Alpha-1 antitrypsin (AAT) RNAi agents, compositions including AAT RNAi agents, and methods of use
Novel AAT RNAi agents target and inhibit AAT gene expression to address liver damage from Z-AAT protein accumulation in AATD, providing effective prevention and reversal of liver injury and fibrosis.
Patent Information
- Application Number
- AU2024203661
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-05-31
- Publication Date
- 2026-07-16
AI Technical Summary
Current treatments for Alpha-1 antitrypsin deficiency (AATD) do not effectively prevent or reverse liver damage caused by Z-AAT protein accumulation, leading to conditions like chronic hepatitis, cirrhosis, and hepatocellular carcinoma, and there is a need for novel RNAi agents that can selectively and efficiently inhibit AAT gene expression to address this.
Development of novel AAT-specific RNA interference (RNAi) agents with specific sense and antisense strands, designed to target and inhibit AAT gene expression, which are administered using various delivery methods to reduce Z-AAT protein accumulation and associated liver damage.
The AAT RNAi agents effectively prevent and reverse Z-AAT accumulation-related liver injury and fibrosis, reducing ER stress and the risk of liver cell damage, offering therapeutic benefits for AATD-related conditions.
Smart Images

Figure 00000144_0000 
Figure 00000149_0000 
Figure 00000153_0000
Abstract
Description
CROSS REFERENCE TO RELATED APPLICATIONS This application claims priority from United States Provisional Patent Application Serial No. 5 62 / 444,452, filed on January 10, 2017, United States Provisional Patent Application Serial No. 62 / 486,720, filed on April 18, 2017, and United States Provisional Patent Application Serial No. 62 / 596,232, filed on December 8, 2017, the contents of each of which are incorporated herein by reference in their entirety. This is a divisional of Australian patent application No. 2018208505, the entire content of which 10 is incorporated herein by reference. FIELD OF THE INVENTION Disclosed herein are RNA interference (RNAi) agents for inhibition of alpha-1 antitrypsin gene expression, compositions that include alpha-1 antitrypsin RNAi agents, and methods of use thereof. 15 BACKGROUND Alpha-1 antitrypsin (AAT, a1-antitrypsin, or A1AT) deficiency is an inherited, autosomal codominant genetic disorder that causes misfolding of the AAT protein and poor secretion of the misfolded protein leading to lung and liver diseases. AAT deficiency (AATD) occurs with a frequency of about 1 in every 1,500 to 3,500 individuals and most often affects persons with 20 European ancestry. Alpha-1 Antitrypsin is a protease inhibitor belonging to the serpin superfamily. Normal AAT protein is a circulating glycoprotein protease inhibitor primarily synthesized in the liver by hepatocytes and secreted into the blood. The known physiologic function of AAT is to inhibit neutrophil proteases, which serves to protect host tissues from non-specific injury during periods 25 of inflammation. The most clinically significant form of AATD, a genetic disorder associated with liver disease in children and adults, and pulmonary disease in adults, is caused by the Z mutation. The Z mutant allele (PiZ), through a single point mutation, renders the mutant Z form AAT protein (the "Z-AAT protein") prone to abnormal folding causing intracellular retention. The mutant Z-AAT protein 30 monomers are able to form chains of polymers that amass into aggregates, 2024203661 31 May 2024 which are sometimes referred to as ‘’globules." The misfolded Z-AAT protein is ineffective in traversing the secretory pathway, and instead polymerizes and accumulates in the endoplasmic reticulum (ER) of hepatocytes. The polymeric globule masses stress the ER and trigger continuous hepatocyte injury, leading to fibrosis, cirrhosis, and increased risk of hepatocellular carcinoma. Further, the absence of circulating anti-protease activity’ leaves the lung vulnerable to injury' by neutrophil elastase, resulting in the development of respiratory complications such as emphysema. Individuals with the homozygous PiZZ genotype have severe deficiency of functional AAT, which leads to pulmonary disease. Weekly use of AAT augmentation therapy, using purified human AAT, results in near normal plasma levels of AAT in subjects with AATD, and helps prevent lung damage in affected individuals. However, while the administration of purified AAT can ameliorate or help prevent lung damage caused by the absence of endogenously secreted AAT, AATD patients remain vulnerable to endoplasmic reticulum liver storage disease caused by the deposition and accumulation of excessive abnormally folded AAT protein. Accumulated Z-AAT protein in the globule conformation in hepatocytes is a well-known characteristic of AATD liver disease and is believed to lead to proteotoxic effects that are responsible for inducing liver injury, including liver cell damage and death and chronic liver injury, in individuals with AATD. (see, e.g., D. Lindblad el al., Hepatology 2007, 46: 1228-1235). Patients with AATD often develop liver disease, which can be severe or fatal, even in infancy. Clinical presentations of injury in the liver include chronic hepatitis, cirrhosis, hepatocellular carcinoma, transaminitis, cholestasis, fibrosis, and even fulminant hepatic failure. There is currently no clinically approved treatment to prevent the onset or slowthe progression of liver disease due to AATD. Further, while U.S. Patent Application Publication No. 2015 / 0361427 discloses certain RNAi agents capable of inhibiting the expression of an AAT gene, there remains a need for novel and effective AAT RNAi agents having improved potency’ that can selectively, efficiently, and safely inhibit the expression of an AAT gene, thereby preventing and potentially reversing Z-AAT accumulation-related liver injury' and fibrosis. Similarly, while U.S. Patent Application Publication No. 2015 / 0011607 to Brown et al. (“Brown ’607”) discloses various sequences for inhibiting expression of an AAT gene, Brown teaches the use of longer double-stranded constructs (referred to in Brown as DsiRNAs), which according to Brown have been found to give “unexpected effective results in terms of potency’ 2024203661 31 May 2024 and duration of action” as compared to 19-23mer siRNA agents. (See. e.g.. Brown '607 al paragraph
[0376] ). Moreover, many of the sequences disclosed in Brown ’607 are designed to be used in DsiRNA constructs that are designed to target different locations of an AAT mRN A as compared to the sequences disclosed in the present invention. Such differences lead to different binding affinity to the AAT mRNA and produces a different cleavage site, which can impact the inhibitory effect of the compound, while also potentially leading to additional off-target issues (see, e.g., Piotr J. Kamola et al., PLoS Compul Biol, 2015, 1 l(12):el004656 at Fig. 1 (illustrating the mechanism of siRNA-Mediated Gene Silencing)). For example, nothing in Brown '607 teaches or suggests the design of an RNAi agent (of any length) wherein the 5' terminal nucleobase or nucleotide of the antisense strand would be aligned with the position that is 19 nucleotides downstream (towards the 3' end) from position 1000 on an AAT gene (SEQ ID NO: 1). Put different, and again solely as an example involving one such potential AAT RNAi agent sequence, nothing in Brown '607 teaches or suggests the design of an RNAi agent wherein the 5' terminal nucleobase of the antisense strand of an RNAi agent corresponds to position 1018 on an AAT gene (SEQ ID NO: 1). Further, nothing in Brown ’607 teaches or suggests the modified AAT RNAi agent constructs disclosed herein. Summary There exists a need for novel AAT-specific RNA interference (RNAi) agents (also herein termed RNAi agent, RNAi trigger, or trigger) that are able to selectively and efficiently inhibit the expression of an AAT gene. Further, there exists a need for compositions of novel AAT-specific RNAi agents for the treatment of diseases associated with AAT deficiency. Because liver damage resulting from AATD occurs through a gain-of-function mechanism, inhibition of AAT gene expression is useful in preventing accumulation of the Z-AAT protein in the liver. Further, the reduction or removal of the Z-AAT polymer aggregates reduces the ER stress in hepatocytes, and offers additional advantages in reducing the likelihood of occurrence of liver cell damage and assisting in the treatment of liver cell damage and chronic liver injury such as fibrosis, cirrhosis, hepatocellular carcinoma, and other conditions and diseases caused by AATD. Reduction of inflammatory Z-AAT protein, which has been clearly defined as the cause of progressive liver disease in AATD patients, is important as it can slowr or halt the progression of liver disease and allow fibrotic tissue repair. 2024203661 31 May 2024 In general, the disclosure features novel AAT RIN Ai agents, compositions comprising the AAT RNAi agents, and methods for inhibiting the expression of an AAT gene in vivo and / or in vitro using AAT RNAi agents and compositions that include AAT RNAi agents. Further described herein are methods of treatment of AATD-related diseases using the AAT RNAi agents described herein and compositions that include AAT RNAi agents. The AAT RNAi agents and methods disclosed herein can provide for the treatment of AATD, including the treatment of conditions and diseases caused by AATD, such as chronic hepatitis, cirrhosis, hepatocellular carcinoma, and fulminant hepatic failure. The AAT RNAi agents disclosed herein, when administered to a subject, can prevent and / or reverse Z-AAT accumulation-related liver injury and fibrosis. The AAT RNAi agents described herein may be administered to a subject, e.g., a human or animal subject, by any suitable methods known in the art, such as subcutaneous injection or intravenous administration. In one aspect, the disclosure features RNAi agents for inhibiting the expression of an alpha-1 antitrypsin (AAT) gene, wherein the RNAi agent comprises a sense strand and an antisense strand. Also described herein are compositions comprising an RNAi agent capable of inhibiting the expression of an alpha-1 antitry psin gene, wherein the RNAi agent comprises a sense strand and an antisense strand, and at least one pharmaceutically acceptable excipient. Each AAT RNAi agent described herein includes a sense strand and an antisense strand. The sense strand and the antisense strand can be partially, substantially, or fully complementary to each other. The length of the RNAi agent sense and antisense strands described herein each can be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides in length. In some embodiments, the sense and / or antisense strands are independently’ 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. 'Hie sense and antisense strands can be either the same length or different lengths. The RNAi agents described herein, upon delivery to a cell expressing AAT, inhibit the expression of one or more AAT genes in vivo or in vitro. An AAT RNAi agent includes a sense strand (also referred to as a passenger strand), and an antisense strand (also referred to as a guide strand). A sense strand of the AAT RNAi agents 2024203661 31 May 2024 described herein includes a nucleotide sequence having at least 85% identity to a core stretch of at least 16 consecutive nucleotides to a sequence in an AAT mRNA. In some embodiments, the sense strand core stretch having at least 85% identity to a sequence in an AAT mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. An antisense strand of an AAT RNAi agent includes a nucleotide sequence having at least 85% complementarity over a core stretch of at least 16 consecutive nucleotides to a sequence in an AAT mRNA and the corresponding sense strand, hr some embodiments, the antisense strand core stretch having at least 85% complementarity to a sequence in an AAT mRNA or the corresponding sense strand is 16,17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the AAT RNAi agents disclosed herein target a portion of an AAT gene having the sequence of any of the sequences disclosed in Table 1. Examples of AAT RNAi agent sense strands and antisense strands that can be used in AAT RNAi agents are provided in Tables 2, 3, 4 and 5. Examples of duplexes that include AAT RNAi agent are provided in Table 6. Examples of 19-nucleotide core stretch sequences that may consist of or may be included in the sense strands and antisense strands of certain AAT RNAi agents disclosed herein, are provided in Table 2. In another aspect, the disclosure features methods for delivering AAT RNAi agents to liver cells in a subject, such as a mammal, in vivo. In some embodiments, one or more AAT RNAi agents are delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery' methods include, but are not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or Dynamic Polyconjugates™ (DPCs) (see, for example WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, each of which is incorporated herein by reference). In some embodiments, a delivery vehicle, such as a polymer, an amphipathic polymer, a membrane active polymer, a peptide, such as a melittin or melittin-like peptide, a reversibly' modified polymer or peptide, or a lipid, can be used with the AAT RNAi agents disclosed herein. In some embodiments, an AAT RNAi agent is delivered to target cells or tissues by covalently linking or conjugating the RNAi agent to a targeting group such as an asialoglycoprotein 2024203661 31 May 2024 receptor ligand. In some embodiments, an asialoglycoprotein receptor ligand includes, consists of, or consists essentially of, a galactose or galactose-derivative cluster. In some embodiments, an A AT RNAi agent is linked to a targeting ligand comprising the galactose-derivative N-acetyl-galactosamine. In some embodiments, a galactose-derivative cluster includes an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, a galactose derivative cluster is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. Example targeting groups useful for delivering RNAi agents are disclosed, for example, in U.S. Patent Application No. 15 / 452,324 and WO 2017 / 156012, which are incorporated by reference herein in their entirety. A targeting group can be linked to the 3' or 5' end of a sense strand or an antisense strand of an AAT RNAi agent. In some embodiments, a targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, a targeting group is linked to the 5' end of the sense strand. In some embodiments, a targeting group is linked internally to a nucleotide on the sense strand and / or the antisense strand of the RNAi agent. In some embodiments, a targeting group is linked to the RNAi agent via a linker. A targeting group, with or without a linker, can be linked to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3,4, and 5. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5. In another aspect, the disclosure features compositions that include one or more AAT RNAi agents that have the duplex structures disclosed in Table 6. In some embodiments, described herein are compositions that include a combination or cocktail of at least two AAT RNAi agents having different nucleotide sequences. In some embodiments, the two or more different AAT RNAi agents are each separately and independently linked to targeting groups. In some embodiments, the two or more different AAT RNAi agents are each linked to targeting groups that include or consist of targeting ligands that include one or more moieties that target an asialoglycoprotein receptor. In some embodiments, the two or more different AAT RNAi agents are each linked to targeting groups that include or consist of targeting ligands that include one or more galactose-derivatives. In some embodiments, the tw o or more different AAT RNAi agents are each linked to targeting groups that include or consist 2024203661 31 May 2024 of targeting ligands that include one or more N-acetyl-galactosamines. In some embodiments, when two or more RNAi agents are included in a composition, each RNAi agent is independently linked to the same targeting group. In some embodiments, when two or more RNAi agents are included in a composition, each RNAi agent is independently linked to a different targeting group, such as targeting groups having different chemical structures. In some embodiments, targeting groups are linked to the AAT RNAi agents without the use of an additional linker. In some embodiments, the targeting group is designed having a linker readily present to facilitate the linkage to an AAT RNAi agent. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents may be linked to their respective targeting groups using the same linkers. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers. In another aspect, the disclosure features methods for inhibiting alpha-1 antitrypsin gene expression in a subject, the methods comprising administering to the subject an amount of an AAT RNAi agent capable of inhibiting the expression of an AAT gene, wherein the AAT RNAi agent comprises a sense strand and an antisense strand. Also described herein are methods for the treatment of a condition or disease caused by AATD, comprising administering to a subject a therapeutically effective amount of an RNAi agent described herein. Further described are methods for inhibiting expression of an AAT gene, wherein the methods include administering to a cell an AAT RNAi agent described herein. In some embodiments, disclosed herein are methods for the treatment of AATD (including the treatment of a condition or disease caused by AATD), the methods comprising administering to a subject a therapeutically effective amount of an RNAi agent having an antisense strand comprising the sequence of any of the sequences in Tables 2, 3, or 4. In some embodiments, disclosed herein are methods for inhibiting expression of an AAT gene, the methods comprising administering to a cell an AAT RN Ai agent that includes an antisense strand comprising the sequence of any of tire sequences in Tables 2, 3, or 4. 2024203661 31 May 2024 In some embodiments, disclosed herein methods for the treatment of AATD (including the treatment of a condition or disease caused by AATD), the methods comprising administering to a subject a therapeutically effective amount of an RN Ai agent that includes a sense strand comprising the sequence of any of the sequences in Tables 2, 3, or 5. In some embodiments, disclosed herein are methods for inhibiting expression of an AAT gene, wherein the methods include administering to a cell an AAT RM Ai agent that includes a sense strand comprising the sequence of any of the sequences In Tables 2, 3, or 5. In some embodiments, disclosed herein are methods for the treatment of AATD (including the treatment of a condition or disease caused by AATD), wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 5, and an antisense strand comprising any of the sequences in 'fable 4. in some embodiments, disclosed herein are methods for inhibiting expression of an A AT gene, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 5, and an antisense strand comprising any of the sequences in Table 4. In some embodiments, disclosed herein are methods of inhibiting expression of an AAT gene, wherein the methods include administering to a subject an AAT RNAi agent that includes a sense strand consisting of the nudeobase sequence of any of the sequences in Table 5, and the antisense strand consisting of the nudeobase sequence of any' of the sequences in Table 4. In other embodiments, disclosed herein are methods of inhibiting expression of an AAT gene, wherein the methods include administering to a subject an AAT RNAi agent that includes a sense strand consisting of the modified sequence of any' of the modified sequences in Table 5, and the antisense strand consisting of the modified sequence of any of the modified sequences in Table 4. In some embodiments, disclosed herein are methods for inhibiting expression of an AAT gene in a cell, wherein the methods include administering one or more AAT RNAi agents having the duplex structure set forth in Table 6. 2024203661 31 May 2024 In some embodiments, the AAT RNAi agents disclosed herein have structures that include, consist of, or consist essentially of, the structure shown in any one of Figure 1, Figure 2, Figure 3, Figure 4, Figure 5, Figure 6, Figure 7, or Figure 8. Tire AAT RNAi agents disclosed herein are designed to target specific positions on an AAT gene (SEQ ID NO: I). As defined herein, an antisense strand sequence is designed to target an AAT gene at a given position on the gene when the 5' terminal nucleobase of the antisense strand would be aligned with the position that is 19 nucleotides downstream (towards the 3' end) from the position on the gene when base pairing to the gene. For example, as illustrated in Tables 1, 2. and 3 herein, an antisense strand sequence designed to target an AAT gene at position 1000 requires that when base pairing to the gene, the 5' terminal nucleobase of the antisense strand is aligned w ith position 1018 of the AAT gene. As provided herein, an AAT RNAi agent does not require that the nucleobase al position 1 (5' -> 3') of lire antisense strand be complementary to the gene, provided that there is at least 85% complementarity (e.g.. al leasl 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucleotides. For example, for an AAT RNAi agent disclosed herein that is designed lo target position 1000 of an AAT gene, the 5’ terminal nucleobase of the antisense strand of the of the AAT RNAi agent must be aligned with position 1018 of the gene; however, the 5' terminal nucleobase of the antisense strand may be, but is not required lo be, complementary to position 1018 of an AAT gene, provided that there is at least 85% complementarity (e g., at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucleotides. As shown by, among other things, the various examples disclosed herein, the specific site of binding of the gene by the antisense strand of the AAT RNAi agent (e.g., whether the AAT RNAi agent is designed to target an AAT gene at position 1000, at position 1142, or at some other position) is highly important to the level of inhibition achieved by the AAT RNAi agent. in some embodiments, the antisense strand sequence is designed to have a sequence target position 1000 of an AAT gene (SEQ ID NO: 1). In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence ofUGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein at least one or more nucleotides is a modified nucleotide. In some embodiments, the antisense 2024203661 31 May 2024 strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein at least one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein al least one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein at least one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence ofUGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein one 2024203661 31 May 2024 or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein one or more nucleotides is a modified nucleotide, and the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein one or more nucleotides is a modified nucleotide, and the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of tin AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAAC AUGCCUAAACGUU (SEQ ID NO: 794), wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an AAT RNAi 2024203661 31 May 2024 agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857). In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885). In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence ofUGUUAAACAUGCCUAAACGCG(SEQ ID NO: 800), wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864). In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866). In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence ofUGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857) differing by 0, 1, 2, or 3 nucleotides. