2 to US5 (134.000 - 138.200); genes US7 to US12 (139.700 - 145.600); and / or the second copy of gene ICPO when the first copy has already been removed among the LAT, ICPO, UL34.5 cluster.

[0104] In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 11 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 15 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 18 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 22 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 25 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 30 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 40 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises agenome wherein at least 45 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 50 kbp have been deleted. In embodiments, the HSV-1 prevector comprises a genome wherein at least 55 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 60 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 65 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein at least 75 kbp have been deleted.

[0105] In embodiments, the HSV-1 pre-vector comprises a genome wherein 25 kbp to 80 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein 30 kbp to 75 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein 35 kbp to 70 kbp have been deleted. In embodiments, the HSV-1 pre-vector comprises a genome wherein 40 kbp to 60 kbp have been deleted.

[0106] In embodiments, the modified HSV-1 pre-vector comprising an HSV-1 genome wherein non-essential genes, essential genes, or combinations thereof have been deleted to arrive at a genome backbone comprising less than 130 kbp and greater than 75 kbp.

[0107] In embodiments, the HSV-1 pre-vector optionally comprises a Bacterial Artificial Chromosome (BAC) sequence. As used herein, a BAC is an engineered DNA molecule used in a fashion that allows it to be propagated as a circular artificial chromosome in bacteria. BAC vectors are plasmids constructed with the replication origin of E. coli F factor, and so can be maintained in a single copy per cell. These BAC vectors can hold DNA fragments of up to 300 kbp. Although all non-essential HSV-1 genes can in principle be deleted within a BAC, which is propagated in bacteria, the collective deletion of all of them will most probably create a disabled virus, too much attenuated to be efficiently grown in mammalian cultured cells.

[0108] Preferably, the HSV-1 pre-vectors maintain enough of the HSV-1 genome so as to not become HSV-1 amplicon. By "Amplicon or amplicon vector," it is meant to be a helper-dependent vector, the genome of which lacks most or all HSV genes coding for viral proteins. The genome of amplicon vectors is a concatemeric DNA composed of multiple copies, organized in tandem, of a plasmid-known as the amplicon plasmid- that carries one origin of DNA replication and one packaging signal from HSV-1 genome. In cells expressing the full set of structural, replication and DNA packaging functions from HSV-1, resulting from the presence of an HSV-1 genome acting as helper, the amplicon plasmid is amplified by a rolling-circle mechanism into long head-to-tail concatemers that are then cleaved and packaged, up to one genome size, into HSV-1 virions (Kwongand Frenkel, 1985; Bataille and Epstein, 1997). Amplicon vectors are thus concatemeric DNA sequences packaged into HSV-1 particles.

[0109] The HSV-1 pre-vector serves as a vector template, wherein deletions described above create genomic space allowing the introduction of one or more nucleic acid sequences of interest, e.g., one or more transgenes of interest. The introduction of multiple nucleic acid sequences increases the genome size (i.e., number of base pairs), resulting in the modified HSV-1 vector of the invention. Without wishing to be bound to any particular theory, it is believed that when the modified HSV-1 vector of the invention is of a size similar to the 152 kbp of the wild-type HSV-1 genome or within a range of 143kbp to 154.5 kbp, the resulting modified HSV-1 vector is more stable genomically and, thereby possessing improved vector viability.

[0110] In any embodiment herein, the size of the modified HSV-1 vector is between about 143 kbp and 160 kbp. In embodiments, the size of the modified HSV-1 vector is between about 143 kbp and 158 kbp. In embodiments, the size of the modified HSV-1 vector is between about 143 kbp and 155 kbp. In embodiments, the size of the modified HSV-1 vector, is between about 143 kbp and 153 kbp.

[0111] In any embodiment herein, the size of the modified HSV-1 vector is between about 147 kbp and 165 kbp. In embodiments, the size of the modified HSV-1 vector is between about 147 kbp and 153 kbp. In embodiments, the size of the modified HSV-1 vector is between about 149 kbp and 155 kbp. In embodiments, the size of the modified HSV-1 vector, is between about 149 kbp and 153 kbp. In embodiments, the size of the modified HSV-1 vector, is between about 152 kbp.

[0112] The modified HSV-1 vector comprises at least two inserted transgenes. Specifically, as described above, the modified HSV-1 vector comprises a first transgene encoding components of a gene-editing system and a second transgene encoding a corrected copy of the disease-causing endogenous target gene as described herein.

[0113] As discussed herein, the size of the modified HSV-1 vector genome is itself important, as a genome that is too short or too large cannot be correctly packaged. Preferably, the size of the modified HSV-1 vector genome is about 143 kbp to about 154.5 kbp. The modified HSV-1 vector of the invention is prepared by the introduction of the first and second transgenes (described herein) into the HSV-1 pre-vector. However, depending on the size of the HSV-1 pre-vector and the size of the transgenes introduced therein, the size of the modified HSV-1 vector may not fall within the preferred range of about 143 kbp to about 154.5 kbp. In this case, the modified HSV-1 vector mayfurther comprise one or more stuffers. As used herein, the term “stuffer” refers to any random noncoding DNA sequence, non-coding RNA sequence, one or more exogenous genes of interest, or combinations thereof. Preferably the stuffer is any random non-coding DNA sequence. As used herein, the term, one or more exogenous genes of interest can include, but are not limited to, one or more HSV-1 essential genes, one or more HSV-1 non-essential genes, a reporter gene (e.g., GFP, RFP, luciferase, or fused protein, etc.) driven by an inducible, transient or persistent promoter serving as internal expression control or for biodistribution studies; recombinases driven by an inducible promoter to allow in vivo modifying cellular or viral genes; antibiotic resistance genes such as chloramphenicol; elements of the Tetracycline inducible system (TRE); any foreign DNA encoding a gene of interest, or combinations thereof. The use of reporter genes such as, but not limited to, firefly Luciferase, mCherry, mScarlet, RFP, GFP, CFP, or mGreen Lantern can facilitate the identification of the recombined genome, to assess the stability of the stuffer and to score both infectious particles (PFU) and transducing units (TU).

[0114] The primary purpose of the stuffer is to further introduce one or more nucleotide sequences of an appropriate size (in base pairs) so that the size of the modified HSV-1 vector is at or close to the size of the wild type HSV-1 genome, i.e., about 152 kbp, after the transgenes have been added to the HSV-1 pre-vector. Considerations for the stuffer include the nature of the stuffer, the size of the stuffer, and the placement of the stuffer in the genome of the modified HSV-1 vector of the invention.

[0115] The presence and / or length of the one or more stuffers is tailored according to the size of the transgenes, in kilo-base pairs (kbp), to arrive at the desirable overall length of the modified HSV-1 vector genome. Therefore, the design of the stuffer is determined last after all other design choices for the modified HSV-1 vector have been made.

[0116] In embodiments, the stuffer is a DNA sequence. For example, in one embodiment a scrambled sequence from the HSV-1 genome (e.g., scrambled HSV-1 DNA) can be used. In embodiments, the stuffer can be a scrambled nucleotide sequence of genes deleted from the HSV-1 genome.

[0117] In embodiments, the stuffer is one or more HSV-1 essential genes. In embodiments, the stuffer is a combination of any random non-coding DNA or RNA sequence, and one or more HSV-1 essential genes.In embodiments, the stuffer is one or more HSV-1 non-essential genes. In embodiments, the stuffer is a combination of any random non-coding DNA or RNA sequence and one or more HSV-1 non-essential genes.

[0118] In embodiments, the stuffer is a combination of any random non-coding DNA or RNA sequence, one or more HSV-1 essential genes, and one or more HSV-1 non-essential genes.

[0119] In embodiments, the stuffer is a combination of one or more HSV-1 essential genes and one or more HSV-1 non-essential genes.

[0120] In embodiments, the stuffer is one or more exogenous genes of interest. In embodiments, the stuffer is a combination of any random non-coding DNA or RNA sequence and one or more exogenous genes of interest. In embodiments, the stuffer is a combination of any random non-coding DNA or RNA sequence, one or more HSV-1 essential genes, and one or more exogenous genes of interest. In embodiments, the stuffer is a combination of any random non-coding DNA or RNA sequence, one or more HSV-1 non-essential genes, and one or more exogenous genes of interest. In embodiments, the stuffer is a combination of one or more HSV-1 essential genes, one or more HSV-1 non-essential genes, and one or more exogenous genes of interest. In embodiments, the stuffer is a combination of one or more HSV-1 essential genes and one or more exogenous genes of interest. In embodiments, the stuffer is a combination of one or more HSV-1 non-essential genes and one or more exogenous genes of interest.

[0121] In any embodiments herein, the size of the stuffer will be determined based on the size of the other nucleic acid sequences introduced (e.g., one or more transgenes and / or one or more nucleic acids encoding cell targeting proteins) into the modified HSV-1 vector.

[0122] In embodiments, the stuffer can be introduced into the modified HSV-1 vector of the invention as a single, long nucleic acid sequence. In embodiments, the stuffer can be introduced into the modified HSV-1 vector of the invention as two or more stuffers of the same or different lengths. Stuffers can be inserted in the same DNA regions as the first or the second transgene. In preferred embodiments, the one or more stuffers are inserted in different DNA regions from the first and second transgene.

