method

Abstract

The present invention relates to assays for assessing the presence, absence or development of cervical intra-epithelial neoplasia grade 2 or higher (CIN2+) and / or cervical cancer (CC) in an individual. The invention also relates to in vitro methods of assaying DNA and detecting methylation of the DNA therein, including amplification- based assay and detection methods such as PCR. The invention also relates to kits and systems for performing the assay and detection methods. The invention also relates to methods of treating and / or preventing CIN2+ and / or CC in an individual, and methods of monitoring the CIN2+ or CC status and / or the risk of CIN2+ or CC development in an individual.

Description

FIELD OF THE INVENTION The present invention relates to assays for assessing the presence, absence or development of cervical intra-epithelial neoplasia grade 2 or higher (CIN2+) and / or cervical cancer (CC) in an individual. The invention also relates to in vitro methods of assaying DNA and detecting methylation of the DNA therein, including amplificationbased assay and detection methods such as PCR. The invention also relates to kits and systems for performing the assay and detection methods. The invention also relates to methods of treating and / or preventing CIN2+ and / or CC in an individual, and methods of monitoring the CIN2+ or CC status and / or the risk of CIN2+ or CC development in an individual. CROSS REFERENCE TO RELATED APPLICATION This application claims priority from GB 2401477.1 filed on 5 February 2024, the contents of which are hereby incorporated by reference. BACKGROUND TO THE INVENTION Cervical cancer screening is among the most successful strategies for cancer prevention. In combination with high HPV vaccination coverage, cervical screening with substantial uptake is an essential part of the global strategy to eventually eliminate cervical cancer. Cytology-based cervical screening requires a complex infrastructure, well-trained workforce, and short screening intervals. The proven superiority of testing for oncogenic human papillomaviruses (HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59) as an objective and examiner-independent technique with high sensitivity and prolonged protection against cervical intraepithelial neoplasia grade 2 or worse (CIN2+) has resulted in international guidelines recommending a transition from primary cytology-based to primary HPV-based screening. Due to increased prevalence of HPV in women <30 years of age leading to low specificity of HPV testing, primary HPV screening is only recommended in women >30 years of age. An HPV screen-positive result requires cytology-based triaging so that only HPV- and cytology-positive women are referred for colposcopy and biopsy. In Europe, HPV-positive women typically undergo triaging with cytology. In contrast, patients positive for the main oncogenic HPV types (i.e. HPV16 and 18) are referred directly for colposcopy in the USA. At present, most HPV screening tests WO 2025 / 168613                                   PCT / EP2025 / 052932 provide at least partial information on HPV genotypes. Emphasis is increasing to utilize the information on HPV 16 / 18 - indicating higher risk for disease progression - in the screening algorithms. Cytology shows limited and highly variable sensitivity, that has been observed to decrease over time. It requires equipment and expertise that differs from HPV testing, without being applicable for self-samples. Patients who test positive for HPV through selfsampling need to be re-invited for a separate cytology sample, potentially impacting attendance rates adversely. Therefore, improved strategies for triaging HPV positive women are essential. The proof of principle to utilize DNA methylation (DNAme) tests on a non-cytological sample collected from the cervicovaginal region to detect cervical (pre-) cancer was demonstrated 20 years ago. Since then, several DNAme-based markers have been developed and applied in different settings, predominantly representing case / control studies or small cohort sets with fewer than a thousand volunteers. The inventors validate an optimised DNAme test (WID-qCIN) to HPV positive women in a real-life populationbased cohort. The inventors demonstrate strong predictive performance of the WID-qCIN test optionally in combination with HPV16 / 18 genotyping compared to cytology to triage HPV positive women. SUMMARY OF THE INVENTION The current inventors set out to understand whether DNAme (DNA methylation) profiles may be used to detect the presence or absence of cervical intra-epithelial neoplasia grade 2 or higher (CIN2+) and / or cervical cancer (CC). The inventors also set out to understand whether said DNAme profiles may be associated with the development of CIN2+ and / or CC, and therefore whether such profiles may be capable of functioning as surrogate markers for individual stratification purposes in connection with CIN2+ and / or cancer. In contrast to existing assays that may be used for assessing the presence, absence or development of CIN2+ and / or CC in an individual, the present invention provides hugely simplified test for CIN2+ and / or CC diagnosis or determination of CIN2+ and / or CC risk. The assay according to the present invention is simplified by requiring the assessment of CpG methylation of at least three genomic regions, yet nevertheless maintaining extremely high sensitivity and specificity. Such a simplified test provides not only cost benefits to individuals and public health organisations, it also allows assessments to be conducted more rapidly and more frequently, thereby allowing women to subject to the appropriate course of further cancer tests (i.e. such as obtaining tissue by means of invasive procedures to make a histological diagnosis), and potentially cancer treatment, without delay. For example, a test according to the present invention has particular advantages (e.g. improved sensitivity) in the diagnosis of early stage CIN, such as CIN2 and CIN3, relative to pre-existing tests, thereby enabling improved early identification of women at risk of developing CC. Current strategies for detecting CIN2+ and / or CC in women presenting with HPV-positivity often requires women to undergo cytology screening. The need for an individual to undergo cytology screening is sub-optimal due to the inability to self-sample and consequently a potential for adverse attendance of a screening appointment by the HPV-positive individual. The screening itself also has limited and highly variable sensitivity. An assessment according to the present invention delivers fast results and shows superior performance compared to pre-existing tests. Triage of women with DNAme positivity according to the assessment according to the invention could reduce the number of women requiring cytological assessments for identification of potential CIN2+ and / or CC. Accordingly, the invention provides assay for assessing the presence, absence or development of cervical intra-epithelial neoplasia grade 2 or higher (CIN2+) and / or cervical cancer (CC) in an individual, the assay comprising: a. providing a sample which has been taken from the individual, the sample comprising a population of DNA molecules; b. determining in the population of DNA molecules in the sample the methylation status of a test panel of three or more CpGs, wherein: i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 2, and wherein the at least one CpG is denoted by CG; and ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 3 and SEQ ID NO 4, and wherein the at least one CpG is denoted by CG; and iii. at least one CpG in the test panel is contained within a third DMR comprised in the population of DNA molecules, the third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 5 and SEQ ID NO 6, and wherein the at least one CpG is denoted by CG; and c. assessing the presence, absence or development of CIN2+ and / or CC in the individual based on the methylation status of the CpGs in the test panel The invention further provides a system for a PCR assay, the system comprising: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated. The invention further provides a kit comprising: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated and following bisulfite treatment; - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 3 in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated and following bisulfite treatment of SEQ ID NO: 3; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated and following bisulfite treatment; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 5 in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated and following bisulfite treatment of SEQ ID NO: 5; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated and following bisulfite treatment. The invention further provides an in vitro method of assaying DNA and detecting methylation of the DNA therein, the method comprising measuring a methylation status of a test panel of three or more CpGs, wherein: i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 2, and wherein the at least one CpG is denoted by CG; ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 3 and SEQ ID NO 4, and wherein the at least one CpG is denoted by CG; and iii. at least one CpG in the test panel is contained within a third DMR comprised in the population of DNA molecules, the third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 5 and SEQ ID NO 6, and wherein the at least one CpG is denoted by CG. The invention further provides a method of treating and / or preventing CIN2+ and / or CC in an individual, the method comprising: i. assessing the presence, absence or development of CIN2+ and / or CC in an individual according to the invention; and ii. administering one or more therapeutic or preventative treatments or measures to the individual based on the assessment. The invention further provides a method of monitoring the CIN2+ or CC status and / or the risk of CIN2+ or CC in an individual, the method comprising: (a) assessing the presence, absence or development of CIN2+ and / or CC in an individual by performing the assay according to the invention at a first time point; (b) assessing the presence, absence or development of CIN2+ and / or CC in the individual by performing the assay according to the invention at one or more further time points; and (c) monitoring any change in the CIN2+ or CC status and / or the risk of CIN2+ and / or CC development of the individual. BRIEF DESCRIPTION OF THE FIGURES Figure 1. The KI-ql-2017 study population. AIS denotes adenocarcinoma in situ, CC cervical cancer, CIN1 / 2 / 3 cervical intraepithelial neoplasia grade 1 / 2 / 3, HPV human papillomavirus, and HSIL high grade squamous intraepithelial lesion (reflective of CIN2 or CIN3). Figure 2. Kaplan Meier estimates of cumulative incidence rates for incident CIN2+ cases stratified according to baseline cytology (Panel A), HPV16 / 18 (Panel B), WID-qCIN (Panel C), and WID-qCIN / HPV16 / 18 (Panel D) in the KI-ql-2017 cohort. Inset are cumulative incidence curves corresponding to cervical cancers only. 95% confidence intervals are shown as gray shaded areas. CIN2+ denotes cervical intraepithelial neoplasia or worse, and HPV human papillomavirus. Figure 3. WID-qCIN analysis pathway in the KI-ql-2017 cohort. LOB denotes limit of blank, LOD limit of detection, and PMR percentage of fully methylated reference. Figure 4. Discrimination between <CIN1 controls and CIN2+ cases of the calibration set applying the WID-qCIN test. WO 2025 / 168613                                   PCT / EP2025 / 052932 AUC denotes area under the curve. Figure 5. Distribution of square root transformed SUM-PMR values following WID-qCIN based assessment of HPV-positive samples from the KI-ql-2017 cohort. Boxplots depict disease-progression-dependent distribution of square root transformed SUM-PMR values. Significant differences between two disease-types were assessed by performing unpaired t-tests. Asterisks indicate level of statistical significance (* indicates P<0.05, ** indicates P<0.01). AIS denotes adenocarcinoma in situ, CIN1 / 2 / 3 cervical intraepithelial neoplasia grade 1 / 2 / 3, and HSIL high grade squamous intraepithelial lesion (reflective of CIN2 or CIN3). Figure 6. Discrimination between prevalent <CIN1 controls and CIN2+ cases of the KI-ql-2017 cohort applying the WID-qCIN. AUC denotes area under the curve. Figure 7. Logistic Weibull mixture model results depict cumulative incidence rates of incident CIN2+ cases stratified according to WID-qCIN (Panel A), HPV16 / 18 (Panel B), WID-qCIN / HPV16 / 18 (Panel C) in the KI-ql-2017 cohort. 95% confidence intervals are shown as gray shaded areas. CIN2+ denotes cervical intraepithelial neoplasia or worse, and HPV human papillomavirus. Figure 8. Linearity of target-amplification in gBLOCK DNA at different dilution steps. Linear amplification of DPP6 (Chr7:153584008-153584079), RALYL (Chr8:85095492-85095580), GSX1 (Chrl3:28366785-28366866) and COL2A1 (Chrl2:48381229-48381320) in the singleplex and duplex setup was observed ranging from 100,000 to 10 copies per reaction. Plots depict mean and standard deviation of 2 technical replicates per sample. Figure 9. Analytical sensitivity of WID-qCIN duplex setup in methylated and unmethylated control DNA at different dilution steps. Improved analytical sensitivity was observed for DPP6 (Chr7:153584008-153584079), RALYL (Chr8:85095492-85095580), GSX1 (Chrl3:28366785-28366866) and COL2A1 (Chr12:48381229-48381320) in the duplex setup as compared to the singleplex setup in 5% to 0.1% of bisulfite modified methylated DNA diluted in bisulfite modified unmethylated DNA. WO 2025 / 168613                                   PCT / EP2025 / 052932 Comparable COL2A1 (Chrl2:48381229-48381320) Cq values in all dilution steps indicated similar input amounts of total DNA per reaction (20 ng DNA input). Plots depict mean and standard deviation of 3 technical replicates per sample. SEQUENCES SEQ ID NO: 1 - differentially methylated region within the human DPP6 gene having the chromosomal coordinates Chr7:153584008-153584079 Design strand 5'-3': T CAC C GTAGT GCT T GT T T GT GGAAGC C GAGC GTGCGTGCGCCGCGCGC GCAC C CAGT C CAGC GC GGAGT GGG SEQ ID NO: 2 - differentially methylated region within the human DPP6 gene having the chromosomal coordinates Chr7:153584008-153584079 Negative strand 5'-3': CCCACTCCGCGCTGGACTGGGTGCGCGCGCGGCGCACGCACGCTCGGCTTCCACAAACAAGCACTACGGTGA SEQ ID NO: 9 - a forward primer 5'-3' T TAT C GTAGT GT T T GT T T GT GGAAGT C SEQ ID NO: 10 - a reverse primer 5'-3' CCCACTCCGCGCTAAACTAA SEQ ID NO: 11 - a probe 5'3 CGTGCGTCGCGCGC GTA SEQ ID NO: 3 - differentially methylated region within the human RALYL gene having the chromosomal coordinates Chr8:85095492-85095580 Design strand 5'-3': GCGCCTGAGAGCGGCAACACCAGTGGCGGCAGCAGCGGCAGCGGCAGCTCGCGGCGAGGCTGCCTTCGCTGTG AGC C CAGAC GAGCAGG SEQ ID NO: 4 - differentially methylated region within the human RALYL gene having the chromosomal coordinates Chr8:85095492-85095580 Negative strand 5'-3': CCTGCTCGTCTGGGCTCACAGCGAAGGCAGCCTCGCCGCGAGCTGCCGCTGCCGCTGCTGCCGCCACTGGTGT TGCCGCTCTCAGGCGC SEQ ID NO: 12 - a forward primer 5'-3' GC GT T T GAGAGC GGTAATAT TAGT G WO 2025 / 168613                                   PCT / EP2025 / 052932 SEQ ID NO: 13 - a reverse primer 5'-3' CCTACTCGTCTAAACTCACAACGAAA SEQ ID NO: 14 - a probe 5'-3' AGC GGTAGT T C GC GGC GAGGT T SEQ ID NO: 5 - differentially methylated region within the human GSX1 gene having the chromosomal coordinates Chrl3:28366785-28366866 Design strand 5'-3': CGCAGAGGGCGGGCTGGCTGCGGGGCGACCGCGCGCCGGGGCCATGCCGCGCTCCTTCCTGGTGGACTCGCTAGT GCTGCGC SEQ ID NO: 6 - differentially methylated region within the human GSX1 gene having the chromosomal coordinates Chrl3:28366785-28366866 Negative strand 5'-3': GC GCAGCACTAGC GAGT C CAC CAGGAAGGAGC GC GGCAT GGCCCCGGCGCGCGGTCGCCCC GCAGC CAGC C C G CCCTCTGCG SEQ ID NO: 15 - a forward primer 5'-3' C GTAGAGGGC GGGT T GGT SEQ ID NO: 16 - a reverse primer 5'-3' GC GCAACACTAAC GAAT C CA SEQ ID NO: 17 - a probe 5'-3' CGATCGCGCGTCGG SEQ ID NO: 7 -region within the human COL2A1 gene having the chromosomal coordinates Chrl2:48381229-48381320 Design strand 5'-3': GGGAAGATGGGATAGAAGGGAATACATCTAGAGGTGGGGACAGGCATTGGGCCAGAATGAAGGTTTGGTGGTT GGAGC C CACAACT GT CAGA SEQ ID NO: 8 -region within the human COL2A1 gene having the chromosomal coordinates Chrl2:48381229-48381320 Negative strand 5'-3': TCTGACAGTTGTGGGCTCCAACCACCAAACCTTCATTCTGGCCCAATGCCTGTCCCCACCTCTAGATGTATTC CCTTCTATCCCATCTTCCC SEQ ID NO: 18 - a forward primer 5'-3' T C TAACAAT TATAAAC T C CAAC CAC CAA SEQ ID NO: 19 - a reverse primer 5'-3' GGGAAGAT GGGATAGAAGGGAATAT SEQ ID NO: 20 - a probe 5'-3' CCTTCATTCTAACCCAATACCTATCCCACCTCTAAA All sequences are shown in the 5’ to 3’ direction. DETAILED DESCRIPTION OF THE INVENTION The present invention will be described with respect to particular embodiments and with reference to certain drawings but the disclosure is not limited thereto. Any reference signs in the claims shall not be construed as limiting the scope. It should be appreciated that “embodiments” of the disclosure can be specifically combined together unless the context indicates otherwise. The specific combinations of all disclosed embodiments (unless implied otherwise by the context) are further disclosed embodiments of the claimed invention. In addition, as used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a polynucleotide” includes two or