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885) differing by 0, 1, 2, or 3 nucleotides. 2024203661 31 May 2024 In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864) differing by 0, 1, 2, or 3 nucleotides. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence ofUGUUAAACAUGCCUAAACGCG (SEQ ID NO: 801) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866) differing by 0, 1, 2, or 3 nucleotides. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04824. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04825. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04826. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04827. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04828. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04829. 2024203661 31 May 2024 In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04830. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of A D04831. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex AD04832. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04833. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04834. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04835. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04836. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04837. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence ofUGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 80 is located at positions 1 to 19 (5' -> 3r) of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 80 is located at positions 1 to 19 (5' 3') of the antisense strand. 2024203661 31 May 2024 In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 81 is located at positions 1 to 19 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 81 is located at positions 1 to 19 (5' -> 3') of the antisense strand. In some embodiments, the sense strand of an AAT RNAi agent comprises the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein one or more nucleotides is a modified nucleotide, and wherein position 19 of SEQ ID NO: 429 forms a base pair with the nucleotide located at the 5' terminal end of the antisense strand. In some embodiments, the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein position 19 of SEQ ID NO: 429 forms a base pair with the nucleotide located at the 5' terminal end of the antisense strand. In some embodiments, the sense strand of an AAT RNAi agent comprises the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein one or more nucleotides is a modified nucleotide, and wherein position 19 of SEQ ID NO: 430 forms a base pair with the nucleotide located at the 5' terminal end of the antisense strand. In some embodiments, the sense strand of AN AAT RNAI agent comprises the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein position 19 of SEQ ID NO: 430 forms a base pair with the nucleotide located at the 5' terminal end of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence ofUGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 794 is located at positions 1 to 21 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein all or substantially all of the 2024203661 31 May 2024 nucleotides are modified nucleotides, and wherein SEQ ID NO: 794 is located at positions 1 to 21 (5' 3') of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 839 is located at positions 1 to 22 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 839 is located at positions 1 to 22 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 800 is located at positions 1 to 21 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 800 is located at positions 1 to 21 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence ofUGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 801 is located at positions 1 to 21 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAAC AUGCCUAAACGCU (SEQ ID NO: 801), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 801 is located at positions 1 to 21 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 794 is located at the 5' the terminal end of the antisense strand, and wherein sense strand of an AAT 2024203661 31 May 2024 RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857). In some embodiments, the antisense strand of an AAT RN Ai agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 839 is located at the 5' the terminal end of the antisense strand, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885). In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 800 is located at the 5' the terminal end of the antisense strand, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864). In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 801 is located at the 5' the terminal end of the antisense strand, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866). In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence ofUGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 794 is located at the 5' the terminal end of the antisense strand, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857) differing by 0, I, 2, or 3 nucleotides. In some embodiments, the antisense strand of tin AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified 2024203661 31 May 2024 nucleotide, and wherein SEQ ID NO: 839 is located at the 5' the terminal end of the antisense strand, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885) differing by 0, 1, 2, or 3 nucleotides. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence ofUGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 800 is located at the 5' the terminal end of the antisense strand, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864) differing by 0, 1,2, or 3 nucleotides. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801) differing by 0,1, 2. or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 801 is located at the 5' the terminal end of the antisense strand, and the sense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence of AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866) differing by 0, 1. 2, or 3 nucleotides. Hie AAT RNAi agents described herein can include one or more modified nucleotides. The AAT RNAi agents described herein can also include one or more phosphorothioate intemucl eoside linkages. The AAT RNAi agents described herein can also include one or more targeting groups or linking groups. In some embodiments, the AAT RNAi agents disclosed herein include one or more targeting groups. In some embodiments, the targeting groups are comprised of an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand comprises a galactose or galactose-derivative cluster. In some embodiments, the galactose-derivative cluster comprises N-acetyl-galactosamine, In some embodiments, the targeting ligand comprises an N-acetyl-galactosamine trimer. In some embodiments, a targeting group is conjugated to the sense strand of the AAT RNAi agents disclosed herein. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO: 913), wherein 2024203661 31 May 2024 a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5’ -> 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958), wherein a, c, g, and u are 2'-O-methyl adenosine, cy tidine, guanosine, or uridine, respectively; Af, Cf. Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementaiy to the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -» 3') usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO: 959), wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960), wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementaiy to the antisense strand. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO: 913) and the sense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') cguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1276), wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-iluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; wherein optionally present on the sense strand is one, two, or more inverted abasic deoxyribose 2024203661 31 May 2024 (invAb); and wherein optionally linked to the 5' terminal end of the sense strand is a targeting ligand that includes N-acetyl-galactosamine. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958) and the sense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') gcguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1277), wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Of, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; wherein optionally present on the sense strand is one, two, or more inverted abasic deoxyribose (invAb); and wherein optionally linked to the 5' terminal end of the sense strand is a targeting ligand that includes N-acetyl-galactosamine. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO: 959) and the sense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') cgcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1278), wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; wherein optionally present on the sense strand is one, two, or more inverted abasic deoxyribose (invAb); and wherein optionally linked to the 5' terminal end of the sense strand is a targeting ligand that includes N-acetyl-galactosamine. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960) and the sense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') agcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1279), wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; wherein optionally present on the sense strand is one, two, or more inverted abasic deoxyribose (invAb); and wherein optionally linked to the 5' terminal end of the sense strand is a targeting ligand that includes N-acetyl-galactosamine. 2024203661 31 May 2024 In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO: 913) and the sense strand of an AAT RNAi agent comprises or consists of (5' -> 3') (NAG37)s(invAb)scguuuaGfGfCfauguuuaacausu(invAb) (SEQ ID NO: 1028), wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG37) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958) and the sense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') (NAG37)s(invAb)sgcguuuaGfGfCfauguuuaacausu(invAb) (SEQ ID NO: 1030), wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af. Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG37) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -> 3') usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO: 959) and the sense strand of an AAT RNAi agent comprises or consists of the sequence (5' 3') (NAG37)s(invAb)scgcguuuaGfGfCfauguuuaacas(invAb) (SEQ ID NO: 1024), wherein a, c,g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG37) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein. In some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the sequence (5' -» 3') usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960) and the sense strand of an AAT RNAi agent comprises or consists of the sequence (5' 3') (NAG37)s(invAb)sagcguuuaGfGfCfauguuuaacas(invAb) (SEQ ID NO: 1033), wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and 2024203661 31 May 2024 Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is aphosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG37) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein. In some embodiments, the AAT RNAi agents described herein can include one or more targeting groups having the structure of (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, as defined herein in Table 7. In some embodiments, the AAT RNAi agents described herein include one targeting group al the 5’ end of the sense strand having the structure of (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, as defined herein in Table 7. The AAT RNAi agents disclosed herein can be incorporated into a composition comprising one or more disclosed AAT RNAi agent and at least one pharmaceutically acceptable excipient. In some embodiments, the compositions disclosed herein comprising one or more of the disclosed AAT RNAi agents and at least one pharmaceutically' acceptable excipient is a pharmaceutical composition. The pharmaceutical compositions comprising one or more AAT RNAi agents can be administered in a number of ways depending upon whether local or systemic treatment is desired. Administration can be, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection. In some embodiments, the compositions comprising one or more disclosed AAT RNAi agents and at least one pharmaceutically acceptable excipient can further comprise one or more additional therapeutics or treatments. 2024203661 31 May 2024 In some embodiments, the compositions described herein comprising one or more AAT RNAi agents are packaged in a kit, container, pack, dispenser, pre-filled syringes, or vials. In some embodiments, the compositions described herein are administered parenterally. The AAT RNAi agents and compositions comprising same that are disclosed herein can be administered to a subject to inhibit the expression of the alpha-1 antitrypsin gene in the subject. In some embodiments, the subject is a human. In some embodiments, the subject is a human that has been diagnosed with having AATD. In some embodiments, disclosed herein are methods for inhibiting expression of an AAT gene in a cell, the methods comprising administering an AAT RNAi agent that has an antisense strand that is at least partially complementary to the portion of an AAT mRNA having any one of the sequences listed in Table 1. The AAT RNAi agents and compositions comprising same disclosed herein may be administered to a subject for the treatment of AATD (including a condition or disease caused by alpha-1 antitry psin deficiency). The condition or disease that may be treated, prevented, and'or managed by administration of the AAT RNAi agents and compositions comprising same disclosed herein include chronic hepatitis, cirrhosis, hepatocellular carcinoma, transaminitis, cholestasis, fibrosis, or fulminant hepatic failure. As used herein, the terms "oligonucleotide" and “polynucleotide” mean a polymer of linked nucleosides each of which can be independently modified or unmodified. As used herein, an “RNAi agent” or “RNAi trigger” means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. As used herein, RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway7 or mechanism of 2024203661 31 May 2024 action. RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short interfering RNAs (siRNAs), double-strand RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RN Ai agents described herein is at least partially complementary to the mRNA being targeted (e.g. AAT mRNA). RNAi agents can include one or more modified nucleotides and / or one or more non-phosphodiester linkages. As used herein, the terms “silence,” “reduce,” “inhibit,” “down-regulate," or "knockdown” when referring to expression of a given gene, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with the RNAi agents described herein as compared to a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated. As used herein, the terms “sequence” and “nucleotide sequence” mean a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature. As used herein, a “base”, “nucleotide base,” or “nucleobase,” is a heterocyclic pyrimidine or purine compound, which is a standard constituent of all nucleic acids, and includes the bases that form the nucleotides adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). A nucleobase may further be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. As used herein, the term “nucleotide” can include a modified nucleotide (such as, for example, a nucleotide mimic, abasic residue (Ab), or a surrogate replacement moiety). As used herein, and unless otherwise indicated, the term “complementary," when used to describe a first nucleobase or nucleotide sequence (e.g., RNAi agent sense strand or targeted mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) and form a duplex or double helical structure under certain standard conditions with an oligonucleotide or 2024203661 31 May 2024 polynucleotide including the second nucleotide sequence. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity' is independent of modification. For example, a and Af, as defined herein, are complementary' to U (or T) and identical to A for the purposes of determining identity or complementarity. As used herein, “perfectly complementary” or “fully complementary” means that all (100%) of the nucleobases or nucleotides in a contiguous sequence of a first polynucleotide yvill hybridize with the same number of nucleobases or nucleotides in a contiguous sequence of a second poly nucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence. As used herein, “partially complementary” means that in a hybridized pair of nucleobase sequences, at least 70%, but not all, of the bases in a contiguous sequence of a first polynucleotide yvill hybridize yvith the same number of bases in a contiguous sequence of a second poly nucleotide. As used herein, “substantially complementary ” means that in a hybridized pair of nucleobase sequences, at least 85%, but not all, of the bases in a contiguous sequence of a first polynucleotide yvill hybridize yvith the same number of bases in a contiguous sequence of a second polynucleotide. The terms “complementary,” “fully complementary',” “partially complementary',” and “substantially complementary'” herein are used yvith respect to the nucleobase or nucleotide matching betyveen the sense strand and the antisense strand of an RNAi agent, or betyveen the antisense strand of an RNAi agent and a sequence of an AAT mRNA. As used herein, the term “substantially identical” or “substantially identity” as applied to nucleic acid sequence means that a nucleic acid sequence comprises a sequence that has at least about 85% sequence identity or more, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. Percentage of sequence identity is determined by comparing tyvo optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions 2024203661 31 May 2024 by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences substantially identical to those disclosed herein. As used herein, the terms "treat / ’ ‘'treatment,’’ and the like, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treat’’ and treatment” may include the prevention, management, prophylactic treatment, and / or inhibition of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, the phrase “introducing into a cell,” when referring to an RNAi agent, means functionally delivering the RNAi agent into a cell. The phrase "functional delivery,” means that delivering the RNAi agent to the cell in a manner that enables the RNAi agent to have the expected biological activity, e.g., sequence-specific inhibition of gene expression. Unless stated otherwise, use of the symbol % as used herein means that any group or groups may be linked thereto that is in accordance with the scope of the inventions described herein. As used herein, the term “isomers” refers to compounds that have identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed "diastereoisomers,” and stereoisomers that are non-superimposable mirror images are termed “enantiomers,” or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is termed a “chiral center.” As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers are present and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers. 2024203661 31 May 2024 As used in a claim herein, the phrase ''consisting of’ excludes any element, step, or ingredient not specified in the claim. When used in a claim herein, the phrase "consisting essentially of’ limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. 5 The person of ordinary skill in the art would readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g,, N, O, or S atoms) in a protonated or deprotonated state, depending upon the environment in which tire compound or composition is placed. Accordingly, as used herein, the structures disclosed herein envisage 10 that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their state of protonation based on the environment (such as pH), as would be readily understood by the person of ordinary skill in the art. 15 Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinan’ skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in 20 their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other objects, features, aspects, and advantages of the invention will be apparent from the 25 following detailed description, accompanying figures, and from the claims. Brief Description of the Drawings FIGs. 1A to IE represent the chemical duplex structure of AD04828 shown as a sodium salt. 30 FIGs. 2A to 2E represent the chemical duplex structure of AD04828 shown as a free acid. FIGs. 3A to 3E represent the chemical duplex structure of AD04831 shown as a sodium salt. 2024203661 31 May 2024 FIG. 4A to 4E represent the chemical duplex structure of AD04831 shown as a free acid. FIG. 5A to 5E represent the chemical duplex structure of AD04836 shown as a sodium salt. FIG. 6A to 6E represent the chemical duplex structure of AD04836 shown as a free acid. FIG. 7A to 7E represent the chemical duplex structure of AD04837 shown as a sodium salt. FIG. 8A to 8E represent the chemical duplex structure of AD04837 shown as a free acid. FIG. 9 is a bar graph showing average normalized cynomolgus monkey (cyno) A AT (cAAT) serum levels in cynos (n=3) following a single subcutaneous administration of 3 mg / kg of either AD04824, AD04825, AD04826, or AD04827, according to Example 4. AAT serum levels were normalized to average pre-treatment values. Experimental error is shown as standard deviation. FIG. 10 is a bar graph showing average normalized cAAT serum levels in cynos (n=2 or n=3) following a single subcutaneous administration of 3 mg / kg of either AD04828. AD04836, AD04831, or AD04837, according to Example 5. AAT serum levels were normalized to average pre-treatment values. Experimental error is shown as standard deviation. FIG. 11. is a bar graph showing the results of a w estern blot analysis of the soluble fractions (Z-AAT monomer) from livers of PiZ mice dosed with either saline or NAG-conjugated AAT RNAi agent having the duplex structure AD04837, dosed for 8 weeks q2w, normalized to baseline control according to Example 7. Individual mouse measurements are shown grouped by treatment group, and experimental error is shown as standard deviation. FIG. 12. is a bar graph showing the results of a western blot analysis of the insoluble fractions (Z-AAT polymer) from livers of PiZ mice dosed with either saline or NAG-conjugated AAT RNAi agent having the duplex structure AD04837, according to Example 7. Individual mouse measurements are shown grouped by treatment group, and experimental error is shown as standaid deviation. 