[0123] In embodiments, the stuffer can be introduced as several, smaller stuffers in different intergenic regions of the modified HSV-1 genome. In embodiments, the smaller stuffers can be the same or different lengths.It is important to note that a BAC sequence, when present in the HSV-1 pre-vector, is removed when preparing the modified HSV-1 vector of the invention. As such, the size of the BAC sequence is not considered when determining the size of the stuff er so that the final size of the modified HSV-1 vector is about 152 kbp as described herein.

[0124] In embodiments, the stuffer can originate from cellular DNA introns.

[0125] In any embodiment disclosed herein, the transgenes and the optional stuffers can be introduced into the HSV-1 pre-vector backbone by site specific recombination (SSR), by homologous recombination (HR), or En passant mutagenesis technique.

[0126] In embodiments, this invention utilizes the heterogenous expression kinetic of HSV-1 vector in cells to allow for control and distinct expression profiles for at least the first and second transgenes as described herein.

[0127] The wild-type HSV-1 follows a well-defined sequence of events from initial infection to the production of new virions. During the entry step, which occurs within 0-1 hour post-infection, HSV-1 virions bind to heparan sulfate proteoglycans and interact with specific receptors such as nectin-1. The viral envelope fuses with the cell membrane, allowing the nucleocapsid and tegument proteins to enter the cytoplasm. The nucleocapsid is then transported along microtubules to nuclear pores, releasing viral DNA into the nucleus. Within a few hours post-infection, the immediate-early (IE) phase begins, with the viral DNA undergoing transcription to produce IE proteins such as ICPO, ICP4, ICP22, ICP27, and ICP47. These regulatory proteins modulate the host cell environment to favor viral replication. From 4-8 hours post-infection, the early (E) phase ensues, with IE proteins activating the transcription of early genes that encode enzymes necessary for viral DNA synthesis, such as DNA polymerase and thymidine kinase. During this period, viral DNA replication begins, increasing viral DNA copies for the production of late genes. The late (L) phase, spanning 8-16 hours post-infection, involves the transcription of late genes that encode structural proteins required for assembling new virions. The assembly and egress phase, from 16-24 hours post-infection, leads to the assembly of new viral capsids in the nucleus, the encapsidation of replicated viral DNA and the acquisition of their final envelope by budding into cytoplasmic vesicles. Mature virions are released from the cell by exocytosis or cell lysis. The release of progeny virions, occurring from 24-48 hours post-infection, spreads the infection to neighboring cells.

[0128] nrHSV-1 vectors, lacking essential viral genes required for replication, are unable to replicate, unable to exit infected cell, nor induce a lytic phase but have the ability to express one ormore transgenes. Without wishing to be bound by any particular theory, in neuronal cells, where HSV-1 establishes latency, the first transgene is inserted between lytic genes and can be expressed for a short period of time before its heterochromatinization, while the second transgene is inserted in a region protected by chromatin insulators (such as the LAT region) can be expressed for the long term.

[0129] Similarly, in non-neuronal cells, as non-replicative HSV-1 (nrHSV-1) vectors fail to launch a lytic phase due to the deletion of essential genes, the viral genome can enter into a latent state after this failure. Hence, the first transgene inserted between lytic genes should be expressed for a short time before repression, while the second transgene inserted in the insulator-protected region should be expressed for the long term.

[0130] The modified HSV-1 vector of the invention comprises at least two transgenes inserted within different regions of the modified HSV-1 vector to provide distinct kinetic profiles of expressions, wherein at least a first transgene exhibits a first kinetic profile of expression and at least a second transgene exhibits a second kinetic profile of expression after entering a cell, wherein the first kinetic profile and the second kinetic profile are different from each other.

[0131] The modified HSV-1 vector of the invention comprises at least two transgenes inserted within different regions of the modified HSV-1 vector to provide distinct kinetic profiles of expressions, wherein at least a first transgene is expressed for a first period and at least a second transgene is expressed for a second period after entering a cell, and wherein the first period is a shorter period than the second period.

[0132] In embodiments, the first period and the second period begin at about the same time.

[0133] In embodiments, the first period begins before the second period.

[0134] In embodiments, the second period begins after the end of the first period. In some cases, the second period begins after the beginning of the first period and before the end of the first period.

[0135] In embodiments, the first period is transient, i.e., the first transgene is characterized by a transient expression. As used herein, the term “transient” is opposite to the persistent or long-term expression and refers to a temporary expression that will be terminated, preferably by constitutive and / or facultative heterochromatinization of the modified HSV-1 vector.

[0136] In embodiments, the first period lasts no more than about four weeks. In preferred embodiments, the first period ranges from about one hour to about three weeks. In preferredembodiments, the first period ranges from about two hours to about two weeks. In even preferred embodiments, the first period ranges from about three hours to about one week.

[0137] In embodiments, the first period is about four weeks or less. In embodiments, the first period is about three weeks or less. In preferred embodiments, the first period is about two weeks or less. In preferred embodiments, the first period is about one week or less. In preferred embodiments, the first period is about 6 days, about 5 days, about 4 days, or about 3 days.

[0138] In embodiments, the second period is for a long term, i.e., the second transgene is characterized by a long-term expression.

[0139] In embodiments, the second period lasts no less than about four weeks.

[0140] In embodiments, the second period lasts about one month, three months, six months, one year, two years, three years, or longer. For example, the modified HSV-1 vector of the invention can express the second transgene for at least 28 days, and preferably for at least 60 days. In embodiments, the second period lasts about 30 to 45 days, or from 45 to 90 days, or from 90 to 365 days, or 365 days to several years. In embodiments, the second period lasts for a life or nearly a life-time of the subject to whom the vector is administered. As used herein, the term “life-time” or “lifelong” refers to a length of time starting from the beginning of the expression of the second transgene to the death of the subject to whom the vector is administered.

[0141] In embodiments, the first period is at least about 2 hours shorter than the second period. In embodiments, the first period is at least about 4 hours, 6 hours, 8 hours, 12 hours, 16 hours, 24 hours, 36 hours, 48 hours shorter than the second period. In embodiments, the first period is at least about 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, one month, two months, three months, six months shorter than the second period. In embodiments, the first period is at least about one year, two years, three years, four years, five years, six years, seven years, eight years, nine years, ten years shorter than the second period.

[0142] The second transgene is operably linked to at least one sequence conferring long-term expression. In embodiments, the second transgene is introduced downstream of a chromatin insulator. In embodiments, the second transgene is introduced between two chromatin insulators.

[0143] In embodiments, the second transgene can be introduced in a Latency Associated Transcripts (LAT) locus or region. A LAT locus or region is a repeated locus that is contained in the inverted repeated sequences known as b and b' of the virus genome. The b and b' sequences of the virusgenome are also known as TRL (Terminal Repeat Long) and IRL (Internal Repeat Long), respectively.

[0144] The LAT locus includes an upstream DNA insulator (INS or CTRL1) sequence, the Latency Associated Promoter (LAP), a region conferring Long-Term Expression (LTE) and a downstream DNA insulator (INS). In embodiments, the second transgene is introduced either between the Latency Associated Promoter (LAP) and the Long-Term Expression (LTE) region, or between the LTE region and the DNA insulator (INS or CTRL2) sequence present downstream of the LTE.

[0145] Importantly, the LAT locus contains both the LTE and the DNA insulator sequences (INS) that confer long-term expression to the second transgene, e.g., a therapeutic transgene, introduced into this site. In embodiments, the second transgene will be localized between the long-term expression (LTE) and the downstream DNA insulating (INS) motifs.

[0146] By "long-term expression sequence" or "long-term expression element (LTE)" it is meant a nucleotide sequence that when operably linked to a foreign DNA of interest (e.g., the second transgene) allows for sustained expression of a gene product for about 28 to 45 days, or from 45 to 90 days, or from 90 to 365 days, or 365 days to several years or even during the life of the patient.

[0147] Long-term expression (LTE) sequences were identified in HSV-1 as a region of the latency-associated transcripts (LAT), which originate from the LAT-associated promoter (LAP). This LTE is located downstream of the LAT transcription start site. Preferably, the LTE is comprised between about 1.5 kb to about 3 kb downstream of the LAT transcription start site. Additionally, chromatin insulators (also called DNA insulators) also contribute to providing long-term expression. Without wishing to be bound to any particular theory, DNA insulators may inhibit epigenetic silencing.

[0148] Sequences conferring long-term expression (both the LTE and the DNA insulator sequences) can be placed either upstream and / or downstream the foreign DNA.

[0149] The LAT locus is surrounded by chromatin insulators, favorizing its expression compared to the repressed lytic genes (Washington et al., “CTCF Binding Sites in the Herpes Simplex Virus 1 Genome Display Site-Specific CTCF Occupation, Protein Recruitment, and Insulator Function,” doi: 10.1128 / JVI.00156-18). Chromatin insulators can decrease the risk of insertional mutagenesis by disrupting the interactions between the enhancers in the vectors and the regulatory elements of cellular oncogenes. There are two kinds of chromatin insulators: barrier insulators, which protect chromosomal domains from heterochromatinization, and enhancer-blocking insulators, which prevent the interaction between regulatory elements of different chromatin domains. Certainelements combine barrier- and enhancer-blocking activities. In embodiments, the second transgene is introduced downstream of one chromatin insulator. In embodiments, the second transgene is introduced between a pair of chromatin insulators. Figures 1-6 illustrate mGreenlantem reporter transgene, as the second transgene described herein, is inserted into the LAT region between two chromatin insulators (CTRL2 and CTRL1) to convey long-term expression.