more polynucleotides, reference to “a protein” includes two or more proteins, and the like. "About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ± 20 % or + 10 %, more preferably + 5 %, even more preferably + 1 %, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. “Polynucleotide”, “nucleotide sequence”, “DNA sequence”, or “nucleic acid molecule(s)” as used herein refers to a polymeric form of nucleotides of any length, which comprises ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA, and RNA. The term “polynucleotide ” as used herein, may be a single or double stranded covalently-linked sequence of nucleotides in which the 3' and 5' ends on each nucleotide are joined by phosphodiester bonds. The polynucleotide may be made up of deoxyribonucleotide bases or ribonucleotide bases. Polynucleotides may be manufactured synthetically in vitro or isolated from natural sources. Polynucleotides may further include modified DNA or RNA, for example DNA or RNA that has been methylated, or RNA that has been subject to post-translational modification, for example 5’-capping with 7-methylguanosine, 3’-processing such as cleavage and polyadenylation, and splicing. Polynucleotides may also include synthetic nucleic acids (XNA), such as hexitol nucleic acid (HNA), cyclohexene nucleic acid (CeNA), threose nucleic acid (TNA), glycerol nucleic acid (GNA), locked nucleic acid (LNA) and peptide nucleic acid (PNA). Chromosomal coordinates with reference to a human polynucleotide sequence are defined with respect to hgl9. A Differentially Methylated Region (DMR) refers to a double-stranded polynucleotide sequence, formed of complementary polynucleotide sequences, whereby differential CpG methylation of one or more CpGs may be observed. The DMR may be an isolated double-stranded polynucleotide sequence. The DMR may be a region within a double stranded sequence optionally comprised within a population of DNA molecules. The DMR may be a region within a genome. The skilled person is aware that CpG methylation observed in a first strand of a DMR effectively acts as a surrogate indicator for the presence of CpG methylation at the complementary CpG dinucleotide in the complementary second strand of said DMR. For the purposes of determining the methylation status of CpG in a DMR, the skilled person would therefore be aware that determining CpG methylation in one strand of a DMR is sufficient to define a CpG within a DMR as a whole (i.e. on either strand) as methylated. Described particularly herein are methods for determining methylation status of CpGs in a test panel whereby the methods rely on PCR directed towards one strand of a DMR, in order to thereby determine the methylation status of CpGs within the DMR as a whole. The skilled person would be able to devise a method likewise relying on PCR but directed to the complementary strand in order to determine the methylation status of CpGs within the DMR as a whole. As used herein, a percentage of “sequence identity” will be understood to arise from a comparison of two sequences in which they are aligned together to give a maximum correlation between the sequences. This may include inserting “gaps” in either one or both sequences to enhance the degree of alignment. The percentage of sequence identity may then be determined over the length of each of the sequences being compared. For example, a nucleotide sequence (“subject sequence”) having at least 95% “sequence identity” with another nucleotide sequence (“query sequence”) is intended to mean that the subject sequence is identical to the query sequence except that the subject sequence may include up to five nucleotide alterations per 100 nucleotides of the query sequence. In other words, WO 2025 / 168613                                   PCT / EP2025 / 052932 to obtain a nucleotide sequence of at least 95% sequence identity to a query sequence, up to 5% (i.e. 5 in 100) of the nucleotides in the subject sequence may be inserted or substituted with another nucleotide or deleted. Percentage identity is also used equivalently in relation to protein sequences but in terms of comparing the corresponding amino acids. Assay A CpG as defined herein refers to the CG dinucleotide motif identified in relation to each SEQ ID NO. nucleotide sequence (SEQ ID NOs 1 to 6), wherein the cytosine base of the CG dinucleotide be modified. Thus, by determining the methylation status of any panel of one or more CpGs defined by or identified in a given SEQ ID NO, it is meant that a determination is made as to the methylation status of the cytosine of the CG dinucleotide motif, accepting that variations in the sequence upstream and downstream of any given CpG may exist due to sequencing errors or variation between individuals. A cervical intra-epithelial neoplasia refers to abnormal cells present in the cervix that are at risk of developing into cancerous cells. Identification of CIN in an individual, therefore, may indicate an increased risk of developing cervical cancer (CC) in said individual. CIN may be determined to be grade 1, 2 or 3, and wherein the higher the grade the greater the risk of the CIN developing into CC. Accordingly, there is a clinical need therefore to provide a test that is fast and simple, and may identify CIN at an early grade. The present inventors therefore sought to identify a simple and easy CpG methylationbased assay capable of assessing the presence, absence or development of ‘cervical intraepithelial neoplasia grade 2 or higher’ (CIN2+) and / or cervical cancer (CC) in an individual with high sensitivity and specificity. A test according to the present invention is demonstrated herein as having particular advantages (e.g. improved sensitivity) in the diagnosis of early stage CIN, such as CIN2 and CIN3, relative to pre-existing tests, thereby enabling improved early identification of women at risk of developing CC. A test according to the invention is also able to diagnose CC with high sensitivity and high specificity. Any of the assays described herein for assessing the presence, absence or development of CIN2+ and / or CC in an individual are capable of being utilised for assessing the presence, absence or development of CIN2+ and / or CC. Most preferably, the assay is a diagnostic assay for determining the presence or absence of CIN2+ and / or CC in the individual. The present inventors determined CpG methylation levels in a cervical sample (e.g. a cervicovaginal swab or a cervical liquid-based cytology sample) using an assay according to the present invention and compared the ability of the assay to accurately diagnose individuals with CIN2+ and / or CC based on their DNA methylation status with a conventional assessment pathway. Determination of positive DNA methylation according to the assay of the invention indicates a higher probability of current or future (e.g. up to 6 years post sample collection) pre-cancer (CIN2+) and / or AIS / CC diagnosis, compared to cytology assessment. Accordingly, applying the assay according to the invention would lead to improved triaging of women for colposcopy relative to cytology-based assessment. A negative DNA methylation assessment using the assay of the invention would indicate a very low probability of current or future (e.g. up to 6 years post sample collection) precancer (CIN2+) or AIS / CC. The DNA methylation assay of the invention can for example help provide objective and efficient means for referring women for invasive assessment to confirm a CIN2+ and / or CC diagnosis. These findings led to the establishment of the assay of the present invention. In any of the assays described herein, in a sample which has been taken from an individual, the sample comprises a population of DNA molecules. The individual may be healthy, and particularly free of CIN2+, AIS or CC. The individual may be asymptomatic or symptomatic of a cervical cancer. Symptoms of CC will be well known to a person of skill in the art. A symptom may comprise one or more of: - Bleeding from the vagina following sexual activity, occurring between menstrual cycles, or after menopause; - Menstrual bleeding characterized by increased heaviness and duration compared to the normal; - Thin, bloody discharge from the vagina; and - Pelvic discomfort or discomfort experienced during sexual intercourse. The sample may preferably be a cervicovaginal sample. The sample may have been self-collected or collected by a clinician. The sample may have been obtained using a swab of the cervical or upper vaginal region, preferably wherein the swab collects fluid drained from the uterine cavity. Any suitable device for sample collection from the cervix or vagina may be used. Preferably the sample for example has been obtained by contacting the cervix with a brush device which collects epithelial cells and / or fluid from the cervix to thereby obtaining a cervical liquid-based cytology sample, e.g. using a Cervex-Brush® released into ThinPrep (PreservCyte®). Alternatively, the sample may be obtained using a uterine lavage or an aspiration biopsy, for example by way of a pipelle biopsy. Alternatively, a uterine brush may be used to obtain a sample, e.g. a Tao brush. WO 2025 / 168613                                   PCT / EP2025 / 052932 The invention provides an assay for assessing the presence, absence or development of CIN2+ and / or CC in an individual, the assay comprising: a. providing a sample which has been taken from the individual, the sample comprising a population of DNA molecules; b. determining in the population of DNA molecules in the sample the methylation status of a test panel of three or more CpGs, wherein: i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 2, and wherein the at least one CpG is denoted by CG; and ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 3 and SEQ ID NO 4, and wherein the at least one CpG is denoted by CG; and iii. at least one CpG in the test panel is contained within a third DMR comprised in the population of DNA molecules, the third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 5 and SEQ ID NO 6, and wherein the at least one CpG is denoted by CG; and c. assessing the presence, absence or development of CIN2+ and / or CC in the individual based on the methylation status of the CpGs in the test panel. The assay of the invention may be further defined wherein: a. at least two CpGs denoted by CG contained within the first DMR, at least three CpGs denoted by CG contained within the first DMR, at least four CpGs denoted by CG contained within the first DMR, at least five CpGs denoted by CG contained within the first DMR, or all of the CpGs denoted by CG contained within the first DMR, are in the test panel of CpGs; b. at least two CpGs denoted by CG contained within the second DMR, at least three CpGs denoted by CG contained within the second DMR, at least four CGs denoted by CG contained within the second DMR, at least five CpGs denoted by CG contained within the second DMR, or all of the CpGs denoted by CG contained within the second DMR, are in the test panel of CpGs; and / or c. at least two CpGs denoted by CG contained within the third DMR, at least three CpGs denoted by CG contained within the third DMR, at least four CGs denoted by CG contained within the third DMR, at least five CpGs denoted by CG contained within the third DMR, or all of the CpGs denoted by CG contained within the third DMR, are in the test panel of CpGs. The assay of the invention may be further defined wherein at least two CpGs contained within the first DMR are contained within the test panel, at least two CpGs contained within the second DMR, and at least two CpGs contained within the third DMR are contained within the test panel. The assay of the invention may be further defined wherein at least three CpGs contained within the first DMR are contained within the test panel, at least three CpGs contained within the second DMR, and at least three CpGs contained within the third DMR are contained within the test panel. The assay of the invention may be further defined wherein at least four CpGs contained within the first DMR are contained within the test panel, at least four CpGs contained within the second DMR, and at least four CpGs contained within the third DMR are contained within the test panel. The assay of the invention may be further defined wherein at least five CpGs contained within the first DMR are contained within the test panel, at least five CpGs contained within the second DMR, and at least five CpGs contained within the third DMR are contained within the test panel. The assay of the invention may be further defined wherein all of the CpGs contained within at least one strand of the first DMR are contained within the test panel, all of the CpGs contained within at least one strand of the second DMR are contained within the test panel, and all of the CpGs contained within at least one strand of the third DMR are contained within the test panel. The assay of the invention may be further defined wherein all of the CpGs denoted contained within the first DMR are contained within the test panel, all of the CpGs denoted contained within the second DMR are contained within the test panel, and all of the CpGs denoted contained within the third DMR are contained within the test panel. In the assay of the invention, when the CpGs of the test panel of three or more CpGs are determined to be methylated, the individual is assessed as having CIN2+ and / or CC, or as being at risk of development of CIN2+ and / or CC. CIN2+ refers to CIN grade 2 cervical intra-epithelial neoplasia and higher grades. CIN2+ may therefore comprise CIN2, CIN3 and adenocarcinoma in situ (AIS). The assay of the invention may be for assessing the presence absence of development of CIN2, or CIN2+. CC may comprise any cervical cancer or cervical metastasis known in the art, for example squamous cell carcinoma such as an ectocervical cancer, or an adenocarcinoma such as an endocervical or ectocervical cancer. The cancer may be a new cancer, but may also be a recurring cancer. Cancer recurrence is a well understood term in the art, and may mean that the original cancer returns either in the same tissue, in an organ adjacent to the tissue where the cancer originated from (e.g. cervix) or elsewhere in the body. The cancer may be a metastasis of a cancer of the cervix or a metastasis present in the cervix yet originating in a cancer of an organ distinct from the cervix. Described herein are assays that utilise a statistically robust panel of three or more CpGs whose methylation status can be determined to provide a reliable prediction of the presence, absence or development of CIN2+ and / or CC in an individual. By determining the methylation status of each CpG within the panel of one or more CpGs, the individual’s cancer status or risk of developing CIN2+ and / or CC can be determined with statistically robust sensitivity and specificity. The skilled person would understand that the methylation status of each CpG within a panel of three or more CpGs can be determined by any suitable means. Any one method, or a combination of methods, may be used to determine the methylation status of each CpG within a panel of three or more CpGs. Various exemplary methods for determining the methylation status of each CpG within a panel of three or more CpGs are described herein. For example, in one method a percent methylated reference (PMR) value of a CpG may be determined. In another method the methylation P-values of a CpG may be determined. In another method, methylation-sensitive enzymes can be employed which digest or cut only in the presence of methylated DNA. Preferably such methods comprising the use of methylation-sensitive enzymes would not comprise subjecting the three or more CpGs in the test panel to bisulfite treatment, and would preferably further comprise digital PCR. Different mechanisms may be employed to determine specific values depending on the circumstances, such as PCR-based mechanisms or array-based mechanisms, and these different methods are discussed further herein in ‘Assessment of methylation status of CpGs’. As described herein, the methods of determining methylation status when applied to the assay of the invention can establish absence of CIN2+ and / or CC in the individual. Likewise, such methods can determine that an individual’s risk of CIN2+ and / or CC development or whether the individual has CIN2+ and / or CC. A skilled person will readily appreciate that methylation status of the test panel of three or more CpGs can indicate a “likelihood” or “risk” or “prediction” of any of the assays of the invention correctly assessing the presence, absence or development of CIN2+ and / or CC in an individual. This is because the assessment is based upon a correlation between DNA methylation profiles of tissue samples and individual disease status. Nevertheless, as demonstrated by data set out in the Examples and elsewhere herein, the assays of the invention provide such correlations with high statistical accuracy, thus providing the skilled person with a high degree of confidence that the the methylation status of the CpGs of the test panel for any individual whose CIN2+ and / or CC status is required to be tested will provide an accurate correlation with actual disease status for the individual. In the context of the present invention, “likelihood”, “risk” and “prediction” may be used synonymously with each other. Any references herein to sequences, genomic