2024203661 31 May 2024 Detailed Description RNAi zAgents Described herein are RN Ai agents for inhibiting expression of an AAT gene (referred to herein as AAT RN Ai agents or AAT RN Ai triggers). Each AAT RN Ai agent comprises a sense strand and an antisense strand. The sense strand and the antisense strand each can be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands each can be 17 to 26 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, a sense strand is 22 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 19 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, a doublestranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides. In some embodiments, the region of perfect or substantial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5’ end of the antisense strand by 0, 1. 2, 3, or 4 nucleotides that are not perfectly or substantially complementary ). Hie sense strand and antisense strand each contain a core stretch sequence that is 16 to 23 nucleobases in length. An antisense strand core stretch sequence is 100% (perfectly) complementary- or at least about 85% (substantially) complementary- to a nucleotide sequence (sometimes referred to, e.g., as a target sequence) present in the AAT mRNA target. A sense 2024203661 31 May 2024 strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is perfectly identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the AAT mRNA target. A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length. In some embodiments, the antisense strand core stretch sequence is 16, 17, 18, 19,20,21. 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch sequence is 16, 17, 18, 19,20,21, 22, or 23 nucleotides in length. Examples of nucleotide sequences used in forming AAT RNAi agents are provided in Tables 2, 3, 4 and 5. Examples of AAT RNAi agent duplexes, that include the sense strand and antisense strand sequences in Tables 2, 3,4, and 5, are shown in Table 6. The AAT RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an AAT RNAi agent may be partially, substantially, or fully complementary to each other. Within the complementary7 duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of al least 16, at least 17, at least 18, at least 19, al least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18,19, 20,21, 22, or 23 nucleo tide sequence of the antisense s trand core stretch sequence (i.e., the sense and antisense core stretch sequences of an AAT RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at 1 east 23 nucleotides that is at least 85% base paired or 100% base paired.) In some embodiments, the antisense strand of an AAT RNAi agent disclosed herein differs by 0,1,2, or 3 nucleotides from any of tire antisense strand sequences in Table 2, Table 3, or Table 4. In some embodiments, the sense strand of an AAT RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 3, or Table 5. The sense strand and or the antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, the 5' end, or both the 3' and 5' ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may’ or may not be complementary’ to the corresponding sequence in an AAT mRNA. The 2024203661 31 May 2024 sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in an AAT mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary- to the corresponding sense strand’s additional nucleotides, if present. As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and'or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary' to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extension nucleotides of one strand base pairs yvilh one or more 5' extension nucleotides of the other strand. In other embodiments, one or more of 3' extension nucleotides of one strand do not base pair with one or more 5' extension nucleotides of the other strand. In some embodiments, an AAT RNAi agent has an antisense strand having a 3' extension and a sense strand having a 5' extension. In some embodiments, an AAT RNAi agent comprises an antisense strand having a 3' extension of 1,2,3,4,5, or 6 nucleotides in length. In other embodiments, an AAT RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary- to the corresponding AAT mRNA sequence. In some embodiments, a 3' antisense strand extension includes or consists of one of the following sequences, but is not limited to: AU A, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each listed 5' -> 3'). In some embodiments, the 3' end of the antisense strand can include additional abasic residues (Ab). An “abasic residue” or “abasic site” is a nucleotide or nucleoside that lacks anucleobase at the 1' position of the sugar. In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the abasic residue(s) can be added as inverted abasic residues (invAb) (see Table 7). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 2024203661 31 May 2024 31(11), 2705-16). In some embodiments, an AAT RNAi agent comprises a sense strand having a 3' extension of I, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to nucleotides in the AAT mRNA sequence. In some embodiments, the 3' sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5' to 3'). In some embodiments, the 3' end of the sense strand may include additional abasic residues. In some embodiments, UUAb, UAb, or Ab are added to the 3' end of the sense strand. In some embodiments, the one or more abasic residues added to the 3' end of the sense strand are inverted (invAb). In some embodiments, one or more inverted abasic residues or abasic sites may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an AAT RNAi agent comprises a sense strand having a 5' extension of 1,2, 3,4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides that correspond to nucleotides in the AAT mRNA sequence. In some embodiments, the sense strand 5' extension is one of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5' to 3'). A sense strand can have a 3' extension and'or a 5’ extension. In some embodiments, the 5’ end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, the one or more abasic residues added to the 5' end of the sense strand can be inverted (e.g., invAb). In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol 2024203661 31 May 2024 (abasic ribose) residue. In some embodiments, the 3' end of the antisense strand core stretch sequence, or the 3' end of the antisense strand sequence, may include an inverted abasic residue (invAb (see Table 7)). Examples of sequences used in forming AAT RN Ai agents are provided in Tables 2. 3. 4. and 5. In some embodiments, an AAT RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2, 3, or 4. In some embodiments, an AAT RNAi agent antisense strand includes the sequence of nucleotides (from 5' end -> 3' end) 1-17,2-15,2-17,1-18,2-18,1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24, of any of the sequences tn Table 2, Table 3, or Table 4. In certain embodiments, an AAT RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4. In some embodiments, an AAT RNAi agent sense strand includes the sequence of any of the sequences in Tables 2, 3, or 5. In some embodiments, an AAT RNAi agent sense strand includes the sequence of nucleotides (from 5' end 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-20, 3-21. 3-22, 3-23, 3-24, 4-21, 4-22. 4-23, 4-24, 5-22, 5-23, 5-24, 6-23, 6-24, 7-24. of any of the sequences in Tables 2, 3, or 5. In certain embodiments, an AAT RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 5. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a blunt end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair). In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As 2024203661 31 May 2024 used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands from a pair (i.e., do not form an overhang) but are not complementary (i.e. form a non-complementaiy pair). As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3' or 5' overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5' overhang end, a blunt end and a 3' overhang end, a frayed end and a 5' overhang end, a frayed end and a 3' overhang end, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3' overhang end, two fray ed ends, or two blunt ends. Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can preserve activity of the compound in cells while al the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the polynucleotide or oligonucleotide construct. In some embodiments, an A AT RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an AAT RNAi agent is prepared as a sodium salt. Such forms are within the scope of the inventions disclosed herein. Modified Nucleotides In some embodiments, an AAT RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2'-modified nucleotides, 3' to 3' linkages (inverted) nucleotides (represented herein as invdN, invN, invn), modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as NuMAorNUNA), locked nucleotides (represented herein as Nlna or NLNA), 3'-O-methoxy (2' intemucleoside linked) nucleotides (represented herein as 3'-OMen), 2’-F-Arabino nucleotides (represented herein as NfANA or NFana), 5-Me, 2'-fluoro nucleotide (represented herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucleotides, and cyclopropyl 2024203661 31 May 2024 phosphonate containing nucleotides (cPrpN). 2'-modified nucleotides (i.e. a nucleotide with a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to. 2'-O-methyl nucleotides (represented herein as a lower case letter ’n’ in a nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (represented herein as Nf, also represented herein as 2'-fluoro nucleotide), 2'-deoxy nucleotides (represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (represented herein as NM or 2-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single AAT RNAi agent or even in a single nucleotide thereof. The AAT RNAi agent sense strands and antisense strands can be synthesized and / or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide. Modified nucleobases include synthetic and natural nucleobases, such as 5-substiluted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, (eg., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyL or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouraciL cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine. In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0,1,2,3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being ribonucleotides. As used herein, an antisense sense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 2024203661 31 May 2024 1, or 2) nucleotides in the sense strand being ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is a ribonucleotide. Modified Internucleoside Linkages In some embodiments, one or more nucleotides of an AAT RNAi agent are linked by nonstandard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified intemucleoside linkages or backbones include, but are not limited to, 5’-phosphorothioate groups (represented herein as a lower case “s”), chiral phosphorothioates, ihiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3'-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphos photri esters, morpholino linkages, boranophosphates having normal 3-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5-3' or 2'-5' to 5'-2'. In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified intemucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic intersugar linkages. In some embodiments, modified intemucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components. In some embodiments, a sense strand of an AAT RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an AAT RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3,4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an AAT RNAi agent can contain 1,2, 3, or 4 phosphorothioate linkages, an antisense strand of an AAT RNAi agent can contain 1,2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages. 2024203661 31 May 2024 In some embodiments, an AAT RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. In some embodiments, an AAT RNAi agent antisense strand contains four phosphorothioate intemucleoside linkages. In some embodiments, the four phosphorothioate intemucleoside linkages are between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24,23-25, or 24-26 from the 5' end. In some embodiments, an AAT RNAi agent contains at least two phosphorothioate intemucleoside linkages in the sense strand and three or four phosphorothioate intemucleoside linkages in the antisense strand. In some embodiments, an AAT RNAi agent contains one or more modified nucleotides and one or more modified intemucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with modified intemucleoside linkage. AAT RNAi Agents In some embodiments, the AAT RNAi agents disclosed herein target an AAT gene at or near the positions of the AAT genome shown in Table 1. In some embodiments, the antisense strand of an AAT RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target AAT 19-mer sequence disclosed in Table 1. Table 1. AAT 19-mer mRNA Target Sequences (taken from human AAT cDNA, GenBank NM_000295.4 (SEQ ID NO: 1)) SEQ ID NO: AAT 19-mer Target Sequences (5’ - 3’) Corresponding Genome Position (taken from SEQ ID NO: 1) 2 CGUUUAGGCAUGUUUAACA 1000-1()18 3 AACAGCACCAAUAUCUUCU 469-487 4 AUAUCAUCACCAAGUUCCU 1142-1160 5 AGAUGCUGCCCAGAAGACA 348-366 6 CUGGCACACCAGUCCAACA 454-472 2024203661 31 May 2024 SEQ ID NO: AAT 19-mer Target Sequences (5’^3') Corresponding Genome Position (taken from SEQ ID NO: 1) 7 UGGCACACCAGUCCAACAG 455-473 8 GCACACCAGUCCAACAGCA 457-475 9 CAGUCCAACAGCACCAAUA 463-481 10 AGUCCAACAGCACCAAUAU 464-482 ] I GUCCAACAGCACCAAUAUC 465-483 12 CCAACAGCACCAAUAUCUU 467-485 13 CCCCAGUGAGCAUCGCUAC 491-509 14 GAGCAUCGCUACAGCCUUU 498-516 15 GCAUCGCUACAGCCUUUGC 500-518 16 CAUCGCUACAGCCUUUGCA 501-519 17 UCGCUACAGCCUUUGCAAU 503-521 18 CUACAGCCUUUGCAAUGCU 506-524 19 ACAGCCUUUGCAAUGCUCU 508-526 20 GAAGGCUUCCAGGAACUCC 613-631 21 UAGUGGAUAAGUUUUUGGA 710-728 22 UGUACCACUCAGAAGCCUU 743-761 23 GUACCACUCAGAAGCCUUC 744-762 24 ACACCGAAGAGGCCAAGAA 779-797 25 ACCGAAGAGGCCAAGAAAC 781-799 26 AGGCCAAGAAACAGAUCAA 788-806 27 GGCCAAGAAACAGAUCAAC 789-807 28 GCCAAGAAACAGAUCAACG 790-808 29 UACUCAAGGGAAAAUUGUG 825-843 30 CUCAAGGGAAAAUUGUGGA 827-845 31 UCAAGGGAAAAUUGUGGAU 828-846 32 UUGGUCAAGGAGCUUGACA 847-865 33 AGGAGCUUGACAGAGACAC 854-872 34 AGCUUGACAGAGACACAGU 857-875 35 U U U GC U CUGGUGAAUUACA 877-895 36 AGC GUUUAGGCAUGUUUAA 998-1016 37 GCGUUUAGGCAUGUUUAAC 999-1017 38 UUAGGCAUGUUUAACAUCC 1003-1021 39 UGGGUGCUGCUGAUGAAAU 1045-1063 40 UGCCACCGCCAUCUUCUUC 1074-1092 41 CCUGGAAAAUGAACUCACC 1119-1137 42 CGAUAUCAUCACCAAGUUC 1140-1158 43 ACCAAGUUCCUGGAAAAUG 1150-1168 44 UCCAUUACUGGAACCUAUG 1207-1225 45 CCAUUACUGGAACCUAUGA 1208-1226 46 ACUGGAACCUAUGAUCUGA 1213-1231 47 GGAACCUAUGAUCUGAAGA 1216-1234 2024203661 31 May 2024 SEQ ID NO: AAT 19-mer Target Sequences (5--3-) Corresponding Genome Position (taken from SEQ ID NO: 1) 48 GAACCUAUGAUCUGAAGAG 1217-1235 49 CAGCAAUGGGGCUGACCUC 1269-1287 50 GCAAUGGGGCUGACCUCUC 1271-1289 51 AGAGGAGGCACCCCUGAAG 1299-1317 52 AGGCACCCCUGAAGCUCUC 1304-1322 53 UCUCCAAGGCCGUGCAUAA 1319-1337 54 UCCAAGGCCGUGCAUAAGG 1321-1339 55 CCAAGGCCGUGCAUAAGGC 1322-1340 56 CAAGGCCGUGCAUAAGGCU 1323-1341 57 AAGGCUGUGCUGACCAUCG 1336-1354 58 GGCUGUGCUGACCAUCGAC 1338-1356 59 CUGCUGGGGCCAUGUUUUU 1373-1391 60 GCUGGGGCCAUGUUUUUAG 1375-1393 61 CUGGGGCCAUGUUUUUAGA 1376-1394 62 GGGGCCAUGUUUUUAGAGG 1378-1396 63 GGGCCAUGUUUUUAGAGGC 1379-1397 64 GAGGCCAUACCCALGLCUA 1393-1411 65 GGCCAUACCCAUGUCUAUC 1395-1413 66 CCCGAGGUCAAGUUCAACA 1417-1435 67 AGGUCAAGUUCAACAAACC 1421-1439 68 CAAGUUCAACAAACCCUUU 1425-1443 69 AGUUCAACAAACCCUUUGU 1427-1445 70 GUUCAACAAACCCUUUGUC 1428-1446 71 UCAACAAACCCUUUGUCUU 1430-1448 72 ACCCUUUGUCUUCUUAAUG 1437-1455 73 CCUUUGUCUUCUUAAUGAU 1439-1457 74 UAC C AAGUCUCCCCUCUUC 1467-1485 75 AAGUCUCCCCUCUUCAUGG 1471-1489 76 AGUCUCCCCUCUUCAUGGG 1472-1490 77 UCUCCCCUCUUCAUGGGAA 1474-1492 78 CUCCCCUCUUCAUGGGAAA 1475-1493 79 AUGACAUUAAAGAAGGGUU 1569-1587 In some embodiments, an AAT RNAi agent includes an antisense strand wherein position 1$) of the antisense strand (5' -> 3') is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an AAT RNAi agent includes an 5 antisense strand wherein position 1 of the antisense strand (5' -> 3') is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Table 1. 2024203661 31 May 2024 In some embodiments, an A AT RNAi agent includes an antisense strand wherein position 2 of the antisense strand (5' -> 3') is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, an AAT RNAi agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5' -> 3') are capable of forming base pairs with each of the respective complementary' bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1. For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5' end -> 3' end) can be perfectly complementary to the AAT gene, or can be non-complementary to the AAT gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end -> 3' end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end -> 3' end) forms an A:U or U:A base pair with the sense strand. In some embodiments, an AAT RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 4. In some embodiments, an AAT RNAi sense strand comprises the sequence of nucleotides (from 5' end -> 3' end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2, Table 3, or Table 5. In some embodiments, an AAT RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5' end 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 4, and (ii) a sense strand comprising the sequence of nucleotides (from 5' end -> 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 3, or Table 5. In some embodiments, the AAT RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2. Table 2. Example A AT RM Ai Agent Antisense Strand and Sense Strand Core Stretch Base Sequences (N - any nucleobase) SEQ ID NO: Antisense Base Sequence (5’^3') (19-mers) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 80 UGUUAAACAUGCCUAAACG 429 CGUUUAGGCAUGUUUAACA 1000-1018 81 AGUUAAACAUGCCUAAACG 430 CGUUUAGGCAUGUUUAACU 1000-1018 82 NGUUAAACAUGCCUAAACG 431 CGUUUAGGCAUGUUUAACN 1000-1018 83 NGUUAAACAUGCCUAAACN 432 NGUUUAGGCAUGUUUAACN 1000-1018 84 AGAAGAUAUUGGUGCUGUU 433 AACAGCACCAAUAUCUUCU 469-487 85 UGAAGAUAUUGGUGCUGUU 434 AACAGCACCAAUAUCUUCA 469-487 86 NGAAGAUAUUGGUGCUGUU 435 AACAGCACCAAUAUCUUCN 469-487 87 NGAAGAUAUUGGUGCUGUN 436 NACAGCACCAAUAUCUUCN 469-487 88 AGGAACUUGGUGAUGAUAU 437 AUAUCAUCACCAAGUUCCU 1142-1160 89 UGGAACUUGGUGAUGAUAU 438 AUAUCAUCACCAAGUUCCA 1142-1160 90 NGGAACUUGGUGAUGAUAU 439 AUAUCAUCACCAAGUUCCN 1142-1160 91 NGGAACUUGGUGAUGAUAN 440 NUAUCAUCACCAAGUUCCN 1142-1160 92 UGUCUUCUGGGCAGCAUCU 441 AGAUGCUGCCCAGAAGACA 348-366 93 AGUCUUCUGGGCAGCAUCU 442 AGAUGCUGCCCAGAAGACU 348-366 94 NGUCUUCUGGGCAGCAUCU 443 AGAUGCUGCCCAGAAGACN 348-366 95 NGUCUUCUGGGCAGCAUCN 444 NGAUGCUGCCCAGAAGACN 348-366 96 UGUUGGACUGGUGUGCCAG 445 CUGGCAC ACC AGUCCAACA 454-472 97 AGUUGGACUGGUGUGC CAG 446 CUGGCACACCAGUCCAACU 454-472 98 NGUUGGACUGGUGUGCCAG 447 CUGGCACACCAGUCCAACN 454-472 99 NGUUGGACUGGUGUGCCAN 448 NUGGCACACCAGUCCAACN 454-472 100 CUGUUGGACUGGUGUGCCA 449 UGGCACACCAGUCCAACAG 455-473 101 UUGUUGGACUGGUGUGCCA 450 UGGCACACCAGUCCAACAA 455-473 102 AUGUUGGACUGGUGUGCCA 451 UGGCACACCAGUCCAACAU 455-473 103 NUGUUGGACUGGUGUGCCA 452 UGGCACACCAGUCCAACAN 455-473 104 NUGUUGGACUGGUGUGCCN 453 NGGCACACCAGUCCAACAN 455-473 105 UGCUGUUGGACUGGUGUGC 454 GCACACCAGUCCAACAGCA 457-475 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 106 AGCUGUUGGACUGGUGUGC 455 GCACACCAGUCCAACAGCU 457-475 107 NGCUGUUGGACUGGUGUGC 456 GCACACCAGUCCAACAGCN 457-475 108 NGCUGUUGGACUGGUGUGN 457 NCACACCAGUCCAACAGCN 457-475 109 UAUUGGUGCUGUUGGACUG 458 CAGUCCAACAGCACCAAUA 463-481 ] 10 AAUUGGUGCUGUUGGACUG 459 CAGUCCAACAGCACCAAUU 463-481 111 NAUUGGUGCUGUUGGACUG 460 CAGUCCAACAGCACCAAUN 463-481 112 NAUUGGUGCUGUUGGACUN 461 NAGUCCAACAGCACCAAUN 463-481 113 AUAUUGGUGCUGUUGGACU 462 AGUCCAACAGCACCAAUAU 464-482 114 UUAUUGGUGCUGUUGGACU 463 AGUCCAACAGCACCAAUAA 464-482 115 NUAUUGGUGCUGUUGGACU 464 AGUCCAACAGCACCAAUAN 464-482 116 NUAUUGGUGCUGUUGGACN 465 NGUCCAACAGCACCAAUAN 464-482 117 GAUAUUGGUGCUGUUGGAC 466 GUCCAACAGCACCAAUAUC 465-483 ] 18 UAUAUUGGUGCUGUUGGAC 467 GUCCAACAGCACCAAUAUA 465-483 119 AAUAUUGGUGCUGUUGGAC 468 GUCCAACAGCACCAAUAUU 465-483 120 NAUAUUGGUGCUGUUGGAC 469 GUCCAACAGCACCAAUAUN 465-483 121 NAUAUUGGUGCUGUUGGAN 470 NUCCAACAGCACCAAUAUN 465-483 122 AAGAUAUUGGUGCUGUUGG 471 CCAACAGCACCAAUAUCUU 467-485 123 UAGAUAUUGGUGCUGUUGG 472 CCAACAGC ACC AAUAUCUA 467-485 124 NAGAUAUUGGUGCUGUUGG 473 CCAACAGCACCAAUAUCUN 467-485 125 NAGAUAUUGGUGCUGUUGN 474 NC AAC AGC ACCAAUAUCUN 467-485 126 GUAGCGAUGCUCACUGGGG 475 CCCCAGUGAGCAUCGCUAC 491-509 127 UUAGCGAUGCUCACUGGGG 476 CCCCAGUGAGCAUCGCUAA 491-509 128 AUAGCGAUGCUCACUGGGG 477 CCCCAGUGAGCAUCGCUAU 491-509 129 NUAGCGAUGCUCACUGGGG 478 CCCCAGUGAGCAUCGCUAN 491-509 130 NUAGCGAUGCUCACUGGGN 479 NCCCAGUGAGCAUCGCUAN 491-509 131 AAAGGCUGUAGCGAUGCUC 480 GAGCAUCGCUACAGCCUUU 498-516 132 UAAGGCUGUAGCGAUGCUC 481 GAGCAUCGCUACAGCCUUA 498-516 133 NAAGGCUGUAGCGAUGCUC 482 GAGCAUCGCUACAGCCUUN 498-516 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 134 NAAGGCUGUAGCGAUGCUN 483 NAGCAUCGCUACAGCCUUN 498-516 135 GCAAAGGCUGUAGCGAUGC 484 GCAUCGCUACAGCCUUUGC 500-518 136 UCAAAGGCUGUAGCGAUGC 485 GCAUCGCUACAGCCUUUGA 500-518 137 ACAAAGGCUGUAGCGAUGC 486 GCAUCGCUACAGCCUUUGU 500-518 138 NCAAAGGCUGUAGCGAUGC 487 GCAUCGCUACAGCCUUUGN 500-518 139 NCAAAGGCUGUAGCGAUGN 488 NCAUCGCUACAGCCUUUGN 500-518 140 UGCAAAGGCUGUAGCGAUG 489 CAUCGCUACAGCCUUUGCA 501-519 141 AGCAAAGGCUGUAGCGAUG 490 CAL CGCU ACAGCCUUUGCU 501-519 142 NGCAAAGGCUGUAGCGAUG 491 NAUC GCUAC AGCCI JI JUGCN 501-519 143 NGCAAAGGCUGUAGCGAUN 492 NAUCGCUACAGCCUUUGCN 501-519 144 AUUGCAAAGGCUGUAGCGA 493 UCGCUACAGCCUUUGCAAU 503-521 145 UUUGCAAAGGCUGUAGCGA 494 UCGCUACAGCCUUUGCAAA 503-521 146 NUUGCAAAGGCUGUAGCGA 495 UCGCUACAGCCUUUGCAAN 503-521 147 NUUGCAAAGGCUGUAGCGN 496 NCGCUACAGCCUUUGCAAN 503-521 148 AGCAUUGCAAAGGCUGUAG 497 C U AC AGCC U U U GC A A U GC U 506-524 149 UGCAUUGCAAAGGCUGUAG 498 CUACAGCCUUUGCAAUGCA 506-524 150 UGCAUUGCAAAGGCUGUAG 499 CUACAGCCUUUGCAAUGCN 506-524 151 NGCAUUGCAAAGGCUGUAN 500 NUACAGCCUUUGCAAUGCN 506-524 152 AGAGCAUUGCAAAGGCUGU 501 ACAGCCUUUGCAAUGCUCU 508-526 153 UGAGCAUUGCAAAGGCUGU 502 ACAGC CUUUGCAAUGCUCA 508-526 154 NGAGCAUUGCAAAGGCUGU 503 ACAGCCUUUGCAAUGCUCN 508-526 155 NGAGCAUUGCAAAGGCUGU 504 NCAGCCU U UGCAAUGC UCN 508-526 156 GGAGUUCCUGGAAGCCUUC 505 GAAGGCUUCCAGGAACUCC 613-631 157 UGAGUUCCUGGAAGCCUUC 506 GAAGGCUUCCAGGAACUCA 613-631 158 AGAGUUCCUGGAAGCCUUC 507 GAAGGCUUCCAGGAACUCU 613-631 159 NGAGUUCCUGGAAGCCUUC 508 GAAGGCUUCCAGGAACUCN 613-631 160 NGAGUUCCUGGAAGCCUUN 509 NAAGGCUUCCAGGAACUCN 613-631 161 UCCAAAAACUUAUCCACUA 510 UAGUGGA UAAGUU U U UGGA 710-728 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 162 ACCAAAAACUUAUCCACUA 511 UAGUGGAUAAGUUUUUGGU 710-728 163 NCCAAAAACUUAUCCACUA 512 U AGUGGAUAAGUU UUUGGN 710-728 164 NCCAAAAACUUAUCCACUN 513 NAGUGGAUAAGUUUUUGGN 710-728 165 AAGGCUUCUGAGUGGUACA 514 UGUACCACUCAGAAGCCUU 743-761 166 UAGGCUUCUGAGUGGUACA 515 UGUACCACUCAGAAGCCUA 743-761 167 NAGGCUUCUGAGUGGUACA 516 UGUACCAC UCAGAAGCC UN 743-761 168 NAGGCUUCUGAGUGGUACN 517 NGUAC CACUC AGAAGC CUN 743-761 169 GAAGGCUUCUGAGUGGUAC 518 GUACCACUCAGAAGCCUUC 744-762 170 UAAGGCUUCUGAGUGGUAC 519 GUACCACUCAGAAGCCUUA 744-762 171 AAAGGCUUCUGAGUGGUAC 520 GUACCACUCAGAAGCCUUU 744-762 172 NAAGGCUUCUGAGUGGUAC 521 GUACCACUCAGAAGCCUUN 744-762 173 NAAGGCUUCUGAGUGGUAN 522 NUACCACUCAGAAGCCUUN 744-762 174 UUCUUGGCCUCUUCGGUGU 523 ACACCGAAGAGGCCAAGAA 779-797 175 AUCUUGGCCUCUUCGGUGU 524 ACACCGAAGAGGCCAAGAU 