[0150] Those skilled in the art will recognize that other LTE-like sequences, as well as other DNA insulator sequences, have been described and are continually being discovered. For example, the ICP4 locus is also surrounded by CTCF-dependent chromatin insulators. A cluster of CTCF motifs called CTRS3 is located at the 5’ of the ICP4 locus and three cluster of CTCF motifs, CTRS1, CTRS2, and Cta'm, are located at its 3’ end (Amelio et al., 10.1128 / JVI.80.5.2358-2368.2006, Bloom et al., 10.1016 / j.bbagrm.2009.12.001). All such LTE-like sequences and DNA insulator sequences are encompassed by the present invention.

[0151] In embodiments, the mHSV-1 vector genome contains both LAT regions, one in the TRL and the other in the IRL. In embodiments, one of the LAT regions, either in the TRL or in the IRL, has been deleted. In embodiments, when the HSV-1 pre-vector genome contains the two LAT loci, the second transgene can be introduced into either or both loci, i.e., into the LAT loci in the TRL region and / or in the IRL region. In embodiments, when the LAT locus in the IRL region is deleted, the second transgene can be introduced into the LAT locus in the TRL region only. In embodiments, when the LAT locus in the TRL region is deleted, the second transgene can be introduced into the LAT locus in the IRL region only. Preferably, the second transgene can be introduced into the LAT locus in the TRL region. More preferably, the LAT locus in the IRL region is deleted, and the second transgene can be introduced into the LAT locus in the TRL region only, as shown in Figures 1-6.

[0152] In any embodiment disclosed herein, the first transgene is introduced into the HSV-1 vector between its lytic genes, thereby being preferably expressed before the heterochromatinization. In preferred embodiments, the first transgene is only expressed before the heterochromatinization. Namely, the first period as described above preferably ends before the heterochromatinization.

[0153] Heterochromatinization of the genomic regions containing the transposon-retrotransposon sequences and other repeated sequences is a strategy developed against them. Such heterochromatinic regions are commonly called constitutive heterochromatin. Facultative heterochromatinization refers to the heterochromatinization of the particular gene domains during cellular differentiation.Facultative heterochromatin refers to chromatin regions that can switch between condensed, transcriptionally silent states and more relaxed, transcriptionally active states depending on cellular context and environmental signals. In the context of HSV-1 vectors, facultative heterochromatin plays a crucial role in regulating viral gene expression, particularly during latency and reactivation. During latency, the HSV-1 genome becomes associated with both constitutive and facultative heterochromatins, leading to the silencing of most viral genes to maintain the dormant state. This involves histone modifications and the binding of repressive complexes, compacting the viral DNA and rendering it inactive. Reactivation from latency involves the disruption of heterochromatin, allowing the transcription of immediate-early genes (IE) and initiating the lytic cycle. Therefore, in the modified HSV-1 vectors, the first transgene inserted between lytic genes is expressed before the lytic genes become heterochromatinized and repressed. The lytic genes as used herein include IE genes (such as ICPO, ICP27), Early (E) genes (such as US1, US2, UL9, UL30, UL42, UL 23), and Late (L) genes (such as UL19, UL21, UL22, UL26, UL27, UL38, UL45, UL46, UL48).

[0154] In embodiments, the first transgene is inserted between lytic genes in the UL region, US region, and / or TRL region. In embodiments, the first transgene is inserted between lytic genes in the UL region and / or US region. In embodiments, the first transgene is inserted between lytic genes in the UL region. In embodiments, the first transgene is inserted between lytic genes in the US region. In additional embodiments, the first transgene is inserted between lytic genes in the TRL region.

[0155] In embodiments, the first transgene is inserted into the intergenic region between two convergent lytic genes in the UL region or in the US region. In embodiments, the first transgene is inserted into the intergenic region between two convergent lytic genes in the UL region, such as UL3-UL4, UL7-UL8, UL10.5-UL11, UL15-UL16, UL21-UL22, UL26.5-UL27, UL30-U131, U135-UL36, UL40-UL41, UL45-UL46, UL50-UL51, or UL55-UL56. For example, as illustrated in Figures 1-3 respectively, the first transgene (mScarlet reporter transgene) is inserted into the intergenic region between UL21 and UL22, UL26.5 and UL27, or UL45 and UL46. Without being bound by the theory, the first transgene is preferably inserted into the intergenic region between convergent genes to avoid intervening with the promoter regions.

[0156] In embodiments, the first transgene is inserted into the intergenic region between convergent lytic genes in the US region. In embodiments, the first transgene is inserted into the intergenic region between convergent lytic genes in the US region, such as US1-US2, or US9-US10.For example, as illustrated in Figure 4, the first transgene (mScarlet reporter transgene) is inserted into the intergenic region between US1 and US2.

[0157] In embodiments, the first transgene is inserted into a region where the original gene has been deleted, as described herein. For example, the first transgene is inserted into a region deleted for the joint region, as shown in Figure 5.

[0158] In embodiments, the first transgene is inserted into the intergenic region between ICP34.5 (i.e., y34.5) and ICPO in the TRL region, as shown in Figure 6.

[0159] In some of any embodiment herein, the first transgene is operably linked to, and under the same control of, regulatory elements. In some of any embodiment herein, the second transgene is operably linked to, and under the same control of, regulatory elements.

[0160] In some of any embodiment herein, where the term “first transgene” refers to one or more transgenes that are expressed for the first period as defined herein, the first transgenes are operably linked to the same or different regulatory elements.

[0161] In some of any embodiment herein, where the term “second transgene” refers to one or more transgenes that are expressed for the second period as defined herein, the second transgenes are operably linked to the same or different regulatory elements.

[0162] The term “regulatory element” is intended to include promoters, enhancers, insulators, introns, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). A tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes). Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. Preferably, the regulatory element is operable in a eukaryotic cell.

[0163] In embodiments, regulator element is selected from one or more pol III promoter (e.g. 1, 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g. 1, 2, 3, 4, 5, or more pol IIpromoters), one or more pol I promoters (e.g. 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof. Examples of pol III promoters include, but are not limited to, U6 and Hl promoters.

[0164] Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the CAG promoter, the CBA promoter, the P-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter.

[0165] In embodiments, the first regulatory element is a polymerase III promoter. In embodiments, the second regulatory element is a polymerase II promoter.

[0166] Also encompassed by the term “regulatory element” are enhancer elements, such as WPRE; CMV enhancers; the R-U5' segment in LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit P-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981). It will be appreciated by those skilled in the art that the design and choice of regulatory elements can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc. In embodiments, the second transgene is inserted in an operable connection with one or more LTEs and / or DNA insulator sequences within the modified HSV-1 vector. The first transgene is inserted in an operable connection with one or more lytic gene sequences within the modified HSV-1 vector. By "operably connected" or “in an operable connection” in regard to the second transgene, it is to be understood that the one or more LTEs and / or DNA insulator sequences allow the expression of the transgene in a cellular environment in which genetic elements (i.e., "genes") otherwise present within the HSV genome are preferably transcriptionally silent. By "operably connected" or “in an operable connection” in regard to the first transgene, it is to be understood that the first transgene is expressed for a certain period of time, preferably before heterochromatinization, in a cellular environment.

[0167] Within the transgene(s) inserted into the inventive vector, there is at least a promoter sequence and a transcribed sequence such that the transcribed sequence(s) is controlled by the promoter. A “promoter”, as used herein, is a DNA regulatory region capable of binding RNA polymerase in a mammalian cell and initiating transcription of an operably linked downstream (31direction) sequence. For purposes of the present invention, a promoter sequence includes at least the minimum number of bases or elements necessary to initiate transcription of a gene of interest at levels detectable above background. Within the promoter sequence is a transcription initiation site, aswell as RNA polymerase binding domains. Eukaryotic promoters will often, but not always, contain "TATA" boxes and other DNA motifs, such as "CAT" or "SP1" boxes.

[0168] The promoters for the first transgene and the second transgene can be independently any promoter desired to control / regulate the expression of the transcribed sequence(s).

[0169] In embodiments, the promoter within a transgene expression cassette inserted into the inventive vector can be a constitutive mammalian promoter, such as are known in the art (e.g., EFla, UbC, P-actin, PGK, U6 and the like).

[0170] In embodiments, the promoter can be a cell-specific or tissue-specific promoter (e.g., EOS, OCT4, Nanog (for ESC / iPSC), SOX2 (for neural stem cells), aMHC, Brachyury, Tau, GFAP, NSE, Synapsin I (for neurons), Apo A-I, Albumin, ApoE (for liver), MCK, SMC a-Actin, Myosin heavy chain, Myosin light chain (for muscle), etc.), such as a promoter that specifically or preferentially control expression of genes in a defined cell type (e.g., within a liver cell, lung cell, epithelial cell, cardiac cell, neural cell, skeletal muscle cell, embryonic, induced pluripotent, or other stem cell, cancer cell, etc.).