sequences and / or genomic coordinates are derived based upon Homo sapiens (human) genome assembly GRCh37 (hgl9). The skilled person would understand variations in the nucleotide sequences of any given sequence, particularly the sequences of SEQ ID NOs 1 to 8, may exist due to sequencing errors and / or variation between individuals. The assay of the invention represents a ‘prediction’ because the determination of any test panel of three or more CpGs in accordance with the invention is unlikely to be capable of diagnosing every individual as having or not having cancer with 100% specificity and 100% sensitivity. Rather, depending on the specific set of CpGs, the false positive and false negative rate will vary. In other words, the inventors have discovered that an assay comprising the determination of a test panel of CpGs wherein at least one CpGs is derived from a first DMR comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 2, and wherein at least one CpG is derived from a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 3 and SEQ ID NO 4, and wherein at least one CpG is derived from a third DMR comprised in the population of DNA molecules, the third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 5 and SEQ ID NO 6, assays of the invention can achieve variable levels of sensitivity and specificity for predicting the presence, absence or development of CIN2+ and / or CC, as defined by receiver operating characteristics. Such sensitivity and specificity can be seen from the data disclosed herein to be achievable at high proportions, demonstrating accurate and statistically-significant discriminatory capability. According to any of the assays or methods described herein, assessing the ‘development’ of CIN2+ and / or CC in the context of the invention may refer to assessing whether an individual is likely or unlikely to develop CIN2+ and / or CC. Assessing the development of CIN2+ and / or CC may therefore represent a prediction of the onset of CIN2+ and / or CC in an individual, or a prognosing of the likelihood of the onset of CIN2+ and / or CC in an individual. The individual may be healthy, and in particular the individual may be free of CIN2+, AIS or CC. The individual may have CIN2, CIN3 or AIS, and wherein the assay may predict or prognose the onset of CC in said individual. The CpGs of the assays of the invention may therefore indicate that cells of the cervix may eventually transform to cancer. Assessing the development of cancer in accordance with the assays of the invention may refer to assessing progression or worsening of a pre-existing cancer lesion in an individual. Assessment of the development of CIN2+ and / or CC in accordance with the assays of the invention may refer to predicting the likelihood of recurrence of cancer. In any of the assays described herein, the step of assessing the presence or development of CIN2+ and / or CC in an individual based may involve the application of a threshold value. This value may typically depend on the method used for determining the methylation status of the CpGs in the test panel of three or more CpGs. Typically, the threshold value will relate to the proportion methylated DNA molecules in the sample having positive methylation at three or more CpGs of the test panel. Determining the methylation status can be performed by any of the suitable methods described herein. In any of such assays of the invention, the assay may be characterised as having a ROC AUC of 0.60 or more, 0.61 or more, 0.62 or more, 0.63 or more, 0.64 or more, 0.65 or more, 0.66 or more, 0.67 or more, 0.68 or more, 0.69 or more, 0.70 or more, 0.71 or more, 0.72 or more, 0.73 or more, 0.74 or more, 0.75 or more, 0.76 or more, 0.77 or more, 0.78 or WO 2025 / 168613                                   PCT / EP2025 / 052932 more, 0.79 or more, 0.80 or more, 0.81 or more, 0.82 or more, 0.83 or more, 0.84 or more, 0.85 or more, 0.86 or more, 0.87 or more, 0.88 or more, 0.89 or more or 0.90 or more. Any of the assays described herein may further comprise determining in a sample which has been taken from the individual the presence or absence of human papilloma virus (HPV). The presence of HPV in the sample may indicate that the individual is positive for HPV infection. The determining of the presence or absence of HPV may comprises testing for the presence of DNA from HPV, preferably wherein the determining comprises genotyping. The skilled person would understand suitable means for genotyping HPV in a sample. The HPV may be any one or more subtypes of HPV known in the art, preferably wherein the HPV is known to be oncogenic and thereby known to indicate increased likelihood of the presence of CIN2+ and / or CC in the individual. The oncogenic HPV subtypes comprise subtype 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, and 59. More preferably the HPV subtype is 16 and / or 18. Preferably, any of the assays described herein may further comprise determining in a sample which has been taken from the individual the presence or absence of HPV 16 and HPV18. In any of the assays described herein the individual may be positive for one or more subtypes of HPV. The HPV may be any one or more subtypes of HPV known in the art, preferably wherein the HPV is known to indicate increased likelihood of the presence of CIN2+ and / or CC in the individual. The oncogenic HPV subtypes comprise subtype 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, and 59. More preferably the HPV subtype is 16 and / or 18. The individual is most preferably positive for HPV 16 and HPV18. Preferably, the step of determining the methylation status of the CpGs in the test panel may comprise an amplification-based technique. Amplification may be performed by any suitable method, such as polymerase chain reaction (PCR), polymerase spiral reaction (PSR), loop mediated isothermal amplification (LAMP), nucleic acid sequence based amplification (NASBA), self-sustained sequence replication (3SR), rolling circle amplification (RCA), strand displacement amplification (SDA), multiple displacement amplification (MDA), ligase chain reaction (LCR), helicase dependant amplification (HDA), ramification amplification method (RAM), recombinase polymerase amplification (RPA) etc. Preferably, amplification is performed by polymerase chain reaction (PCR). Optionally, wherein the PCR comprises quantification, further optionally wherein the PCR comprises real time quantitative PCR and / or digital PCR. The step of determining the methylation status of the CpGs contained within the first, second and third DMRs by PCR comprises: a. a duplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by CG in the first DMR, and PCR amplification of a region comprising one or more CpGs denoted by CG in the third DMR; and b. a duplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by CG in the second DMR, and PCR amplification of a control sequence within the same reaction vessel, preferably wherein the control sequence does not comprise any CpG dinucleotides, denoted by CG. Prior to PCR, the population of DNA molecules in the sample may be subject to bisulfite treatment, and preferably the three or more CpGs in the test panel may be subject to bisulfite treatment. Bisulfite treatment of nucleic acid molecules is a well-known procedure to the skilled person. In particular the skilled person would be aware of how to treat nucleic acid molecules with bisulfite in order to ensure that all unmethylated cytosines in the nucleic acid molecule are converted to uracil. The PCR reaction comprising PCR amplification of regions comprising one or more CpGs in the second DMR is preferably a duplex reaction further comprising PCR amplification of a control sequence, and preferably wherein said reactions are within the same reaction vessel. The control sequence preferably does not comprise any CpG dinucleotides. The control sequence is preferably defined according to SEQ ID NO: 7, and its reverse complement sequence SEQ ID NO: 8. When the assay comprises PCR that is quantified, sufficient input DNA material may preferably be used in the PCR reactions of the assay, preferably wherein the control sequence comprises or consists of a double stranded region defined by SEQ ID NO: 7 and SEQ ID NO: 8. Preferred methods for determining methylation status in the context of PCR may comprise amplification using forward and reverse primers together with a detection system. The detection system may comprise a probe for annealing to any one of the DMRs are sequences assayed according to the invention. The probe may comprise a detection moiety, or the probe may comprise a portion of sequence capable of hybridising to a component of the system comprising a detection moiety. The system may for example be a MethyLight system or a QuARTS (Quantitative allele-specific real-time target and signal amplification) system. Detection systems, including MethyLight and QuARTS, for use as part of a PCR assay for determining methylation status are well-known in the art. A preferred method for determining methylation status in the context of PCR and the assay of the invention is a MethyLight reaction. MethyLight reactions are well-known to the skilled person. MethyLight reactions are PCR reactions in that they comprise the use forward and reverse primers, however the reactions additionally comprise the use of a probe optionally comprising a detection moiety. The probe may for example comprise a nucleic acid sequence able to anneal to a sequence comprised within a sequence defined according to SEQ ID NOs 1-8 following bisulfite treatment, or to the complementary sequence of SEQ ID NOs 1-8 following bisulfite sequence, as described herein. Excitation, and subsequent emission by, said detection moiety indicates the presence and amplification of a sequence comprising a complementary sequence to said probe nucleic acid sequence. Preferably prior to such a PCR reaction, such as a MethyLight reaction, the population of DNA molecules in the sample have been subject to bisulfite treatment, more preferably wherein the three or more CpGs in the test panel have been subject to bisulfite treatment. Yet more preferably, the PCR can be further characterised wherein: a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 11; and / or b. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 14; and / or c. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 17 d. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising an a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 8 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 20. The PCR can be further characterised wherein: a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 11; and / or b. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 14; and c. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 17; and d. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising an a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 8 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 20. The PCR may further comprise a negative control. The negative control may be any suitable negative control known in the art. Preferably, the negative control is a PCR reaction absent any template nucleic acid sequence and optionally absent any PCR primer or probes. The negative control may be water. The PCR can be further characterised wherein: a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 11; and / or b. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 14; and c. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 17; and d. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising an a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 8 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 20; and e. a negative control. The assay may comprise assessing of the presence, absence or development of CIN2+ and / or CC in the individual based on methylation of the CpGs in the test panel comprises determination of mean percent of fully methylated reference (PMR) values for each DMR based on the methylation status of the CpGs from each DMR comprised in the test panel. The sum of the PMR values for each DMR (EPMR) may be used to assess the presence, absence or development of CIN2+ and / or CC in the individual. As described herein, there are many methods known to the skilled person that could be applied to determine methylation status of the test panel of three or more CpGs. However, an exemplary preferred approach for the determination of the methylation status of each CpG within the panel of three or more CpGs in the assay of the invention comprises PCR and wherein the PCR is characterised wherein: a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 11; and b. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 14; and c. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 17; d. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising an a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 8 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment; wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 20 and wherein the assay further comprises determination of mean percent of fully methylated reference (PMR) values for each strand based on the methylation status of the CpGs from each strand comprised in the test panel. The XPMR is thereby preferably used to assess the presence, absence or development of CIN2+ and / or CC in the individual. The individual may have AUB, and may be pre- or post-menopausal, and may be positive for HPV16 and / or HPV18. The sensitivity of the assay of the invention for determining the presence of CIN2+ in an individual is preferably at least 50%, more preferably at least 60% and most preferably at least 70%. Preferably, the XPMR for assessing the individual as having CIN2+ and / or CC, is more than 0. The cancer may also be assessed to be a metastasis of a cervical cancer. Determining the XPMR by the same method of determining methylation status by PMR, a XPMR of 0 is indicative of an absence of CIN2+ and / or CC in the individual. In the assay of the invention, where SUM-PMR (EPMR) is described as “above 0”, any SUM-PMR value that is above 0 is indicative of a positive prediction of CIN2+ and / or CC in accordance with the invention. For a negative prediction, the SUM-PMR must equal exactly zero. Whilst the preferred exemplary PMR-based assessment of methylation status of the CpGs in the test panel, and the subsequent assessment of risk by XPMR and specified thresholds can be used in accordance with the invention to assess the presence, absence or development of CIN2+ and / or CC in an individual, the skilled person would appreciate that alternative methods for determining methylation status can be utilised as described herein and the presence, absence or development of CIN2+ and / or CC in the individual may be determined accordingly. WO 2025 / 168613                                   PCT / EP2025 / 052932 A particularly preferred embodiment of the invention is therefore an assay for assessing the absence or development of CIN2+ and / or CC in an individual, the assay comprising: a. providing a sample which has been taken from the individual, the sample comprising a population of DNA molecules; b. determining in the population of DNA molecules in the sample the methylation status of a test panel of three or more CpGs, the panel comprising all of the CpGs contained within strand of the first DMR having the sequence set forth in SEQ ID NO 1, all of the CpGs contained within the strand of the second DMR having the sequence set forth in SEQ ID NO 3, and all of the CpGs contained within the strand of the third DMR having the sequence set forth in SEQ ID NO 5; and c. assessing the presence, absence or development of CIN2+ and / or CC in the individual based on the methylation status of the CpGs in the test panel, wherein the step of determining comprises PCR, and wherein the PCR is characterised wherein: i. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs in SEQ ID NO: 1 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 11; and ii. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs in SEQ ID NO: 3 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 14; and iii. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe comprising a detection moiety, wherein the reverse primer anneals to the sequence defined according to SEQ ID NO: 5 following bisulfite treatment; and the forward primer and probe primer anneals to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 17; and iv. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe comprising a detection moiety, wherein the reverse primer anneals to the sequence defined according to SEQ ID NO: 7 following bisulfite treatment; and the forward primer and probe primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 20, and wherein prior to the PCR, the population of DNA molecules is treated with bisulfite; and wherein the assay further comprises determining in a sample which has been taken from the individual the presence or absence of HPV16 and / or 18; and wherein the assay further comprises determination of mean percent of fully methylated reference (PMR) values for each DMR based on the methylation status of the CpGs from each DMR comprised in the test panel, and optionally wherein the XPMR is determined and the individual is assessed as: A. having CIN2+ and / or CC, optionally wherein the individual is positive for HPV16 and / or HPV18, when SUM-PMR is more than 0; B. not having CIN2+ and / or CC, when the SUM-PMR is 0. The invention also provides a variety of assays, each comprising any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more (or any range derivable therein) of a variety of steps and in no particular order, including methods of the following: measuring in a sample; analyzing a sample; assessing a sample; evaluating a sample; measuring nucleic acids in a sample; assessing nucleic acids in a sample; detecting nucleic acids in a sample; measuring methylation in nucleic acids in a sample; analyzing nucleic acids in a sample; assessing nucleic acids in a sample; measuring methylation at three or more CpG dinucleotides in a sample; detecting methylation at three or more CpG dinucleotides in a sample; assaying methylation at three or more CpG dinucleotides in a sample; assessing methylation at three or more CpG dinucleotides in a sample; measuring a methylation status in a sample; assaying a methylation status in a sample; detecting methylation status in a sample; determining methylation status in a sample; identifying methylation status in a sample; measuring three or more DNA methylation markers in a sample; assessing three or more DNA methylation markers in a sample; detecting three or more DNA methylation markers in a sample; measuring the presence of methylation at three or more markers in a sample; detecting the presence of methylation at three or more markers in a sample; assessing the presence of methylation at three or more markers in a sample; assaying the presence of one of more markers in a sample; measuring three or more DNA methylation markers in a sample but excluding the measuring of three or more other DNA methylation markers in the sample; assessing three or more DNA methylation markers in a sample but excluding the assessing of three or more other DNA methylation markers in the sample; analyzing three or more DNA methylation markers in a sample but excluding the analyzing of three or more other DNA methylation markers in the sample; detecting three or more DNA methylation markers in a sample but excluding the detecting of three or more other DNA methylation markers in the sample; measuring methylation status in nucleic acids from a sample from tissue from tissue of an individual suspected of, or at risk for, being cancerous; detecting methylation status in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; analyzing methylation status in nucleic acids from a sample from tissue from an individual from the individual suspected of, or at risk for, being cancerous; assessing methylation status in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; measuring methylation at three or more CpG dinucleotides in a sample but excluding the measuring of methylation at three or more CpG dinucleotides in the sample; assessing methylation at three or more CpG dinucleotides in a sample but excluding the assessing of methylation at three or more CpG dinucleotides in the sample; analyzing methylation at three or more CpG dinucleotides in a sample but excluding the analyzing of methylation at three or more CpG dinucleotides in the sample; detecting methylation at three or more CpG dinucleotides in a sample but excluding the detecting of methylation at three or more CpG dinucleotides in the sample; measuring methylation at three or more CpG dinucleotides in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; detecting methylation at three or more CpG dinucleotides in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; analyzing methylation at three or more CpG dinucleotides in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; assessing methylation at three or more CpG dinucleotides in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; treating an individual for cancer when the individual has been determined to have a methylation status at three or more methylation markers; treating an individual for cancer when the individual has been determined to have methylation at three or more CpG dinucleotides; wherein any of the aforementioned methods, or any other methods encompassed by the disclosure, may comprise any three or more of the following method steps: measuring methylation status, wherein the measuring identifies the methylation status of three or markers from nucleic acids in a sample; measuring methylation status, wherein the measuring identifies the presence of three or more markers from nucleic acids in a sample; measuring the presence of three or more methylation markers from a sample; providing DNA from a sample; providing nucleic acids from a sample; determining whether three or more methylation markers from nucleic acids from a sample are methylated; measuring whether three or more methylation markers from nucleic acids from a sample are methylated; performing a sequencing step on nucleic acids from a sample; determining a sequence of nucleic acids from a sample; performing bisulphite conversion on three or more markers; performing bisulphite conversion on three or more CpG dinucleotides; WO 2025 / 168613                                   PCT / EP2025 / 052932 hybridizing DNA to an array comprising probes capable of determining methylated versus non-methylated markers; hybridizing DNA to an array comprising probes capable of determining methylated versus non-methylated CpG dinucleotides; hybridizing DNA to an array comprising probes capable of discriminating between methylated and non-methylated markers; hybridizing DNA to an array comprising probes capable of discriminating between methylated and non-methylated CpG dinucleotides; performing an amplification step on sequence from nucleic acids from a sample; performing an amplification step on sequence from nucleic acids using methylation-specific primers; performing amplification of sequence comprising three or more regions suspected of having methylation or in need of determination of a methylation status; performing PCR on sequence comprising three or more regions suspected of having methylation or in need of determination of a methylation status; performing a capturing step; performing a binding step; performing a purification step; performing a capturing step comprising binding of polynucleotides comprising three or more methylation markers to binding molecules specific to the three or more methylation markers and collecting complexes thereof; stratifying the grade of a cancer; determining the risk of cancer; determining the risk of recurrence of cancer; obtaining a sample from an individual; obtaining DNA from a sample from an individual; administering a treatment to an individual; providing DNA from a sample; determining whether three or more methylation markers from a panel of methylation markers comprises a specific sequence; and / or obtaining data that identifies whether each one of a group of methylation markers from a panel comprises a specific sequence. Moreover, in some aspects of the invention, an individual who is administered a therapy or treatment has been subjected to any of the methods and steps described herein. Assessment of methylation status of CpGs Methylation of DNA is a recognised form of epigenetic modification which has the capability of altering the expression of genes and other elements such as microRNAs. In cancer development and progression, methylation may have the effect of e.g. silencing tumor suppressor genes and / or increasing the expression of oncogenes. Other forms of dysregulation may occur as a result of methylation. Methylation of DNA occurs at discrete loci which are predominately dinucleotides consisting of a CpG motif, but may also occur at CHH motifs (where H is A, C, or T). During methylation, a methyl group is added to the fifth carbon of cytosine bases to create methylcytosine. Methylation can occur throughout the genome and is not limited to regions with respect to an expressed sequence such as a gene. Methylation typically, but not always, occurs in a promoter or other regulatory region of an expressed sequence such as enhancer elements. Most typically, the methylation status of CpGs is clustered in CpG islands, for example CpG islands present in the regulatory regions of genes, especially in their promoter regions. Typically, an assessment of DNA methylation status involves analysing the presence or absence of methyl groups in DNA, for example methyl groups on the 5 position of one or more cytosine nucleotides. Preferably, the methylation status of one or more cytosine nucleotides present as a CpG dinucleotide (where C stands for Cytosine, G for Guanine and p for the phosphate group linking the two) is assessed. A variety of techniques are available for the identification and assessment of CpG methylation status, as will be outlined briefly below. The assays described herein encompass any suitable technique for the determination of CpG methylation status. Methyl groups are lost from a starting DNA molecule during conventional in vitro handling steps such as PCR. To avoid this, techniques for the detection of methyl groups commonly involve the preliminary treatment of DNA prior to subsequent processing, in a way that preserves the methylation status information of the original DNA molecule. Such preliminary techniques involve three main categories of processing, i.e. bisulphite modification, restriction enzyme digestion and affinity-based analysis. A bisulfite-free preliminary technique may comprise TET-assisted pyridine borane sequencing (TAPS) combined with ten-eleven translocation (TET) oxidation of 5mC and 5hmC to 5-carboxylcytosine (5caC), and subsequent pyridine borane reduction of 5caC to dihydrouracil (DHU) for the detection of DNA methylation. Products of these techniques WO 2025 / 168613                                   PCT / EP2025 / 052932 can then be coupled with sequencing or array-based platforms for subsequent identification or qualitative assessment of CpG methylation status. Techniques involving bisulphite modification of DNA have become the most common assays for detection and assessment of methylation status of CpG dinucleotides. Treatment of DNA with bisulphite, e.g. sodium bisulphite, converts cytosine bases to uracil bases, but has no effect on 5-methylcytosines. Thus, the presence of a cytosine in bisulphite-treated DNA is indicative of the presence of a cytosine base which was previously methylated in the starting DNA molecule. Such cytosine bases can be detected by a variety of techniques. For example, primers specific for unmethylated versus methylated DNA can be generated and used for PCR-based identification of methylated CpG dinucleotides. DNA may be amplified, either before or after bisulphite conversion. A separation / capture step may be performed, e.g. using binding molecules such as complementary oligonucleotide sequences. Standard and next-generation DNA sequencing protocols can also be used. Accordingly, in any of the methods described and defined herein, steps of determining in the population of DNA molecules in the sample the methylation status of CpGs in a test panel may be performed by methods which comprise subjecting CpGs to bisulfite treatment, e.g. subjecting the population of DNA molecules in the sample to bisulfite treatment. Any such method may further comprise an amplification step, preferably a PCR amplification step, such as any PCR amplification step described and defined herein. Quantitative allele-specific real-time target and signal amplification (QuARTS) may also be applied to the invention described herein in order to determine in the population of DNA molecules in the sample the methylation status of a test panel of three or more CpGs. QuARTS is known in the art. QuARTS combines a polymerase-based target amplification with an invasive cleavage-based signal amplification. The fluorescence signal is detected in a fashion similar to real-time PCR. Accordingly, in any of the methods described and defined herein, steps of determining in the population of DNA molecules in the sample the methylation status of CpGs in a test panel may be performed by methods which comprise subjecting CpGs to bisulfite treatment, e.g. subjecting the population of DNA molecules in the sample to bisulfite treatment. Any such method may further comprise a PCR amplification step, preferably wherein the PCR amplification step comprises the use of a forward primer, a reverse primer and a detection system, wherein the detection system may comprise a probe for annealing to any one of the DMRs or sequences assayed according to the invention, wherein the probe may comprise a portion of sequence capable of hybridising to a component of the system comprising a detection moiety. In other approaches, methylation-sensitive enzymes can be employed which digest or cut only in the presence of methylated DNA. Such enzyme-based approaches optionally do not require bisulfite treatment of the DNA being assayed. Analysis of resulting fragments is commonly carried out using microarrays. Affinity-based techniques exploit binding interactions to capture fragments of methylated DNA for the purposes of enrichment. Binding molecules such as anti-5-methylcytosine antibodies are commonly employed prior to subsequent processing steps such as PCR and sequencing. Olkhov-Mitsel and Bapat (2012) provide a comprehensive review of techniques available for the identification and assessment of biomarkers involving methylcytosine. For the purposes of assessing the methylation status of the CpG-based biomarkers characterised and described herein, any suitable assay can be employed. Assays described herein may comprise determining methylation status of CpGs by bisulphite converting the DNA. Preferred assays involve bisulphite treatment of DNA, including amplification of the identified CpG loci for methylation specific PCR and / or sequencing and / or assessment of the methylation status of target loci using methylation-discriminatory microarrays. Amplification of CpG loci can be achieved by a variety of approaches. Preferably, CpG loci are amplified using PCR. A variety of PCR-based approaches may be used. For example, methylation-specific primers may be hybridized to DNA containing the CpG sequence of interest. Such primers may be designed to anneal to a sequence derived from either a methylated or non-methylated CpG locus. Following annealing, a PCR reaction is performed and the presence of a subsequent PCR product indicates the presence of an annealed CpG of identifiable sequence. In such assays, DNA is bisulphite converted prior to amplification. Such techniques are commonly referred to as methylation specific PCR (MSP) In other techniques, PCR primers may anneal to the CpG sequence of interest independently of the methylation status, and further processing steps may be used to determine the status of the CpG. Assays are designed so that the CpG site(s) are located between primer annealing sites. This assay scheme is used in techniques such as bisulphite genomic sequencing, COBRA, Ms-SNuPE. In such assay, DNA can be bisulphite converted before or after amplification. Small-scale PCR approaches may be used. Such approaches commonly involve mass partitioning of samples (e.g. digital PCR). These techniques offer robust accuracy and sensitivity in the context of a highly miniaturised system (pico-liter sized droplets), ideal for the subsequent handling of small quantities of DNA obtainable from the potentially small volume of cellular material present in biological samples, particularly urine samples. A variety of such small-scale PCR techniques are widely available. For example, microdroplet-based PCR instruments are available from a variety of suppliers, including RainDance Technologies, Inc. (Billerica, MA; http: / / raindancetech.com / ) and Bio-Rad, Inc. (http: / / www.bio-rad.com / ). Digital PCR from Qiagen and Thermofisher may also be suitable. Microarray platforms may also be used to carry out small-scale PCR. Such platforms may include microfluidic network-based arrays e.g. available from Fluidigm Corp, (www.fluidigm.com). Following amplification of CpG loci, amplified PCR products may be coupled to subsequent analytical platforms in order to determine the methylation status of the CpGs of interest. For example, the PCR products may be directly sequenced to determine the presence or absence of a methylcytosine at the target CpG or analysed by array-based techniques. Any suitable sequencing techniques may be employed to determine the sequence of target DNA. In the assays of the present invention the use of high-throughput, so-called “second generation”, “third generation” and “next generation” techniques to sequence bisulphite-treated DNA can be used. In second generation techniques, large numbers of DNA molecules are sequenced in parallel. Typically, tens of thousands of molecules are anchored to a given location at high density and sequences are determined in a process dependent upon DNA synthesis. Reactions generally consist of successive reagent delivery and washing steps, e.g. to allow the incorporation of reversible labelled terminator bases, and scanning steps to determine the order of base incorporation. Array-based systems of this type are available commercially e.g. from Illumina, Inc. (San Diego, CA; http: / / www.illumina.com / ). Third generation techniques are typically defined by the absence of a requirement to halt the sequencing process between detection steps and can therefore be viewed as realtime systems. For example, the base-specific release of hydrogen ions, which occurs during the incorporation