779-797 176 NUCUUGGCCUCUUCGGUGU 525 ACACCGAAGAGGCCAAGAN 779-797 177 NUCUUGGCCUCUUCGGUGN 526 NCACCGAAGAGGCCAAGAN 779-797 178 GUUUCUUGGCCUCUUCGGU 527 ACCGAAGAGGCCAAGAAAC 781-799 179 UUUUCUUGGCCUCUUCGGU 528 ACCGAAGAGGCCAAGAAAA 781-799 180 AUUUCUUGGCCUCUUCGGU 529 ACCGAAGAGGCCAAGAAAU 781-799 181 NUUUCUUGGCCUCUUCGGU 530 ACCGAAGAGGCCAAGAAAN 781-799 182 NUUUCUUGGCCUCUUCGGN 531 NCCGAAGAGGCCAAGAAAN 781-799 183 UUGAUCUGUUUCUUGGCCU 532 AGGCCAAGAAACAGAUCAA 788-806 184 AUGAUCUGUUUCUUGGCCU 533 AGGCCAAGAAACAGAUCAU 788-806 185 NUGAUCUGUUUCUUGGCCU 534 AGGCCAAGAAACAGAUCAN 788-806 186 NUGAUCUGUUUCUUGGCCN 535 NGGCCAAGAAACAGAUCAN 788-806 187 GUUGAUCUGUUUCUUGGCC 536 GGCCAAGAAACAGAUCAAC 789-807 188 UUUGAUCUGUUUCUUGGCC 537 GGCCAAGAAACAGAUCAAA 789-807 189 AUUGAUCUGUUUCUUGGCC 538 GGCCAAGAAACAGAUCAAU 789-807 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 190 NUUGAUCUGUUUCUUGGCC 539 GGCCAAGAAACAGAUCAAN 789-807 191 NUUGAUCUGUUUCUUGGCN 540 NGCCAAGAAACAGAUCAAN 789-807 192 CGUUGAUCUGUUUCUUGGC 541 GCCAAGAAACAGAUCAACG 790-808 193 UGUUGAUCUGUUUCUUGGC 542 GCCAAGAAACAGAUCAACA 790-808 194 AGUUGAUCUGUUUCUUGGC 543 GCCAAGAAACAGAUCAACU 790-808 195 NGUUGAUCUGUUUCUUGGC 544 GCCAAGAAACAGAUCAACN 790-808 196 NGUUGAUCUGUUUCUUGGN 545 NCCAAGAAACAGAUCAACN 790-808 197 CACAAUUUUCCCUUGAGUA 546 UACUCAAGGGAAAAUUGUG 825-843 198 UACAAUUUUCCCUUGAGUA 547 UACUCAAGGGAAAAUUGUA 825-843 199 AACAAUUUUCCCUUGAGUA 548 U AC U CAAGGGA AAA U U GU U 825-843 200 NACAAUUUUCCCUUGAGUA 549 UACUCAAGGGAAAAUUGUN 825-843 201 NACAAUUUUCCCUUGAGUN 550 N AC UCAAGGGAAAAUUGUN 825-843 202 UCCACAAUUUUCCCUUGAG 551 C UCAAGGGAAAAUUGUGGA 827-845 203 ACCACAAUUUUCCCUUGAG 552 CUCAAGGGAAAAUUGUGGU 827-845 204 NCCACAAUUUUCCCUUGAG 553 CUCAAGGGAAAAU UGUGGN 827-845 205 NCCACAAUUUUCC CUUGAN 554 NUCAAGGGAAAAUUGUGGN 827-845 206 AUCCACAAUUUUCCCUUGA 555 UCAAGGGAAAAUUGUGGAU 828-846 207 UUCCACAAUUUUCCCUUGA 556 UCAAGGGAAAAUUGUGGAA 828-846 208 NUCCACAAUUUUCCCUUGA 557 UCAAGGGAAAAUUGUGGAN 828-846 209 NUCCACAAUUUUCCCUUGN 558 NCAAGGGAAAAUUGUGGAN 828-846 210 UGUCAAGCUCCUUGACCAA 559 UUGGUCAAGGAGCUUGACA 847-865 211 AGUCAAGCUCCUUGACCAA 560 U U GGU C AAGGAGCU U GACU 847-865 212 NGUCAAGCUCCUUGACCAA 561 NUGGUCAAGGAGCUUGACA 847-865 213 NGUCAAGCUCCUUGACCAA 562 NUGGUCAAGGAGCUUGACN 847-865 214 GUGUCUCUGUCAAGCUCCU 563 AGGAGCUUGACAGAGACAC 854-872 215 UUGUCUCUGUCAAGCUCCU 564 AGGAGCUUGACAGAGACAA 854-872 216 AUGUCUCUGUCAAGCUCCU 565 AGGAGCUUGACAGAGACAU 854-872 217 NUGUCUCUGUCAAGCUCCU 566 AGGAGCUUGACAGAGACAN 854-872 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 218 NUGUCUCUGUCAAGCUCCN 567 NGGAGCUUGACAGAGACAN 854-872 219 ACUGUGUCUCUGUCAAGCU 568 AGCUUGACAGAGACACAGU 857-875 220 UCUGUGUCUCUGUCAAGCU 569 AGCUUGACAGAGACACAGA 857-875 221 NCUGUGUCUCUGUCAAGCU 570 AGCUUGACAGAGACACAGN 857-875 222 NCUGUGUCUCUGUCAAGCN 571 NGCUUGACAGAGACACAGN 857-875 223 UGUAAUUCACCAGAGCAAA 572 UUUGCUCUGGUGAAUUACA 877-895 224 AGUAAUUCACCAGAGCAAA 573 UUUGCUCUGGUGAAUUACU 877-895 225 NGUAAUUCACCAGAGCAAA 574 UUUGCUCUGGUGAAUUACN 877-895 226 NGUAAUUCACCAGAGCAAN 575 NUUGCUCUGGUGAAUUACN 877-895 227 UUAAACAUGCCUAAACGCU 576 AGCGUUUAGGCAUGUUUAA 998-1016 228 AUAAACAUGCCUAAACGCU 577 AGCGUUUAGGCAUGUUUAU 998-1016 229 NUAAACAUGCCUAAACGCU 578 AGCGU UUAGGCAUGUUUAN 998-1016 230 NUAAACAUGCCUAAACGCN 579 NGCGUUUAGGCAUGUUUAN 998-1016 231 GUUAAACAUGCCUAAACGC 580 GCGUUUAGGCAUGUUUAAC 999-1017 232 UUUAAACAUGCCUAAACGC 581 GCGUUUAGGCAUGUUUAAA 999-1017 233 AUUAAACAUGCCUAAACGC 582 GCGUUUAGGCAUGUUUAAU 999-1017 234 NUUAAACAUGCCUAAACGC 583 GCGUUUAGGCAUGUUUAAN 999-1017 235 NUUAAACAUGCCUAAACGN 584 NC GUUUAGGCAUGUUUAAN 999-1017 236 GGAUGUUAAACAUGCCUAA 585 U U A GGC A U G U U U A AC A U C C 1003-1021 237 UGAUGUUAAACAUGCCUAA 586 UUAGGCAUGUUUAACAUCA 1003-1021 238 AGAUGUUAAACAUGCCUAA 587 UUAGGCAUGUUUAACAUCU 1003-1021 239 NGAUGUUAAACAUGCCUAA 588 U U A GGC A U G U U U A AC A U C N 1003-1021 240 NGAUGUUAAACAUGCCUAN 589 NUAGGCAUGUUUAACAUCN 1003-1021 241 AUUUCAUCAGCAGCACCCA 590 UGGGUGCUGCUGAUGAAAU 1045-1063 242 UUUUCAUCAGCAGCACCCA 591 UGGGUGCUGCUGAUGAAAA 1045-1063 243 NUUUCAUCAGCAGCACCCA 592 UGGGUGCUGCUGAUGAAAN 1045-1063 244 NUUUCAUCAGCAGCACCCN 593 NGGGUGCUGCUGAUGAAAN 1045-1063 245 GAAGAAGAUGGCGGUGGCA 594 UGCCACCGCCAUCUUCUUC 1074-1092 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID INO: 1 246 UAAGAAGAUGGCGGUGGCA 595 UGCCACCGCCAUCUUCUUA 1074-1092 247 AAAGAAGAUGGCGGUGGCA 596 UGCCACCGCCAUCUUCUUU 1074-1092 248 NAAGAAGAUGGCGGUGGCA 597 UGCCACCGCCAUCUUCUUN 1074-1092 249 NAAGAAGAUGGCGGUGGCN 598 NGCCACCGCCAUCUUCUUN 1074-1092 250 GGUGAGUUCAUUUUCCAGG 599 CCUGGAAAAUGAACUCACC 1119-1137 251 UGUGAGUUCAUUUUCCAGG 600 CCU GGAAAAUGAACUCAC A 1119-1137 252 AGUGAGUUCAUUUUCCAGG 601 C CUGGAAAAUGAACUCACU 1119-1137 253 NGUGAGUUCAUUUUCCAGG 602 CCUGGAAAAUGAACUCACN U 19-1137 254 NGUGAGUUCAUUUUCCAGN 603 NCUGGAAAAUGAACUCACN 1119-1137 255 GAACUUGGUGAUGAUAUCG 604 CGA U A L C AUC ACC A AGUUC 1140-1158 256 UAACUUGGUGAUGAUAUCG 605 CGAUAUCAUCACCAAGUUA 1140-1158 257 AAACUUGGUGAUGAUAUCG 606 CGAUAUCAUCACCAAGUUU 1140-1158 258 UAACUUGGUGAUGAUAUCG 607 CGAUAUCAUCACCAAGUUN 1140-1158 259 NAACUUGGUGAUGAUAUCN 608 NG AUAUCAUC ACC'AAGU UN 1140-1158 260 CAUUUUCCAGGAACUUGGU 609 ACCAAGUUCCUGGAAAAUG 1150-1168 261 UAUUUUCCAGGAACUUGGU 610 ACCAAGUUCCUGGAAAAUA 1150-1168 262 AAUUUUCCAGGAACUUGGU 611 ACCAAGUUCCUGGAAAAUU 1150-1168 263 NAUUUUCCAGGAACUUGGU 612 ACCAAGUUCCUGGAAAAUN 1150-1168 264 NAUUUUCCAGGAACUUGGN 613 NCCAAGUUCCUGGAAAAUN 1150-1168 265 CAUAGGUUCCAGUAAUGGA 614 UCCAUUACUGGAACCUAUG 1207-1225 266 UAUAGGUUCCAGUAAUGGA 615 UCCAUUACUGGAACCUAUA 1207-1225 267 AAUAGGUUCCAGUAAUGGA 616 UCCAUUACUGGAACCUAUU 1207-1225 268 NAUAGGUUCCAGUAAUGGA 617 UCCAUUACUGGAACCUAUN 1207-1225 269 NAUAGGUUCCAGUAAUGGN 618 NCCAUUACUGGAACCUAUN 1207-1225 270 UCAUAGGUUCCAGUAAUGG 619 CCAUUACUGGAACCUAUGA 1208-1226 271 ACAUAGGUUCCAGUAAUGG 620 CCAUUACUGGAACCUAUGU 1208-1226 272 NCAUAGGUUCCAGUAAUGG 621 C C AUUACUGG AACC U Al JGN 1208-1226 273 NCAUAGGUUCCAGUAAUGN 622 NCAUUACUGGAACCUAUGN 1208-1226 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 274 UCAGAUCAUAGGUUCCAGU 623 AC U GGAACC UAUGAUCUGA 1213-1231 275 ACAGAUCAUAGGUUCCAGU 624 ACUGGAACCUAUGAUCUGU 1213-1231 276 NCAGAUCAUAGGUUCCAGU 625 ACUGGAACCUAUGAUCUGN 1213-1231 277 NCAGAUCAUAGGUUCCAGN 626 NCUGGAACCUAUGAUCUGN 1213-1231 278 UCUUCAGAUCAUAGGUUCC 627 GGAACCUAUGAUCUGAAGA 1216-1234 279 ACUUCAGAUCAUAGGUUCC 628 GGAACCUAUGAUCUGAAGU 1216-1234 280 NCUUCAGAUCAUAGGUUCC 629 GGAACCUAUGAUCUGAAGN 1216-1234 281 NCUUCAGAUCAUAGGUUCN 630 NGAACCUAUGAUCUGAAGN 1216-1234 282 CUCUUCAGAUCAUAGGUUC 631 GAACCUAUGAUCUGAAGAG 1217-1235 283 UUCUUCAGAUCAUAGGUUC 632 GAACCUAUGAUCUGAAGAA 1217-1235 284 AUCUUCAGAUCAUAGGUUC 633 GAACCUAUGAUCUGAAGAU 1217-1235 285 NUCUUCAGAUCAUAGGUUC 634 GAACCUAUGAUCUGAAGAG 1217-1235 286 NUCUUCAGAUCAUAGGUUN 635 NAACCUAUGAUCUGAAGAN 1217-1235 287 GAGGUCAGCCCCAUUGCUG 636 CAGCAAUGGGGCUGACCUC 1269-1287 288 UAGGUCAGCCCCAUUGCUG 637 CAGCAAUGGGGCUGACCUA 1269-1287 289 AAGGUCAGCCCCAUUGCUG 638 CAGCAAUGGGGCUGACCUU 1269-1287 290 NAGGUCAGCCCCAUUGCUG 639 C AGC AAUGGGGCUGAC CUN 1269-1287 291 NAGGUCAGCCCCAUUGCUN 640 NAGCAAUGGGGCUGACCUN 1269-1287 292 GAGAGGUCAGCCCCAUUGC 641 GCAAUGGGGCUGACCUCUC 1271-1289 293 UAGAGGUCAGCCCCAUUGC 642 GCAAUGGGGCUGACCUCUA 1271-1289 294 AAGAGGUCAGCCCCAUUGC 643 GCAAUGGGGCUGACCUCUU 1271-1289 295 NAGAGGUCAGCCCCAUUGC 644 GCAAUGGGGC UGACCU C UN 1271-1289 296 NAGAGGUCAGCCCCAUUGN 645 NCAAUGGGGCUGACCUCUN 1271-1289 297 CUUCAGGGGUGCCUCCUCU 646 AGAGGAGGCACCCCUGAAG 1299-1317 298 UUUCAGGGGUGCCUCCUCU 647 AG AGG AGGCACCCCUGAAA 1299-1317 299 AUUCAGGGGUGCCUCCUCU 648 AGAGGAGGCACCCCUGAAU 1299-1317 300 NUUCAGGGGUGCCUCCUCU 649 AGAGGAGGCACCCCUGAAN 1299-1317 301 NU UCAGGGGU GCCUCC UCN 650 NGAGGAGGCACCCCUGAAN 1299-1317 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 302 GAGAGCUUCAGGGGUGCCU 651 AGGCACCCCUGAAGCUCUC 1304-1322 303 UAGAGCUUCAGGGGUGCCU 652 AGGCACCCCUGAAGCUCUA 1304-1322 304 AAGAGCUUCAGGGGUGCC U 653 AGGCACCCCUGAAGCUCUU 1304-1322 305 NAGAGCUUCAGGGGUGCCU 654 AGGCACCCCUGAAGCUCUN 1304-1322 306 NAGAGCUUCAGGGGUGCCN 655 NGGCACCCCUGAAGCUCUN 1304-1322 307 UUAUGCACGGCCUUGGAGA 656 UCUCCAAGGCCGUGCAUAA 1319-1337 308 AUAUGCACGGCCUUGGAGA 657 UCUCCAAGGCCGUGCAUAU 1319-1337 309 NUAUGCACGGCCUUGGAGA 658 UCUCCAAGGCCGUGCAUAN 1319-1337 310 NUAUGCACGGCCUUGGAGN 659 NCUCCAAGGCCGUGCAUAN 1319-1337 311 CCUUAUGCACGGCCUUGGA 660 UCCAAGGCCGUGCAUAAGG 1321-1339 312 UCUUAUGCACGGCCUUGGA 661 UCCAAGGCCGUGCAUAAGA 1321-1339 313 ACUUAUGCACGGCCUUGGA 662 UCCAAGGCCGUGCAUAAGU 1321-1339 314 NCUUAUGCACGGCCUUGGA 663 UCCAAGGCCGUGCAUAAGN 1321-1339 315 NCUUAUGCACGGCCUUGGN 664 NCCAAGGCCGUGCAUAAGN 1321-1339 316 GCCUUAUGCACGGCCUUGG 665 CCAAGGCCGUGCAUAAGGC 1322-1340 317 UCCUUAUG CACGGCCUUGG 666 CCAAGGCCGUGCAUAAGGA 1322-1340 318 ACCUUAUGCACGGCCUUGG 667 CCAAGGCCGUGCAUAAGGU 1322-1340 319 NCCUUAUGCACGGCCUUGG 668 CCAAGGCCGUGCAUAAGGN 1322-1340 320 NCCUUAUGCACGGCCUUGN 669 NCAAGGCCGUGCAUAAGGN 1322-1340 321 AGCCUUAUGCACGGCCUUG 670 CAAGGCCGUGCAUAAGGCU 1323-1341 322 UGCCUUAUGCACGGCCUUG 671 CAAGGCCGUGCAUAAGGCA 1323-1341 323 NGCCUUAUGCACGGCCUUG 672 CAAGGCCGUGCAUAAGGCN 1323-1341 324 NGCCUUAUGCACGGCCUUN 673 NAAGGCCGUGCAUAAGGCN 1323-1341 325 CGAUGGUCAGCACAGCCUU 674 AAGGCUGUGCUGACCAUCG 1336-1354 326 UGAUGGUCAGCACAGCCUU 675 AAGGCUGUGCUGACCAUCA 1336-1354 327 AGAUGGUCAGCACAGCCUU 676 AAGGCUGUGCUGACCAUCU 1336-1354 328 NGAUGGUCAGCACAGCCUU 677 AAGGCUGUGCUGACCAUCN 1336-1354 329 NGAUGGUCAGCACAGCCUN 678 NAGGCUGUGCUGACCAUCN 1336-1354 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 330 GUCGAUGGUCAGCACAGCC 679 GGCUGUGCUGACCAUGGAC 1338-1356 331 UUCGAUGGUCAGCACAGCC 680 GGCUGUGCUGACCAUCGAA 1338-1356 332 AUCGAUGGUCAGCACAGCC 681 GGCUGUGCUGACCAUCGAU 1338-1356 333 NUCGAUGGUCAGCACAGCC 682 GGC UGU GCUGACCAU OGAN 1338-1356 334 NUCGAUGGUCAGCACAGCN 683 NGCUGUGCUGACCAUCGAN 1338-1356 335 AAAAACAUGGCCCCAGCAG 684 CUGCUGGGGCCAUGUUUUU 1373-1391 336 UAAAACAUGGCCCCAGCAG 685 CUGCUGGGGCCAUGUUUUA 1373-1391 337 NAAAACAUGGCCCCAGCAG 686 CUGCUGGGGCCAUGUUUUN 1373-1391 338 NAAAACAUGGCCCCAGCAN 687 NUGCUGGGGCCAUGUUUUN 1373-1391 339 CUAAAAACAUGGCCCCAGC 688 GCUGGGGCCAUGUU U U U AG 1375-1393 340 UUAAAAACAUGGCCCCAGC 689 GCUGGGGCC AUGUUUUU AA 1375-1393 341 AUAAAAACAUGGCCCCAGC 690 GCUGGGGCCAUGUUUUUAU 1375-1393 342 NUAAAAACAUGGCCCCAGC 691 GC UGGGGCCAUGUU U U U AN 1375-1393 343 NUAAAAACAUGGCCCCAGN 692 NCUGGGGCCAUGUUUUUAN 1375-1393 344 UCUAAAAACAUGGCCCCAG 693 C UGGGGCCAUGUUUUUAGA 1376-1394 345 ACUAAAAACAUGGCCCCAG 694 CUGGGGCCAUGUUUUUAGU 1376-1394 346 NCUAAAAACAUGGCCCCAG 695 CUGGGGCC AUGUUUUUA GN 1376-1394 347 NCUAAAAACAUGGCCCCAN 696 NUGGGGCCAUGUUUUUAGN 1376-1394 348 CCUCUAAAAACAUGGCCCC 697 GGGGC CA U GU U U U U AGAGG 1378-1396 349 UCUCUAAAAACAUGGCCCC 698 GGGGC C AUGUUUUU AGAGA 1378-1396 350 ACUCUAAAAACAUGGCCCC 699 GGGGCCAUGUUUUUAGAGU 1378-1396 351 NCUCUAAAAACAUGGCCCC 700 GGGGC C A U GU U U U U AGA GN 1378-1396 352 NCUCUAAAAACAUGGCCCN 701 NGGGCCAUGUUUUUAGAGN 1378-1396 353 GCCUCUAAAAACAUGGCCC 702 GGGCCAUGUU U U UAGAGGC 1379-1397 354 UCCUCUAAAAACAUGGCCC 703 GGGCCAUGUUUUUAGAGGA 1379-1397 355 ACCUCUAAAAACAUGGCCC 704 GGGCCAUGUUUUUAGAGGU 1379-1397 356 NCCUCUAAAAACAUGGCCC 705 GGGC CAUGUUUUUAGAGGN 1379-1397 357 NCCUCUAAAAACAUGGCCN 706 NGGCCAUGUUUUUAGAGGN 1379-1397 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID INO: 1 358 UAGACAUGGGUAUGGCCUC 707 GAGGCCAUACCCAUGUCUA 1393-1411 359 AAGACAUGGGUAUGGCCUC 708 GAGGCCAUACCCAUGUCUU 1393-1411 360 NAGACAUGGGUAUGGCCUC 709 GAGGCCAUACCCAUGUCUN 1393-1411 361 NAGACAUGGGUAUGGCCUN 710 NAGGCCAUACCCAUGUCUN 1393-1411 362 GAUAGACAUGGGUAUGGCC 71 1 GGCCAUACCCAUGUCUAUC 1395-1413 363 UAUAGACAUGGGUAUGGCC 712 GGCCAUACCCAUGUCUAUA 1395-1413 364 AAUAGACAUGGGUAUGGC C 713 GGCCAUACCCAUGUCUAUU 1395-1413 365 NAUAGACAUGGGUAUGGCC 714 GGCCAUACCCAUGUCUAUN 1395-1413 366 NAUAGACAUGGGUAUGGCN 715 NGCCAUACCCAUGUCUAUN 1395-1413 367 UGUUGAACUUGACCUCGGG 716 CCCGAGGUCAAGUUCAACA 1417-1435 368 AGUUGAACUUGACCUCGGG 717 CCCGAGGUC A AGUUCAACU 1417-1435 369 NGUUGAACUUGACCUCGGG 718 CCCGAGGUCAAGUUCAACN 1417-1435 370 NGUUGAACUUGACCUCGGN 719 NCCGAGGUCAAGUUCAACN 1417-1435 371 GGUUUGUUGAACUUGACCU 720 AGGUCAAGUUCAACAAACC 1421-1439 372 UGUUUGUUGAACUUGACCU 721 AGGUC AAGUUCAACAAACA 1421-1439 373 AGUUUGUUGAACUUGACCU 722 AGGUCAAGUUCAACAAACU 1421-1439 374 NGUUUGUUGAACUUGACCU 723 AGGUCAAGUUCAACAAACN 1421-1439 375 NGUUUGUUGAACUUGACCN 724 NGGUCAAGUUCAACAAACN 1421-1439 376 AAAGGGUUUGUUGAACUUG 725 CAAGUUCAACAAACCCUUU 1425-1443 377 UAAGGGUUUGUUGAACUUG 726 CAAGUUCAACAAACCCUUA 1425-1443 378 NAAGGGUUUGUUGAACUUG 727 CAAGLUCAACAAACCCUUN 1425-1443 379 NAAGGGUUUGUUGAACUUN 728 NAAGUUCAACAAACCCUUN 1425-1443 380 ACAAAGGGUUUGUUGAACU 729 AGUUCAACAAACCCUUUGU 1427-1445 381 UCAAAGGGUUUGUUGAACU 730 AGUUCAACAAACCCUUUGA 1427-1445 382 NCAAAGGGUUUGUUGAACU 731 AGUUCAACAAACCCUUUGN 1427-1445 383 NCAAAGGGUUUGUUGAACN 732 NGUUCAACAAACCCUUUGN 1427-1445 384 GACAAAGGGUUUGUUGAAC 733 GUUCAACAAACCCUUUGUC 1428-1446 385 UACAAAGGGUUUGUUGAAC 734 GU UCAACAAACCCUUUGUA 1428-1446 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 386 AACAAAGGGUUUGUUGAAC 735 GUUCAACAAACCCUUUGUU 1428-1446 387 NACAAAGGGUUUGUUGAAC 736 GUUCAACAAACCCUUUGUN 1428-1446 388 NACAAAGGGUUUGUUGAAN 737 NUUCAACAAACCCU U UG UN 1428-1446 389 AAGACAAAGGGUUUGUUGA 738 UCAACAAACCCUUUGUCUU 1430-1448 390 UAGACAAAGGGUUUGUUGA 739 UCAACAAACCCUUUGUCUA 1430-1448 391 NAGACAAAGGGUUUGUUGA 740 UCAACAAACCCUUUGUCUN 1430-1448 392 NAGACAAAGGGUUUGUUGN 741 NCAACAAACCCUUUGUCUN 1430-1448 393 C A U U AAGAAGAC A A AGGGU 742 AC CCUUUGUCU U CU U AAUG 1437-1455 394 UAUUAAGAAGACAAAGGGU 743 ACCCUUUGUCUUCUUAAUA 1437-1455 395 AAUUAAGAAGACAAAGGGU 744 ACCCUUUGUCUUCUUAAUU 1437-1455 396 NAUUAAGAAGACAAAGGGU 745 ACCCUUUGUCUUCUUAAUN 1437-1455 397 NAUUAAGAAGACAAAGGGN 746 NCCCUUUGUCUUCUUAAUN 1437-1455 398 AUCAUUAAGAAGACAAAGG 747 CCUUUGUCUUCUUAAUGAU 1439-1457 399 UUCAUUAAGAAGACAAAGG 748 CCUUUGUCUUCUUAAUGAA 1439-1457 400 NUCAUUAAGAAGACAAAGG 749 CC U U UGUCUUCU U AAUGAN 1439-1457 401 NUCAUUAAGAAGACAAAGN 750 NCUUUGUCUUCUUAAUGAN 1439-1457 402 GAAGAGGGGAGACUUGGUA 751 UACCAAGUCUCCCCUCUUC 1467-1485 403 UAAGAGGGGAGACUUGGUA 752 UACC AAGUCUCC C CUC UU A 1467-1485 404 AAAGAGGGGAGACUUGGUA 753 UACCAAGUCUCCCCUCUUU 1467-1485 405 NAAGAGGGGAGACUUGGUA 754 UAC C AAGUCUCC C CUC UUN 1467-1485 406 NAAGAGGGGAGACUUGGUN 755 NACCAAGUCUCCCCUCUUN 1467-1485 407 CCAUGAAGAGGGGAGACUU 756 A AGU C UCCCCUCU UCAUGG 1471-1489 408 UCAUGAAGAGGGGAGACUU 757 AAGUCUCCCCUCUUCAUGA 1471-1489 409 ACAUGAAGAGGGGAGACUU 758 AAGUCUCCCCUCUUCAUGU 1471-1489 410 NCAUGAAGAGGGGAGACUU 759 AAGUCUCCCCUCUUCAUGN 1471-1489 411 NCAUGAAGAGGGGAGACUN 760 NAGUCUCCCCUCUUCAUGN 1471-1489 412 CCCAUGAAGAGGGGAGACU 761 AGUCUCCCCUCUUCAUGGG 1472-1490 413 UCCAUGAAGAGGGGAGACU 762 AGU C U CCCCUC U UCAUGGA 1472-1490 WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5’^3’) (19-iners) SEQ ID NO: Sense Base Sequence (5’ 3’) (19-mers) Genome Position of SEQ ID NO: 1 414 ACCAUGAAGAGGGGAGACU 763 AGUCUCCCCUCUUCAUGGU 1472-1490 415 NCCAUGAAGAGGGGAGACU 764 AGUCUCCCCUCUUCAUGGN 1472-1490 416 NCCAUGAAGAGGGGAGACN 765 NGUCUCCCCUCUUCAUGGN 1472-1490 417 UUCCCAUGAAGAGGGGAGA 766 UCUCCCCUCUUCAUGGGAA 1474-1492 418 AUCC CAUGAAGAGGGGAGA 767 UCUCCCCUCUUCAUGGGAU 1474-1492 419 NUCCCAUGAAGAGGGGAGA 768 UCUCCCCUCUUCAUGGGAN 1474-1492 420 NUCCCAUGAAGAGGGGAGN 769 NCUCCCCUCUUCAUGGGAN 1474-1492 421 UUUCCCAUGAAGAGGGGAG 770 C U C CCCUC U UCAUGGGAAA 1475-1493 422 AUUCCCAUGAAGAGGGGAG 771 CUCCCCUCUUCAUGGGAAU 1475-1493 423 NU UCCCAUGAAGAGGGGAG 772 CUCCCCUCUUCAUGGGAAN 1475-1493 424 NUUCCCAUGAAGAGGGGAN 773 NUCCCC U C U U C A UGGGAAN 1475-1493 425 AACCCUUCUUUAAUGUCAU 774 AU GACAU UAAAGAAGGGUU 1569-1587 426 UACCCUUCUUUAAUGUCAU 775 AUGACAUUAAAGAAGGGUA 1569-1587 427 N ACC CUUCUUUAAUGUCAU 776 AUGACAUUAAAGAAGGGUN 1569-1587 428 NACCCUUCUUUAAUGUCAN 777 NUGACAU UAAAGAAGGGUN 1569-1587 WO 2018 / 132432 PCT / US2018 / 013102 Table 3. Example A AT RM Ai Agent Antisense Strand and Sense Strand Base Sequences SEQ ID NO: Antisense Base Sequence (5' —> 3') SEQ ID NO: Sense Base Sequence (5' —> 3') 778 GGAACUUGGUGAUGAUAU 840 AUAUCAUCACCAAGUUCC 779 GAUCAUAGGUUCCAGUAA 841 UUACUGGAACCUAUGAUC 780 ACAGCCUUAUGCACGGCC 842 GGCCGUGCAUAAGGCUGU 781 UCGAUGGUCAGCACAGCC 843 GGCUGUGCUGACCAUCGA 782 CAAAGGGUUUGUUGAACU 844 AGUUCAAC AAACCCUUUG 783 TGGAACUUGGUGAUGAUAUTT 845 UAL’AUAUCAUCACCAAGUUCC AT 783 TGGAACUUGGUGAUGAUAUTT 846 AUAUCAUCACCAAGUUCCAT 784 TGGAACUUGGUGAUGAUAUCGUG 847 CGAUAUCAUCACCAAGUUCCA 785 ACUUGGUGAUGAUAUTT 848 U AUCAUCACCAAGU U CCAT 786 TGGAACTTGGTGATGATATTT 849 TATATATC ATC ACCAAGTTCCAT 787 UUUAAACAUGCCUAAACGCUU 850 GCGUUUAGGCAUGUUUAAAUU 788 UGCAUUGCCCAGGUAUUUCUU 851 GAAAUACCUGGGCAAUGCAUU 789 UGGAACUUGGUGAUGAUAUUU 852 AUAUCAUCACC AAGUUC CAUU 790 UGAUCAUAGGUUCCAGUAAUU 853 UUACUGGAACCUAUGAUCAUU 791 UACAGCCUUAUGCACGGCCUU 854 GGCCGUGCAUAAGGCUGUAUU 792 UUCGAUGGUCAGCACAGCCUU 855 GGCUGUGCUGACCAUCGAAUU 793 UCAAAGGGUUUGUUGAACUUU 856 AGUUCAACAAACCCUUUGAUU 794 UGUUAAACAUGCCUAAACGUU 857 CGUUUAGGCAUGUUUAACAUU 795 UUUAAACGUGC CUAAACGCUG 858 CAGCGUUUAGGCAUGUUUAAA 796 UGCAUUGCCCAGGUAUUUCAG 859 CUGAAAUACCUGGGCAAUGCA 797 UGGAACUUGGUGAUGAUAUCG 847 CGAUAUCAUCACCAAGUUCCA 798 UGAUCAUAGGUUC CAGUAAUG 860 CAUUACUGGAACC UAUGAUCA 791 UACAGCCUUAUGCACGGCCUU 861 AAGGCCGUGCAUAAGGCUGUA 792 UUCGAUGGUCAGCACAGCCUU 862 AAGGCUGUGCUGACCAUCGAA 799 UCAAAGGGUUUGUUGAACUUG 863 CAAGUUCAACAAACCCUUUGA 800 UGUUAAACAUGCCUAAACGCG 864 CGCGUUUAGGCAUGUUUAACA 801 UGUUAAACAUGCCUAAACGCU 857 CGUUUAGGCAUGUUUAACAUU WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5' —> 3') 794 UGUUAAACAUGCCUAAACGUU 801 UGUUAAACAUGCCUAAACGCU 794 UGUUAAACAUGCCUAAACGUU 801 UGUUAAACAUGCCUAAACGCU 802 UGUUAAACAUGCCUAAACGCUUC 803 UGCUGUUGGACUGGUGUGCUU 804 UGCUGUUGGACUGGUGUGCCA 804 UGCUGUUGGACUGGUGUGCCA 803 UGCUGUUGGACUGGUGUGCUU 805 UGCUGUUGGACUGGUGUGCCAUU 806 UGCUGUUGGACUGGUGUGCCAGC 807 UAAGGCUUCUGAGUGGUACUU 808 UAAGGCUUCUGAGUGGUACAA 808 UAAGGCUUCUGAGUGGUACAA 809 UAAGGCUUCUGAGUGGUACAACU 810 GAAGGCUUCUGAGUGGUACUU 811 AAGACAAAGGGUUUGUUGAUU 812 AAGACAAAGGGUUUGUUGAAC 812 AAGACAAAGGGUUUGUUGAAC 813 UAGACAAAGGGUUUGUUGAAC 814 AAGACAAAGGGUUUGUUGAACUU 815 UAGACAUGGGUAUGGCCUCUU 816 UAGACAUGGGUAUGGCCUCUA 816 UAGACAUGGGUAUGGCCUCUA 817 UAGACAUGGGUAUGGCCUCUAAA 818 UAGACAUGGGUAUGGCCUCUAUU 819 UUUGAUCUGUUUCUUGGCCUU 820 UUUGAUCUGUUUCUUGGCCUC 820 UUUGAUCUGUUUCUUGGCCUC SEQ ID NO: Sense Base Sequence (5' 3T) 1265 CGUUUAGGCAUGUUUAACA 1265 CGUUUAGGCAUGUUUAACA 865 AACGUUUAGGCAUGUUUAACA 866 AGCGUUUAGGCAUGUUUAACA 866 AGCGUUUAGGCAUGUUUAACA 1266 GCACACCAGUCCAACAGCA 1266 GCACACCAGUCCAACAGCA 867 UGGCACACCAGUCCAACAGCA 868 AAGCACACCAGUCCAACAGCA 867 UGGCACACCAGUCCAACAGCA 867 UGGCACACCAGUCCAACAGCA 1267 GUACCACUCAGAAGCCUUA 1267 GUACCACUCAGAAGCCUUA 869 UUGUACCACUCAGAAGCCUUA 869 UUGUACCACUCAGAAGCCUUA 1268 GUACCACUCAGAAGCCUUC 1269 UCAACAAACCCUUUGUCUU 1269 UCAACAAACCCUUUGUCUU 870 GUUCAACAAACCCUUUGUCUU 871 GUUCAACAAACCCUUUGUCUA 870 GUUCAACAAACCCUUUGUCUU 1270 GAGGCCAUACCCAUGUCUA 1270 GAGGCCAUACCCAUGUCUA 872 UAGAGGCCAUACCCAUGUCUA 872 UAGAGGCCAUACCCAUGUCUA 872 UAGAGGCCAUACCCAUGUCUA 1271 GGCCAAGAAACAGAUCAAA 1271 GGCCAAGAAACAGAUCAAA 873 GAGGCCAAGAAACAGAUCAAA WO 2018 / 132432 PCT / US2018 / 013102 SEQ ID NO: Antisense Base Sequence (5' —> 3') 821 UUUGAUCUGUUUCUUGGCCUCUU 822 UGUUGGACUGGUGUGCCAGUU 823 UGUUGGACUGGUGUGCCAGCU 824 UGUUGGACUGGUGUGCCAGCUGG 825 UGUUGGACUGGUGUGCCAGCUG 826 AAAGGGUUUGUUGAACUUGUU 827 AAAGGGUUUGUUGAACUUGAC 828 UAAGGGUUUGUUGAACUUGACCU 829 UAAGGGUUUGUUGAACUUGAC 830 UAUUGGUGCUGUUGGACUGUU 831 UAUUGGUGCUGUUGGACUGGU 832 UAUUGGUGCUGUUGGACUGGUU 833 UUGUUGGACUGGUGUGCCAG 834 UUGUUGGACUGGUGUGCCAGCU 835 UAUAGACAUGGGUAUGGCCUC 835 UAUAGACAUGGGUAUGGCCUC 836 UCAAAGGGUUUGUUGAACUUGAC 836 UCAAAGGGUUUGUUGAACUUGAC 837 UUAUUGGUGCUGUUGGACUGG 838 UGUUAAACAUGCCUAAACGC 839 UGUUAAACAUGCCUAAACGCUU 839 UGUUAAACAUGCCUAAACGCUU 800 UGUUAAACAUGCCUAAACGCG 801 UGUUAAACAUGCCUAAACGCU 838 UGUUAAACAUGCCUAAACGC SEQ ID NO: Sense Base Sequence (5' 3T) 873 GAGGCCAAGAAACAGAUCAAA 1272 CUGGCACACCAGUCCAACA 874 AGCUGGCACACCAGUCCAACA 874 AGCUGGCACACCAGUCCAACA 875 GCUGGCACACCAGUCCAACA 1273 CAAGUUCAACAAACCCUUU 876 GUCAAGUUCAACAAACCCUUU 877 GUCAAGUUCAACAAACCCUUA 877 GUCAAGUUCAACAAACCCUUA 1274 CAGUCCAACAGCACCAAUA 878 ACCAGUCCAACAGCACCAAUA 879 CCAGUCCAACAGCACCAAUA 880 CUGGCACACCAGUCCAACAA 880 CUGGCACACCAGUCCAACAA 1275 GGCCAUACCCAUGUCUAUA 881 GAGGCCAUACCCAUGUCUAUA 882 GUCAAGUUCAACAAACCCUUUGA 863 CAAGUUCAACAAACCCUUUGA 883 CCAGUCCAACAGCACCAAUAA 884 GCGUUUAGGCAUGUUUAACA 884 GCGUUUAGGCAUGUUUAACA 885 GCGUUUAGGCAUGUUUAACAUU 886 CGCGUUUAGGCAUGUUUAACAUU 887 AGCGUUUAGGCAUGUUUAACAUU 885 GCGUUUAGGCAUGUUUAACAUU WO 2018 / 132432 PCT / US2018 / 013102 2024203661 31 May 2024 The AAT RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 or Table 3 can be modified nucleotides or unmodified nucleotides. In some embodiments, the AAT RNAi agents having the sense and antisense strand sequences that comprise or consist of any of the nucleotide sequences in Table 2 or Table 3 are all or substantially all modified nucleotides. In some embodiments, the antisense strand of an AAT RNAi agent disclosed herein differs by 0, I, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an AAT RNAi agent disclosed herein differs by 0, I, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 3. As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to theN nucleotide at the corresponding position on the oilier strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand. Certain modified AAT RNAi agent sense and antisense strands are provided in Table 4 and Table 5. Modified AAT RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 4. Modified AAT RNAi agent sense strands, as well as their underly ing unmodified sequences, are provided in Table 5. In forming AAT RNAi agents, each of the nucleotides in each of the unmodified sequences listed in Tables 4 and 5, as well as in Table 2 and Table 3, above, can be a modified nucleotide. The AAT RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 3, or Table 5, can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3, or Table 4, provided the two sequences have a region of at least 85% complementarity’ over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. WO 2018 / 132432 PCT / US2018 / 013102 58 2024203661 31 May 2024 In some embodiments, an AAT RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 4. In some embodiments, an AAT RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2 or Table 3. Examples of antisense strands containing modified nucleotides are provided in Table 4. Examples of sense strands containing modified nucleotides are provided in Table 5. As used in Tables 4 and 5, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups. As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence, that when present in an oligonucleotide, the monomers are mutually linked by 5’-3’-phosphodiester bonds: A C G U = ad enosine-3'-phosphate; = cytidine-3'-phosphate; = guanosine-3'-phosphate; = uridine-3'-phosphate n = any 2'-OMe modified nucleotide a = 2'-O-methyladenosine-3'-phosphaie as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosph orothioate g gs t ts = 2'-O-methylguanosine-3'-phosphate = 2'-O-methylguanosine-3'-phosphorolhioate = 2'-O-methyl-5-methyluridine-3'-phosphate = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate US Nf Af Afs Cf Cfs Gf Gfs = 2'-O-methyluridine-3'-phosphorothioale = any 2'-fluoro modified nucleotide = 2'-fluoroadenosine-3'-phosphate = 2'-fluoroadenosine-3 '-phosporothioate = 2'-fluorocytidine-3'-phosphate = 2'-fluorocytidine-3'-phosphorothioate = 2'-fluoroguanosine-3'-phosphate = 2'-fluoroguanosine-3'-phosphorothioate 2024203661 31 May 2024 Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3 '-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate 5 dN = any 2'-deoxyribonucleotide dT = 2'-deoxythymidine-3’-phosphate Nuka = 2\3'-seco nucleotide mimics (unlocked nucleobase analogs)-3'-Phosphate Nunas 10 = 2',3'-seco nucleotide mimics (unlocked nucleobase analogs)-3'-phosphorothioate UlJNA = 2'.3'-seco-uridine-3'-phosphate UUNAS = 2',3'-seco-uridine-3'-phosphorothioate a_2N = see Table 7 a_2Ns = see Table 7 15 pu_2N = see Table 7 pu_2Ns = see Table 7 Npu = see Table 7 Nus = see Table 7 Nlna = locked nucleotide 20 NIama = 2'-F-Arabino nucleotide NM = 2-methoxyethyl nucleotide AM = 2-methoxy ethy 1 adenosi ne-3 '-phosphate AMs = 2'-methoxyelhyladenosine-3'-phosphorothioate TM = 2'- meth oxy ethy 1 thy midine-3'-phosphate 25 TMs = 2'- meth oxy ethy 1 thy mi d i n e- 3' -ph osph o roth i o ate R = ribitol (invdN) = any inverted deoxyribonucleotide (3'-3' linked nucleotide) (invAb) = inverted (3'-3' linked) abasic deoxyribonucleotide, see Table 7 (invAb)s 30 = inverted (3'-3' linked) abasic deoxyribonucleotide-5'-phosphorothioate, see Table 7 (invn) = any inverted 2'-OMe nucleotide (3'-3' linked nucleotide) s = phosphorothioate linkage vpdN = vinyl phosphonate deoxyribonucleotide (5Me-N0 = 5’-Me, 2’-fluoro nucleotide 35 cPrp = cyclopropyl phosphonate, see Table 7 epTcPr = see Table 7 epTM = see Table 7 (Chol-TEG) = see Table 7 (TEG-Biotin) = see Table 7 40 (PEG-C3-SS) = see Table 7 (Alk-SS-C6) = see Table 7 2024203661 31 May 2024 (C6-SS-Alk) = see Table 7 (C6-SS-Alk-Me) = see Table 7 The person or ordinary skill in the art would readily understand that the terminal nucleotide al 5 the 3' end of a given oligonucleotide sequence would typically have a hy droxyl (-OH) group al the respective 3’ position of the given monomer instead of a phosphate moiety ex vivo. Unless expressly indicated otherwise herein, such understandings of the person of ordinary7 skill in the art are used when describing the AAT RNAi agents and compositions of AAT RNAi agents disclosed herein. 