[0171] In embodiments, promoters for use in sensory neurons include promoters of genes coding for sensory neuroreceptors such as Transient Receptor Potential Vanilloid 1 (TRPV1) or Transient Receptor Potential cation channel subfamily M member 8 (TRPM8), or from promoters of genes coding for sensory neuromodulators or sensory neurotransmitters, such as the promoters of Substance P, PACAP, Calcitonin Gene Related Peptide (CGRP). In embodiments, promoter of genes coding for sensory neuroreceptors according to the invention is a promoter of the TRP gene family, more preferentially the promoter TRPV1 or TRPM8. In embodiments, promoters of genes coding for sensory neuromodulators or sensory neurotransmitters according to the invention is the CGRP, or the promoter of genes involved in neurite outgrowth and stress response in sensory neurons, preferably the promoter of the gene encoding advillin (ADVL). In other embodiments, the promoter within a transgene inserted into the inventive vector can be an inducible promoter. In embodiments, the promoter is a promoter for use in the central nervous system. Any promoter for use in the central nervous system known in the art is contemplated herein.

[0172] In some cases, promoters used for the first transgene and the second transgene are the same. In some cases, promoters for the first transgene and the second transgene are different. In some cases, wherein the first transgene includes more than one first transgene, the promoters for all the first transgenes can be independently any promoter desired to control / regulate the expression of thetranscribed sequence(s). In other words, they can be independently identical or different among themselves. In some cases, wherein the second transgene includes more than one second transgene, the promoters for all the second transgenes can be independently any promoter desired to control / regulate the expression of the transcribed sequence(s). In other words, they can be independently identical or different among themselves.

[0173] In any embodiment disclosed herein, the one or more transgenes can be part of one or more expression cassettes. The term "expression cassette" as used herein refers to any nucleic acid sequence containing a promoter and a downstream coding sequence or transgene, which expression is driven by said promoter, which is followed by a polyadenylation signal.

[0174] In addition to the promoter(s) and coding sequence(s), the transgene(s) inserted into the genome of the inventive vector also can comprise additional regulatory element(s). For example, the transgene(s) can include one or more sites for binding of microRNA. The presence of such sites facilitates down-regulation of the transgene expression in certain cell types. Thus, for example, a vector comprising a transgene desired to be expressed specifically in a cancer or tumor cell (which may be toxic to many cell types) can comprise binding sites for microRNAs of "normal" (i.e., non-malignant) cells, so that the expression of the transgene is suppressed in non-malignant cells.

[0175] In embodiments, transgene(s) within the inventive vector can be monocistronic (i.e., encoding a single mRNA, resulting in a single protein or polypeptide) or polycistronic (i.e., encoding multiple mRNA, resulting in more than one protein or polypeptide) or can express a single or multiple mRNAs that encode self-cleavable polyproteins. In embodiments, all or part of the transcribed portion of the transgene also can encode non-translated RNA, such as siRNA or miRNA. In embodiments, the inventive vector can comprise multiple separate monocistronic or polycistronic transgene units, each with its own respective promoter, translated sequence(s) or non-translated RNA sequence(s), and other regulatory elements.

[0176] The production of any modified HSV-1 vector prepared from the HSV-1 pre-vector will thus require the concurrent construction of a cell line simultaneously complementing the deleted essential genes and optionally one or more of these non-essential genes.

[0177] Therefore, to facilitate growing, producing, and propagating the modified HSV-1 vectors of the invention and producing stocks thereof, an aspect of the invention provides a complementing cell line, which complements the genes deleted from the HSV genome. Thus, a preferred complementing cell according to the present invention is derived from a cell type that complements the HSV genesthat have been deleted. Such cells can be engineered to express such genes by methods known in the art (e.g., by introducing expression cassettes within the cells so that they express the genes from genetic constructs other than the HSV genome, such as the cellular chromosomes).

[0178] Additionally, the complementing cell line can be engineered to express a gene encoding a selectable marker, such as markers typically employed in engineering packaging cells or cells expressing any other foreign gene. Suitable selectable genes include those conferring resistance to neomycin / G418, hygromycin, blasticidin, puromycin, zeocin, and the like.

[0179] It will be understood that methods for engineering a source cell type (e.g., Vero cells) to contain expression constructs encoding the deleted HSV proteins, as well as other proteins (such as the recombinase and / or the selectable gene product) are known to persons of ordinary skill. For example, the gene of interest with a selectable marker can be subcloned into lentiviral vectors, the source cell infected with the lentiviral vectors, selected for expression of the marker (e.g., blasticidin resistance), and then expression of the gene of interest confirmed.

[0180] The modified HSV-1 vector can be produced via any available cell lines. For example, the manufacturing of the modified HSV-1 vectors utilizes a complementing cell line. The inventive complementing cell comprising the modified HSV-1 vectors can be propagated and cloned. Thus, the invention provides a clonal population, i.e., a cell line, comprising or consisting of or essentially of the complementing cell line as described herein.

[0181] Using the inventive complementing cells of the invention, the inventive modified HSV-1 vector can be propagated. Accordingly, the invention provides a method of propagating the modified HSV-1 vector of the present invention. In accordance with the inventive method, the complementing cell line is infected with the modified HSV-1 vector and then cultured until plaques form. The viral population is amplified by repeated transfer of infectious particles to increasingly large, fresh populations of the complementing cells. For these repeated transfers, multiplicity of infection (MOI) can be between about 0.001 pfu / cell and about 0.03 pfu / cell. Ultimately, the inventive vectors (as packaged viruses) are purified from the cells at 90% cytopathic effect.

[0182] Generally, the inventive modified HSV-1 vector is most useful when enough of the virus can be delivered to a cell population to ensure that the cells are confronted with a suitable number of viruses. Thus, the present invention provides a stock, preferably a homogeneous stock, comprising the inventive modified HSV-1 vector. The preparation and analysis of HSV stocks is well known in the art. For example, a viral stock can be manufactured in roller bottles containing cells infected withthe HSV-1 vector. The viral stock can then be purified on a continuous gradient, and aliquoted and stored until needed. Viral stocks vary considerably in titer, depending largely on viral genotype and the protocol and cell lines used to prepare them. Preferably, such a stock has a viral titer of about 106pfu / ml or even more preferably about 107pfu / ml (or at least about such values). In still more preferred embodiments, the titer can be about 108pfu / ml, or about 109pfu / ml (or at least about such values), and high titer stocks of about IO10pfu / ml or about 1011pfu / ml or even about 1012pfu / ml (or at least about such values) are most preferred. Thus, the titer of the HSV-1 vector stock according to the present invention can vary from about 106pfu / ml to about 1012pfu / ml (preferably between about 109to about 101 1pfu / ml).

[0183] The invention additionally provides a composition comprising the modified HSV-1 vector of the invention and a physiologically-acceptable carrier. The carrier of the composition can be any suitable carrier for the vector. The carrier desirably is a pharmaceutically acceptable (e.g., a physiologically or pharmacologically acceptable) carrier (e.g., excipient or diluent).

[0184] Pharmaceutically acceptable carriers are well known and are readily available. The choice of carrier will be determined, at least in part, by the particular vector and the particular method used to administer the composition. The composition can further comprise any other suitable components, especially for enhancing the stability of the composition and / or its end-use. Accordingly, there is a wide variety of suitable formulations of the composition of the invention. The following formulations and methods are merely exemplary and are in no way limiting.

[0185] Formulations suitable for parenteral administration include aqueous and nonaqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and nonaqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The formulations can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile liquid excipient, for example, water, for injections, immediately prior to use.

[0186] Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.

[0187] In addition, the composition can comprise additional therapeutic or biologically- active agents. For example, therapeutic factors useful in the treatment of a particular indication can bepresent. Factors that control inflammation, such as ibuprofen or steroids, can be part of the composition to reduce swelling and inflammation associated with in vivo administration of the vector and physiological distress. Immune system suppressors can be administered with the composition method to reduce any immune response to the vector itself or associated with a disorder.

[0188] Alternatively, immune enhancers can be included in the composition to up-regulate the body's natural defenses against disease. Antibiotics, i.e., microbicides and fungicides, can be present to reduce the risk of infection associated with gene transfer procedures and other disorders.

[0189] The modified HSV-1 vector is capable of both transient expression of one or more first transgenes and persistent expression of one or more second transgenes as defined herein. Using the modified HSV-1 vector (and stocks and compositions comprising the vector), the invention provides a method of expressing the transgenes within a nucleated cell, especially a non-complementing cell. In accordance with the method, the inventive vector is exposed to the cell under conditions suitable for the vector to infect the cell. Once the cell is infected, the transgenes will be transcribed (expressed) within the cell, provided the promoter within the transgenes is one which is active in the cell and that the transgenes are not suppressed by another regulatory mechanism (e.g., the microRNAs discussed herein). In other words, the inventive vectors serve as gene transfer and expression vectors within mammalian cells.