process, can be detected in the context of microwell systems (e.g. see the Ion Torrent system available from Life Technologies; http: / / www.lifetechnologies.com / ). Similarly, in pyrosequencing the base-specific release of pyrophosphate (PPi) is detected and analysed. In nanopore technologies, DNA molecules are passed through or positioned next to nanopores, and the identities of individual bases are determined following movement of the DNA molecule relative to the nanopore. Systems of this type are available commercially e.g. from Oxford Nanopore (https: / / www.nanoporetech.com / ). In an alternative assay, a DNA polymerase enzyme is confined in a “zero-mode waveguide” and the identity of incorporated bases are determined with florescence detection of gamma-labeled phosphonucleotides (see e.g. Pacific Biosciences; http: / / www.pacificbiosciences.com / ). In other assays sequencing steps may be omitted. For example, amplified PCR products may be applied directly to hybridization arrays based on the principle of the annealing of two complementary nucleic acid strands to form a double-stranded molecule. Hybridization arrays may be designed to include probes which are able to hybridize to amplification products of a CpG and allow discrimination between methylated and nonmethylated loci. For example, probes may be designed which are able to selectively hybridize to an CpG locus containing thymine, indicating the generation of uracil following bisulphite conversion of an unmethylated cytosine in the starting template DNA. Conversely, probes may be designed which are able to selectively hybridize to a CpG locus containing cytosine, indicating the absence of uracil conversion following bisulphite treatment. This corresponds with a methylated CpG locus in the starting template DNA. Following the application of a suitable detection system to the array, computerbased analytical techniques can be used to determine the methylation status of a CpG. Detection systems may include, e.g. the addition of fluorescent molecules following a methylation status-specific probe extension reaction. Such techniques allow CpG status determination without the specific need for the sequencing of CpG amplification products. Such array-based discriminatory probes may be termed methylation-specific probes. Any suitable methylation-discriminatory microarrays may be employed to assess the methylation status of the CpGs described herein. One particular methylation-discriminatory microarray system is provided by Illumina, Inc. (San Diego, CA; http: / / www.illumina.com / ). In particular, the Infinium MethylationEPIC BeadChip array and the Infinium HumanMethylation450 BeadChip array systems may be used to assess the methylation status of CpGs for predicting cancer development as described herein. Such a system exploits the chemical modifications made to DNA following bisulphite treatment of the starting DNA molecule. Briefly, the array comprises beads to which are coupled oligonucleotide probes specific for DNA sequences corresponding to the unmethylated form of a CpG, as well as separate beads to which are coupled oligonucleotide probes specific for DNA sequences corresponding to the methylated form of an CpG. Candidate DNA molecules are applied to the array and selectively hybridize, under appropriate conditions, to the oligonucleotide probe corresponding to the relevant epigenetic form. Thus, a DNA molecule derived from a CpG which was methylated in the corresponding genomic DNA will selectively attach to the bead comprising the methylation-specific oligonucleotide probe, but will fail to attach to the bead comprising the non-methylation-specific oligonucleotide probe. Single-base extension of only the hybridized probes incorporates a labeled ddNTP, which is subsequently stained with a fluorescence reagent and imaged. The methylation status of the CpG is determined by calculating the ratio of the fluorescent signal derived from the methylated and unmethylated sites. Infinium HumanMethylation450 and MethylationEPIC BeadChip array systems and custom-built arrays can be used to interrogate CpGs in the assays described herein. Alternative or customised arrays could, however, be employed to interrogate the CIN2+ and / or cancer-specific CpG biomarkers defined herein, provided that they comprise means for interrogating all CpG for a given assay, as defined herein. Techniques involving combinations of the above-described assays may also be used. For example, DNA containing CpG sequences of interest may be hybridized to microarrays and then subjected to DNA sequencing to determine the status of the CpG as described above. In the assays described above, sequences corresponding to CpG loci may also be subjected to an enrichment process if desired. DNA containing CpG sequences of interest may be captured by binding molecules such as oligonucleotide probes complementary to the CpG target sequence of interest. Sequences corresponding to CpG loci may be captured before or after bisulphite conversion or before or after amplification. Probes may be designed to be complementary to bisulphite converted DNA. Captured DNA may then be subjected to further processing steps to determine the status of the CpG, such as DNA sequencing steps. Capture / separation steps may be custom designed. Alternatively, a variety of such techniques are available commercially, e.g. the SureSelect target enrichment system available from Agilent Technologies (http: / / www.agilent.com / home). In this system biotinylated “bait” or “probe” sequences (e.g. RNA) complementary to the DNA containing CpG sequences of interest are hybridized to sample nucleic acids. Streptavidin- coated magnetic beads are then used to capture sequences of interest hybridized to bait sequences. Unbound fractions are discarded. Bait sequences are then removed (e.g. by digestion of RNA) thus providing an enriched pool of CpG target sequences separated from non-CpG sequences. Template DNA may be subjected to bisulphite conversion and target loci amplified by small-scale PCR such as microdroplet PCR using primers which are independent of the methylation status of the CpG. Following amplification, samples may be subjected to a capture step to enrich for PCR products containing the target CpG, e.g. captured and purified using magnetic beads, as described above. Following capture, a standard PCR reaction is carried out to incorporate DNA sequencing barcodes into CpG-containing amplicons. PCR products are again purified and then subjected to DNA sequencing and analysis to determine the presence or absence of a methylcytosine at the target genomic CpG. CpG methylation status may be measured indirectly using a detection system such as fluorescence. A methylation-discriminatory microarray may be used. When calculating the degree of methylation of a given CpG, the Illumina® definition of beta-values may be used. The Illumina® methylation beta-value of a specific CpG site is calculated from the intensity of the methylated (M) and unmethylated (U) alleles, as the ratio of fluorescent signals P=Max(M,0) / [Max(M,0)+Max(U,0)+100]. On this scale, 0<P<l, P values of 1 or close to 1 indicate 100% methylation whereas values of 0 or close to 0 indicate 0% methylation. As explained in more detail in the Examples below, one particular exemplary technique which the inventors have used is a methylation discriminatory array, such as an Illumina InfiniumMethylation EPIC BeadChip. These assays utilise probes directed to methylated and unmethylated CpGs at a given locus. Another exemplary technique which the inventors have used to determine the methylation status of any one or more CpGs is a fluorescence-based PCR technique referred to as MethyLight. These assays utilise forward and reverse PCR primers specific for sequences encompassing a DMR such as those described herein. The methylation status of one or more CpGs contained within said DMRs may therefore be determined by MethyLight analysis. The assays also utilise detectable probes for specific regions within the one or more CpGs that are to be assayed. The detectable probes are typically designed such that they hybridise only to methylated forms of the one or more CpGs to be assayed. Exemplary forward and reverse PCR primers and detectable probes that target regions within DMRs 1 to 3 are defined according to SEQ ID NOs 9 to 17. Other techniques which may be used to determine the methylation status of any one or more CpGs include the use of restriction enzymes. Such methods may employ methylation-sensitive enzymes which only digest unmethylated DNA and / or methylationdependent enzymes which only cut methylated DNA. Such enzymes may be used to enrich for methylated or unmethylated sequences and provide a read-out of DNA methylation. Accordingly, in any of the methods described and defined herein, steps of determining in the population of DNA molecules in the sample the methylation status of CpGs in a test panel may be performed by methods which comprise subjecting the population of DNA molecules in the sample to endonuclease treatment, such as restriction endonuclease treatment. Any such method may further comprise an amplification step, preferably a PCR amplification step. Bioinformatic tools and statistical metrics for CpG-based assays Software programs which aid in the in silico analysis of bisulphite converted DNA sequences and in primer design for the purposes of methylation-specific analyses are generally available and have been described previously. In risk models for predicting CIN2+ and / or cancer, a receiver-operating-characteristic (ROC) curve analysis is often used, in which the area under the curve (AUC) is assessed. Each point on the ROC curve shows the effect of a rule for turning a risk / likelihood estimate into a prediction of the presence, absence or development of cancer in an individual. The AUC measures how well the model discriminates between case subjects and control subjects. An ROC curve that corresponds to a random classification of case subjects and control subjects is a straight line with an AUC of 50%. An ROC curve that corresponds to perfect classification has an AUC of 100%. In any of the methods described herein, the 95% confidence interval for the ROC AUC may be between 0.60 and 1. In any of the methods described herein, the interval may be defined as a range having as an upper limit any number between 0.60 and 1. The upper limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99 or 1.00. In any of the methods described herein, the interval may be defined as a range having as a lower limit any number between 0.60 and 1. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, WO 2025 / 168613                                   PCT / EP2025 / 052932 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99 or 1.00. In any of the methods described herein, the interval range may comprise any of the above lower limit numbers combined with any of the above upper limit numbers as appropriate. Preferably, the upper limit number is 1. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 1 and as a lower limit any number between 0.60 and 1. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97,0.98,0.99 or 1.00. The upper limit number may be 0.99. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.99 and as a lower limit any number between 0.60 and 0.99. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97,0.98 or 0.99. The upper limit number may be 0.98. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.98 and as a lower limit any number between 0.60 and 0.98. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97 or 0.98. The upper limit number may be 0.97. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.97 and as a lower limit any number between 0.60 and 0.97. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96 or 0.97. The upper limit number may be 0.96. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.96 and as a lower limit any number between 0.60 and 0.96. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, WO 2025 / 168613                                   PCT / EP2025 / 052932 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95 or 0.96. The upper limit number may be 0.95. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.95 and as a lower limit any number between 0.60 and 0.95. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94 or 0.95. The upper limit number may be 0.94. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.94 and as a lower limit any number between 0.60 and 0.94. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93 or 0.94. The upper limit number may be 0.93. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.93 and as a lower limit any number between 0.60 and 0.93. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92 or 0.93. The upper limit number may be 0.92. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.92 and as a lower limit any number between 0.60 and 0.92. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91 or 0.92. The upper limit number may be 0.91. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.91 and as a lower limit any number between 0.60 and 0.91. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90 or 0.91. The upper limit number may be 0.90. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.90 and as a lower limit any number between 0.60 and 0.90. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89 or 0.90. The upper limit number may be 0.89. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.89 and as a lower limit any WO 2025 / 168613                                   PCT / EP2025 / 052932 number between 0.60 and 0.89. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88 or 0.89. The upper limit number may be 0.88. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.88 and as a lower limit any number between 0.60 and 0.88. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87 or 0.88. The upper limit number may be 0.87. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.87 and as a lower limit any number between 0.60 and 0.87. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86 or 0.87. The upper limit number may be 0.86. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.86 and as a lower limit any number between 0.60 and 0.86. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85 or 0.86. The upper limit number may be 0.85. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.85 and as a lower limit any number between 0.60 and 0.85. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84 or 0.85. The upper limit number may be 0.84. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.84 and as a lower limit any number between 0.60 and 0.84. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81,0.82, 0.83 or 0.84. The upper limit number may be 0.83. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.83 and as a lower limit any number between 0.60 and 0.83. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81,0.82 or 0.83. The upper limit number may be 0.82. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.82 and as a lower limit any number between 0.60 and 0.82. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81 or 0.82. The upper limit number may be 0.81. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.81 and as a lower limit any number between 0.60 and 0.81. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80 or 0.81. The upper limit number may be 0.80. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.80 and as a lower limit any number between 0.60 and 0.80. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79 or 0.80. The upper limit number may be 0.79. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.79 and as a lower limit any number between 0.60 and 0.79. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78 or 0.79. The upper limit number may be 0.78. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.78 and as a lower limit any number between 0.60 and 0.78. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77 or 0.78. The upper limit number may be 0.77. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.77 and as a lower limit any number between 0.60 and 0.77. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76 or 0.77. The upper limit number may be 0.76. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.76 and as a lower limit any number between 0.60 and 0.76. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75 or 0.76. The upper limit number may be 0.75. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.75 and as a lower limit any number between 0.60 and 0.75. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74 or 0.75. The upper limit number may be 0.74. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.74 and as a lower limit any number between 0.60 and 0.74. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73 or 0.74. The upper limit number may be 0.73. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.73 and as a lower limit any number between 0.60 and 0.73. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72 or 0.73. The upper limit number may be 0.72. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.72 and as a lower limit any number between 0.60 and 0.72. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71 or 0.72. The upper limit number may be 0.71. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.71 and as a lower limit any number between 0.60 and 0.71. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70 or 0.71. The upper limit number may be 0.70. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.70 and as a lower limit any number between 0.60 and 0.70. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69 or 0.70. In vitro DNA methylation methods The invention provides an in vitro method of assaying DNA and detecting methylation of the DNA therein, the method comprising measuring a methylation status of a test panel of three or more CpGs, wherein: i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 2, and wherein the at least one CpG is denoted by CG; ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by WO 2025 / 168613                                   PCT / EP2025 / 052932 complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 3 and SEQ ID NO 4, and wherein the at least one CpG is denoted by CG; and iii. at least one CpG in the test panel is contained within a third DMR comprised in the population of DNA molecules, the third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 5 and SEQ ID NO 6, and wherein the at least one CpG is denoted by CG. The measuring of methylation status may be performed according to the determining step according to the assay of the invention. The test panel of the in vitro method may be defined according to the test panel of the assay of the invention. The in vitro method may comprise PCR that is defined in accordance with the PCR of the assay of the invention. Primer and probes may be used in the in vitro method of the invention which are identical to the primer and probes of the assay of the invention. PCR in the in vitro method may comprise the use of a negative control defined according to the assay of the invention. System and kit of parts As explained in more detail herein, provided is a system and a kit. The system is suitable for a PCR assay, preferably providing components when utilised in combination function to provide a PCR assay. The system may comprise a combination of components which may be produced, sold and distributed separately and which together may optionally form a kit, or simply a combination of physical products, for example a combination of products in use, e.g. in a PCR reaction. The system provided herein is for a PCR assay, the system comprising: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated. The system may further comprise a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 7 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment of SEQ ID NO: 7. Most preferably, the system comprises: i. a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 11; and ii. a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 14; iii. a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 17; iv. a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 7 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment of SEQ ID NO: 7; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 20. The kit comprises: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of WO 2025 / 168613                                   PCT / EP2025 / 052932 SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated. The kit may further comprise a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 7 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment of SEQ ID NO: 7. Most preferably, the kit comprises: i. a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 11; and ii. a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 14; iii. a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 17; iv. a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 7 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment of SEQ ID NO: 7; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 20. The kit may further comprise instructions for use. Method of treatment and diagnosis The term “treatment” as used herein is intended to refer to any intervention or procedure performed on an individual, including a surgical intervention, or a pharmacological intervention such as the administration of a compound or drug, or screening intervention. Any such treatment may be performed for therapeutic purposes or for preventative or prophylactic purposes. The invention also encompasses the performance of one or more treatment steps following a positive classification of CIN2+ and / or CC, particularly squamous cell carcinoma such as an ectocervical cancer, or an adenocarcinoma such as an endocervical or ectocervical cancer, based on any of the assays described herein. Said treatments may be considered “therapeutic” treatments. The invention also encompasses the performance of one or more treatment steps following a negative classification of CIN2+ and / or CC or prediction of an individual being at risk of development of CIN2+ and / or CC, based on any of the methods described herein. Said treatments may be considered “risk prevention”, “preventative” or “prophylactic” treatments. The invention thus encompasses a method of treating a CIN2+ and / or CC patient, particularly a CC patient, comprising administering chemotherapy, radiation, immunotherapy or any cancer therapy described herein to the patient assessed to be CIN2+ and / or positive for CC based on any of the assays described herein, particularly wherein the CC is squamous cell carcinoma such as an ectocervical cancer, or an adenocarcinoma such as an endocervical or ectocervical cancer. The invention therefore provides a method of treating and / or preventing CIN2+ and / or CC in an individual, the method comprising: i. assessing the presence, absence or development of CIN2+ and / or CC in an individual according to any one of claims 1 to 12; and ii. administering one or more therapeutic or preventative treatments or measures to the individual based on the assessment. The step of administering one or more treatments may comprise different treatment steps depending on the stratification of an individual on the basis of their CIN2+ and / or CC status or their risk of having CIN2+ and / or CC or on the basis of risk of CIN2+ and / or CC development, particularly wherein the CC is squamous cell carcinoma such as an ectocervical cancer, or an adenocarcinoma such as an endocervical or ectocervical cancer. Particularly the amount of an invasiveness of the treatments administered may vary dependent on the stratification of an individual on the basis of their CIN2+ and / or CC WO 2025 / 168613                                   PCT / EP2025 / 052932 status or their risk of having CIN2+ and / or CC or on the basis of their risk of CIN2+ and / or CC development. The treatments administered to the individual may comprise any treatments considered suitable by a person skilled in the art. For example, the treatments administered to the individual may comprise: - further examinations such as colposcopyand, if applicable, biopsy; and / or - surgical therapy such as excision, ablation, trachelectomy; radical hysterectomy, and / or - chemotherapy, radiation therapy, immunotherapy or any suitable cancer therapy where the CC is invasive. For example, when the individual is subject to the assay of the invention, and when the EPMR is more than 0, the individual is subjected to one or more treatments described herein according to their CIN2+ and / or CC status and risk, and most preferably wherein the one or more treatments comprises at least colposcopy and / or biopsy and / or a cervical cytology test. In case colposcopy and / or biopsy and / or cervical cytology assessments are negative for CIN2+ and / or CC, the assay according to the invention should be repeated in about 6 months, and a further colposcopy and / or biopsy and / or cervical cytology test should be performed if the DNA methylation as determined herein e.g. by EPMR has not decreased. Methods of monitoring The invention also provides methods of monitoring the CIN2+ and / or CC status and / or the risk of CIN2+ and / or CC development of an individual. The invention is therefore for monitoring the presence, or risk of the presence of development, of CIN2+ and / or CC in the individual. CC is particularly a squamous cell carcinoma such as an ectocervical cancer, or an adenocarcinoma such as an endocervical or ectocervical cancer. “Monitoring” in the context of the present invention may refer to longitudinal assessment of an individual’s CIN2+ and / or CC status, risk of having CIN2+ and / or CC or risk of CIN2+ and / or CC development. This longitudinal assessment may be carried out according to any of the assays of the invention described herein. This longitudinal assessment may involve performance of any of the assays of the invention described herein to predict the presence or development of CIN2+ and / or CC in an individual at more than one time point over the course of an undetermined time window. The time window may be any period of time whilst the individual is still living. The time window may persist for the lifetime of the individual. The time window may persist until the individual’s CIN2+ and / or CC status, risk of having CIN2+ and / or CC or risk of CIN2+ and / or CC development falls below a certain level. The level may be determined by the methylation status of the three or more CpGs in the test panel. The level may be determined by any of the methods for determining methylation described herein. The level may preferably be determined by a mean percent of fully methylated reference (PMR) values for each DMR based on the methylation status of the CpGs from each DMR comprised in the test panel, preferably wherein the sum of the PMR values for each DMR (EPMR) may be used to assess the presence, absence or development of CIN2+ and / or CC in the individual and therefore the level of risk. The invention therefore provides a method of monitoring the CIN2+ and / or CC status and / or the risk of cancer development of an individual, the method comprising: (a) assessing the presence, absence or development of CIN2+ and / or CC in an individual by performing the assay according to the invention at a first time point; (b) assessing the presence, absence or development of CIN2+ and / or CC in the individual by performing the assay according to the invention at one or more further time points; and (c) monitoring any change in the CIN2+ and / or CC status and / or the risk of CIN2+ and / or CC development of the individual, particularly wherein the cancer is a squamous cell carcinoma such as an ectocervical cancer, or an adenocarcinoma such as an endocervical or ectocervical cancer. In any of the methods of monitoring described herein, the steps of assessing the presence, absence or development of CIN2+ and / or CC in an individual based on a threshold CIN2+ and / or CC risk, for example as described in the method of treatment stratification provided herein. Threshold values can provide an indication of an individual’s CIN2+ and / or CC status, risk of having CIN2+ and / or CC or an individual’s risk of CIN2+ and / or CC development. For example, methylation status of the test panel of CpGs may indicate the presence or absence of CIN2+ and / or CC, or a high or low risk of harbouring or developing CIN2+ and / or CC. The invention further encompasses a method of measuring methylation in a patient at multiple time points comprising (a) assessing the presence, absence or development of CIN2+ and / or CC in an individual by performing any one of the assays of the invention described herein at a first time point; (b) assessing the presence, absence or development of CIN2+ and / or CC in the individual by performing any one of the assays of the invention described herein at one or more further time points, and (c) detecting differential WO 2025 / 168613                                   PCT / EP2025 / 052932 methylation status between (a) and (b), monitoring any change in the CIN2+ or CC status and / or the risk of CIN2+ and / or CC development of the individual. In any of the methods of monitoring described herein, the individual may be HPV positive, particularly HPV 16 and / or HPV 18 positive. The individual may already harbour CC, particularly a squamous cell carcinoma such as an ectocervical cancer, or an adenocarcinoma such as an endocervical or ectocervical cancer. The individual may not have cancer. In any of the methods of monitoring described herein, depending on the risk of the presence or development of cancer in the individual, one or more treatments are administered to the individual according to any one of the methods of treatment encompassed by the invention and described herein, or for example wherein the EPMR as described herein is 0 no treatment is administered to the individual. Preferably, the EPMR is determined wherein the test panel of three or more CpGs comprises or consists of the CpGs contained with at least one strand of each of the DMRs 1-3. Different treatments may be administered depending on the stratification of an individual on the basis of their CIN2+ and / or CC, risk of having CIN2+ and / or CC or on the basis of their risk of CIN2+ and / or CC development. The method may further comprise administration of one or more treatments according to the methods of treatment provided herein. Methylation status of the CpGs of the test panel, and therefore CIN2+ and / or CC risk, may change between any two or more time points. For this reason, longitudinal monitoring of an individual’s CpG methylation status and cancer risk could be of particular benefit to the assessment of, for example, cancer progression, prevention of recurrence of cancer, cancer treatment efficacy, or cancer efficacy. In any of the methods of monitoring described herein, the one or more further time points may be any suitable time point. Preferably the one or more further time points may of suitable distance apart for sufficiently frequent screening in order to predict any particularly early onset cases of presence or development of CIN2+ and / or CC in an individual. Preferably the one or more further time points may be of suitable distance apart for assessing the efficacy of one or more treatments. Preferably the one or more further time points may be of suitable distance apart for predicting whether an individual remains free of cancer after a successful course of treatment. The one or more further time points may be about monthly, about two monthly, about three monthly, about four monthly, about five monthly, about six monthly, about seven monthly, about eight monthly, about nine WO 2025 / 168613                                   PCT / EP2025 / 052932 monthly, about ten monthly, about eleven monthly, about yearly, about two yearly, or more than two yearly. In any of the methods of monitoring described herein, changes may be made to the one or more treatments wherein a positive or negative responses to the one or more treatments are observed. Treatments may be changed in accordance with the methods of treatments described herein. Treatments may particularly be changed if the individual’s CIN2+ and / or CC status or risk stratification as described herein with respect to the methods of treatment provided herein. In any of the methods of monitoring encompassed by the invention, the step of predicting the presence or development of CIN2+ and / or CC in an individual may involve the use of any one of the arrays described herein. EXAMPLES The present invention will now be described with reference to specific Examples, which should not be construed as in any way limiting. EXAMPLE 1 - Cervical cancer screening using DNA methylation triage: a population-based cohort study ABSTRACT Background: Cervical cancer screening comprises oncogenic human papillomavirus (HPV) testing followed by cytology-based triage of positive cases. Whether DNA methylation instead of cytology can be used for triaging HPV positive women is currently unknown. We performed a longitudinal assessment of HPV positive women utilizing an objective, automated DNA methylation analysis pipeline. Methods: We accessed the Swedish National Cervical Screening Registry to follow all 28,017 women aged >30 years who attended cervical cancer screening in the capital region of Stockholm between January 1 to March 31, 2017. DNA was extracted from residual cervical smear samples of all 2,377 HPV positive women and was analyzed using the WID-qCIN test (i.e., DNA methylation of the human genes DPP6, RALYL, and GSX1 with a pre-defined threshold). We assessed the performance of cytology in comparison to the WID-qCIN, HPV16 / 18 genotyping and the combination of both tests (WID-qCIN / HPV16 / 18) to detect prevalent and incident (defined as histological diagnosis obtained between 0-12 months and between 13-72 months after the baseline sample collection, respectively) cervical intraepithelial neoplasia grade 2 or worse (CIN2+) and cervical cancers (CC) cases. Results: Cytology-based triaging naturally resulted in cytology showing the highest sensitivity to detect prevalent CIN2+ disease (98.4%, 95% CI, 96.0 to 99.4) since positive cytology results, by guideline definition, had triggered further investigation. The sensitivities of the WID-qCIN / HPV16 / 18 combination for CIN3 (93.4%, 95%CI, 85.7 to 97.3) and for CC (100%, 95% CI, 67.9 to 100.0) were comparable to that of cytology. In the incident setting, baseline cytology only predicted 18.2% (49 / 269) of CIN2+ cases (hazard ratio (HR) 0.96; 95% CI, 0.71 to 1.31; P=0.78) and 20.0% (2 / 10) of CC cases (HR 0.93; 95% CI, 0.20 to 4.40; P=0.92) beyond twelve months, whereas the WID-qCIN / HPV16 / 18 identified 69.4% (179 / 258) of