10 Targeting groups and linking groups include the following, for which their chemical structures are provided below in Table 7: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), 15 (NAG32)s, (NAG33), (NAG33)s, (NAG34). (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and / or antisense strand can have any targering groups or linking groups listed above, as well as other targeting or linking groups, conjugated to the 5' and / or 3' end of the sequence. Table 4. AAT RNAi Agent Antisense Strand Sequences Antisense Strand ID: SEQ ID NO. Antisense Sequence (Modified) (5' - 3’) SEQ ID NO. Underlying Base Sequence (S' - 3') AM00516-AS 888 d' 1 ’GfgAfaCfUUNA U fgGfuGfaU fg AfuAfud' Is d 1 783 TGGAACUUGGUGAUGAUAUTT AM02129-AS 889 dTsGfsgAfaCfUUNAUfgGfuGfaUfgAfuAfudTsdT 783 TGGAACUUGGUGAUGAUAUTT AM02130-AS 890 dTsGfsgAfaCfUuNAUfgGfuGfaUfgAfuAfuCfgsusg 784 TGGAACUUGGUGAUGAUAUCGUG AM04786-AS 891 aCfUUNAUfgGfuGfaUfgAfuAfudTsdT 785 ACUUGGUGAUGAUAUTT AM05303-AS 892 dTdGdGdAdAdCdTdTdGdGdTdGdAdTdGdAdTdA dTdTsdT 786 TGGAACTTGGTGATGATATTT AM05643-AS 893 usUfsusAfaAfcAfUfGfcCfuAfaAfcGfcusu 787 UUUAAACAUGCCUAAACGCUU AM05645-AS 894 usGfscsAfuUfgCfCfCfaGfgUfaUfuUfcusu 788 UGCAUUGCCCAGGUAUUUCUU AM05647-AS 895 usGfsgsAfaCfuUfGfGfuGfaUfgAfuAfuusu 789 UGGAACUUGGUGAUGAUAUUU AM05649-AS 896 usGfsasUfcAfuAfGIGfuucCfaGfuAfausu 790 UGAUCAUAGGUUCCAGUAAUU AM05651-AS 897 usAfscsAfgCfcUfUfAfuGfcAfcGfgCfcusu 791 UACAGCCUUAUGCACGGCCUU AM05653-AS 898 usUfscsGfaUfgGfUfCfaGfcAfcAfgCfcusu 792 UUCGAUGGUCAGCACAGCCUU AM05655-AS 899 usCfsasAfaGfgGfUfUfuGfuUfgAfaCfuusu 793 UCAAAGGGUUUGUUGAACUUU AM05657-AS 900 usGfsusUfaAfaCfAfUfgCfcUfaAfaCfgusu 794 UGUUAAACAUGCCUAAACGUU AM05659-AS 901 usUfuAfaAfcgugcCfuAfaAfcGfcsUfsg 795 UUUAAACGUGCCUAAACGCUG AM05661-AS 902 usGfscAfuUfgcccaGfgUfaUfuUfcsAfsg 796 UGCAUUGCCCAGGUAUUUCAG AM05663-AS 903 usGfsgAfaCfuugguGfaUfgAfuAfusCfsg 797 UGGAACUUGGUGAUGAUAUCG AM05665-AS 904 usGfsaUfcAfuagguUfcCfaGfuArasUfsg 798 UGAUCAUAGGUUCCAGUAAUG AM05667-AS 905 usAfscAfgCfcuuauGfcAfcGfgCfcsUfsu 791 UAC AGCCUUAUGCACGGCCUU AM05669-AS 906 usUfscGfaUfggucaGfcAfcAfgCfcsUfsu 792 UUCGAUGGUCAGCACAGCCUU AM05671-AS 907 usCfsaAfaGfgguuuGfuUfgAfaCfusUfsg 799 UC AAAGGGUl JI JGUUGA ACUUG AM05673-AS 908 usGfsuUfaAfacaugCfcUfaAfaCfgsCfsg 800 UGUUAAACAUGCCUAAACGCG AM05677-AS 909 usUfsuAfaAfcgugcCfuAfaAfcGfcsUfsg 795 UUUAAACGUGCCUAAACGCUG AM05884-AS 910 vpusGfsusUfaAfaCfAfUfgCfcUfaAfaCfgusu 794 UGUUAAACAUGCCUAAACGUU WO 2018 / 132432 PCT / US2018 / 013102 Antisense Strand ID: SEQ ID NO. Antisense Sequence (Modified) (5' 3’) SEQ ID NO. Underlying Base Sequence (5' - 3') AM05885-AS 911 cPrpusGfsusUfaAfaCfAfUfgCfcUfaAfaCfgusu 794 UGUUAAACAUGCCUAAACGUU AM05886-AS 912 usGfsusUfaAfaCfAfUfgCfcUfaAfaCfgcsu 801 UGUUAAACAUGCCUAAACGCU AM 05 8 8 7-AS 913 usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu 794 UGUUAAACAUGCCUAAACGUU AM05888-AS 914 usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcsu 801 UGUUAAACAUGCCUAAACGCU AM05889-AS 915 usGfsusUfaAfaCfAfUfgCfcUfaAfaCfgCfsu 801 UGUUAAACAUGCCUAAACGCU AMO589O-AS 916 usGfsusUfaAfaCfAfUfgCfcUfaAfaCfgCfuusc 802 UGUUAAAC AUGC CUAAACGCUUC AM05891-AS 917 usGfsusU:faAfaC faU:fgCfcU faAfaC fgC fs u 801 UGUUAAACAUGCCUAAACGCU AM05892-AS 918 usGfsusUfaAfaCfaUfgCfcUfaAfaCfgCfuusc 802 UGUUAAACAUGCCUAAACGCUUC AM05900-AS 919 cPrpusGfsuUfaAfacaugCfcUfaAfaCfgsCfsg 800 UGUUAAACAUGCCUAAACGCG AM05901-AS 920 usGfsgsAfaCfUUNAUfGfGfuGfaUfgAfuAfuusu 789 UGGAACUUGGUGAUGAUAUUU AM05954-AS 921 usGfscsUfgUfuggacUfgGfuGfuGfcusu 803 UGCUGUUGGACUGGUGUGCUU AM05955-AS 922 usGfscsUfgUfuggacUfgGfuGfuGfccsa 804 UGCUGUUGGACUGGUGUGCCA AM05956-AS 923 usGfscsUfgUfuggacUfgGfuGfuGfccausu 805 UGCUGUUGGACUGGUGUGCCAUU AM05957-AS 924 usGfscsUfgUfuggacUfgGfuGfuGfccagsc 806 UGCUGUUGGACUGGUGUGCCAGC AM05961-AS 925 usAfsasGfgCfuUfcUfgAfgUfgGfuAfcusu 807 UAAGGCUUCUGAGUGGUACUU AM05962-AS 926 usAfsasGfgCfuUfcUfgAfgUfgGfuAfcasa 808 UAAGGCUUCUGAGUGGUACAA AM05963-AS 927 usAfsasGfgCfuUfcUfgAfgUfgGfuAfcaacsu 809 UAAGGCUUCUGAGUGGUACAACU AM05964-AS 928 gsAfsasGfgCfuUfcUfgAfgUfgGfuAfcusu 810 GAAGGCUUCUGAGUGGUACUU AM05969-AS 929 asAfsgs Afc AfaAfgGfgUfuUfgUfuGfaus u 811 AAGACAAAGGGUUUGUUGAUU AM05970-AS 930 asAfsgsAfcAfaAfgGfgUfuUfgUfuGfaasc 812 AAGACAAAGGGUUUGUUGAAC AM05973-AS 931 usAfsgsAfcAfaAfgGfgUfuUfgUfuGfaasc 813 UAGACAAAGGGUUUGUUGAAC AM05974-AS 932 asAfsgsAfcAlaAfgGfgUfuUfgUfuGfaacusu 814 AAGACAAAGGGUUUGUUGAACUU AM05976-AS 933 usAfsgsAfcAfuGfgGfuAfuGfgCfcUfcusu 815 UAGACAUGGGUAUGGCCUCUU AM05977-AS 934 usAfsgsAfcAfuGfgGfuAfuGfgCfcUfcusa 816 UAGACAUGGGUAUGGCCUCUA AM05979-AS 935 usAfsgsAfcAfuGfgGfuAfuGfgCfcUfcuaasa 817 UAGACAUGGGUAUGGCCUCUAAA AM05980-AS 936 usAfsgsAfcAfuGfgGfuAfuGfgCfcUfcuausu 818 UAGACAUGGGUAUGGCCUCUAUU WO 2018 / 132432 PCT / US2018 / 013102 Antisense Strand ID: SEQ ID NO. Antisense Sequence (Modified) (5' 3’) SEQ ID NO. Underlying Base Sequence (5' - 3') AM05982-AS 937 us UfsusGfaUfcUfgUfuUfcUfuGfgCfcusu 819 UUUGAUCUGUUUCUUGGCCUU AM05983-AS 938 usUfsusGfaUfcUfgUfuUfcUfuGfgCfcusc 820 UUUGAUCUGUUUCUUGGCCUC AM 0598 5-AS 939 usUfsusGfaUfcUfgUfuUfcUfuGfgCfcucusu 821 UUUGAUCUGUUUCUUGGCCUCUU AM05987-AS 940 usGfsusUfgGfacuggUfgUfgCfcAfgusu 822 UGUUGGACUGGUGUGCCAGUU AM05989-AS 941 usGfsusUfgGfacuggUfgUfgCfcAfgcsu 823 UGUUGGACUGGUGUGCCAGCU AM05990-AS 942 usGfsusUfgGfacuggUfgUfgCfcAfgcugsg 824 UGUUGGACUGGUGUGCCAGCUGG AM05992-AS 943 usGfsusUfgGfacuggUfgUfgCfcAfgcusg 825 UGUUGGACUGGUGUGC C AGCUG AM05994-AS 944 asAfsasGfgGfuUfuGfuUfgAfaCfuUfgusu 826 AAAGGGUUUGUUGAACUUGUU AM05996-AS 945 asAfsasGfgGfuUfuGfuUfgAfaCfuUfgasc 827 AAAGGGUUUGUUGAACUUGAC AM05998-AS 946 usAfsasGfgGfuUfuGfuUfgAfaCfuUfgaccsu 828 UAAGGGUUUGUUGAACUUGACCU AM05999-AS 947 usAfsasGfgGfuUfuGfuUfgAfaCfuUfgasc 829 UAAGGGUUUGUUGAACUUGAC AM06124-AS 948 usAfsusUfgGfuGfcUfgUfuGfgAfcUfgusu 830 UAUUGGUGCUGUUGGACUGUU AM06125-AS 949 usAfsusUfgGfuGfcUfgUfuGfgAfcUfggsu 831 UAUUGGUGCUGUUGGACUGGU AM06126-AS 950 usAfsusUfgGfuGfcUfgUfuGfgAfcUfggusu 832 UAUU GGU GC UGU UGGACU GGU U AM06130-AS 951 us U fsgs U fuGfgacugGfuGfuGfcC fasg 833 UUGUUGGACUGGUGUGCCAG AM06131-AS 952 usUfsgsUfuGfgacugGfuGfuGfcCfagcsu 834 UUGUUGGACUGGUGUGCCAGCU AM06133-AS 953 usAfsusAfgAfcAfuGfgGfuAfuGfgCfcusc 835 UAUAGACAUGGGUAUGGCCUC AM06134-AS 954 usAfsusAfgAfcauggGfuAfuGfgCfcusc 835 UAUAGACAUGGGUAUGGCCUC AM06137-AS 955 usCfsasAfaGfgGfuUfuGfuUfgAfaCfuugasc 836 UCAAAGGGUUUGUUGAACUUGAC AM06140-AS 956 usUfsasUfuGfgugcuGfuUfgGfaCfugsg 837 UUAUUGGUGC UGU UGGACUGG AM06227-AS 957 usGfsusUfaAfaCfaUfgCfcUfaAfaCfgsc 838 UGUUAAACAUGCC UAAACGC AM06228-AS 958 usGfsusUfaAfaCfaUfgCfcUIaAfaCfgcusu 839 UGUUAAACAUGC CUAAACGCUU AM06234-AS 959 usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg 800 UGUUAAACAUGCCUAAACGCG AM06235-AS 960 usGfsuUfaAfacaugCfcUfaAfaCfgCfsu 801 UGUUAAACAUGCCUAAACGCU AM06237-AS 961 usGfsuUfaAfaCfAfUfgCfcUfaAfaCfgsCfsg 800 UGUUAAACAUGCCUAAACGCG AM06238-AS 962 NpusGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu 794 UGUUAAACAUGCCUAAACGUU WO 2018 / 132432 PCT / US2018 / 013102 Antisense Strand ID: SEQ ID NO. Antisense Sequence (Modified) (5' 3’) SEQ ID NO. Underlying Base Sequence (5' - 3') AM06261-AS 963 NusGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu 794 UGUUAAACAUGCCUAAACGUU Table 5. AAT RNAi Agent Sense Strand Sequences Sense Strand SEQ Sense Sequence (Modified) ID: ID NO. (5* —3') SEQ Underlying Base Sequence ID (5’ -> 3') NO. AMO 1887 SS 964 fChol’TEG) uAuAfuAfuCfaUfcAfcCfaAfgUfuCfcAf(invdT)(TEG-Biotin) „., UAUAUAUCAUCACCAAGUUCCAT 845 . a ™ । o oo c c (Chol-TEG)uAu AfuAfuCfaUfcAfcCfaAfgUfuCfcAf( invdT)(P EG- AJMU1 ooo-SS yoj SS) UAUAUAUCAUCACCAAGUUCCAT AM01855-SS 966 (Alk-SS-C6)AfuAfuCfaUfcAfcCfaAfgUfuCfcAf(invdT) 846 AUAUCAUCACCAAGUUCCAT AM02132-SS 967 CfsgsAfuAfuCfalJfcAfcCfaAfgUfuC fcAf(C6-S S - Al k) 847 CGAUAUCAUCACCAAGUUCCA AM02390-SS 968 CfsgsAfuAfuCfaUfcAfcCfaAfgUfuCfcAf(C6-SS-Alk-Me) 847 CGAUAUCAUCACCAAGUUCCA AM04785-SS 969 uAfuCfaUfcAfcCfaAfgUfuCfcAfGnvdT) 848 UAUCAUCACCAAGUUCCAT (Chol- AM05304-SS 970 TEG)dTdAdTdAdTdAdTdCdAdTdCdAdCdCdAdAdGdTdTdCdCsd A(invdT)(TEG-Biotin) T ATATATC ATC A CC AAGTTC CAT 849 (Chol- AM05599-SS 971 TEG)dTdAdTdAdTdAdTdCdAdTdCdAdCdCdAdAdGdTdTdCdCsd A(invdT) TATATATC ATC A CCAAGTTCCAT 849 AM05642-SS 972 (N AG25)(invAb)GfcGfuUfuAfGfGfcAfuGfuUfiiAfaausu(invAb) 850 GCGUUUAGGCAUGUUUAAAUU AM05644-SS 973 (NAG25)(invAb)GfaAfaUfaClCfUfgGfgCfaAfuGfcausu(invAb) 851 GAAAUACCUGGGCAAUGCAUU AM05646-SS 974 (NAG25)(invAb)AfuAfuCfaUlCfAfcCfaAfgUfuCfcausu(invAb) 852 AUAUCAUCACCAAGUUCCAUU AM05648-SS 975 (NAG25)(invAb)UfuAfcUfgGfAfAfcCfuAfuGfaUfcausu(invAb) 853 UUACUGGAACCUAUGAUCAUU AM05650-SS 976 (NAG25)(invAb)GfgCfcGfuGlCfAfuAfaGfgCfuGfuausu(invAb) 854 GGCCGUGCAUAAGGCUGUAUU AM05652-S S 977 (NAG25 )(in vAb)GfgCfuGfuGiCfUfgAfcCfaUfcGfaaus u( inv Ab) 855 GGCUGUGCUGACCAUCGAAUU WO 2018 / 132432 PCT / US2018 / 013102 Sense Strand ID: SEQ ID NO. Sense Sequence (Modified) (5’-3') SEQ ID NO. Underlying Base Sequence (5’ - 3*) AM05654-SS 978 (NAG25)(invAb)AfgUfuCfaAlCfAfaAfcCfcUfuUfgausu(invAb) 856 AGUUCAACAAACCCUUUGAUU AM05656-SS 979 (NAG25)(mvAb)CfgUfuUfaGfGfCfaUfgUfuUfaAfcausu(invAb) 857 CGUUUAGGCAUGUUUAACAUU AM05658-SS 980 (NAG25)scsagcguuuAfGfGfcauguuuaasa(invAb) 858 CAGCGUUUAGGCAUGUUUAAA AM05660-SS 981 (NAG25)scsugaaauaCrcnjfgggcaaugcsa(invAb) 859 CUGAAAUACCUGGGCAAUGCA AM05662-SS 982 (NAG25)scsgauaucaUfCfAfccaaguuccsa(invAb) 847 CGAUAUCAUCACCAAG UUCCA AM05664-SS 983 (NAG25)scsauuacugGfA£Afccuaugaucsa(invAb) 860 CAUUACUGGAACCUAUGAUCA AM05666-SS 984 (NAG25)sasaggccguGfCfAfuaaggcugusa(invAb) 861 AAGGCCGUGCAUAAGGCUGUA AM05668-SS 985 (NAG25)sasaggcuguGlCflJfgaccaucgasa(invAb) 862 AAGGCUGUGCUGACCAUCGAA AM05670-SS 986 (NAG25)scsaaguucaAfCfAfaacccuuugsa(mvAb) 863 CAAGUUCAACAAACCCUUUGA AM05672-SS 987 (N AG25)scsgcguuuaGfGfCfauguuuaacsa(invAb) 864 CGCGUUUAGGCAUGUUUAACA AM05658-SS 988 (NAG25)scsagcguuuAfGfGfcaugiiuuaasa(invAb) 858 CAGCGU UUAGGCAU GU U UAAA AM05893-SS 989 (NAG25)s(invAb)scguuuaGfGfCfauguuuaacausu(mvAb) 857 CGUUUAGGCAUGUUUAACAUU AM05894-SS 990 (NAG25)s(invAb)sCfgUfuUfaGIGfCfaUfgUfuUfaAfcas(invAb) 429 C GUUUAGGCAUGU U U AACA AM05895-SS 991 (NAG25)s(invAb)scguuuaGfGfCfauguuuaacas(invAb) 429 C GU U UA GGC AU GU U U A ACA AM05896-SS 992 (NAG25 )s (inv Ab)saaCfgUfuUfaGfGfCfaUfgUluUfaAfcas( inv Ab) 865 AACGUU UAGGCAUGUUUAACA AM05897-SS 993 (NAG25)s(invAb)sagCfgUfuUfaGfGICfaUfgUfuUfaAfcas(invAb) 866 AGC GU U U AGGC A U GU U U A At: A AM05898-SS 994 (NAG25)s(invAb)saacguuuaGfGfCfauguuuaacas(invAb) 865 AACGUUUAGGCAUGUUUAACA AM05899-SS 995 (NAG25)s(invAb)sagcguuuaGIGfCfauguuuaacas(invAb) 866 AGCGUUUAGGCAUGUUUAACA AM05958-SS 996 (NAG37)s(invAb)sgcacacCfAfGfuccaacagcas(invAb) 454 GCACACCAGUCCAACAGCA AM05959-SS 997 (NAG37)s(invAb)suggcacacCfAfGfuccaacagcas(invAb) 867 U GGC AC ACC A GU CC A AC AGC A AM05960-SS 998 (NAG37)s(invAb)saagcacacCfAfGfuccaacagcas(invAb) 868 AAGCACACCAGUCCAACAGCA AM05965-SS 999 (NAG37)s(invAb)sguaccaCfUfCfagaagccuuas(invAb) 519 GUACCACUCAGAAGCCUUA AM05966-SS 1000 (NAG37)s(invAb)suuguaccaCfUfCfagaagccuuas(invAb) 869 UUGUACCACUCAGAAGCCUUA AM05967-SS 1001 (NAG37)s(invAb)sguaccaCfUfCfagaagccuucs(invAb) 518 GUAC CAC U CAGAAGCCUUC AM05968-SS 1002 (NAG37)s(invAb)sucaacaAfAfCfccuuugucuus(invAb) 738 UCAACAAACCCUUUGUCUU WO 2018 / 132432 PCT / US2018 / 013102 Sense Strand ID: SEQ ID NO. Sense Sequence (Modified) (5’-3') SEQ ID NO. Underlying Base Sequence (5’ - 3*) AM05971-SS 1003 (NAG37)s(invAb)sguucaacaAfAfCfccuuugucuus(invAb) 870 GUUCAACAAACCCUUUGUCUU AM05972-SS 1004 (NAG37)s(invAb)sguucaacaAfAfCfccuuugucuas(invAb) 871 GUUCAACAAACCCUUUGUCUA AM05975-SS 1005 (NAG37)s(invAb)sgaggccAfUfAfcccaugucuas(invAb) 707 GAGGCCAUACCCAUGUCUA AM05978-SS 1006 (NAG37)s(invAb)suagaggccAfUfAfcccaugucuas(invAb) 872 UAGAGGCCAUACCCAUGUCUA AM05981-SS 1007 (NAG37)s(invAb)sggccaaGfA£Afacagaucaaas(invAb) 537 GGC CAAGAAACAGAUCAAA AM05984-SS 1008 (NAG37)s(invAb)sgaggccaaGfAfAfacagaucaaas(invAb) 873 GAGGCCAAGAAACAGAUCAAA AM05986-SS 1009 (NAG37)s(invAb)scuggcaCfAfCfcaguccaacas(invAb) 445 CUGGCACACCAGUCCAACA AM05988-SS 1010 (NAG37)s(mvAb)sagcuggcaCfAICfcaguccaacas(invAb) 874 AGCUGGCACACCAGUCCAACA AM05991-SS 1011 (NAG37)s(invAb)sgcuggcaCfAfCfcaguccaacas(invAb) 875 GCUGGCACACCAGUCCAACA AM05993-SS 1012 (NAG37)s(invAb)scaaguuCfAfAfcaaacccuuus(invAb) 725 CAAGUUCAACAAACCCUUU AM05995-SS 1013 (NAG37)s(invAb)sgucaaguuCfAfAfcaaacccuuus(invAb) 876 GUCAAGUUCAACAAACCCUUU AM05997-SS 1014 (NAG37)s(invAb)sgucaaguuCfAlAfcaaacccuuas(mvAb) 877 GUCAAGUUCAACAAACCCUUA AM06127-SS 1015 (NAG37)s(invAb)scaguccAfAfCfagcaccaauas(invAb) 458 CAGUCCAACAGCACCAAUA AM06128-SS 1016 (NAG37)s(invAb)saccaguccAfAfCfagcaccaauas(invAb) 878 ACCAGUCCAACAGCACCAAUA AM06129-SS 1017 (NAG37 )s (inv Ab)sccaguccAfAiCIagcaccaauas(inv Ab) 879 CCAGUCCAACAGCACCAAUA AM06132-SS 1018 (NAG37)s(invAb)scuggcacAfCfCfaguccaacaas(invAb) 880 CUGGCACAC CAGUCCAACAA AM06135-SS 1019 (NAG37)s(invAb)sggccauAfCfCfcaugucuauas(invAb) 712 GGCCAUACCCAUGUCUAUA AM06136-SS 1020 (NAG37)s(invAb)sgaggccauAfCfCfcaugucuauas(invAb) 881 GAGGCCAUACCCAUGUCUAUA AM06138-SS 1021 (NAG37)s(invAb)sgucaaguucaAfCfAfaacccuuugas(invAb) 882 GUCAAGUUCAACAAACCCUUUGA AM06139-SS 1022 (NAG37)s(invAb)scaaguucaAfCfAfaacccuuugas(invAb) 863 CAAGUUCAACAAACCCUUUGA AM06141-SS 1023 (NAG37)s(invAb)sccaguccaAfCfAfgcaccaauaas(invAb) 883 CCAGUCCAACAGCACCAAUAA AM06195-SS 1024 (NAG37)s(invAb)scgcguuuaGfGfCfauguuuaacas(invAb) 864 CGCGUUUAGGCAUGUUUAACA AM06223-SS 1025 (NAG37)s(invAb)scguuuaGfGfCfauguuuaacas(invAb) 429 C GU U U AGGC A U GU U U A AC A AM06224-SS 1026 (NAG37)s(invAb)scsgcguuuaGfGlUfauguuuaacsa(invAb) 864 CGCGUUUAGGCAUGUUUAACA AM06225-SS 1027 (NAG37)s(invAb)sagCfgUfuUfaGfGfCfaUfgUfuUfaAfcas(invAb) 866 AGCGUUUAGGCAUGUUUAACA WO 2018 / 132432 PCT / US2018 / 013102 Sense Strand SEQ Sense Sequence (Modified) ID: ID NO. (5*— 3’) SEQ Underlying Base Sequence ID (5’ -> 3') NO. AM06226-SS 1028 (NAG37)s(invAb)scguuuaGfGlCfauguuuaacausu(mvAb) 857 CGU U U AGGC AUGU U U AACA U U AM06229-SS 1029 (NAG37)s(mvAb)sgcguuuaGfGfCfauguuuaacas(invAb) 884 GCGUUUAGGCAUGUUUAACA AM06230-SS 1030 (NAG37)s(mvAb)sgcguuuaGfGfCfauguuuaacausu(invAb) 885 GCGUUUAGGCAUGUUUAACAUU AM06231-SS 1031 (NAG37)s(invAb)scgcguuuaGfGfCfauguuuaacsausu(invAb) 886 CGCGUUUAGGCAUGUUUAACAUU AM06232-SS 1032 (NAG37)s(mvAb)sagCfgUfuUfaGlGICfaUfgUfuUfaAfcausu(invAb) 887 AGCGUUUAGGCAUGUUUAACAUU AM06236-SS 1033 (NAG37)s(invAb)sagcguuuaGfGfCfauguuuaacas(invAb) 866 AGCGUUUAGGCAUGUUUAACA AM06239-SS 1034 (NAG37)s(invAb)scgcguuuaGfGfCfauguuuaacsas(mvAb) 864 CGCGUUUAGGCAUGUUUAACA WO 2018 / 132432 PCT / US2018 / 013102 2024203661 31 May 2024 The AAT RNAi agents described herein are formed by annealing an antisense strand with a sense strand, A sense strand containing a sequence listed in Table 2, Table 3, or Table 5 can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3, or Table 4, provided the two sequences have a region of at least 85% complementarity over a contiguous 5 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the antisense strand of an AAT RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 4. In some embodiments, the sense strand of an AAT RNAi agent disclosed herein differs by 0, 1., 2, or 3 10 nucleotides from any of the sense strand sequences in Table 5. In some embodiments, an AAT RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 4. In some embodiments, an AAT RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end -> 3' end) 1-17, 215 17, 1-18, 2-18, 1-19, 2-19,1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24, of any of the sequences in Table 2, Table 3, or Table 4. In certain embodiments, an AAT RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4. 20 In some embodiments, an AAT RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 5. In some embodiments, an AAT RNAi agent sense strand comprises the sequence of nucleotides (from 5' end 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21,4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of 25 the sequences in Table 2, Table 3, or Table 5. In certain embodiments, an AAT RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 5 For the AAT RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand 30 (from 5' end 3' end) can be perfectly complementary to an AAT gene, or can be non-complementary to an AAT gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end 3' end) is a U, A, or dT (or a modified version of U, A or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end 3' end) forms an A:U or U: A base pair with the sense strand. 2024203661 31 May 2024 In some embodiments, an AAT RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 4. In some embodiments, an AAT RNAi sense strand comprises the sequence of nucleotides (from 5' end -> 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 3, or Table 5. In some embodiments, an AAT RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 4, and (ii) a sense strand comprising the sequence of nucleotides (from 5' end -> 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2. Table 3, or Table 5. A sense strand containing a sequence listed in Table 2, Table 3, or Table 5 can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3, or Table 5, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18. 19, 20, or 21 nucleotide sequence. In some embodiments, the AAT RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 5, and an antisense strand consisting of tire modified sequence of any of the modified sequences in Table 4. Representative sequence pairings are exemplified by the Duplex ID Nos. shown in Table 6. In some embodiments, an AAT RNAi agent comprises any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an AAT RNAi agent consists of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an AAT RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an AAT RNAi agent includes the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos, presented herein and a targeting group and / or linking group, wherein the targeting group and / or linking group is covalently linked (i.e,, conjugated) to the sense strand or the antisense strand. In some embodiments, an AAT RNAi agent includes the sense strand and antisense strand modified nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an AAT RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the duplexes represented by any 2024203661 31 May 2024 of the Duplex ID Nos. presented herein and a targeting group and / or linking group, wherein the targeting group and / or linking group is covalently linked to the sense strand or the antisense strand. In some embodiments, an AAT RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 2, Table 3, or Table 6, and comprises an asialoglycoprotein receptor ligand targeting group. In some embodiments, an AAT RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group selected from the group consisting of (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. In some embodiments, the targeting group is (NAG25) or (NAG25)s as defined in Table 7. In other embodiments, the targeting group is (NAG37) or (NAG37)s as defined in Table 7. In some embodiments, an AAT RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense strand and'or sense strand nucleotide sequences of any of the duplexes of Table 6. In some embodiments, an AAT RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences of any of the duplexes of Table 6, and comprises an asialoglycoprotein receptor ligand targeting group. In some embodiments, an AAT RNAi agent comprises the duplex structure of any of the duplexes in Table 6. In some embodiments, an AAT RNAi agent consists of the duplex structure of any of the duplexes in Table 6. 2024203661 31 May 2024 Duplex ID Antisense Strand ID Sense Strand ID ADO 1131 AM00516-AS AM01887-SS AD01132 AM00516-AS AMO1888-SS ADO 1174 AM00516-AS AMO1855-SS ADO 1286 AM02129-AS AM01855-SS AD01287 AM02130-AS AMO2132-SS AD01442 AM02130-AS AM02390-SS AD03752 AM04786-AS AM04785-SS AD04156 AM05303-AS AM05304-SS AD04406 AM05303-AS AM05599-SS AD04444 AM05643-AS AM05642-SS AD04445 AM05645-AS AM05644-SS AD04446 AM05647-AS AM05646-SS AD04447 AM05649-AS AM05648-SS AD04448 AM05651-AS AM05650-SS AD04449 AM05653-AS AM05652-SS AD04450 AM05655-AS AM05654-SS AD04451 AM05657-AS AM05656-SS AD04452 AM05659-AS AMO5658-SS AD04453 AM05661-AS AM05660-SS AD04454 AM05663-AS AM05662-SS AD04455 AM05665-AS AM05664-SS AD04456 AM05667-AS AM05666-SS AD04457 AM05669-AS AM05668-SS AD04458 AM05671-AS AM05670-SS AD04459 AM05673-AS AM05672-SS AD04464 AM05677-AS AMO5658-SS AD04601 AM05884-AS AM05656-SS AD04602 AM05885-AS AMO5656-SS Table 6. AAT RNAi Agents Identified by Duplex ID No. with Corresponding Sense and Antisense Strands Duplex ID Antisense Strand ID Sense Strand ID AD04603 AM05886-AS AM05656-SS AD04604 AM05887-AS AM05893-SS AD04605 AM05888-AS AM05893-SS AD04606 AM05657-AS AM05894-SS AD04607 AM05886-AS AM05894-SS AD04608 AM05887-AS AM05895-SS AD04609 AM05888-AS AM05895-SS AD04610 AM05657-AS AM05896-SS AD04611 AM05889-AS AM05897-SS AD04612 AM05890-AS AM05897-SS AD04613 AM05887-AS AM05898-SS AD04614 AM05891-AS AM05899-SS AD04615 AM05892-AS AM05899-SS AD04616 AM05900-AS AM05672-SS AD04617 AM05901-AS AM05646-SS AD04652 AM05954-AS AM05958-SS AD04653 AM05955-AS AM05958-SS AD04654 AM05955-AS AM05959-SS AD04655 AM05954-AS AM05960-SS AD04656 AM05956-AS AM05959-SS AD04657 AM05957-AS AM05959-SS AD04658 AM05961-AS AM05965-SS AD04659 AM05962-AS AM05965-SS AD04660 AM05962-AS AM05966-SS AD04661 AM05963-AS AM05966-SS AD04662 AM05964-AS AM05967-SS AD04663 AM05969-AS AM05968-SS AD04664 AM05970-AS AM05968-SS 2024203661 31 May 2024 Duplex ID Antisense Strand ID Sense Strand ID AD04665 AM05970-AS AM05971-SS AD04666 AM05973-AS AM05972-SS AD04667 AM05974-AS AM05971-SS AD04668 AM05976-AS AM05975-SS AD04669 AM05977-AS AM05975-SS AD04670 AM05977-AS AM05978-SS AD04671 AM05979-AS AM05978-SS AD04672 AM05980-AS AM05978-SS AD04673 AM05982-AS AM05981-SS AD04674 AM05983-AS AM05981-SS AD04675 AM05983-AS AM05984-SS AD04676 AM05985-AS AM05984-SS AD04677 AM05987-AS AM05986-SS AD04678 AM05989-AS AM05988-SS AD04679 AM05990-AS AM05988-SS AD04680 AM05992-AS AM05991-SS AD04681 AM05994-AS AM05993-SS AD04682 AM05996-AS AM05995-SS AD04683 AM05998-AS AM05997-SS AD04684 AM05999-AS AM05997-SS AD04761 AM06124-AS AM06127-SS AD04762 AM06125-AS AM06128-SS AD04763 AM06126-AS AM06129-SS AD04764 AM06130-AS AM06132-SS AD04765 AM06131-AS AM06132-SS Duplex ID Antisense Strand ID Sense Strand ID AD04766 AM06133-AS AM06135-SS AD04767 AM06134-AS AM06136-SS AD04768 AM06137-AS AM06I38-SS AD04769 AM06137-AS AM06I39-SS AD04770 AM06140-AS AM0614I-SS AD04805 AM05673-AS AM06195-SS AD04824 AM05887-AS AM06223-SS AD04825 AM05900-AS AM06224-SS AD04826 AM05889-AS AM06225-SS AD04827 AM05888-AS AM06223-SS AD04828 AM05887-AS AM06226-SS AD04829 AM06227-AS AM06229-SS AD04830 AM06228-AS AM06229-SS AD04831 AM06228-AS AM06230-SS AD04832 AM05673-AS AM06231-SS AD04833 AM05889-AS AM06232-SS AD04834 AM06227-AS AM06230-SS AD04836 AM06234-AS AM06I95-SS AD04837 AM06235-AS AM06236-SS AD04838 AM06237-AS AM06239-SS AD04839 AM05673-AS AM06239-SS AD04840 AM06238-AS AM06223-SS AD04857 AM06261-AS AM06223-SS In some embodiments, an AAT RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. The RNAi agents described herein, upon delivery to a cell expressing an AAT 5 gene, inhibit or knockdown expression of one or more AAT genes in vivo. Targeting Groups, Linking Groups, and Delivery Vehicles 2024203661 31 May 2024 In some embodiments, an AAT RNAi agent is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, linking group, delivery polymer, or a deliver}- vehicle. The non-nucleotide group can enhance targeting, delivery’ or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 5 7. The non-nucleotide group can be covalently linked to the 3' and or 5' end of either the sense strand and / or the antisense strand. In some embodiments, an AAT RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5' end of an AAT RNAi agent sense strand. A non-nucleotide group can be linked directly or indirectly to the RNAi agent via a 10 linker, linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker. In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve 15 cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent. Targeting groups or targeting moieties can enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific 20 distribution and cell-specific uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody’ fragments, and antibody mimics with affinity to cell surface molecules. 