[0190] The invention can be employed to express transgene(s) within cells either in vivo or in vitro, as desired. For use in vivo, the cell can be any type of desired cell, such as exocrine secretory cells (e.g., glandular cells, such as salivary gland cells, mammary gland cells, sweat gland cells, digestive gland cells, etc.), hormone secreting gland cells (e.g., pituitary cells, thyroid cells, parathyroid cells, adrenal cells, etc.), ectoderm-derived cells (e.g., keratinizing epithelial cells (e.g., making up the skin and hair), wet stratified barrier epithelial cells (e.g., of the cornea, tongue, oral cavity, gastrointestinal tract, urethra, vagina, etc.), cells of the nervous system (e.g., peripheral and central neurons, glia, etc.), mesoderm- derived cells, cells of many internal organs (such as kidney, liver, pancreas, heart, lung) bone marrow cells, and cancerous cells either within tumors or otherwise. Preferred nonlimiting examples of cells suitable for infection by the inventive vectors include liver cells, lung cells, neuronal cells, epithelial cells, cardiac cells, adipose cells, muscle cells, stem cells, and cancer cells.

[0191] When used in vivo, the inventive method can treat a disease or a condition within a subject, wherein the first transgene encodes the components of a gene-editing system that targets and knocksout the expression of a disease-causing endogenous target gene and the second transgene encodes one or more prophylactically- or therapeutically-active replacement proteins or polypeptides, i.e., a corrected copy of the disease-causing endogenous target gene. Thus, the invention provides a method of treating a disease or condition in a subject, comprising administering the vector of the present invention to the subject, in an amount and at a location sufficient to infect cells of the subject such that the transgenes are expressed within the cells of the subject.

[0192] The modified HSV-1 vector of the invention can include first and second transgenes that encode the gene-editing systems and corrected (replacement) endogenous target gene for the treatment of any autosomal dominant or recessive conditions as described herein. For example, the disease or condition can be Huntington’s disease, in which the first transgene encodes the geneediting system that targets and knocks out the huntingtin gene and the second transgene includes a corrected copy of the huntingtin to provide a protein having normal (non-pathogenic) function and / or activity, thereby treating the disease.

[0193] In embodiments, the inventive method can be used in vitro to cause expression of the transgenes within cells in culture. Again, any type of cells can be infected in vitro with the inventive method, such as stem cells and fibroblasts, such as a human dermal fibroblast (HDF) or a human lung fibroblast (HLF). Other preferred types of cells for use in vitro include keratinocytes, peripheral blood mononuclear cells, hematopoietic stem cells (CD34+), or mesenchymal stem / progenitor cells.

[0194] In embodiments, infecting a cell in vivo or in vitro with the vector, composition, or stock of the invention, the cell can be any mammalian nucleated cell for which it is desired to express the transgenes. Thus, the vector can be employed to infect cells of many mammalian species. It is believed that the inventive methods can be applied in veterinary therapies. The animals for this invention can be any animal models that are permissive to HSV-1 infection, such as mice, rats, rabbits, guinea pigs, hamsters, or non-human primates such as macaques. Similarly, the inventive method can be employed in a veterinary context for companion animals.

[0195] The modified HSV-1 vectors of the invention can be used in vivo in humans as well, to provide for the expression of a prophylactically- or therapeutically-active agent in a medical setting.

[0196] In embodiments, the invention provides a kit comprising the modified HSV-1 vector according to the invention and instructions.

[0197] Features may be described herein as part of the same or separate aspects or embodiments of the present invention for the purpose of clarity and a concise description. It will be appreciated by theskilled person that the scope of the invention may include embodiments having combinations of all or some of the features described herein as part of the same or separate embodiments.

[0198] Definitions

[0199] The term "transgene" refers to a particular nucleic acid sequence, including coding sequence for a gene product or non-coding sequence for an RNA product to be expressed in a cell into which the nucleic acid sequence is introduced. The term "transgene" includes (1) a nucleic acid sequence that is not naturally found in the cell (i.e., a heterologous nucleic acid sequence); (2) a nucleic acid sequence that is a mutant form of a nucleic acid sequence naturally found in the cell into which it has been introduced; (3) a nucleic acid sequence that serves to add additional copies of the same (i.e., homologous) or a similar nucleic acid sequence naturally occurring in the cell into which it has been introduced; or (4) a silent naturally occurring or homologous nucleic acid sequence whose expression is induced in the cell into which it has been introduced. By "mutant form" is meant a nucleic acid sequence that contains one or more nucleotides that are different from the wild-type or naturally occurring sequence, i.e., the mutant nucleic acid sequence contains one or more nucleotide substitutions, deletions, and / or insertions. In some cases, the transgene may also include a sequence encoding a leader peptide or signal sequence such that the transgene product will be secreted from the cell, or the transgene may include both a leader peptide or signal sequence plus a membrane anchor peptide, or even be a fusion protein between two naturally occurring proteins or part of them, such that the transgene will remain anchored to cell membranes, or a sequence that allows the protein to accumulate in a specific region of the cell, such as a nuclear localizing signal.

[0200] As used herein, the term “transgene,” when appearing alone without “first” or “second,” includes both the first transgene and the second transgene.

[0201] As used herein, although “the first transgene” and “the second transgene” are used in singular forms, they are both meant to include the plural form as well. The term “the first transgene” refers to one or more first transgenes that are expressed for the first period as defined herein. It can be only one first transgene, or multiple distinct first transgenes, or multiple copies of the same first transgene. The term “the second transgene” refers to one or more second transgenes that are expressed for the second period as defined herein. Similarly, it can be only one second transgene, or multiple distinct second transgenes, or multiple copies of the same second transgene.A “gene product” is a molecule resulting from the expression of a particular gene. A “gene” refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular gene product after being transcribed, and sometimes also translated. In instances, the gene consists or consists essentially of coding sequence, that is, sequence that encodes the gene product. In other instances, the gene comprises additional, non-coding, sequence. For example, the gene may or may not include regions preceding and following the coding region, e.g. 5' untranslated (5' UTR) or “leader” sequences and 3' UTR or “trailer” sequences, as well as intervening sequences (introns) between individual coding segments (exons). Gene products include, e.g., a protein, a polypeptide, a peptide, an aptamer, an mRNA, and the like.

[0202] A “RNA product” is a sequence that is transcribed into a non-coding nucleotide sequence, such as an interfering RNA including short interfering RNA (siRNA), microRNA (miRNA), small hairpin RNA (shRNA), antisense oligonucleotide (asRNA), and the like. Such RNA products can silence a specific gene and / or to disrupt the corresponding encoded protein (a “gene of interest” or “targeted gene” or “selected gene”). By “silencing” a gene, it is meant that expression of the target gene is reduced or eliminated. Without being bound by theory, it is believed that silencing is characterized by specific mRNA degradation or mRNA block in translation after the expression of a non-coding complementary sequence such as siRNA, asRNA, shRNA, miRNA, or any other form of interfering RNA (iRNA) into cells.

[0203] As used herein, the singular forms “a”, “an”, and “the” include both singular and plural referents unless the context clearly dictates otherwise.

[0204] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.

[0205] Throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention.

[0206] Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers with that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.As used herein, the term “about” will be understood by persons of ordinary skill in the art and will vary to extent on the context in which it is used. As used herein when referring to a measurable value such as an amount, a temporal duration, and the like, the term “about” is meant to encompass variations of ±20% or ±10%, including ±5%, ±1%, and ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

[0207] As used herein, “heterogenous expression” refers to that multiple transgenes included in one vector, delivered to a cell at the same time, exhibit distinct expression kinetics. Namely, they have different expression periods. “Different expression periods” means the time lengths of the expression are different, regardless of whether the starting time for each expression period is the same or different from each other.

[0208] The terms “polynucleotide”, “nucleotide”, “nucleotide sequence”, “nucleic acid” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.

[0209] As used herein the term “wild type” is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.

[0210] As used herein the term “variant” should be taken to mean the exhibition of qualities that have a pattern that deviates from what occurs in nature.

[0211] The terms “non-naturally occurring” or “engineered” are used interchangeably and indicate the involvement of the hand of man. The terms, when referring to nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.

[0212] “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. Apercent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). “Perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

[0213] As used herein, “stringent conditions” for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology -Hybridization With Nucleic Acid Probes Part I, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay”, Elsevier, N.Y.

[0214] “Hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the “complement” of the given sequence.

[0215] As used herein, “expression” refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and / or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.The terms “polypeptide”, “peptide” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component. As used herein the term “amino acid” includes natural and / or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.

[0216] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.

[0217] As used herein, “treatment” or “treating,” or “palliating” or “ameliorating” are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and / or a prophylactic benefit. By therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested.

[0218] The term “effective amount” or “therapeutically effective amount” refers to the amount of an agent that is sufficient to effect beneficial or desired results. The therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will provide an image for detection by any one of the imaging methods described herein. The specific dose may vary depending on one or more of: the particular agent chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to be imaged, and the physical delivery system in which it is carried.

[0219] A “target sequence” refers to a sequence to which a DNA-targeting RNA, such as a guideRNA is designed to have complementarity, where hybridization between the target sequenceand DNA-targeting RNA promotes the formation of a DNA-targeting RNA / site-directed modifying polypeptide complex, such as a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote the formation of a complex.