incident CIN2+ (HR 3.55; 95% CI, 2.73 to 4.63; P<0.01) and 80.0% (8 / 10) of incident CC (HR 6.44, 95% CI, 1.37 to 30.35; P 0.02). Triaging with cytology or WID-qCIN / HPV16 / 18 would have required 4.1 and 2.4 colposcopy referrals in order to detect one CIN2+, respectively, during the entire 6-year period. Conclusions: Triage of HPV positive women with the WID-qCIN test in combination with HPV16 / 18 genotyping detected similar numbers of CIN3+ and predicted substantially higher numbers of incident CIN2+ cases compared to triage with cytology, while triggering fewer colposcopies. [Funded by The Land Tirol, the European Union’s Horizon 2020 Research and Innovation program (Grant Agreement No. 874662; HEAP) and The Eve Appeal]. INTRODUCTION Cervical cancer screening is among the most successful strategies for cancer prevention. In combination with high HPV vaccination coverage, cervical screening with substantial uptake is an essential part of the global strategy to eventually eliminate cervical cancer1. Cytology-based cervical screening requires a complex infrastructure, well-trained workforce, and short screening intervals. The proven superiority of testing for oncogenic human papillomaviruses (HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59) as an objective and examiner-independent technique with high sensitivity and prolonged protection against cervical intraepithelial neoplasia grade 2 or worse (CIN2+)2'6 has resulted in international guidelines recommending a transition from primary cytologybased to primary HPV-based screening7,8. Due to increased prevalence of HPV in women <30 years of age9 leading to low specificity of HPV testing, primary HPV screening is only recommended in women >30 years of age. An HPV screen-positive result requires cytology-based triaging so that only HPV- and cytology-positive women are referred for colposcopy and biopsy7. In Europe, HPV-positive women typically undergo triaging with cytology. In contrast, patients positive for the main oncogenic HPV types (i.e. HPV16 and 18) are referred directly for colposcopy in the USA10,11. At present, most HPV screening tests provide at least partial information on HPV genotypes. Emphasis is increasing to utilize the information on HPV16 / 18 - indicating higher risk for disease progression - in the screening algorithms10. Cytology shows limited and highly variable sensitivity12, that has been observed to decrease over time13. It requires equipment and expertise that differs from HPV testing, without being applicable for self-samples. Patients who test positive for HPV through selfsampling need to be re-invited for a separate cytology sample, potentially impacting attendance rates adversely. Therefore, improved strategies for triaging HPV positive women are essential. The proof of principle to utilize DNA methylation (DNAme) tests on a non-cytological sample collected from the cervicovaginal region to detect cervical (pre-) cancer was demonstrated 20 years ago14. Since then, several DNAme-based markers have been developed and applied in different settings15'24, predominantly representing case / control studies or small cohort sets with fewer than a thousand volunteers. Here, the inventors devise and apply an optimised DNAme test (WID-qCIN) to HPV positive women from a real-life population-based cohort of the 28,017 women >30 years of age having attended screening in the capital region of Sweden between January 1 and March 31, 2017. We WO 2025 / 168613                                   PCT / EP2025 / 052932 assessed the predictive performance of the WID-qCIN test in combination with HPV16 / 18 genotyping compared to cytology to triage HPV positive women. METHODS Study population: In 2017, the Swedish cervical cancer screening program invited all women 23-70 years of age to provide a cervical smear sample every three to five years depending on age. Liquid-based cytology (LBC) specimens were collected by midwives and subjected to HPV testing and cytological assessment26. As recommended in the European guidelines for triaging, women aged 30-70 years were primary HPV screened and triaged with cytology upon a positive HPV result. HPV testing was conducted using the Cobas® 4800 platform which provides genotyping information on HPV16 / 18 and other oncogenic HPV27 strains. All cervical LBC samples obtained in Greater Stockholm were biobanked at -25 °C at the Karolinska University Hospital28,29. Sample collection was based on written information and patient consent following an opt-out principle (i.e., samples were biobanked by default unless participant opted out). Women with HPV positive and cytology negative results at the baseline visit were invited for follow-up screens within 36 months. Women with HPV positive and cytology positive (ASC-US+; atypical squamous cells of undetermined significance or worse) results were referred for colposcopy. Upon clinical indication, cervical biopsies were taken and histopathologically assessed. Histopathological findings were reported as cervical intraepithelial neoplasia grade 2 or 3 (CIN2 or 3), high grade squamous intraepithelial lesion (HSIL), adenocarcinoma in situ (AIS), or cervical cancer (CC). In 2017, Swedish pathology laboratories gradually replaced reporting of CIN2 and CIN3 separately with HSIL (which includes CIN2 or CIN3 without differentiating between the two). Positive histopathological findings (i.e., CIN2+) triggered immediate treatment of the patient according to national guidelines. All data on screening invitations, HPV, cytologies, and histopathological assessments from the cervix are uploaded to the Swedish National Cervical Screening Registry (NKCx) once per year26. NKCx was complete up until December 31, 2022. For ascertainment of a case of invasive cervical cancer, we required that information about invasive cancer should be obtained from two independent sources. Apart from the NKCx data on cervical histopathologies, we also obtained data in invasive cervical cancer from the Swedish National Quality Register for Gynecological Cancers (GCR)30. For nine women, the NKCx and the GCR did not agree regarding the diagnosis of an invasive cancer, and for eight women the original diagnostic slides and medical charts were then reviewed by a pathologist who was unaware of the random allocation and of the HPV and cytology status. For one woman, the original slides could not be located and for this woman we kept the original assignment provided by the NKCx. Study conduct: We conducted a population-based cohort study including all women >30 years of age who attended the cervical cancer screening program in the capital region of Stockholm between January 1 and March 31, 2017 (the KI-ql-2017 cohort) [Figure 1], We assessed cervical samples from all HPV positive women of the KI-ql-2017 cohort with the optimized WID-qCIN test and a prespecified cutoff (listed below) for what was considered DNA methylation / WID-qCIN-positive. We retrieved information on age, HPV status (negative or positive), HPV16 / 18 status (for HPV positive cases only) and cytology outcomes on women having attended the cervical cancer screening program between January 1 and March 31, 2017 from NKCx in order to identify all HPV positive specimens. Histopathological diagnoses made between 0-12 months and between 13-72 months were extracted from NKCx, and invasive cervical cancer cases were independently verified using data retrieved from the GCR. Furthermore, dates of histopathological diagnosis, last HPV positive test, last HPV negative test, last cytology positive test, and last cytology negative test results between January 1, 2017 and December 31, 2022 were extracted from NKCx. Ethical approval for the use of samples and linked disease status information in the current study was granted by the Karolinska Ethical Committee (Dnr 2014 / 1242-31 / 4 and 2022-04693-02). Optimized WID-qCIN test: The WID-qCIN, a quantitative real-time PCR test, assesses DNAme in bisulfite modified DNA in three human gene target regions28. The assay has been optimized as described in the Supplementary Appendix and Figure 3. Samples of the KI-ql-2017 cohort were analyzed with the optimized and calibrated duplex setup of the WID-qCIN test using a pre-defined threshold. Percentage of fully methylated reference (PMR) values were calculated as previously described28. Samples with SUM-PMR >0 were defined as WID-qCIN-positive, and samples with SUM-PMR=0 as WID-qCIN-negative (Figure 4). Statistical analyses. Statistical significance was set to 5% and 95% confidence intervals (CI) were computed for all estimates. Analyses were performed using R (version 4.3.1). The 95% confidence intervals for proportions were computed using the Wilson method in the prop.test function in the stats R package (version 4.3.1). Where applicable, sensitivity or specificity estimates were compared using a two-sided Chi-squared test without Yates’ continuity correction using the prop.test function. Time from sample collection to incident (13 to 72 months) CIN2+ (or cervical cancer) diagnosis was represented using Kaplan-Meier estimators of cumulative incidence curves using the survfit function in the survival R package (version 3.5-7). Hazard ratios (HR) and 95% Cis were calculated using the Cox proportional hazards model using the coxph function in the survival R package (version 3.5-7). Log-rank tests were performed using the survdiff function in the survival R package. Censoring time was defined as the time to the most recent negative test (see the Supplementary Appendix). A logistic Weibull mixture model, which considers undiagnosed prevalent disease and interval-censored incident disease, was implemented using the PIMixture R package (version 0.4.4). Odds ratios, hazard ratios, and 6-year cumulative incidence estimates, along with 95% confidence intervals were computed31. RESULTS Study population. Between January 1 and March 31, 2017, 28,017 women participated in cervical screening in the capital region of Stockholm. A total of 2,377 women tested positive for HPV. Of these, 711 were cytology positive (ASC-US+; atypical squamous cells of undetermined significance or worse) and were then referred for colposcopy and histological assessment. The biopsies obtained within the first twelve months as a consequence of the baseline screen were defined as prevalent cases (306 CIN2+ of which 11 were cervical cancers) [Figure 1], Biopsies obtained after twelve months were defined as incident cases (271 CIN2+ of which 11 were cervical cancers; prevalent CIN2+ cases for whom data from follow-up screens / colposcopy were also reported between months 13 WO 2025 / 168613                                   PCT / EP2025 / 052932 and 72 were excluded from the incidence analyses). The average follow-up time of women without CIN2+ was 40.3 months (range 0.3 to 71.4). The mean age of HPV positive women was 40.8 years (range 30-64 years) and 654 (27.5%) were HPV16 and / or HPV 18 (HPV16 / 18) positive and 686 (28.9%) were WID-qCIN positive. Among WID-qCIN positive women, 49.4% and 41.4% were cytology positive and HPV16 / 18 positive, respectively (Table 1). Five women had inadequate cytology results, three were missing HPV subtype information and 90 had inconclusive WID-qCIN results. Detection of prevalent disease. The sensitivity of cytology to detect prevalent CIN2+ cases defined by histopathology was, by definition, very high at 98.4% since only cytology positive women in the cohort had been referred for colposcopy and thus histopathological biopsy. Whereas HPV16 / 18 genotyping detected only approximately half of the CIN2+ cases (53.3%, 95% CI, 47.5 to 58.9), the sensitivity of the stand-alone WID-qCIN testing (77.0%, 95% CI, 71.6 to 81.6) or WID-qCIN testing in combination with HPV16 / 18 genotyping (further on referred to as WID-qCIN / HPV16 / 18) (85.9%, 95% CI, 81.3 to 89.6) was significantly higher (P<0.01 and P<0.01, respectively). Importantly, HPV 16 / 18 alone would have missed >40% of CIN3 cases (sensitivity 58.9%, 95% CI, 48.4 to 68.8), and the sensitivity of the WID-qCIN test alone (85.7%, 95% CI, 76.4 to 91.9) or the WID-qCIN / HPV16 / 18 (93.4%, 95%CI, 85.7 to 97.3) was significantly higher for CIN3 detection (P<0.01 and P<0.01, respectively). All cervical cancers were detected by HPV16 / 18 or the WID-qCIN / 16 / 18. The WID-qCIN test detected 10 / 11 cervical cancers (Table 2). The specificity (<CIN1) was comparable for cytology (80.1%, 95% CI, 78.3 to 81.8), HPV16 / 18 (76.3%, 95% CI, 74.4 to 78.1), and WID-qCIN (76.9%, 95% CI, 74.9 to 78.7). The specificity for the WID-qCIN / HPV16 / 18 was significantly lower (60.7%, 95% CI, 58.5 to 62.9) when compared to either HPV16 / 18 alone (P<0.01) or the WID-qCIN test alone (P<0.01) (Table 2). All incident cases (diagnosed 13-72 months) were regarded as disease-free for the purposes of calculating sensitivity and specificity in the prevalent setting (0-12 months). The association between the numerical values of the WID-qCIN test (defined as the sum percentage methylation across the three genes) and the histological outcomes further substantiates the ability of the WID-qCIN test to indicate disease progression (Figure 5 and Figure 6). Prediction of incident disease. Based on baseline test results, triage with cytology, HPV16 / 18, the WID-qCIN and the WID-qCIN / HPV16 / 18 predicted 18.2% (hazard ratio, 0.96, 95% CI, 0.70-1.31), 45.6% (hazard ratio, 2.72, 95% CI, 2.14-3.45), 46.3% (hazard ratio, 3.01, 95% CI, 2.36-3.85), and 69.4% (hazard ratio, 3.55, 95% CI, 2.73-4.63) of incident CIN2+ cases, respectively (Table 3 and Figure 2). Whereas cytology only predicted 20.0% of incident cervical cancers (i.e. cancers detected more than twelve months after sample collection), HPV16 / 18 or the WID-qCIN predicted 54.5% and 40.0% respectively. The WID-qCIN / HPV16 / 18 identified 80.0% of all invasive cervical cancers that developed 13-72 months after the cervical sample collection. Hazard ratios and Kaplan-Meier curves are shown in Table 3 and Figure 2, respectively. Non-proportional hazards were observed for incident CIN2+ cases stratified according to cytology. This is likely an artefact due to disease detection primarily triggered by a cytology positive test result. The majority of CIN2+ cases identified because of a (baseline) cytology positive test were detected within 0-12 months (Figure 7) rather than within 13-72 months. Furthermore, women who were cytology negative at baseline may have tested positive at the second screening round (at approximately three years) but are still classified as cytology negative for the purposes of our analysis, which potentially explains why the two curves cross shortly after three years. We also implemented a previously described prevalence-incidence statistical model that considers two features of our cohort32. Firstly, it allows for the possibility of undiagnosed prevalent cases (since some incident CIN2+ cases may be prevalent cases that were previously undiagnosed), and secondly the fact that incident cases are interval censored (since disease onset is known only to occur between irregular visits). According to the model the WID-qCIN test had a hazard ratio of 2.31 (95% CI, 1.31 to 4.08), HPV16 / 18 had a hazard ratio of 2.47 (95% CI, 1.40 to 4.37), and the WID-qCIN / HPVl 6 / 18 had a hazard ratio of2.83 (95% CI, 1.55 to 5.16) (Table 7 andFigure7). The model failed to converge when the cohort was stratified by cytology, potentially due to poor model fit to the observed non-proportional hazards in cytology negative and positive women. Cumulative risk by baseline triage test status. Out of 28,017 screened women, 2,377 were HPV positive in the primary screening test. In the HPV positive subset of women, cytology-based triaging identified 60.8% of WO 2025 / 168613                                   PCT / EP2025 / 052932 CIN2+ cases and 63.6% of CCs over the 72-month study period (Table 4). This required a total of 1,432 colposcopy referrals (split over two screening rounds), resulting in an average of 4.1 colposcopy referrals required to detect one CIN2+ case. HPV16 / 18 genotype triage (based on a single baseline screen) would have detected 49.7% of CIN2+ cases and 75.0% of cervical cancers. Assuming that a positive HPV16 / 18 result would trigger a colposcopy referral, a total of 654 referrals would be required for this strategy, resulting in an average of 2.3 referrals to detect one CIN2+ case. WID-qCIN triaging would have detected 62.5% of CIN2+ cases and 69.6% of cervical cancers. A total of 686 referrals would be required, resulting in an average of 2.0 referrals to detect one CIN2+ case. Finally, WID-qCIN / HPV16 / 18 triaging would have detected 78.1% of CIN2+ cases and 91.3% of cervical cancers. Importantly, this includes seven out of eight cervical cancers in cytology negative women detected 13 to 72 months after the baseline screen. A total of 1,033 colposcopy referrals would be required, resulting in an average of 2.4 referrals to detect one CIN2+ case. DISCUSSION We report a large-scale, population-based longitudinal evaluation of triaging HPV-positive women >30 years of age participating in cervical screening using an automated molecular test (HPV16 / 18 in combination with WID-qCIN). The two tests in combination detect 85.9% (100%) of prevalent and 69.4% (80.0%) of incident CIN2+ (cervical cancer) cases. Importantly, the WID-qCIN / HPV16 / 18 identified seven out of eight cytology negative women who were subsequently diagnosed with invasive