25 In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which in some instances can sen e as linkers. In some embodiments, a targeting group comprises a galactose derivative cluster. 30 The AAT RNAi agents described herein can be synthesized having a reactive group, such as an amine group, at the 5'-terminus. The reactive group can be used to subsequently attach a targeting group using methods typical in the art. 2024203661 31 May 2024 In some embodiments, a targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, an asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor 5 that is equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-bulanoylgalaclos-amine (see for example: S.T. lobst and K. Drickamer, J.B.C., 1996, 271, 6686). Galactose derivatives, and clusters of galactose derivatives, that are useful for in vivo targeting of 10 oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chern., 257, 939-945). Galaclose derivatives have been used to target molecules to hepatocytes in vivo through 15 their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to the asialoglycoprotein receptor(s) facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative) or multimeric (e.g., having multiple galactose derivatives). The 20 galactose derivative or galactose derivative cluster can be attached to the 3' or 5' end of the sense or antisense strand of the RNAi agent using methods known in the art. The preparation of targeting groups, such as galactose derivative clusters, is described in, for example, U.S. Patent Application Serial No. 15'452,324 and U.S. Patent Publication No. US 2017 / 0253875, the contents of both of which are incorporated by reference herein in their 25 entirety. As used herein, a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is attached to a molecule through its C-l carbon. In some embodiments, the galactose derivative cluster is a galactose 30 derivative trimer (also referred to as tri-antennaiy galactose derivative or tri-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose 2024203661 31 May 2024 derivative tetramer (also referred to as tetra-antennary galactose derivative or tetra-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N -acetyl -gal actosami nes. 5 As used herein, a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be attached to the central branch point through the C-l carbons of the saccharides. In some embodiments, the galactose derivatives are linked to the branch point via linkers or 10 spacers. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Patent No. 5,885,968; Biessen et al. J. Med. Chern. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG? spacer. The branch point can be any small molecule which permits attachment of three galactose derivatives and further permits attachment of the branch point to the RNAi agent. An 15 example of branch point group is a di-lysine or di-glutamate. Attachment of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cy clic group. In some embodiments, a galaclose derivative comprises or consists of N-acetyl-galactosamine. In 20 some embodiments, the galactose derivative cluster is comprised of a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer. Embodiments of the present disclosure include pharmaceutical compositions for delivering an AAT RNAi agent to a liver cell in vivo. Such pharmaceutical compositions can include, 25 for example, an AAT RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer. 30 Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), 2024203661 31 May 2024 (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s as defined in Table 7. Other targeting groups, including galactose cluster targeting ligands, are known in the art. 5 In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group or delivery polymer or delivery vehicle. The linking group can be linked to the 3' or the 5' end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' or 3’ end 10 of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5' end of an RNAi agent sense strand. Examples of linking groups, can include, but are not limited to: reactive groups such a primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups. 15 A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage may optionally include a spacer that increases the distance between the two joined atoms. A spacer can further add flexibility 20 and / or length to the linkage. Spacers can include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description. 25 Any of the AAT RNAi agent nucleotide sequences listed in Tables 2, 3, 4, or 5, whether modified or unmodified, may contain 3' or 5' targeting groups or linking groups. Any of the AAT RNAi agent sequences listed in Tables 4 or 5 which contain a 3' or 5' targeting group or linking group, may alternatively contain no 3' or 5' targeting group or linking group, or 30 may contain a different 3' or 5' targeting group or linking group including, but not limited to, those depicted in Table 7. Any of the AAT RNAi agent duplexes listed in Table 2, Table 3, or Table 6, whether modified or unmodified, may further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 7, and the targeting 2024203661 31 May 2024 group or linking group may be attached to the 3' or 5' terminus of either the sense strand or the antisense strand of the AAT RNAi agent duplex. Examples of targeting groups and linking groups are provided in Table 7. Table 5 provides 5 several embodiments of AAT RNAi agent sense strands having a targeting group or linking group linked to the 5' or 3' end. Table 7. Structures Representing Various Modified Nucleotides. Targeting Groups, and Linking Groups 5Me-Gf WO 2018 / 132432 PCT / US2018 / 013102 2024203661 31 May 2024 2024203661 31 May 2024 When positioned internally on oligonucleotide: linkage towards 5' end of oligonucleotide linkage towards 3' end of oligonucleotide (invAb)s When positioned at the 3' terminal end of oligonucleotide: linkage towards 5' end of oligonucleotide (invAb) (Chol-TEG) 2024203661 31 May 2024 WO 2018 / 132432 PCT / US2018 / 013102 2024203661 31 May 2024 2024203661 31 May 2024 2024203661 31 May 2024 WO 2018 / 132432 PCT / US2018 / 013102 WO 2018 / 132432 PCT / US2018 / 013102 2024203661 31 May 2024 2024203661 31 May 2024 (NAG31)s (NAG32) (NAG32)s 2024203661 31 May 2024 (NAG33) (NAG33)s (NAG34) 2024203661 31 May 2024 (NAG34)s -H (NAG35) H (NAG35)s 2024203661 31 May 2024 WO 2018 / 132432 PCT / US2018 / 013102 2024203661 31 May 2024 In each of the above structures in Table 7, NAG comprises an N-acetyl-galactosamine or another asialoglycoprotein receptor ligand, as would be understood by a person of ordinary skill in the art to be attached in view of the structures above and description provided herein. For example, in some embodiments, NAG in the structures provided in Table 7 is represented by the following structure: (N-acetyl-galactosamine) 2024203661 31 May 2024 Each (NAGx) can be attached to an A AT RNAi agent via a phosphate group (as in (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group, (as is (NAG25)s, (NAG29)s, (NAG3())s, (NAG31)s, or(NAG37)s), or another linking group. 5 O O H-H 0’ s' Phosphate group Phosphorothioate group Other linking groups known in the art may be used. 10 In some embodiments, a delivery' vehicle can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a meliltin peptide, a melitlin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a 15 reversibly modified membrane active polyamine. In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 20 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), or other delivery' systems available in the art. Pharmaceutical Compositions and Formulations 25 The A AT RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations. In some embodiments, pharmaceutical compositions include at least one AAT RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of the target mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a 30 disease or disorder that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to 2024203661 31 May 2024 treat a subject at risk of developing a disease or disorder that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment the method includes administering an AAT RNAi agent linked to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more 5 pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical compositions including an AAT RNAi agent, thereby forming a pharmaceutical formulation suitable for in vivo delivery to a subject, including a human. 10 The pharmaceutical compositions that include an AAT RNAi agent and methods disclosed herein decrease the level of the target mRNA in a cell, group of cells, group of cells, tissue, or subject, including: administering to the subject a therapeutically effective amount of a herein described AAT RNAi agent, thereby inhibiting the expression of AAT mRNA in the subject. 15 !n some embodiments, the described pharmaceutical compositions including an AAT RNAi agent are used for treating or managing clinical presentations in a subject with AATD, such as chronic hepatitis, cirrhosis, hepatocellular carcinoma, transaminitis, cholestasis, fibrosis, and even fulminant hepatic failure. In some embodiments, a therapeutically or 20 prophylactically effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any' of the disclosed AAT RNAi agents can be used to decrease the number, severity', and / or frequency7 of symptoms of a disease in a subject. 25 The described pharmaceutical compositions including an AAT RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of AAT mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions including an AAT RNAi agent thereby' treating the symptom. In other 30 embodiments, the subject is administered a prophylactically effective amount of one or more AAT RNAi agents, thereby preventing the at least one symptom. 2024203661 31 May 2024 The route of administration is the path by which an AAT RNAi agent is brought into contact with the body. Tn general, methods of administering drugs and nucleic acids for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The AAT RNAi agents disclosed herein can be administered 5 via any suitable route in a preparation appropriately tailored to the particular route. Thus, herein described pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, mtraculaneously, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, the herein described pharmaceutical compositions are administered via subcutaneous injection. 10 The pharmaceutical compositions including an AAT RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the 15 compositions described herein. For example, deliver} can be by local administration, (eg., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In 20 certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection. Accordingly, in some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical 25 compositions described herein are formulated for administration to a subject. As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described AAT RNAi agents and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients 30 (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., AAT RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients can act to a) aid in processing of the drug delivery7 system 2024203661 31 May 2024 during manufacture, b) protect, support, or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and / or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance. 5 Excipients include, but are not limited to: absorption enhancers, anti-adherents, antifoaming agents, anti-oxidants, binders, buffering agents, carriers, coaling agents, colors, delivery' enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, 10 preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions 15 (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include phy siological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of 20 microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many 25 cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. 30 Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic 2024203661 31 May 2024 dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a pow'der of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution 5 thereof. Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable 10 polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration. The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants 15 and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, poly anhydrides, polyglycolic acid, collagen, polyorthoesters, and poly lactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known 20 to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811. The AAT RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a 25 predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment 30 of individuals. A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited 2024203661 31 May 2024 to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or comprise the herein defined RNAi agents may be used as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” 5 “therapeutically effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce a pharmacological, therapeutic or preventive result. Generally, an effective amount of an active compound will be in the range of from about 0.1 to about 100 mg / kg of body weight day, e.g., from about 1.0 to about 50 mg / kg of body 10 weight'day. In some embodiments, an effective amount of an active compound will be in the range of from about 0.25 to about 5 mg / kg of body weight per dose. In some embodiments, an effective amount of an active ingredient will be in the range of from about 0.5 to about 4 mg / kg of body weight per dose. The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological 15 efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can, in some instances, be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can, in some instances, be smaller than the optimum. 20 For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an AAT RNAi agent can be combined with an excipient or with a second therapeutic agent ortreatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an 25 antibody fragment, peptide and / or aptamer. The described AAT RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions described herein can be packaged in pre-filled syringes or vials. 30 Methods of Treatment and Inhibition of Expression The AAT RN Ai agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the 2024203661 31 May 2024 compound, in some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) having AATD, or symptoms, diseases, or disorders that would benefit from reduction or inhibition in expression of AAT mRNA, such as AATD liver disease. The subject is administered a therapeutically effective amount of any one or more 5 of the AAT RNAi agents described herein. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. The described pharmaceutical compositions including an AAT RNAi agent can be used io provide methods for the therapeutic treatment of diseases, such as AATD. Such methods include administration of a pharmaceutical composition described herein to a human being or 10 animal. In some embodiments, the AAT RNAi agents described herein are used to treat a subject with AATD. including symptoms, diseases or disorders related to AATD. AATD liver diseases or disorders include, but are not limited to, chronic hepatitis, cirrhosis, 15 hepatocellular carcinoma, transaminitis, cholestasis, fibrosis, and fulminant hepatic failure. In some embodiments, the described AAT RNAi agents are used to treat at least one symptom in a subject having AATD. The subject is administered a therapeutically effective amount of any one or more of the described RNAi agents. 20 In certain embodiments, the present invention provides methods for treatment of AATD in a patient in need thereof, comprising administering to the patient any of the AAT RNAi agents described herein. In some embodiments, the AAT RNAi agents are used to treat or manage a clinical 25 presentation of a subject with an AATD liver disease or disorder. The subject is administered a therapeutically effective amount of one or more of the AzXT RNAi agents or AAT RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising an AAT RNAi agent described herein to a subject to be treated. 30 In some embodiments, the gene expression level and / or mRNA level of an AAT gene in a subject to whom a described AAT RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 2024203661 31 May 2024 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the AAT RNAi agent or to a subject not receiving the AAT RNAi agent. The gene expression level and / or mRNA level in the subject is reduced in a cell, group of cells, and or tissue of the subject. 5 In some embodiments, the protein level of AAT in a subject to whom a described AAT RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered tire AAT 10 RNAi agent or to a subject not receiving the AAT RNAi agent. The protein level in the subject is reduced in a cell, group of cells, tissue, blood, and / or other fluid of the subject. In some embodiments, the Z-AAT poly mer protein lev el in a s ubj ect having AATD to whom a described AAT RNAi agent has been administered is reduced by at least about 5%, 10%, 15 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the AAT RNAi agent or to a subject not receiving the AAT RNAi agent. In some embodiments, the Z-AAT poly mer protein level in a subject to whom a described AAT RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 20 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the AAT RNAi agent or to a subject not receiving the AAT RNAi agent. A reduction in AAT gene expression, AAT mRNA, or AAT protein levels can be assessed 25 and quantified by general methods known in the art. The Examples disclosed herein forth generally known methods for assessing inhibition of AAT gene expression and reduction in AAT protein levels. The reduction or decrease in AAT mRNA level and / or protein level (including Z-AAT polymer and / or monomer) are collectively referred to herein as a reduction or decrease in AAT or inhibiting or reducing the expression of AAT. 30 Cells and Tissues and non-Human organisms 2024203661 31 May 2024 Cells, tissues, and non-human organisms that include at least one of the AAT RNAi agents described herein is contemplated. The cell, tissue, or non-human organism is made by delivering the RNAi agent to the cell, tissue, or non-human organism. 5 The above provided embodiments and items are now illustrated with the following, nonlimiting examples. Examples Example 1. Identification of RNAi agent sequences and synthesis of RNAi agents 10 A selection process for identifying lead sequences for inhibiting expression of the AAT gene began with in silico methods to identify conserved sequences across variants of an AAT gene (SEQ ID NO: 1). The AAT sequence was initially screened using bioinformatics for 19-nucleotide sequences having a complementary sequence in known variants of human AAT. Sequences known to have manufacturing challenges and those predicted to have poor 15 RNAi activity based on known parameters were eliminated. Sequences were then subjected to cross-species reactivity analysis to select candidates that would cross-react with cynomolgus monkey AAT. The sequences were also evaluated for specificity to avoid off-target effects against the human and cynomolgus monkey genomes. One-hundred fifteen (115) sequence families of 19-tners were selected as candidates. 20 The duplexes in Table 6 herein were synthesized according to the following procedures: Synthesis The sense and antisense strands of the AAT RNAi agents were synthesized according to 25 phospho rami dite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, either aMerMade96E® (Bioautomation) or aMerMadel2® (Bioautomation) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 A or 600A, obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, 30 USA). Specifically, the following 2'-O-methyl phosphoramidites were used: (5'-O- dimethoxytrityl-N6-(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropy-lamino) phosphoramidite, 5'-O-dimethoxy-trityl-N4-(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5'-O- 2024203661 31 May 2024 dimethoxy trityl-N2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyano-ethyl-N,N- di isopropylamino)phosphoramidite, and 5'-O-dimethoxy-trityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidites carried the same protecting groups as the 2'-O-methyl RNA amidites. 5 The following UNA phosphoramidites were used: 5'-(4,4'-Dimethoxytrityl)-N-benzoyl-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor-amidite, 5'-(4,4'-Dimelhoxytrilyl)-N-acetyl-2',3'-seco-cytosine, 2’-benzoy 1-3'-[(2-cyanoethyl )- (N,N-diiso-propyl)] -phosphoramidite, 5 '-(4.4'-Dimelhoxy inly 1)-N -isobutyryl-2',3 '-seco guanosine. 