[0220] EXAMPLES

[0221] The following examples further illustrate the invention but should not be construed as limiting its scope.

[0222] To illustrate the effect of the location of the transgenes on their kinetics of expression, nrHSV-1 vectors with the insertion of two transgenes at different locations are designed. The mGreenLantern reporter transgene has been inserted in the LAT region, allowing long-term expression in cells, while the mScarlet reporter transgene has been inserted in the long region between genes expressed only during the lytic cycle, hence providing a short-term expression. For example, insertions in the intergenic region between UL21 and UL22 (Figure 1), or UL26.5 and UL27 (Figure 2), or UL45-UL46 (Figure 3) are devised.

[0223] The present invention describes the method for developing nrmHSV-1 vectors that combine (i) short-term expression of gene-editing machinery targeting specifically endogenous target genes or alleles and (ii) long-term re-expression of the corresponding gene that has been corrected and optimized to escape the gene-editing machinery recognition. To this end, a nrmHSV-1 vector has been designed with insertion of editing transgenes and replacement transgenes at different locations within the vector.

[0224] For example, first transgenes comprising the Cas9 coding sequence and guide RNAs (gRNAs) have been inserted in the long region (UL) between the UL45 and UL46 genes, a region that is susceptible to heterochromatinization. These gene-editing transgenes are expressed only during the lytic cycle hence providing a short-term expression area (Figures 7A, 7B, 8A, 8B, 9A, and 9B and Sequences 1 to 6). In this example, the gRNAs have been designed to recognize and target the eGFP (Sequence 12) gene which has been stably integrated within the genome of HEK 293 cells. To improve efficacy of gene deletion, two gRNAs are used to target the gene of interest but one transgene encoding the gRNA or even more than two transgenes encoding gRNAs can be used.

[0225] To initiate transcription of the non-coding gRNAs, the U6 (Sequence 1) RNA polymerase Ill-dependent promoter (RNA pol III promoter) was tested. This RNA pol III promoter triggers thetranscription of the gRNAs but is not limited to such promoter and other RNA pol III promoters such as Hl (Sequence 2) or RNA polymerase II promoters can also be used to transcribe gRNA in a cell specific manner if needed. Alternatively, multiple gRNAs can be encoded by and transcribed from a single transgene with ribozyme-mediated self-cleavage (Vicki Hsieh-Feng and Yinong Yang, Efficient expression of multiple guide RNAs for CRISPR / Cas genome editing, aBIOTECH ; 1(2): 123- 134. (2020 Jan 23) eCollection 2020 Apr doi: 10.1007 / s42994-019-00014-w.) (Figure 8A and 8B).

[0226] The second transgene encodes a modified eGFP (Sequences 10 and 11) in which the nucleotide sequences have been optimized to ensure their non-recognition by the gRNAs encoded by the first transgenes (i.e., the gRNAs do not hybridize to the nucleotide sequence of the second transgene) and, thus, avoid being knocked out by the gene-editing machinery of the first transgene. As most amino acids can be translated from multiple codons, the nucleotide sequences of the replacement genes of the second transgenes are modified to be different from the endogenous gene, but the amino acid sequence remains unchanged. In case of a disease-causing endogenous target gene, the amino acid sequence would be identical to, or similar to, the wild-type, non-diseasecausing gene product (protein) so long as the normal function and / or activity of the healthy protein is maintained.

[0227] Two sequence optimizations have been performed to the nucleotide sequences of the second transgenes. The first codon optimization provides a nucleotide sequence that has no significant matching with any of the two gRNAs (Sequence 10). The second codon optimization provides a nucleotide sequence with significant complementarity to one of the two gRNAs significantly except that the sequence is followed by a degenerate protospacer adjacent motif (PAM) sequence (Sequence 11). Any codon optimization algorithms can be used to modify the nucleotide sequence of the second transgenes so that is not recognized by the gRNA(s) of the first transgene(s). For example, see Ranaghan et al., Assessing optimal: inequalities in codon optimization algorithms, BMC Biol. ;I9(1):36 (2021 Feb 19) doi: 10.1186 / sl2915-021-00968-8, which is incorporated herein by reference.

[0228] The second transgenes have been inserted in a region that is protected from heterochromatinization (e.g., in the LAT region) allowing long term expression in infected cells (Figure 7A and Sequences 7 to 11). Within the LAT region, the optimized transgenes are inserted between the viral chromatin insulators CTCF-repeat long 1 and 2 (CTRL1 and CTRL2).To assess whether the nrHSV-1 vectors shown in Figures 7A, 8 A and 9A provide (i) shortterm expression of the CRISPR / Cas9 machinery of the first transgene; (ii) knock out of the endogenous gene by the expressed CRISPR / Cas9 machinery; and (iii) long-term expression of the replacement (“corrected”) protein, we performed in vitro analysis.

[0229] Three (3) HSV-bacterial artificial chromosomes (BAC) were generated by using “en passant” recombination and transfected in complementing African-green monkey kidney (Vero) cells to produce the nrmHSV-1 viral vectors described in Figures 7A and 9A. Two (2) versions of the nrmHSV-1 vector as described in Figure 9 were generated, incorporating 2 variations of the codon optimized eGFP as described above (Sequences 10 and 11).

[0230]

[0231] Then, non-complementing human embryonic kidney (HEK) cells expressing endogenous eGFP (enhanced green fluorescence protein) from a non-optimized sequence (Sequence 12) were infected at different multiplicity of infection (MOI) (0, 0.1, 0.5, 1, 3,) with one of the 3 HSV-1 vectors in Figures 7A and 9A or with a control vector which expresses luciferase instead of the optimized eGFP gene and which does not express the CRISPR / cas9 system. At different timepoints post-infection (24 and 48 hours), the deletion of the endogenous eGFP by the CRIPR / Cas9 machinery was assessed by amplification of the targeted region by PCR from gDNA followed by agarose electrophoresis and RT-PCR (RT-qPCR). In parallel, the expression from the control vector (negative control), the expression of the CRISPR / Cas9 machinery from the nrmHSV-1 vectors, and the expression of the endogenous eGFP and the expression of the exogenous codon-optimized eGFP (second transgene) expressed from the nrHSV-1 vectors were assessed by RT-qPCR. To assess the ability of the different codon-optimized versions of the replacement gene to escape recognition by the gene editing machinery, amplification of the putative targeted region from the episome by PCR followed by agarose electrophoresis was also performed.

[0232] As a summary, the foregoing example demonstrated that with all vectors constructed:

[0233] 1 / editing system was expressed (Fig.14 and 19) and functional to allow for the deletion of the targeted gene in the cell (Fig.12, 13, 17, and 18)

[0234] 2 / editing system did not delete the replacement gene in the episome: Fig.16 and 213 / replacement gene was expressed: Fig.15 and 20

[0235] To exclude a dose effect of the vector, the previous experiment was repeated (Fig 17 to 21) with a readout at 48h and a constant MOI of 3 in all conditions, with an increasing fraction of nrHSV-1 vectors balanced with a non-CRISPR non-eGFP control vector. The conclusions remained the same.

[0236] SEQUENCES

[0237] Sequence 1: Shows the U6 Promoter pol III sequence. gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaa gatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgctta ccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacacc

[0238] Sequence 2: Shows the H1 Promoter pol III sequence. gaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcg ccctg gcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaat caccataaacgtgaa atg tctttg g atttg g g a atcttata agttctgtatgagaccac

[0239] Sequence 3: Shows the first guide RNA sequence.

[0240] gggcgaggagctgttcaccg

[0241] Sequence 4: Shows the first gRNA scaffold sequence. gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc Sequence 5: Shows the second guide RNA sequence.

[0242] gaagttcgagggcgacaccc

[0243] Sequence 6: Shows the second guide RNA sequences with the terminators (in bold and capitalized), and the gRNA scaffold sequences (in underline), gggcgaggagctgttcaccggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccg a gtcg g tg cl l l l l l l g g ccg g ccgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcggga acacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgt gttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacg aagttcgagggcgacacc cgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcl l l l l l l Sequence 7: Shows Promoter pol II sequence. ggcctccgcgccgggttttggcgcctcccgcgggcgcccccctcctcacggcgagcgctgccacgtcagacgaagggcgcagc gagcgtcctgatccttccgcccggacgctcaggacagcggcccgctgctcataagactcggccttagaaccccagtatcagcagaa ggacattttaggacgggacttgggtgactctagggcactggttttctttccagagagcggaacaggcgaggaaaagtagtcccttct cggcgattctgcggagggatctccgtggggcggtgaacgccgatgattatataaggacgcgccgggtgtggcacagctagttccg teg ca g ccg g g atttg g gtcg eg gttcttg tttgtg g ateg ctgtg ategtea ettg gtg a gta g eg g g etg etg g g etg g ccg g g g ctttcgtggccgccgggccgctcggtgggacggaagcgtgtggagagaccgccaagggctgtagtctgggtccgcgagcaagg ttgccctgaactgggggttggggggagcgcagcaaaatggcggctgttcccgagtcttgaatggaagacgcttgtgaggcgggc tgtgaggtcgttgaaacaaggtggggggcatggtgggcggcaagaacccaaggtcttgaggccttcgctaatgcgggaaagctc ttattcgggtgagatgggctggggcaccatctggggaccctgacgtgaagtttgtcactgactggagaactcggtttgtcgtctgttgc gggggcggcagttatggcggtgccgttgggcagtgcacccgtacctttgggagcgcgcgccctcgtcgtgtcgtgacgtcacccgttctgttg g cttata atgcagggtggggcca cctg ccggtaggtgtgcggtagg cttttctccgtcg ca ggacgcagggttcggg cct agggtaggctctcctgaatcgacaggcgccggacctctggtgaggggagggataagtgaggcgtcagtttctttggtcggttttatg ta cctatcttctta a gta g ctg a a g ctccg gttttg a a ctatg eg ctcg gggttggcga gtgtg ttttgtg a a gtttttta g g ca ccttttg a a atgta atcatttg g gtea atatg ta attttca gtgtta g a eta gta a attgteeg eta a attetg g ccgtttttg g cttttttgtta g a c Sequence 8: Shows the Cas9 sequence that includes the NLS sequences (in bold): atggactataaggaccacgacggagactacaaggatcatgatattgattacaaagacgatgacgataagatggccccaaagaaga agcggaaggtcggtatccacggagtcccagcagccgacaagaagtacagcatcggcctggacatcggcaccaactctgtgggct gggccgtgatcaccgacgagtacaaggtgcccagcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaag aacctgatcggagccctgctgttcgacagcggcgaaacagccgaggccacccggctgaagagaaccgccagaagaagatacac cagacggaagaaccggatctgctatctgcaagagatcttcagcaacgagatggccaaggtggacgacagcttcttccacagactgg aagagtccttcctggtggaagaggataagaagcacgagcggcaccccatcttcggcaacatcgtggacgaggtggcctaccacg agaagtaccccaccatctaccacctgagaaagaaactggtggacagcaccgacaaggccgacctgcggctgatctatctggccctg gcccacatgatcaagttccggggccacttcctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatcca gctggtgcagacctacaaccagctgttcgaggaaaaccccatcaacgccagcggcgtggacgccaaggccatcctgtctgccaga ctgagcaagagcagacggctggaaaatctgatcgcccagctgcccggcgagaagaagaatggcctgttcggaaacctgattgcc ctgagcctgggcctgacccccaacttcaagagcaacttcgacctggccgaggatgccaaactgcagctgagcaaggacacctacg acgacgacctggacaacctgctggcccagatcggcgaccagtacgccgacctgtttctggccgccaagaacctgtccgacgccatc ctgctgagcgacatcctgagagtgaacaccgagatcaccaaggcccccctgagcgcctctatgatcaagagatacgacgagcacc accaggacctgaccctgctgaaagctctcgtgcggcagcagctgcctgagaagtacaaagagattttcttcgaccagagcaagaac ggctacgccggctacattgacggcggagccagccaggaagagttctacaagttcatcaagcccatcctggaaaagatggacggca ccgaggaactgctcgtgaagctgaacagagaggacctgctgcggaagcagcggaccttcgacaacggcagcatcccccaccag atccacctgggagagctgcacgccattctgcggcggcaggaagatttttacccattcctgaaggacaaccgggaaaagatcgagaa gatcctgaccttccgcatcccctactacgtgggccctctggccaggggaaacagcagattcgcctggatgaccagaaagagcgag gaaaccatcaccccctggaacttcgaggaagtggtggacaagggcgcttccgcccagagcttcatcgagcggatgaccaacttcg ataagaacctgcccaacgagaaggtgctgcccaagcacagcctgctgtacgagtacttcaccgtgtataacgagctgaccaaagtg aaatacgtgaccgagggaatgagaaagcccgccttcctgagcggcgagcagaaaaaggccatcgtggacctgctgttcaagacc aaccggaaagtgaccgtgaagcagctgaaagaggactacttcaagaaaatcgagtgcttcgactccgtggaaatctccggcgtgg aagatcggttcaacgcctccctgggcacataccacgatctgctgaaaattatcaaggacaaggacttcctggacaatgaggaaaacg aggacattctggaagatatcgtgctgaccctgacactgtttgaggacagagagatgatcgaggaacggctgaaaacctatgcccac ctgttcgacgacaaagtgatgaagcagctgaagcggcggagatacaccggctggggcaggctgagccggaagctgatcaacg gcatccgggacaagcagtccggcaagacaatcctggatttcctgaagtccgacggcttcgccaacagaaacttcatgcagctgatcc acgacgacagcctgacctttaaagaggacatccagaaagcccaggtgtccggccagggcgatagcctgcacgagcacattgcca atctggccggcagccccgccattaagaagggcatcctgcagacagtgaaggtggtggacgagctcgtgaaagtgatgggccgg cacaagcccgagaacatcgtgatcgaaatggccagagagaaccagaccacccagaagggacagaagaacagccgcgagaga atgaagcggatcgaagagggcatcaaagagctgggcagccagatcctgaaagaacaccccgtggaaaacacccagctgcagaa cgagaagctgtacctgtactacctgcagaatgggcgggatatgtacgtggaccaggaactggacatcaaccggctgtccgactacg atgtggaccatatcgtgcctcagagctttctgaaggacgactccatcgacaacaaggtgctgaccagaagcgacaagaaccgggg caagagcgacaacgtgccctccgaagaggtcgtgaagaagatgaagaactactggcggcagctgctgaacgccaagctgattac ccagagaaagttcgacaatctgaccaaggccgagagaggcggcctgagcgaactggataaggccggcttcatcaagagacagct ggtggaaacccggcagatcacaaagcacgtggcacagatcctggactcccggatgaacactaagtacgacgagaatgacaagct gatccgggaagtgaaagtgatcaccctgaagtccaagctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatc aacaactaccaccacgcccacgacgcctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtaccctaagctggaaagcg agttcgtgtacggcgactacaaggtgtacgacgtgcggaagatgatcgccaagagcgagcaggaaatcggcaaggctaccgcca agtacttcttctacagcaacatcatgaactttttcaagaccgagattaccctggccaacggcgagatccggaagcggcctctgatcgag acaaacggcgaaaccggggagatcgtgtgggataagggccgggattttgccaccgtgcggaaagtgctgagcatgccccaagt gaatatcgtgaaaaagaccgaggtgcagacaggcggcttcagcaaagagtctatcctgcccaagaggaacagcgataagctgatc gccagaaagaaggactgggaccctaagaagtacggcggcttcgacagccccaccgtggcctattctgtgctggtggtggccaaagtggaaaagggcaagtccaagaaactgaagagtgtgaaagagctgctggggatcaccatcatggaaagaagcagcttcgagaag aatcccatcgactttctggaagccaagggctacaaagaagtgaaaaaggacctgatcatcaagctgcctaagtactccctgttcgagc tggaaaacggccggaagagaatgctggcctctgccggcgaactgcagaagggaaacgaactggccctgccctccaaatatgtga acttcctgtacctggccagccactatgagaagctgaagggctcccccgaggataatgagcagaaacagctgtttgtggaacagcac aagcactacctggacgagatcatcgagcagatcagcgagttctccaagagagtgatcctggccgacgctaatctggacaaagtgct gtccgcctacaacaagcaccgggataagcccatcagagagcaggccgagaatatcatccacctgtttaccctgaccaatctgggag cccctgccgccttcaagtactttgacaccaccatcgaccggaagaggtacaccagcaccaaagaggtgctggacgccaccctgatc caccagagcatcaccggcctgtacgagacacggatcgacctgtctcagctgggaggcgacaaaaggccggcggccacgaaaa aggccggccaggcaaaaaagaaaaagtaa

[0244] Sequence 9: Shows the SV40 polyA sequence. taagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgt aaccattataagctgcaataaacaagtt

[0245] Sequence 10: Shows the codon-optimized sequence (bold) of the replacement gene including the CAG promoter (underlined).

[0246] gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggt aaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggac tttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctatt gacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtatta gtcatcg ctatta ccatg ggtcgaggtgagcccca cgttctg cttca ctctccccatctcccccccctcccca ccccca attttgtatttattt attttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcg gggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcg gcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgttgccttcgccccgtgccccgctccgcgccg cctcg cgccgcccgccccgg ctctg a ctg a ccg cgtta ctccca ca ggtgagcgggcgggacgg cccttctcctccg g g ctg ta att agcgcttggtttaatgacggctcgtttcttttctgtggctgcgtgaaagccttaaagggctccgggagggccctttgtgcggggggga gcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggcccgcgctgcccggcggctgtgagcgctgc gggcgcggcgcggggctttgtgcgctccgcgtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcggggg ggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcggcggtcgggct gtaacccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtgcggggcgtggcgcgg ggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggct cgggggaggggcgcggcggccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcg tgcgagagggcgcagggacttcctttgtcccaaatctggcggagccgaaatctgggaggcgccgccgcaccccctctagcgggc gcgggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctc catctccagcctcggggctgccgcagggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgt gaccggcgg ctcta g a g cctctg eta a ccatgttcatg ccttcttctttttccta ca g gtgtcca ctccca gttcaattacag ctctta a g g c tagagtacttaatacgactcactataggctagcgccgccaccatggtatcaaaaggagaagagctgttcacaggggttgtgccca tccttgtagaattggatggggatgttaatggccacaagtttagcgtttcaggcgagggcgagggggacgccacttatggaa aactgactttgaagtttatatgcaccactggtaaactgcctgtcccctggccaacgttggtcaccactttgacttatggtgtacaat gttttagcagatacccagatcacatgaaacagcacgacttctttaaaagcgcgatgccggagggctatgtacaagaacgcact atattctttaaggatgatggaaattataaaacgcgcgctgaggtgaaattcgagggtgatactcttgtcaatagaatcgagctc aagggcatcgactttaaggaggatggcaacattctcgggcacaaactcgagtacaactacaacagtcacaatgtgtatataat ggcagacaaacaaaaaaacggtattaaagtcaatttcaaaatccgccataatattgaggatggcagcgttcagttggcggac cactatcaacagaacacacctattggtgacggtccagttctcctgccagataaccactaccttagcacacaatcagctctctcaaa ggacccgaacgaaaaacgggatcatatggttttgttggaatttgttacggcagcaggcataactctgggtatggacgagctg tacaaataaSequence 11 : Shows another codon-optimized sequence (bold) of the replacement gene including the CAG promoter (underlined).