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)J-phosphoramidite, and 5' 10 (4,4'-Dimethoxy-trityl)-2',3'-seco-uridine, 2'-benzoyl-3'-|(2-cyanoethyl)-(N,N- diiso-propyl)]-phosphoramidite. Targeting ligand-containing phosphoramidites were dissolved in anhydrous di chloromethane or anhydrous acetonitrile (50 mM). while all other amidites were dissolved 15 in anhydrous acetonitrile (50 mM) and molecular sieves (3A) were added. 5-Benzylthio-IH-tetrazole (BTT. 250 mM in acetonitrile) or 5-Ethylthio-l H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 min (RNA), 15 min (targeting ligand), 90 sec (2'0Me), and 60 sec (2'F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl l,2,4-dithiazoline-5-one (POS, obtained from 20 PolyOrg, Inc., Leominster, MA, USA) in anhydrous Acetonitrile was employed. Cleavage and Deprotection of Support Bound Oligomers. After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% ammonium hydroxide solution 25 (Aldrich) for two hours at 30°C. The solution was evaporated and the solid residue was reconstituted in water (see below). Purification Crude oligomers were purified by anionic exchange HPLC using a TKSgel SuperQ-5PW 30 13u column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 16 / 40 column packed 2024203661 31 May 2024 with Sephadex G-25 medium with a running buffer of lOOmM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile. Annealing 5 Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 0.2x PBS (Phosphate-Buffered Saline, 1 x, Coming, Cellgro) to form the RNAi agents. This solution was placed into a thermomixer at 70°C, heated to 95°C, held at 95°C for 5 min. and cooled to room temperature slowly. Some RNAi agents were lyophilized and stored at -15 to -25°C. Duplex concentration was determined by measuring the solution 10 absorbance on a UV-Vis spectrometer in 0.2x PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. Unless otherwise stated, all conversion factor was 0.037 mg (mL-cm). For some experiments, a conversion factor was calculated from an experimentally determined extinction coefficient. 15 Example 2. In Vitro Testing of AATRNAi Agents Candidate sequence duplexes were tested in vitro. The antisense strand sequences and sense strand sequences were annealed to form duplexes of 21-mer strands (having 19 base pairs and a di-nucleotide UU overhang on each 3' end) for in vitro testing, as shown in the 20 following Table 8: Table 8. Sequences of AAT RNAi Agents in Example 2 SEQ ID NO: Antisense Sequence (5’-3') SEQ ID NO: Sense Sequence (5'^3’) Duplex ID No. 1035 AGAAGAUAUUGGUGCUGUUUU 1150 AACAGCACCAAUAUCUUCUUU DI 1036 AGGAACUUGGUGAUGAUAUUU 1151 AUAUCAUCACCAAGUUCCUUU D2 1037 UGUCUUCUGGGCAGCAUCUUU 1152 AGAUGCUGCCCAGAAGACAUU D3 1038 UGUUGGACUGGUGUGCCAGUU 1153 CUGGCACACCAGUCCAACAUU D4 1039 CUGUUGGACUGGUGUGCCAUU 1154 UGGCACACCAGUCCAACAGUU D5 1040 UGCUGUUGGACUGGUGUGCUU 1155 GCACACCAGUCCAACAGCAUU D6 1041 UAUUGGUGCUGUUGGACUGUU 1156 CAGUCCAACAGCACCAAUAUU D7 1042 AUAUUGGUGCUGUUGGACUUU 1157 AGUCCAACAGCACCAAUAUUU D8 1043 GAUAUUGGUGCUGUUGGACUU 1158 GUCCAACAGCACCAAUAUCUU D9 1044 AAGAUAUUGGUGCUGUUGGUU 1159 CCAACAGCACCAAUAUCUUUU D10 1 045 GUAGCGAUGCUCACUGGGGUU 1160 CCCCAGUGAGCAUCGCUACUU DI 1 1046 AAAGGCUGUAGCGAUGCUCUU 1161 GAGCAUCGCUACAGCCUUUUU D12 1047 GCAAAGGCUGUAGCGAUGCUU 1162 GCA U CGC U AC AGCCU U U GC U U D13 1048 UGCAAAGGCUGUAGCGAUGUU 1163 CAUCGCUACAGCCUUUGCAUU D14 1049 AUUGCAAAGGCUGUAGCGAUU 1164 UCGCUACAGCCUUUGCAAUUU D15 1050 AGCAUUGCAAAGGCUGUAGUU 1165 CUACAGCCUUUGCAAUGCUUU DI 6 1051 AGAGCAUUGCAAAGGCUGUUU 1166 ACAGCCUUUGCAAUGCUCUUU DI 7 1052 GGAGUUCCUGGAAGCCUUCUU 1167 GAAGGCUUCCAGGAACUCCUU D18 1053 UCCAAAAACUUAUCCACUAUU 1168 UAGUGGAUAAGUUUUUGGAUU D19 1054 AAGGCUUCUGAGUGGUACAUU 1169 UGUACCACUCAGAAGCCUUUU D20 1055 GAAGGCUUCUGAGUGGUACUU 1170 GUACCACUCAGAAGCCUUCUU D21 1056 UUCUUGGCCUCUUCGGUGUUU 1171 ACACCGAAGAGGCCAAGAAUU D22 1057 GUUUCUUGGCCUCUUCGGUUU 1172 ACCGAAGAGGCCAAGAAACUU D23 1058 UUGAUCUGUUUCUUGGCCUUU 1173 AGGCCAAGAAACAGAU CAAU U D24 1059 GUUGAUCUGUUUCUUGGCCUU 1174 GGCCAAGAAACAGAUCAACUU D25 1060 CGUUGAUCUGUUUCUUGGCUU 1175 GCCAAGAAACAGAUCAACGUU D26 WO 2018 / 132432 PCT / US2018 / 013102 106 SEQ ID NO: Antisense Sequence (5’ 3’) SEQ ID NO: Sense Sequence (5' 3’) Duplex ID No. 1061 CACAAUUUUCCCUUGAGUAUU 1176 UACUCAAGGGAAAAUUGUGUU D27 1062 UCCACAAUUUUCCCUUGAGUU 1177 CUCAAGGGAAAAUUGUGGAUU D28 1063 AUCCACAAUUUUCCCUUGAUU 1178 UCAAGGGAAAAUUGUGGAUUU D29 1064 UGUCAAGCUCCUUGACCAAUU 1179 UUGGUCAAGGAGCUUGACAUU D30 1065 GUGUCUCUGUCAAGCUCCUUU 1180 AGGAGCU U GAC AGAGACACU U D31 1066 ACUGUGUCUCUGUCAAGCUUU 1181 AGCUUGACAGAGACACAGUUU D32 1067 UGUAAUUCACCAGAGCAAAUU 1182 ULUGCUCUGGUGAAUUACAUU D33 1068 UUAAACAUGCCUAAACGCUUU 1183 AGCGUUUAGGCAUGUUUAAUU D34 1069 GUUAAACAUGCCUAAACGCUU 1184 GCGUUUAGGCAUGUUUAACUU D35 1070 UGUUAAACAUGCCUAAACGUU 1185 CGUUUAGGCAUGUUUAACAUU D36 1071 GGAUGUUAAACAUGCCUAAUU 1186 UUAGGCAUGUUUAACAUCCUU D37 1072 AUUUCAUCAGCAGCACCCAUU 1187 U GGGU GC UGCUGAUGAA A UUU D38 1073 GAAGAAGAUGGCGGUGGCAUU 1188 UGCCACCGCCAUCUUCUUCUU D39 1074 GGUGAGUUCAUUUUCCAGGUU 1189 CCUGGAAAAUGAACUCACCUU D40 1075 GAACUUGGUGAUGAUAUCGUU 1190 CGAUAUC A UC AC CAAGUUCUU D41 1076 CAUUUUCCAGGAACUUGGUUU 1191 AC CAAGUUCCUGGAAAAUGUU D42 1077 CAUAGGUUCCAGUAAUGGAUU 1192 UCCAUUACUGGAACCUAUGUU D43 1078 UCAUAGGUUCCAGUAAUGGUU 1193 CCAUUACUGGAACCUAUGAUU D44 1079 UCAGAUCAUAGGUUCCAGUUU 1194 ACUGGAACCUAUGAUCUGAUU D45 1080 UCUUCAGAUCAUAGGUUCCUU 1195 GGAACCUAUGAUCUGAAGAUU D46 1081 CUCUUCAGAUCAUAGGUUCUU 1196 GAACCUAUGAUCUGAAGAGUU D47 1082 GAGGUCAGCCCCAUUGCUGUU 1197 CAGCAAUGGGGCUGACCUCUU D48 1083 GAGAGGUCAGCCCCAUUGCUU 1198 GC A AU GGGGC UGACC UC UCU U D49 1084 CUUCAGGGGUGCCUCCUCUUU 1199 AGAGGAGGC ACC C CUGA AGUU D50 1085 GAGAGCUUCAGGGGUGCCUUU 1200 AGGCACCCCUGAAGCUCUCUU D51 1086 UUAUGCACGGCCUUGGAGAUU 1201 UCUCCAAGGCCGUGCAUAAUU D52 1087 CCUUAUGCACGGCCUUGGAUU 1202 UCCAAGGCCGUGCAUAAGGUU D53 1088 GC CUUAUGCAC GGCCUUGGUU 1203 CCAAGGCCGUGCAUAAGGCUU D54 WO 2018 / 132432 PCT / US2018 / 013102 107 SEQ ID NO: Antisense Sequence (5’ 3’) SEQ ID NO: Sense Sequence (5' 3’) Duplex ID No. 1089 AGCCUUAUGCACGGCCUUGUU 1204 C AAGGCCGUGCA U AAGGCUUU D55 1090 CGAUGGUCAGCACAGCCUUUU 1205 AAGGCUGUGCUGACCAUCGUU D56 1091 GUCGAUGGUCAGCACAGCCUU 1206 GGCUGUGCUGACCAUCGACUU D57 1092 AAAAACAUGGCCCCAGCAGUU 1207 CUGCUGGGGCCAUGUUUUUUU D58 1093 CUAAAAACAUGGCCCCAGCUU 1208 GCUGGGGCCAUGUUUUUAGUU D59 1094 UCUAAAAACAUGGCCCCAGUU 1209 CUGGGGCCAUGUUUUUAGAUU D60 1095 CCUCUAAAAACAUGGCCCCUU 1210 GGGGCCAUGU U U U UAGAGGU U D61 1096 GCCUCUAAAAACAUGGCCCUU 1211 GGGCCAUGUUUUUAGAGGCUU D62 1097 UAGACAUGGGUAUGGCCUCUU 1212 GAGGCCAUACCCAUGUCUAUU D63 1098 GAUAGACAUGGGUAUGGCCUU 1213 GGCCAUACCCAUGUCUAUCUU D64 1099 UGUUGAACUUGACCUCGGGUU 1214 CCCGAGGUCAAGUUCAACAUU D65 1100 GGUUUGUUGAACUUGACCUUU 1215 AGGUCAAGUUCAACAAACCUU D66 1101 AAAGGGUUUGUUGAACUUGUU 1216 CAAGUUCAACAAACCCUUUUU D67 1102 AC AAAGGGUU UGU UGA AC U U U 1217 AGUUCAACAAACCCUUUGUUU D68 1103 GACAAAGGGUUUGUUGAACUU 1218 GUUCAACAAACCCUUUGUCUU D69 1104 AAGACAAAGGGUU UGU UGAU U 1219 UCAACAAACCCUUUGUCUUUU □70 1105 CAUUAAGAAGACAAAGGGUUU 1220 ACCCUUUGUCUUCUUAAUGUU D71 1106 AUCAUUAAGAAGACAAAGGUU 1221 CCUUUGUCUUCUUAAUGAUUU D72 1107 GAAGAGGGGAGACUUGGUAUU 1222 UACCAAGUCUCCCCUCUUCUU D73 1108 CCAUGAAGAGGGGAGACUUUU 1223 AAGUCUCCCCUCUUCAUGGUU D74 1109 CCCAUGAAGAGGGGAGACUUU 1224 AGUCUCCCCUCUUCAUGGGUU □75 1110 UUCCCAUGAAGAGGGGAGAUU 1225 UCUCCCCUCUUCAUGGGAAUU D76 1111 UUUCCCAUGAAGAGGGGAGUU 1226 CUCCCCUCUUCAUGGGAAAUU D77 1112 AACCCUUCUUUAAUGUCAUUU 1227 AUGACAUUAAAGAAGGGUUUU D78 1113 UUGUUGGACUGGUGUGCCAUU 1228 UGGCACACCAGUCCAACAAUU □79 1114 UAUAUUGGUGCUGUUGGACUU 1229 GUCCAACAGCACCAAUAUAUU D80 1115 UUAGCGAUGCUCACUGGGGUU 1230 CCCCAGUGAGCAUCGCUAAUU □81 1116 UCAAAGGCUGUAGCGAUGCUU 1231 GCAUCGCUACAGCCUUUGAUU D82 WO 2018 / 132432 PCT / US2018 / 013102 108 SEQ ID NO: Antisense Sequence (5’ 3’) SEQ ID NO: Sense Sequence (5' 3’) Duplex ID No. 1117 UGAGUUCCUGGAAGCCUUCUU 1232 GAAGGCUUCCAGGAACUCAUU D83 1118 UAAGGCUUCUGAGUGGUACUU 1233 GUACCACUCAGAAGCCUUAUU D84 1119 UUUUCUUGGCCUCUUCGGUUU 1234 ACCGAAGAGGCCAAGAAAAUU D85 1120 UUUGAUCUGUUUCUUGGC CUU 1235 GGCCAAGAAACAGAUCAAAUU D86 1121 UGUUGAUCUGUUUCUUGGCUU 1236 GCCAAGAAACAGAUCAACAUU D87 1122 UACAAUUUUCCCUUGAGUAUU 1237 UACUCAAGGGAAAAUUGUAUU D88 1123 UUGUCUCUGUCAAGCUCCUUU 1238 AGGAGCUUGACAGAGACAAUU D89 1124 UUUAAACAUGCCUAAACGCUU 1239 GCGUUUAGGCAUGUUUAAAUU D90 1125 UGAUGUUAAACAUGCCUAAUU 1240 UUAGGCAUGUUUAACAUCAUU D91 1126 UAAGAAGAUGGCGGUGGCAUU 1241 UGCCACCGCCAUCUUCUl J AVI J D92 1127 UGUGAGUUCAUUUUCCAGGUU 1242 C CUG GAAAAUGAACUCAC AUU D93 1128 UAACUUGGUGAUGAUAUCGUU 1243 CGAUAUC AUCAC CAAGUUAUU D94 1129 UAUUUUCCAGGAACUUGGUUU 1244 ACCAAGUUCClJGGAAAAUAUU D95 1130 UAUAGGUUCCAGUAAUGGAUU 1245 UCCAUUACUGGAACCUAUAUU D96 1131 UUCUUCAGAUCAUAGGUUCUU 1246 GAACCUAUGAUCUGAAGAAUU D97 1132 UAGGUCAGCCCCAUUGCUGUU 1247 CAGCAAUGGGGC UGACC UA UU D98 1133 UAGAGGUCAGCCCCAUUGCUU 1248 GCAAUGGGGCUGACCUCUAUU D99 1134 UUUCAGGGGUGCCUCCUCUUU 1249 AGAGGAGGCACCCCUGAAAUU D100 1135 UAGAGCUUCAGGGGUGCCUUU 1250 AGGCACCCCUGAAGCUCUAUU D101 1136 UCUUAUGCACGGCCUUGGAUU 1251 UCCAAGGCCGUGCAUAAGAUU D102 1137 UCCUUAUGCACGGCCUUGGUU 1252 C C AAGGCC GUGCAUAAGGAUU DI 03 1138 UGAUGGUCAGCACAGCCUUUU 1253 AAGGCUGUGCUGACCAUCAUU D104 1139 UUCGAUGGUCAGCACAGCCUU 1254 GGCU GUGC UGACCAUCGAAU U DI 05 1140 UUAAAAACAUGGCCCCAGCUU 1255 GCUGGGGCCAUGUUUUUAAUU DI 06 1141 UCUCUAAAAACAUGGCCCCUU 1256 GGGGCCAUGUUUUUAGAGAUU DI 07 1142 UCCUCUAAAAACAUGGCCCUU 1257 GGGCCAUGUUUUUAGAGGAUU D108 1143 UAUAGACAUGGGUAUGGCCUU 1258 GGCCAUACCCAUGUCUAUAUU DI 09 1144 UGUUUGUUGAACUUGACCUUU 1259 AGGUCAAGUUCAACAAACAUU DUO WO 2018 / 132432 PCT / US2018 / 013102 109 SEQ ID NO: Antisense Sequence (5’ 3’) SEQ ID NO: Sense Sequence (5'^3’) Duplex ID No. 1145 UACAAAGGGUUUGUUGAACUU 1260 GUUCAACAAACCCUUUGUAUU Dill 1146 UAUUAAGAAGACAAAGGGUUU 1261 ACCCUUUGUCUUCUUAAUAUU DI 12 1147 UAAGAGGGGAGACU UGGUAU U 1262 UACCAAGUCUCCCCUCUUAUU DI 13 1148 UCAUGAAGAGGGGAGACUUUU 1263 AAGUCUCCCCUCUUCAUGAUU D114 1149 UCCAUGAAGAGGGGAGACUUU 1264 AGUCUCCCCUCUUCAUGGAUU DI 15 WO 2018 / 132432 PCT / US2018 / 013102 110 2024203661 31 May 2024 AAT RNAi agents were evaluated by transfection of Hep3B cells, a human hepatocellular carcinoma line. Cells were plated at ~10,000 cells per well in 96-well format, and each of the 115 AAT RNAi agent duplexes was transfected at three concentrations (10 nM. 1 nM, and 0.1 nM), using LipoFectamine RNAiMax (Thermo Fisher) transfection reagent. 5 Relative expression of each of the 115 AAT RNAi agents was determined by qRT-PCR by comparing the expression levels of AAT mRN A to an endogenous control, and normalized to untreated Hep3B cells (AACt analysis), as shown in Table 9. Table 9. In Vitro Data from Duplexes of Example 2 Duplex ID No. (From Table 8) Avg. Rei. Exp. 10 nM Avg. Rei. Exp. 1 nM Avg. Rei. Exp. 0.1 nM DI 1.037 0.896 0.709 D2 0.068 0.089 0.381 D3 0.046 0.064 0.403 D4 0.075 0.090 0.391 D5 0.408 0.424 0.743 D6 0.018 0.032 0.347 D7 0.069 0.125 0.666 D8 0.092 0.193 0.794 D9 0.206 0.228 0.839 D10 0.023 0.032 0.235 Dll 0.309 0.522 0.894 D12 0.049 0.092 0.732 D13 0.549 0.665 0.955 D14 0.531 0.654 0.934 DI 5 0.108 0.197 0.820 DI 6 0,558 0.516 0.834 D17 0.626 0.606 0.841 D18 0.668 0.703 0.778 D19 0.624 0.803 0.785 D20 0.071 0.080 0.506 D21 0.022 0.037 0.345 D22 0.086 0.127 0.588 2024203661 31 May 2024 Duplex ID No. (From Table 8) Avg. Rei. Exp. 10 nM Avg. Rei. Exp. 1 nM Avg. Rei. Exp. 0.1 nM D23 0.175 0.238 0.893 D24 0.134 0.078 0.368 D25 0.056 0.075 0.687 D26 0.122 0.196 0.756 D27 0.517 0.560 0.846 D28 0.801 0.838 0.884 D29 0.820 0.870 0.903 D30 0.558 0.632 0.879 D31 1.112 1.110 0.922 D32 0.246 0.359 1.041 D33 0.107 0.355 0.967 D34 0.096 0.170 0.962 D35 0.317 0.552 0.949 D36 0.064 0.134 0.873 D37 0.463 1.005 1.006 D38 0.428 0.688 0.486 D39 0.730 0.918 1.258 D40 0.059 0.067 0.912 D41 0.093 0.095 0.952 D42 0.582 0.665 0.944 D43 0.196 0.283 1.004 D44 0.195 0.278 0.860 □45 0.053 0.103 0.817 D46 0.082 0.127 1.034 D47 0.089 0.156 0.821 D48 0.735 0.695 0.838 D49 0.604 0.610 0.838 D50 0.543 0.633 0.806 D51 0.114 0.144 0.775 D52 0.108 0.203 0.836 2024203661 31 May 2024 Duplex ID No. (From Table 8) Avg. Rei. Exp. 10 nM Avg. Rei. Exp. 1 nM Avg. Rei. Exp. 0.1 nM D53 1.062 0.836 0.931 D54 0.091 0.274 1.081 D55 0.526 0.623 0.914 D56 0.500 0.588 0.884 D57 0.049 0.126 0.797 D58 0.198 0.302 0.917 D59 0.732 0.745 0.953 D60 0.389 0.580 0.897 D61 0.585 0.624 1.802 D62 0.174 0.215 1.115 D63 0.093 0.074 0.917 D64 0.133 0.133 1.055 D65 0.395 0.362 0.986 D66 0.054 0.055 1.083 D67 0.105 0.118 1.018 D68 0.106 0.122 1.290 D69 0.201 0.194 1.062 D70 0.050 0.048 0.709 D71 0.231 0.216 0.767 D72 0.046 0.030 0.737 D73 0.521 0.423 0.782 D74 0.479 0.467 0.694 D75 0.531 0.583 0.794 D76 0.210 0.285 0.924 D77 0.152 0.181 0.803 D78 0.425 0.485 0.703 D79 0.120 0.127 0.711 D80 0.203 0.167 0.672 D81 0.477 0.402 0.611 D82 0.540 0.489 0.661 2024203661 31 May 2024 Duplex ID No. (From Table 8) Avg. Rei. Exp. 10 nM Avg. Rei. Exp. 1 nM Avg. Rei. Exp. 0.1 nM D83 0.315 0.316 0.838 D84 0.135 0.118 0.375 D85 0.209 0.270 1.050 D86 0.120 0.136 0.928 D87 0.172 0.207 1.056 D88 0.218 0.308 1.006 D89 0.605 0.643 0.925 D90 0.205 0.259 0.927 D91 0.594 1.097 1.052 D92 0.337 0.887 1.015 D93 0.068 0.503 0.864 D94 0.067 0.475 0.811 D95 0.186 0.770 0.931 D96 0.062 0.389 0.550 D97 0.066 0.470 0.896 D98 0.567 0.998 1.044 D99 0.451 1.092 1.359 D100 0.292 0.745 0.875 D101 0.049 0.320 0.659 D102 0.313 0.799 0.732 DI 03 0,068 0.541 0.630 DI 04 0.077 0.552 0.682 DI 05 0.071 0.355 0.459 DI 06 1.179 1.117 1.076 DI 07 0.328 0.597 0.876 DI 08 0.125 0.467 0.573 D109 0.141 0.545 0.753 DUO 0.076 0.497 0.778 Dill 0.132 0.511 0.634 DI 12 0.216 0.586 0.784 2024203661 31 May 2024 Duplex ID No. (From Table 8) Avg. Rei. Exp. 10 nM Avg. Rei. Exp. 1 nM Avg. Rei. Exp. 0.1 nM DI 13 0.462 0.687 1.021 DI 14 0.507 0.792 1.170 DI 15 0.259 0.797 1.027 Example 3. In Vivo Testing ofNAG-ConjugaiedAATRNAi Agents in PiZMice. A transgenic PiZ mouse model (PiZ mice) was used to evaluate AAT RNAi agents in vivo. PiZ mice harbor the human PiZ AAT mutant allele and model human AATD (Carlson et al., Journal of Clinical Investigation 1989). NAG-conjugated AAT RNAi agents were prepared in a pharmaceutically acceptable saline buffer and administered to PiZ mice to evaluate knockdown of AAT gene expression. On day 1, each mouse received a single subcutaneous (SQ) dose into the loose skin on the back between the shoulders of 5.0 mg / kg (mpk) of either AD04446, AD04447. AD04448, AD04449, AD04450, AD04451, AD04454, AD04455, AD04456, AD04457, AD04458, or AD04459. (See Tables 4-7 for the modified AAT RNAi agents and NAG ligand structures). AAT RNAi agents AD04451 and AD04459 included a modified nucleotide antisense strand sequence designed to target an AAT gene (SEQ ID NO: 1) at position 1000; AAT RNAi agents AD04446 and AD04454 included a modified nucleotide antisense strand sequence designed to target an AAT gene (SEQ ID NO: 1) at position 1142; AAT RNAi agents AD04447 and AD04455 included a modified nucleotide antisense strand sequence designed to target an AAT gene (SEQ ID NO: 1) at position 1211; AAT RNAi agents AD04448 and AD04456 included a modified nucleotide antisense strand sequence designed to target an AAT gene (SEQ ID NO: 1) at position 1326; AAT RNAi agents AD04449 and AD04457 included a modified nucleotide antisense strand sequence designed to target an AAT gene (SEQ ID NO: I) at position 1338; and AAT RNAi agents AD04450 and AD04458 included a modified nucleotide antisense strand sequence designed to target an AAT gene (SEQ ID NO: 1) at position 1427. (See also Tables 1 and 2). Three mice were dosed with each AAT RNAi agent (n = 3). Plasma samples were drawn and analyzed for AAT (Z-AAT) protein levels on day 1 (predose), day 8, day 15, day 22, day 29, and day 36. AAT levels were normalized to day 1 2024203661 31 May 2024 (pre-dose) AAT plasma levels. Protein levels were measured by quantifying circulating human Z-AAT levels in plasma by a commercially available ELISA kit according to the manufacturer’s recommendations. The average normalized AAT (Z-AAT) levels for each RNAi agent are reported in the following Table 10: Table 10. Average Normalized A AT Protein (Normalized to Pre-Treatment) from Example 3 Day 8 Day 15 Day 22 Day 29 Day 36 Group ID Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Group 1 (5.0 mg / kg AD04447) 1.010 0.256 1.050 0.108 1.451 0.137 1.145 0.154 1.117 0.080 Group 2 (5.0 mg / kg AD04448) 0.8X4 0.262 0.866 0.276 1.306 0.112 1.147 0.119 1.076 0.172 Group 3 (5.0 mg / kg AD04449) 0.909 0.060 0.969 0.152 1.290 0.185 1.290 0.201 1.245 0.106 Group 4 (5.0 mg / kg AD04450) 0.595 0.083 0.799 0.131 1.099 0.256 1.090 0.346 1.229 0.444 Group 5 (5 0 mg / kg AD04451) 0.282 0.006 0.525 0.020 1.358 0.188 1.767 0.325 1.586 0.297 Group 6 (5.0 mg / kg AD04455) 0.656 0.126 0.639 0.039 0.741 0.089 0.738 0.235 0.819 0.156 Group 7 (5 0 mg / kg AD04456) 0.605 0.129 0.469 0.036 0.717 0.105 0.662 0.097 0.875 0.195 Group 8 (5 0 mg / kg AD04457) 0.501 0.108 0.663 0.091 1.031 0.324 I. ] 76 0.368 1.603 0.597 Group 9 (5 0 mg / kg AD04458) 0.308 0.081 0.174 0.031 0.177 0.010 0.211 0.010 0.345 0.041 Group 10 (5.0 mg / kg AD04459) 0.256 0.021 0.134 0.045 0.174 0.084 0.234 0.174 0.315 0.336 WO 2018 / 132432 PCT / US2018 / 013102 117 Day 8 Day 15 Day 22 Day 29 Day 36 Group ID Avg AAT Sid Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Group 11 (5.0 mg / kg AD04446) 0.686 0.178 0.739 0.130 0.973 0.263 0.955 0.107 0.885 0.119 Group 12 (5.0 mg / kg AD04454) 0.338 0.014 0.361 0.105 0.602 0.252 0.729 0.266 0.970 0.245 WO 2018 / 132432 PCT / US2018 / 013102 118 2024203661 31 May 2024 As shown from the data in Table 10. above, while AAT RNAi agent AD04447 showed essentially no reduction in AAT protein, AAT RNAi agents AD04458 (which included a modified nucleotide sequence designed to target an AAT gene (SEQ ID NO: 1) at position 1427) and AD04459 (which included a modified nucleotide sequence designed to target an 5 AAT gene (SEQ ID NO: 1) at position 1000) showed a substantial reduction in AAT protein across all timepoints. For example, AD04458 showed knockdown of approximately 69% at day 8 (0.308); approximately 83% at day 15 (0.174). and approximately 82% at day 22 (0.177). Additionally, for example. AD04459 showed a knockdown of approximately 74% al day 8 (0.256), approximately 87% at day 15 (0.134), and approximately 83% at day 22 10 (0.174). Example 4. In Vivo Testing of NAG-Conjugated AAT RNAi Agents in Cynomolgus Monkeys NAG-conjugated AAT RNAi agents were made and combined in a pharmaceutically 15 acceptable saline buffer as known in the art for subcutaneous (SC) injection. On day 1, cynomolgus macaque (Macaca fascicularis) primates (referred to herein as “cynos” or “monkeys") were injected subcutaneously with 3 mg / kg of either AD04824, AD04825, AD04826. or AD04827 (see Tables 4-7 for the modified AAT RNAi agents and NAG ligand structures). Each of these AAT RNAi agents included a modified nucleotide sequence 20 designed to target an AAT gene (SEQ ID NO: 1) at position 1000, and was cross-reactive with cynos. Three monkeys in each group were tested (n=3). Serum samples from treated cynomolgus monkeys were taken on day -7 and day 1 (predose), and on days 8, 15, 22. and 29 to monitor knockdown. Day 36 was also measured for 25 cynos that were injected with AD04825 and AD04826. At the indicated time points, blood samples were drawn and analyzed for cynomolgus monkey AAT (cAAT). Blood was collected from the femoral vein. cAAT levels were determined on a Cobas Integra 400 Plus (Roche Diagnostics) according to the manufacturer’s recommendations. AAT levels for each animal at a respective time point w’as divided by the pre-treatment level (average of 30 day -7 and day 1 (pre-dose)) of expression in that animal to determine the ratio of expression “normalized lo pre-dose.” Normalized cynomolgus monkey AAT (cAAT) protein levels after treatment with each 2024203661 31 May 2024 respective AAT RNAi agent are reported in the following Table 11: Table 11. Normalized cAAT Protein (Normalized to Pre-Treatment) from Example 4 in Cynomolgus Monkeys. Day 8 Day 15 Day 22 Day 29 Day 36 Group ID cAAT cAAT cAAT cAAT cAAT Group 1, Cyno A (3.0 mg / kg AD04824) 0.62 0.52 0.45 0.52 Group 1, Cyno B (3.0 mg / kg AD04824) 0.60 0.36 0.32 0.32 Group 1, Cyno C (3.0 mg / kg AD04824) 0.62 0.44 0.41 0.41 Group 2, Cyno A (3.0 mg / kg AD04825) 0.58 0.33 0.24 0.24 0,22 Group 2, Cyno B (3.0 mg / kg AD04825) 0.58 0.38 0.27 0.25 0.27 Group 2, Cyno C (3.0 mg / kg AD04825) 0.79 0.58 0.43 0.43 0,44 Group 3, Cyno A (3.0 mg / kg AD04826) 0.75 0.59 0.44 0.42 0,38 Group 3, Cyno U (3.0 mg / kg AD04826) 0.66 0,43 0.30 0.26 0.24 Group 3, Cyno C (3.0 mg / kg AD04826) 0.62 0.36 0.27 0.25 0,25 Group 4, Cyno A (3.0 mg / kg AD04827) 0.57 0,38 0.26 0.26 Group 4, Cyno B (3.0 mg / kg AD04827) 0.61 0.37 0.34 0.34 Group 4, Cyno C (3.0 mg / kg AD04827) 0.66 0.43 0.41 0.39 WO 2018 / 132432 PCT / US2018 / 013102 121 2024203661 31 May 2024 Average normalized cAAT levels for each of the respective treatment groups is shown in the bar graph of Figure 9. As illustrated in Table 11, above, and in Figure 9, each of the A AT RNAi agents tested showed substantial knockdown of cAAT in cynomolgus monkeys across all time points measured. 5 Example 5. In Vivo Testing of NAG-Conjugated AAT RNAi Agents in Cynomolgus Monkeys NAG-conj ugated AAT RNAi agents were made and combined in a pharmaceutically acceptable saline buffer as known in the art for subcutaneous (SC) injection. On day 1, 10 cynomolgus macaque (Macaco, fascicularis) primates were injected subcutaneously with 3 mg / kg of either AD04828, AD04831, AD04836, or AD04837 (see Tables 4-7 for the modified AAT RNAi agents and NAG ligand structures). Each of these AAT RNAi agents included a modified nucleotide sequence designed to target an AAT gene (SEQ ID NO: 1) at position 1000. and was cross-reactive with cynos. Three monkeys in each group were 15 tested (n=3) for AD04828 and AD04831, and two monkeys in each group were tested (n=2) for AD04836 and AD04837. Serum samples from treated cynos were taken on day -35 and day 1 (pre-dose), and on days 8,15,21, and 29 to monitor knockdown. At the indicated lime points, blood samples were 20 drawn and analyzed for cAAT. Blood was collected from the femoral vein. cAAT levels w-ere determined on a Cobas Integra 400 Plus (Roche Diagnostics) according to the manufacturer’s recommendations. cAAT levels for each animal at a respective time point was divided by the pre-treatment level (average of day -35 and day 1 (pre-dose)) of expression in that ani mal to determine the ratio of expression "normal ized to pre-treatment”, 25 Normalized cynomolgus monkey AAT (cAAT) protein levels after treatment with each respective AAT RNAi agent are reported in the following Table 12: Table 12. Normalized AAT Protein (Normalized to Pre-Treatment) from Example 5 in Cynomolgus Monkeys Day S Day 15 Day 22 Day 29 Group ID cAAT cAAT cAAT cAAT Group 1, Cyno A (3.0 mg / kg AD04828) 0.60 0.32 0.25 0.23 Group 1, Cyno B (3.0 mg / kg AD04828) 0.67 0.59 0.61 0.76 Group 1, Cyno C (3.0 mg / kg AD04828) 0.51 0,35 0.29 0.29 Group 2, Cyno A (3.0 mg / kg AD04831) 0.68 0,43 0,32 0.28 Group 2, Cyno B (3.0 mg / kg AD04831) 0.71 0.49 0.47 0.44 Group 2, Cyno C (3.0 mg / kg AD04831) 0.61 0.43 0.34 0.30 Group 3, Cyno A (3.0 mg / kg AD04836) 0.61 0.37 0.27 0.23 Group 3, Cyno B (3.0 mg / kg AD04836) 0.67 0.43 0.32 0.27 Group 4, Cyno A (3.0 mg / kg AD04837) 0.65 0.40 0.28 0.24 Group 4, Cyno B (3.0 mg / kg AD04837) 0.55 0.29 0.20 0.17 WO 2018 / 132432 PCT / US2018 / 013102 123 2024203661 31 May 2024 Average normalized cAAT levels for each of the respective treatment groups is shown in the bar graph of Figure 10. As shown above in Table 12, as w’ell as in the bar graph of Figure 10, each of the AAT RNAi agents tested showed substantial knockdown of cAAT in cynomolgus monkeys across all time points measured. 5 Example 6. hi Vivo Testing of NAG-Conjugated AAT RNAi Agents in PiZMice The transgenic PiZ mouse model (PiZ mice) as set forth in Example 3 w as used to evaluate AAT RNAi agents in vivo. NAG-conjugated AAT RNAi agents were prepared in a pharmaceutically acceptable saline buffer and administered to PiZ mice to evaluate 10 knockdown of AAT gene expression. On day I, each mouse received a single subcutaneous (SQ) dose into the loose skin on the back between the shoulders of 2.0 mg / kg (mpk) of either AD04824. AD04828, AD04829, AD04830, AD04831, AD04832, AD04833, AD04834, AD04836. AD04837, AD04838, AD04839, or AD04857. (See Tables 4-7 for the modified AAT RNAi agents and NAG ligand structures). Each of the AAT RNAi agents in this study 15 included a modified nucleotide antisense strand sequence designed to target an AAT gene (SEQ ID NO: 1) at position 1000. (See also Tables 1 and 2). Three mice were dosed with each AAT RNAi agent (n = 3). Plasma samples were drawn and analyzed for AAT (Z-AAT) protein levels on days -2, day 20 1 (pre-dose), day 8, day 15, day 22, day 29, and day 36. AAT levels were normalized to day 1 (pre-dose) AAT plasma levels. Protein levels were measured by quantifying circulating human Z-AAT levels in plasma by a commercially available ELISA kit according to the manufacturer’s recommendations. The average normalized AAT (Z-AAT) levels for each RNAi agent are reported in the following Table 13: Table 13. Average Normalized A AT Protein (Normalized to Pre-Treatment) from Example 6 Day 8 Day 15 Day 22 Day 29 Day 36 Group ID Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Group 1 (2.0 mg / kg AD04824) 0.105 0.036 0.140 0.067 0.204 0.108 0.313 0.104 0.437 0.229 Group 2 (2.0 mg / kg AD04828) 0.141 0.055 0.236 0.111 0.304 0.138 0.624 0.289 0.814 0.139 Group 3 (2.0 mg / kg AD04829) 0.109 0.072 0.119 0.102 0.140 0.119 0.141 0.116 0.179 0.145 Group 4 (2.0 mg / kg AD04830) 0.147 0.095 0.190 0.148 0.307 0.192 0.521 0.424 0.547 0.202 Group 5 (2.0 mg / kg AD04831) 0.154 0.104 0.215 0.171 0.449 0.375 0.701 0.519 0.584 0.418 Group 6 (2,0 mg / kg AD04832) 0.088 0.032 0.089 0.048 0.090 0.046 0.117 0.071 0.193 0.131 Group 7 (2.0 mg / kg AD04833) 0.168 0.029 0.282 0.047 0.448 0.048 0.748 0.223 1.361 0.346 Group 8 (2.0 mg / kg AD04834) 0.159 0.037 0.255 0.159 0.470 0.315 0.662 0.346 0.728 0.141 Group 9 (2 0 mg / kg AD04836) 0.108 0.035 0.070 0.024 0.083 0.032 0.090 0.035 0.168 0.078 Group 10 (2.0 mg / kg AD04837) 0.157 0.071 0.209 0.104 0.242 0.097 0.417 0.198 0.550 0.193 WO 2018 / 132432 PCT / US2018 / 013102 125 Day 8 Day 15 Day 22 Day 29 Day 36 Group ID Avg AAT Sid Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Group 11 (2.0 mg / kg AD04838) 0.106 0.017 0.099 0.022 0.108 0.039 0.158 0.072 0.188 0.050 Group 12 (2.0 mg / kg AD04839) 0.096 0.026 0.069 0.019 0.089 0.036 0.120 0.038 0.186 0.083 Group 12 (2.0 mg / kg AD04857) 0.272 0.130 0.302 0.145 0.478 0.187 0.815 0.436 1.772 1.412 WO 2018 / 132432 PCT / US2018 / 013102 126 2024203661 31 May 2024 As shown from the data in Table 13, above, each of the AAT RNAi agent showed a substantial reduction in AAT protein through at least day 29. For example, at day 15, each of the AAT RNAi agents tested achieved at least approximately 70% knockdown of protein compared to pre-treatment levels, with multiple groups achieving 90% or better knockdown. 5 Example 7. hi Vivo Testing of NAG-Conjugated AATRNAi Agents in PiZMice The transgenic PiZ mouse model described in Example 3 was used. Each mouse was 5 weeks old at the beginning of the study. NAG-conjugated AAT RNAi agents were prepared in a pharmaceutically acceptable saline buffer and administered to PiZ mice to evaluate 10 knockdown of AAT gene expression. Starting on day 1, each mouse received a subcutaneous (SQ) dose q2w (i.e., one injection every two weeks, for a total of 4 injections) into the loose skin on the back between the shoulders of 4.0 mg / kg (mpk) of either: (1) saline vehicle; (2) AD04837 (see Tables 4-7 for the modified AAT RNAi agent and NAG ligand structures), which as noted previously included a modified nucleotide antisense strand 15 sequence designed to target an AAT gene (SEQ ID NO: 1) at position 1000; or (3) aNAG-conjugated RNAi agent that included a nucleotide sequence targeting the HBV gene, to be used as a negative control. Single subcutaneous injections for the saline vehicle group, AAT RNAi agent group, and HBV RNAi agent group were performed on days 1, 15,29, and 43. Seven (7) mice w ere dosed q2w with the saline vehicle (Group 1); nine (9) mice were dosed 20 q2w with the AAT RNAi agent (Group 2); and six (6) mice were dosed with the HBV RNAi agent (Group 3). The mice in the three treatment groups were sacrificed on day 57 (13 weeks old). In addition to the treatment groups, seven (7) mice were sacrificed at week 1 of the study (i.e,, 5-week old mice) to serve as a baseline control. 25 Plasma samples were drawn and analyzed for AAT (Z-AAT) protein levels on day 1 (predose), day 8, day 15, day 22, day 29, and day 36 for all groups. Additional samples for the AAT RNAi agent group and the saline vehicle group w'ere drawn on day 43, day 50, and day 57. AAT levels were normalized to day 1 (pre-dose) AAT plasma levels. Protein levels were measured by quantifying circulating human Z-AAT levels in plasma by a 30 commercially available ELISA kit according to the manufacturer's recommendations. The average normalized AAT (Z-AAT) levels for the saline vehicle and each RNAi agent are reported in the following Table 14: Table 14. Average Normalized A AT Protein (Normalized to Pre-Treatment) from Example 7 Day 8 Day 15 Da, y 22 Da; y29 Group ID Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Group 1 (saline vehicle) (n=7) 0.876 0.172 1.264 0.386 1.234 0.457 1.319 0.453 Group 2 (AD04837) (n=9) 0.139 0.050 0,146 0.064 0.067 0.029 0.072 0.038 Group 3 (HBV RNAi agent - negative control) (n=6) 1.212 0.360 1.019 0.201 1.540 0.155 1.585 0.640 Day 36 Day 43 Day 50 Day 57 Group ID Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Group 1 (saline vehicle) (n=7) 1.267 0.491 1.441 0.416 1.172 0.340 1.058 0.299 Group 2 (AD04837) (n=9) 0.040 0.011 0.051 0.020 0.034 0.007 0.038 0.009 Group 3 (HBV RNAi agent - negative control) (n=6) 1.665 0.476 1.943 0.221 1.580 0.491 2.001 0.770 WO 2018 / 132432 PCT / US2018 / 013102 128 2024203661 31 May 2024 As shown from the data in Table 14, above, the HBV RNAi agent performed successfully as a negative control showing essentially no AAT inhibition. Further, the NAG-conjugated AAT RNAi agent (AD04837) achieved significant knockdown of expression compared to saline and the HBV RNAi agent negative control across all timepoints. In dosing q2w, the 5 AAT RNAi agent in Example 7 showed a knockdown of approximately 96% of AAT protein at day 36 (0.040) and maintained a similar level of knockdown through day 57. In addition to monitoring serum AAT levels, homogenized liver tissue from PiZ mice treated with NAG-conjugated AAT RNAi agent (AD04837) was further analyzed to determine if 10 both soluble Z-AAT (which is expected to be predominantly monomeric protein), and insoluble polymers of Z-AAT (which is expected to be polymeric protein) were effectively reduced. A modified western blot protocol was used to separate the soluble and insoluble Z-AAT fractions under non-denaturing conditions as previously described and known in the art (see, e.g., Mueller et al., Molecular Therapy, March 2012, 20(3): 590-600). 15 A western blot was prepared to examine certain livers of the sacrificed mice. Specifically, livers were examined of (i) 6 baseline mice; (ii) 5 AAT RNAi agent mice; and (iii) 4 saline mice. (The gels used for the western blot analysis included 15 wells). The samples for the animals used for this western blot w ere randomly selected from the various groups. Figures 20 11 and 12 show bar graphs reflecting the Z-AAT polymer and Z-AAT monomer levels quantified from the western blot analysis. As seen from the bar graph in Figure 11, which reports the monomeric protein levels, when compared to baseline each of the mice dosed with AAT RNAi agent shown a significant 25 reduction in AAT monomeric protein across all time points, indicating significant inhibition of the gene. Further, as shown in Figure 12, w hich reports the polymeric protein levels, the animals treated with the saline vehicle continued to have increased polymeric AAT burden after 8 w'eeks. Conversely, the animals treated with AAT RNAi agent showed a reduction in polymeric burden of approximately 50% over the course of 8 weeks as compared to the 30 baseline (5-week-old) mice, indicating that the administration of NAG-conjugated AAT RNAi agent (AD04837) is capable of preventing and potentially reversing the production of polymeric AAT protein. 2024203661 31 May 2024 Example 8. In Vivo Testing ofNAG-ConjugatedAATRNAi Agents in PiZMice The transgenic PiZ mouse model described in Example 3 was used to evaluate RNAi agents in vivo. Each mouse received a single subcutaneous (SQ) dose on day 1 into the loose skin on the back between the shoulders of either: (1) saline; (2) 1.0 mg / kg of the N AG-conjugated 5 AAT RNAi agent of AD04837 (which includes a modified nucleotide antisense strand sequence designed to target an AAT gene (SEQ ID NO: 1) at position 1000); (3) 2.0 mg / kg of AD04837; (4) 4.0 mg / kg of AD04837; or (5) 8.0 mg / kg of AD04837. Four animals were dosed in group 1 (saline), and all four were sacrificed on day 43. Fifteen (15) animals were dosed in each of groups 2, 3, 4, and 5, and 3 animals from each group were sacrificed on 10 day 8, day 15, day 22, day 29, and day 43, respectively. Plasma samples were drawn and analyzed for AAT (Z-AAT) protein levels on day 1 (predose), day 8, day 15, day 22, day 29, day 36, and day 43 for all groups. For the sacrificed mice, cardiac sticks were performed for serum isolation for Z-AAT protein level assessment 15 (200 pl plasma). AAT levels were normalized to day 1 (pre-dose) AAT plasma levels. Protein levels were measured by quantify ing circulating human Z-AAT levels in plasma by a commercially available ELISA kit according to the manufacturer’s recommendations. The average normalized AAT (Z-AAT) levels for the saline vehicle and each RNAi agent dosing group are reported in the following Table 15: Table 15. Average Normalized Plasma A AT Protein (Normalized to Pre-Treatment) from Example 8. Day 8 Day 15 Day 22 Day 29 Group ID Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Avg AAT Std Dev (+ / -) Group 1 (saline vehicle) 1.240 0.633 1.037 0.256 0.884 0.229 0.857 0.286 Group 2(1.0 mg / kg AD04837) 0.266 0.100 0,250 0.107 0.259 0.060 0,412 0,191 Group 3 (2.0 mg / kg AD04837) 0.170 0.102 0.162 0.132 0.199 0.161 0.511 0.514 Group 4 (4.0 mg / kg AD04837) 0.051 0.015 0 038 0.010 0.051 0.021 0.110 0.045 Group 5 (8 0 mg / kg AD04837) 0.030 0.011 0 025 0.010 0.040 0.024 0.063 0.030 Day 36 Day 43 Group 1 (saline vehicle) 1.485 0.431 0.932 0.243 Group 2 (10 mg / kg AD04837) 0.791 0.207 0.560 0.111 Group 3 (2.0 mg / kg AD04837) 0.600 0.140 0.595 0.217 Group 4 (4.0 mg / kg AD04837) 0.156 0.008 0,148 0.022 Group 5 (8.0 mg / kg AD04837) 0.239 0.183 0,202 0.119 WO 2018 / 132432 PCT / US2018 / 013102 131 2024203661 31 May 2024 As shown from the data in Table 15, above, the NAG-conjugated AAT RNAi agent achieved significant knockdown of expression compared to saline across all timepoints measured at all dosing levels tested. 5 I n addition, AAT mRN A levels were also assessed for the sacrificed mice at each respective timepoint. As described above, for Groups 2 through 5 (i.e., the RNAi agent groups), 3 mice were sacrificed on each of days 8,15, 22,29 and 43; and for Group 1, all 4 mice were sacrificed on day 43. Half of the left lateral liver lobe was collected and snap-frozen in liquid nitrogen for RNA isolation. Table 16. Relative AAT mRNA Levels in PiZ Mice Following Administration of a Single SQ Injection of Saline or AAT RNAi Agent Treatment Group Day Animals Average Relative mRNA Expression Low Variance High Variance Group 1 (saline vehicle) 43 n=4 1.000 0.071 0.076 Group 2 (1.0 mg / kg AD04837) 8 n=3 0.412 0.080 0.099 15 n=3 0.419 0.037 0.040 22 n=3 0.483 0.066 0.076 29 n=3 0.696 0.069 0.076 43 n=3 0.813 0.103 0.118 Group 3 (2.0 mg / kg AD04837) 8 n=3 0.272 0.101 0.160 15 n=3 0.235 0.039 0.046 22 n=3 0.327 0.099 0.141 29 n=3 0.587 0.155 0.210 43 n=3 0.845 0.123 0.145 Group 4 (4.0 mg / kg AD04837) 8 n=3 0.129 0.025 0.031 15 n=3 0.161 0.017 0.020 22 n=3 0.222 0.048 0.061 29 n=3 0.247 0.067 0.093 43 n=3 0.454 0.051 0.057 Group 5 (8.0 mg / kg AD04837) 8 n=3 0.078 0.013 0.015 15 n=3 0.055 0.014 0.019 22 n=3 0.077 0.009 0.010 29 n=3 0.116 0.038 0.056 2024203661 31 May 2024 Treatment Group Day Animals Average Relative mRNA Expression Low Variance High Variance 43 N=3 0.332 0.122 0.193 As shown in Table 16, above, relative AAT mRNA expression levels were significantly reduced across all timepoints measured compared to saline vehicle. For example, on day 15, Group 2 (1.0 mg / kg AAT RNAi agent) showed approximately 58% reduction of AAT mRNA levels (0.419); 5 Group 3 (2.0 mg / kg AAT RNAi agent) showed approximately 67% reduction of AAT mRNA levels (0.327); Group 4 (4.0 mg / kg AAT RNAi agent) showed approximately 84% reduction of AAT mRNA levels (0.161); and Group 5 (8.0 mg / kg AAT RNAi agent) showed approximately 94% reduction of Z-AAT mRNA levels (0.055) upon a single SQ dose at day 1. Throughout this specification and the claims which follow, unless the context requires otherwise, 10 the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission 15 or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates. OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed 20 description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. An RNAi agent for inhibiting the expression of an alpha-1 antitrypsin (AAT) gene, wherein the RNAi agent comprises a sense strand and an antisense strand,wherein the antisense strand comprises nucleotides 2-18 ofNGUUAAACAUGCCUAAACN (SEQ ID NO: 83),wherein the sense strand is at least substantially complementary to the antisense strand; and all of the nucleotides of the sense strand and the antisense strand are modified nucleotides,wherein the antisense strand comprises 2, 3, or 4 phosphorothioate linkages, and wherein the modified nucleotides of the antisense strand are selected from 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, 2'-fluoro uridine, 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, 2'-O-methyl uridine, and any combination thereof.
2. The RNAi agent of claim 1, wherein the sense strand and the antisense strand are each between 21 and 24 nucleotides in length.
3. The RNAi agent of claim 1 or claim 2, wherein the sense strand and the antisense strand are each 21 nucleotides in length.
4. The RNAi agent of claim 1, wherein antisense strand comprises the nucleotide sequence selected from (5'^3'):(i) UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794);(ii) UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839);(iii) UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800); and(iv) UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801).
5. The RNAi agent of any one of claims 1-4, wherein(i) the antisense strand comprises the sequence (5'^3')UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), and wherein the sense strand2024203661 15 Jun 2026comprises the sequence (5'^3') CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857),(ii) the antisense strand comprises the sequence (5'^3') UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), and wherein the sense strand comprises the sequence (5'^3') GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885),(iii) the antisense strand comprises the sequence (5'^3') UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), and wherein the sense strand comprises the sequence (5'^3') CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864), or(iv) the antisense strand comprises the sequence (5'^3') UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), and wherein the sense strand comprises the sequence (5'^3') AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866).
6. The RNAi agent of any one of claims 1-5, wherein the RNAi agent comprises one or more targeting groups, optionally wherein the one or more targeting groups or are conjugated to the sense strand, further optionally, wherein the one or more targeting groups are conjugated to the 5' terminal end of the sense strand.
7. The RNAi agent of any one of claims 1-6, wherein the RNAi agent comprises a targeting group that includes an asialoglycoprotein receptor ligand, preferably wherein the asialoglycoprotein receptor ligand comprises N-acetyl-galactosamine, more preferablywherein the asialoglycoprotein receptor ligand comprises an N-acetyl-galactosamine trimer.
8. The RNAi agent of any one of claims 1-7, wherein the RNAi agent comprises one or more targeting groups, and wherein the targeting group has a structure selected from the group consisting of: (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.
9. The RNAi agent of claim 8, wherein the targeting group is (NAG37)s, and (NAG37)s2024203661 15 Jun 2026comprises the following chemical structure:
10. The RNAi agent of claim 5, wherein the antisense strand comprises the nucleotide sequence (5'^3') usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960), wherein:a, c, g, and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively;Af, Cf, Gf, and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; ands is a phosphorothioate linkage.
11. The RNAi agent of claim 5, wherein the sense strand comprises the sequence (5'^3') agcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1279), wherein:a, c, g, and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively;Af, Cf, Gf, and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; ands is a phosphorothioate linkage;2024203661 15 Jun 2026wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and / or one, two, three, or four phosphorothioate internucleoside linkages; andwherein optionally linked to the 5' terminal end of the sense strand is a targeting ligand that comprises N-acetyl-galactosamine.
12. The RNAi agent of claim 5, wherein the antisense strand of the RNAi agent comprises the sequence (5'^3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO: 913), wherein:a, c, g, and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively;Af, Cf, Gf, and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; ands is a phosphorothioate linkage.
13. The RNAi agent of claim 5, wherein the sense strand comprises the sequence (5'^3') cguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1276), wherein:a, c, g, and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively;Af, Cf, Gf, and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; ands is a phosphorothioate linkage;wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and / or one, two, three, or four phosphorothioate internucleoside linkages; andwherein optionally linked to the 5' terminal end of the sense strand is a targeting ligand that comprises N-acetyl-galactosamine.2024203661 15 Jun 202614. The RNAi agent of claim 5, wherein the antisense strand of the RNAi agent comprises the sequence (5'^3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958), wherein:a, c, g, and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively;Af, Cf, Gf, and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; ands is a phosphorothioate linkage.
15. The RNAi agent of claim 5, wherein the sense strand comprises the sequence (5'^3') gcguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1277), wherein:a, c, g, and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively;Af, Cf, Gf, and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; ands is a phosphorothioate linkage;wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and / or one, two, three, or four phosphorothioate internucleoside linkages; andwherein optionally linked to the 5' terminal end of the sense strand is a targeting ligand that comprises N-acetyl-galactosamine.
16. The RNAi agent of claim 5, wherein the antisense strand of the RNAi agent comprises the sequence (5'^3') usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO: 959), wherein:a, c, g, and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively;2024203661 15 Jun 2026Af, Cf, Gf, and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; ands is a phosphorothioate linkage.
17. The RNAi agent of claim 5, wherein the sense strand comprises the sequence (5'^3') cgcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1278), wherein:a, c, g, and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively;Af, Cf, Gf, and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; ands is a phosphorothioate linkage;wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and / or one, two, three, or four phosphorothioate internucleoside linkages; andwherein optionally linked to the 5' terminal end of the sense strand is a targeting ligand that comprises N-acetyl-galactosamine.
18. A composition comprising the RNAi agent of any one of claims 1-17.
19. The composition of claim 18, wherein the composition is packaged in a kit, container, pack, dispenser, pre-filled syringes, or vials.
20. The composition of claim 18 or claim 19, wherein the composition is formulated for administration by subcutaneous injection.
21. Use of the RNAi agent of any one of claims 1-17 or the composition of any one of claims 18-20 in the manufacture of a medicament for inhibiting the expression of an AAT gene in a subject.2024203661 15 Jun 202622. Use of the RNAi agent of any one of claims 1-17 or the composition of any one of claims 18-20 in the manufacture of a medicament for treating alpha-1 antitrypsin deficiency (AATD) or a condition or disease caused by AATD.
23. The use of claim 21 or claim 22, wherein the RNAi agent or the composition reduces the protein level of AAT in a liver cell of the subject, optionally wherein the liver cell is a hepatocyte.
24. The use of any one of claims 21-23, wherein the subject has a disease selected from the group consisting of chronic hepatitis, cirrhosis, hepatocellular carcinoma, transaminitis, cholestasis, fibrosis, and fulminant hepatic failure.
25. A method for inhibiting the expression of an AAT gene in a subject, the method comprising administering to the subject an effective amount of an RNAi agent of any one of claims 1-17 or a composition of any one of claims 18-20.
26. A method for the treatment of a condition or disease caused by alpha-1 antitrypsin deficiency (AATD), the method comprising administering to a subject in need thereof a therapeutically effective amount of an RNAi agent of any one of claims 1-17 or a composition of any one of claims 18-20.
27. The method of claim 26, wherein the condition or disease caused by AAT is a liver disease, optionally wherein the liver disease is chronic hepatitis, cirrhosis, hepatocellular carcinoma, transaminitis, cholestasis, fibrosis, or fulminant hepatic failure.
Citation Information
Patent Citations
Serpina1 sirnas: compositions of matter and methods of treatment
WO2012178033A2