[0247] gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggt aaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggac tttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctatt gacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtatta gtcatcg ctatta ccatg ggtcgaggtgagcccca cgttctg cttca ctctccccatctcccccccctcccca ccccca attttgtatttattt attttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcg gggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcg gcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgttgccttcgccccgtgccccgctccgcgccg cctcg cgccgcccgccccgg ctctg a ctg a ccg cgtta ctccca ca ggtgagcgggcgggacgg cccttctcctccg g g ctg ta att agcgcttggtttaatgacggctcgtttcttttctgtggctgcgtgaaagccttaaagggctccgggagggccctttgtgcggggggga gcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggcccgcgctgcccggcggctgtgagcgctgc gggcgcggcgcggggctttgtgcgctccgcgtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcggggg ggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcggcggtcgggct gtaacccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtgcggggcgtggcgcgg ggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggct cgggggaggggcgcggcggccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcg tgcgagagggcgcagggacttcctttgtcccaaatctggcggagccgaaatctgggaggcgccgccgcaccccctctagcgggc gcgggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctc catctccagcctcggggctgccgcagggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgt gaccggcgg ctcta g a g cctctg eta a ccatgttcatg ccttcttctttttccta ca g gtgtcca ctccca gttcaattacag ctctta a g g c tagagtacttaatacgactcactataggctagcgccgccaccatggtgtctaaaggcgaggagctgttcaccggcgtcgtgccca tcctcgtggagctggatggcgacgtgaacggacacaagttcagtgtgagtggcgagggcgagggcgatgccacctacgg caa g ctg aca ctg a a g tttatctg ca cca ctg g a a a a ctg cccgtg ccttg g ccta ca ctg gtg a ccaccctg a ccta eg g a gt g ca gtg cttctcca g atatccag atcatatg a a g ca g cacg a ettettta a gteeg ccatg cccg a g g g ctatgtg cag g a aa gaaccatttttttcaaggatgacgggaactataaaacaagagcagaggtgaagttcgagggagataccctggtgaatcgga tcgaactgaagggcatcgactttaaggaggacggcaacattctgggccacaagctggagtacaactacaatagccacaatgt gtacatcatggccgataagcagaagaacggcattaaggtgaactttaagatccggcacaacatcgaggatggcagcgtgca g ctg g ccg a ccatta ccag ca g a a ca cccccatcg g a g a eg g ccctg tg ctg ctg cccg ata a cca eta cctg tcca cccag a gcgccctgagcaaagaccccaatgaaaaaagagaccacatggtgctgctggaatttgtgaccgccgccggaatcaccttgg gcatggatgagctgtacaagtaa

[0248] Sequence 12: Shows the native sequence (bold) of the replaced gene including the CMV promoter (underlined).

[0249] cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatag taacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgc caagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggc agtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggg gatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgc cccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctg gttta gtg aaccgtcagatccgctagc gctaccggactcagatctcgagctcaagcttcgaattctgcagtcgacggtaccgcgggcccgggatccaccggtcgccaccatgg tgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttc a g cgtg teeg g eg a g g g eg a g g g eg atg cca ccta eg g ca a g ctg a ccctg a a gttcatctg caeca ccg g ca a g ctg cc cgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacga cttcttca a g tccg cca tg cccg a a g g eta eg tcca g g a g eg ca cca tettettea a g g a eg a eg g ca a eta ca a g a cccg c gccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaaca tcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaagg tg a a ettea a g ateeg cca caa catcg a g g a eg g cag eg tg ca g ctcg ccg a cca eta cca g ca g a a ca cccccatcg g eg acggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatc a catg g teetg etg g a g ttcgtg a ccg ccg ccg g g atca ctctcg g catg g a eg ag ctgta ca a gta a

[0250] The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. All United States patents and published or unpublished United States patent applications cited herein are incorporated by reference. All published foreign patents and patent applications cited herein are hereby incorporated by reference. All other published references, documents, manuscripts and scientific literature cited herein are hereby incorporated by reference.

[0251] While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims. It will also be understood that none of the embodiments described herein are mutually exclusive and may be combined in various ways without departing from the scope of the invention encompassed by the appended claims.

Claims

CLAIMS1. A modified HSV-1 (mHSV-1) vector comprising:(a) a first transgene encoding a gene-editing system directed to endogenous target gene; and(b) a second transgene encoding a corrected copy of the endogenous target gene; wherein the first transgene and the second transgene are inserted within different genomic regions of the modified HSV-1 vector to provide distinct kinetic profiles of expression; wherein the first transgene is expressed for a first period and the second transgene is expressed for a second period; and wherein the first period is a shorter period than the second period.

2. The modified HSV-1 vector of claim 1, wherein the first transgene has a transient expression profile during the first period and the second transgene has a long-term expression profile during the second period.

3. The modified HSV-1 vector of claim 1 or 2, wherein the endogenous target gene is a diseasecausing endogenous target gene.

4. The modified HSV-1 vector of any one of preceding claims, wherein the second transgene is codon optimized to avoid the gene-editing system encoded by the first transgene.

5. The modified HSV-1 vector of any one of the preceding claims, wherein the modified HSV-1 vector is a non-replicative HSV-1 (nrHSV-1) vector.

6. The modified HSV-1 vector of any one of the preceding claims, wherein the second transgene is a part of an expression cassette, wherein the expression cassette further comprises a promoter and optionally an enhancer.

7. The modified HSV-1 vector of any one of the preceding claims, wherein the first transgene is a part of an expression cassette, wherein the expression cassette further comprises a promoter and optionally an enhancer.

558. The modified HSV-1 vector of any one of the preceding claims, wherein the first transgene is only expressed before heterochromatinization after entering the cell.

9. The modified HSV-1 vector of any one of the preceding claims, wherein the second transgene is operably linked to at least one sequence conferring long-term expression.

10. The modified HSV-1 vector of any one of the preceding claims, the second transgene is introduced downstream of a chromatin insulator.

11. The modified HSV-1 vector of any one of the preceding claims, the second transgene is introduced between two chromatin insulators.

12. The modified HSV-1 vector of any one of the preceding claims, wherein the second transgene is introduced to a Latency Associated Transcripts (LAT) region or the ICP4 loci of the modified HSV-1 vector.

13. The modified HSV-1 vector of any one of the preceding claims, the first transgene is introduced into the intergenic region between two lytic genes.

14. The modified HSV-1 vector of any one of the preceding claims, the two lytic genes are selected from the pairs of UL3-UL4, UL7-UL8, UL10.5-UL11, UL15-UL16, UL21-UL22, UL26.5-UL27, UL30-U131, U135-UL36, UL40-UL41, UL45-UL46, UL50-UL51, orUL55-UL56. US1-US2, and US9-US10.

15. The modified HSV-1 vector of any one of claims 1-13, wherein the two lytic genes are ICP34.5 (i.e., y34.5) and ICPO.

16. The modified HSV-1 vector of any one of the preceding claims, wherein the modified HSV-1 vector further optionally comprises one or more additional nucleic acid sequences.

17. The modified HSV-1 vector of any one of the preceding claims, wherein the modified HSV-1 vector further optionally comprises one or more stuffers.

18. The modified HSV-1 vector of any one of the preceding claims, wherein the size of the modified HSV-1 genome is about 147 kbp to about 154.5 kbp.

19. A method of delivering at least two transgenes into a cell for heterogeneous expression, wherein the method comprises contacting the cell with the modified HSV-1 vector according to any one of claims 1-18.

20. The method of claim 19, wherein the cell is a neuron, an epithelial cell, a muscle cell, a connective tissue cell, or a platelet.

21. A method of treating a disease in a subject in need, wherein the method comprises administering the modified HSV-1 vector according to any one of claims 1-18 to the subject.

22. The method of claim 21, wherein the disease is an autosomal dominant or autosomal recessive disease.

23. The method of claim 22, wherein the disease is an autosomal dominant disease.