cervical cancer, an important finding considering patient outcome. The WID-qCIN / HPV16 / 18 combination identified almost three times more women with CIN2+, but nevertheless resulted in a much lower number of women requiring colposcopy in order to identify one woman with CIN2+. The strength of our study includes the population-based real-life setting, which minimizes biases such as healthy volunteer effects, or greater compliance effects that may be observed with clinical trials. Although only residual samples (i.e., after testing for HPV and cytology) were available, 96.2% of samples from all HPV positive women were suitable for WID-qCIN testing. This is higher compared with data from a study16 that assessed the performance of DNAme markers for prevalent disease detection and only included 66.8% of eligible HPV positive patients. Despite our unbiased real-life setting, the sensitivity of the WID-qCIN alone to detect prevalent CIN2+ was significantly higher (77.0%, 95%CI, 71.6 to 81.6) than the sensitivity reported in a pooled analysis that assessed the best DNAme markers and excluded highly biased studies (CIN2+ pooled sensitivity was 66.0%, 95%CI, 61.0 to 70)15. The specificity of the WID-qCIN test was also superior (76.9%, 95%CI, 74.9 to 78.7) when compared to other DNAme markers (74.0%, 95%CI, 69.0 to 78.0)15. Whereas no study has assessed the performance of HPV16 / 18 genotyping in combination with DNAme markers in order to predict incident and detect prevalent disease, Kremer et al. described a complementary effect of HPV16 and DNAme in predicting the likelihood of CIN2 / CIN3 lesions spontaneously regressing, albeit this study was limited by a high proportion (74%) of CIN2 lesions of which only 36% were methylation positive and a low proportion of CIN3 (26%) cases of which 79% showed methylation33. The fact that the WID-qCIN / HPV 16 / 18 detects 93.4% of all prevalent CIN3 cases and predicts 87.5% of all triage cytology negative invasive cervical cancers indicates that replacing cytology-based triaging by a WID-qCIN / HPV 16 / 18 triage strategy could almost eliminate invasive cancers in an HPV-screened population. The gradual transition of Swedish pathology laboratories from reporting CIN2 / 3 lesions to reporting HSIL (encompassing both CIN2 and CIN3 lesions in one combined entity), limits our analyses of the more severe incident CIN3 cases (equivalent to cervical carcinoma in situ). In addition, the precise effect of the proposed molecular triage testing (i.e., HPV16 / 18 in combination with WID-qCIN) on prevention of invasive cervical cancers [by detecting pre-invasive lesions (i.e. CIN2 / CIN3 / AIS / HSIL), which can be excised prior to the onset of invasion] requires assessment in a prospective randomized clinical trial. Yet, the fact that combined WID-qCIN / HPV16 / 18 testing predicted all but two cancers developing within 72 months following sample collection indicates that this DNA-based triaging strategy of HPV positive women has the potential to greatly diminish the number of invasive cancers in the screened population. This further suggests that screening intervals for HPV positive WID-qCIN / HPV 16 / 18 negative women could be extended to five years34. Amongst the 28,017 women, 644 were diagnosed with CIN2+ in the following 72 months and only 40 (6%) of these were HPV negative when tested at the 2017 screen. It remains to be seen whether tests like the WID-qEC, which is able to identify women with endometrial cancer up to two years in advance of diagnosis 35 and (albeit in a rather small set) outperformed cytology 36 and ultrasound 37, should be combined with HPV as a WO 2025 / 168613                                   PCT / EP2025 / 052932 primary screen, in order to detect all cervical cancers, including HPV negative and endocervical adenocarcinoma. Overall, our data indicate that the DNAme-based WID-qCIN test may complement HPV16 / 18 genotyping in triaging HPV positive women with improved performance compared to widely-used cytology. The fact that this novel triage test does not rely on assessment of cellular morphology and can be performed purely on DNA, renders it suitable for screening strategies based on self-sampling. The implementation of WID-qCIN in combination with HPV16 / 18 screening could help to overcome the issue of resampling patients for triaging after positive HPV results on self-samples. Cervical screening is an essential pillar of the global strategy to eliminate cervical cancer and WHO advocates for HPV-based screening using self-sampling as a simple strategy that could work also in resource-limited settings. High performance molecular triaging strategies like the WID-qCIN test, which could be readily automated and do not require complex infrastructures, should further facilitate these efforts. REFERENCES 1. Brisson M, Kim JJ, Canfell K, et al. Impact of HPV vaccination and cervical screening on cervical cancer elimination: a comparative modelling analysis in 78 low-income and lower-middle-income countries. Lancet 2020;395(10224):575-590. DOI: 10.1016 / 80140-6736(20)30068-4. 2. Ronco G, Dillner J, Elfstrom KM, et al. Efficacy of HPV-based screening for prevention of invasive cervical cancer: follow-up of four European randomised controlled trials. Lancet 2014;383(9916):524-32. DOI: 10.1016 / S0140-6736(13)62218-7. 3. Gage JC, Katki HA, Schiffman M, et al. Age-stratified 5-year risks of cervical precancer among women with enrollment and newly detected HPV infection. Int J Cancer 2015; 136(7): 1665-71. DOI: 10.1002 / ijc.29143. 4. Sankaranarayanan R, Nene BM, Shastri SS, et al. HPV screening for cervical cancer in rural India. N Engl J Med 2009;360(14): 1385-94. DOI: 10.1056 / NEJMoa0808516. 5. Mayrand MH, Duarte-Franco E, Rodrigues I, et al. Human papillomavirus DNA versus Papanicolaou screening tests for cervical cancer. N Engl J Med 2007;357(16):1579-88. DOI: 10.1056 / NEJMoa071430. WO 2025 / 168613                                   PCT / EP2025 / 052932 6. Naucler P, Ryd W, Tornberg S, et al. Human papillomavirus and Papanicolaou tests to screen for cervical cancer. NEngl J Med 2007;357(16): 1589-97. DOI: 10.1056 / NEJMoa073204. 7. Bouvard V, Wentzensen N, Mackie A, et al. The IARC Perspective on Cervical Cancer Screening. N Engl J Med 2021;385(20): 1908-1918. DOI: 10.1056 / NEJMsr2030640. 8. Bruni L, Serrano B, Roura E, et al. Cervical cancer screening programmes and agespecific coverage estimates for 202 countries and territories worldwide: a review and synthetic analysis. Lancet Glob Health 2022;10(8):elll5-ell27. DOI: 10.1016 / S2214-109X(22)00241-8. 9. Dunne EF, Unger ER, Sternberg M, et al. Prevalence of HPV infection among females in the United States. JAMA 2007;297(8):813-9. DOI: 10.1001 / jama.297.8.813. 10. Perkins RB, Guido RS, Castle PE, et al. 2019 ASCCP Risk-Based Management Consensus Guidelines for Abnormal Cervical Cancer Screening Tests and Cancer Precursors. J Low Genit Tract Dis 2020;24(2): 102-131. DOI: 10.1097 / LGT. 0000000000000525. 11. Perkins RB, Wentzensen N, Guido RS, Schiffman M. Cervical Cancer Screening: A Review. JAMA2023;330(6):547-558. DOI: 10.1001 / jama.2023.13174. 12. Ramirez AT, Valls J, Baena A, et al. Performance of cervical cytology and HPV testing for primary cervical cancer screening in Latin America: an analysis within the ESTAMPA study. Lancet Reg Health Am 2023;26:100593. DOI: 10.1016 / j.lana.2023.100593. 13. Wang J, Edvardsson H, Strander B, Andrae B, Sparen P, Dillner J. Long-term follow-up of cervical cancer incidence after normal cytological findings. Int J Cancer 2023. DOI: 10.1002 / ijc.34723. 14.    Widschwendter A, Gattringer C, Ivarsson L, et al. Analysis of aberrant DNA methylation and human papillomavirus DNA in cervicovaginal specimens to detect invasive cervical cancer and its precursors. Clin Cancer Res 2004;10(10):3396-400. DOI: 10.1158 / 1078-0432.CCR-03-0143. 15. Salta S, Lobo J, Magalhaes B, Henrique R, Jeronimo C. DNA methylation as a triage marker for colposcopy referral in HPV-based cervical cancer screening: a systematic review and meta-analysis. Clin Epigenetics 2023; 15(1): 125. DOI: 10.1186 / sl3148-023-01537-2. WO 2025 / 168613                                   PCT / EP2025 / 052932 16. Bonde J, Floore A, Ejegod D, et al. Methylation markers FAM19A4 and miR124-2 as triage strategy for primary HPV screen positive women; A large European multi-center study. Int J Cancer 2020. DOI: 10.1002 / ijc.33320. 17. Adcock R, Nedjai B, Lorincz AT, et al. DNA methylation testing with S5 for triage of high-risk HPV positive women. Int J Cancer 2022;151(7):993-1004. DOI: 10.1002 / ijc.34050. 18. Dippmann C, Schmitz M, Wunsch K, et al. Triage of hrHP V-positive women: comparison of two commercial methylation-specific PCR assays. Clin Epigenetics 2020; 12(1): 171. DOI: 10.1186 / s 13148-020-00963-w. 19. Verhoef L, Bleeker MCG, Polman N, et al. Performance of DNA methylation analysis of ASCL1, LHX8, ST6GALNAC5, GHSR, ZIC1 and SST for the triage of HPV-positive women: Results from a Dutch primary HPV-based screening cohort. Int J Cancer 2022; 150(3):440-449. DOI: 10.1002 / ijc.33820. 20. Schmitz M, Eichelkraut K, Schmidt D, et al. Performance of a DNA methylation marker panel using liquid-based cervical scrapes to detect cervical cancer and its precancerous stages. BMC Cancer 2018; 18(1): 1197. DOI: 10.1186 / sl2885-018-5125-8. 21. Zhu P, Xiong J, Yuan D, et al. ZNF671 methylation test in cervical scrapings for cervical intraepithelial neoplasia grade 3 and cervical cancer detection. Cell Rep Med 2023;4(8):101143. DOI: 10.1016 / j.xcrm.2023.101143. 22. Apostolidou S, Hadwin R, Burnell M, et al. DNA methylation analysis in liquidbased cytology for cervical cancer screening. Int J Cancer 2009; 125(12):2995-3002. DOI: 10.1002 / ijc.24745. 23. Teschendorff AE, Jones A, Fiegl H, et al. Epigenetic variability in cells of normal cytology is associated with the risk of future morphological transformation. Genome Med 2012;4(3):24. DOI: 10.1186 / gm323. 24. Doufekas K, Zheng SC, Ghazali S, et al. DNA Methylation Signatures in Vaginal Fluid Samples for Detection of Cervical and Endometrial Cancer. Int J Gynecol Cancer 2016. DOI: 10.1097 / IGC.0000000000000739. 25. Herzog C, Sundstrom K, Jones A, et al. DNA methylation-based detection and prediction of cervical intraepithelial neoplasia grade 3 and invasive cervical cancer with the WID-qCIN test. Clin Epigenetics 2022; 14(1): 150. DOI: 10.1186 / sl3148-022-01353-0. 26. Elfstrom KM, Sparen P, Olausson P, Almstedt P, Strander B, Dillner J. Registrybased assessment of the status of cervical screening in Sweden. Journal of Medical Screening 2016;23(4):217-226. DOI: 10.1177 / 0969141316632023. WO 2025 / 168613                                   PCT / EP2025 / 052932 27. Hortlund M, Sundstrom K, Lamin H, Hjerpe A, Dillner J. Laboratory audit as part of the quality assessment of a primary HPV-screening program. J Clin Virol 2016;75:33-6. DOI: 10.1016 / j.jcv.2015.12.007. 28. Herzog C, Sundstrom K, Jones A, et al. DNA methylation-based detection and prediction of cervical intraepithelial neoplasia grade 3 and invasive cervical cancer with the WID™-qCIN test. Clin Epigenetics 2022; 14(1): 150. (In eng). DOI: 10.1186 / sl3148-022-01353-0. 29. Perskvist N, Norman I, Eklund C, Litton JE, Dillner J. The Swedish cervical cytology biobank: sample handling and storage process. Biopreserv Biobank 2013;ll(l):19-24. DOI: 10.1089 / bio.2012.0036. 30. Ludvigsson JF, Otterblad-Olausson P, Pettersson BU, Ekbom A. The Swedish personal identity number: possibilities and pitfalls in healthcare and medical research. Eur J Epidemiol 2009;24(l 1):659-67. (In eng). DOI: 10.1007 / sl0654-009-9350-y. 31. Cheung LC, Pan Q, Hyun N, et al. Mixture models for undiagnosed prevalent disease and interval-censored incident disease: applications to a cohort assembled from electronic health records. Stat Med 2017;36(22):3583-3595. DOI: 10.1002 / sim.7380. 32. Clarke MA, Cheung LC, Castle PE, et al. Five-Year Risk of Cervical Precancer Following pl6 / Ki-67 Dual-Stain Triage of HPV-Positive Women. JAMA Oncol 2019;5(2): 181-186. DOI: 10.1001 / jamaoncol.2018.4270. 33. Kremer WW, Dick S, Heideman DAM, et al. Clinical Regression of High-Grade Cervical Intraepithelial Neoplasia Is Associated With Absence of FAM19A4 / miR124-2 DNAMethylation (CONCERVE Study). J Clin Oncol 2022;40(26):3037-3046. DOI: 10.1200 / JCO.21.02433. 34. Kim JJ, Burger EA, Regan C, Sy S. Screening for Cervical Cancer in Primary Care: A Decision Analysis for the US Preventive Services Task Force. JAMA2018;320(7):706-714. DOI: 10.1001 / jama.2017.19872. 35. Wright JD, Burke WM, Wilde ET, et al. Comparative effectiveness of robotic versus laparoscopic hysterectomy for endometrial cancer. J Clin Oncol 2012;30(8):783-91. DOI: 10.1200 / JCO.2011.36.7508. 36. Schreiberhuber L, Herzog C, Vavourakis CD, et al. The WID-qEC test: Performance in a hospital-based cohort and feasibility to detect endometrial and cervical cancers. Int J Cancer 2023;152(6):1269-1274. DOI: 10.1002 / ijc.34275. 37. Evans I, Rei sei D, Jones A, et al. Performance of the WID-qEC test versus sonography to detect uterine cancers in women with abnormal uterine bleeding (EPL SURE): a prospective, consecutive observational cohort study in the UK. Lancet Oncol 2023;24(12):1375-1386. DOI: 10.1016 / S1470-2045(23)00466-7. WID-qCIN optimization Following additional optimization measures based on analytical validation guidelines1, the WID-qCIN test was transformed from a singleplex- to a duplex-based reaction setup allowing improved high-throughput applicability. To assure WID-qCIN reproducibility and to reduce the risk of unspecific target-amplification, limit of detection (LOD)- and limit of blank (LOB)-based Cq thresholds were established for all duplex reactions covering (i) target RALYL paired with reference reaction COL2A1 and (ii) target GSX1 paired with target DPP6. LOB is defined as the analysis of analyte-devoid blanks (i.e., samples containing no target material) resulting in stable target-amplification2. LOD describes the lowest concentration of an analyte detected in >95% of all tested replicates1. To define LOB-based Cq thresholds for RALYL, GSX1 and DPP6, nuclease-free H2O, bisulfite modified unmethylated control DNA (Merck) and 30 randomly selected DNAme-negative control samples were assessed in 4-90 replicates depending on sample type. DNA methylation (DNAme)-negative control samples were taken from residual samples from the previously published “LBC-CIN Discovery Set” and represented <CIN1 controls with low target-specific index CpG methylation according to Illumina MethylationEPIC array results3. The LOB-based threshold was defined as the mean (of reproducible) Cq values resulting from blanks and set at 40 for RALYL, 34 for GSX1 and 31 for DPP 6. To assess LOD-based Cq thresholds, bisulfite modified methylated control DNA (Zymo) was diluted in bisulfite modified unmethylated control DNA (Merck) at different percentages. All samples were tested in 90 replicates. Target-specific LOD-based thresholds were calculated as the sum of the mean and standard deviation of Cq values resulting from the lowest-concentrated sample detected in >95% of all replicates. LOD-based thresholds were set as 36 for RALYL, 33 for GSX1 and 35.5 for DPP6. WID-qCIN PMR calculation All samples were assessed in duplicates. Target-PMRs were calculated according to previously published equations3. The SUM-PMR was defined as the sum of the three target-PMRs per sample. Samples with C0L2A1 Cq values >30 in one or both replicates were defined as inconclusive and excluded from SUM-PMR calculations. Samples with both replicate target Cq values <LOB-based thresholds allowed for target-PMR calculation. Samples with both replicate target Cq values above the LOB-based threshold were defined as having target-PMR=0. Samples with one target Cq value >LOB-based threshold, and a second Cq value that is both <LOB-based threshold and >LOD-based threshold were defined as having target-PMR=0. Samples with one target Cq value above the LOB-based threshold and the second Cq value below the LOD-based threshold were defined as inconclusive and were re-tested once (Figure 3). Samples with one or more inconclusive target-PMRs after WID-qCIN re-testing were excluded from SUM-PMR calculations. WID-qCIN calibration The calibration set (Table 5) consisted of DNA samples from 168 HPV-positive and HPV-negative clinician-collected liquid-based cytology (LBC) specimens (ThinPrep) randomly selected from the previously reported “LBC-CIN Discovery” and “LBC-CIN Diagnostic” sets3. All 168 samples were taken from women >23 years of age with histopathologically confirmed CIN2+ or <CIN1 and analyzed according to the protocol in Figure 3. The WID-qCIN SUM-PMR resulted in an AUC of 0.84 (95% CI: 0.77-0.91) [Figure 4] when analyzing the calibration set with 123 <CIN1 controls and 45 CIN2+ cases. Based on these observations, the duplex-specific SUM-PMR threshold (SUM-PMR=0) was selected to achieve optimal specificity of 95.9% (95% CI: 90.3-98.5) and clinically significant sensitivity of 71.1% (95% CI: 55.5-83.2) [Figure 4 and Table 6]. The SUM-PMR threshold was selected prior to analysis of the KLql-2017 cohort. WID-qCIN performance in HPV-positive women in the prevalence-group of the KI-ql-2017 cohort Positive correlation between prevalent disease severity and the level of DNAme in WID-qCIN target regions, represented by SUM-PMRs, was observed upon analysis of HPV-positive women from the KI-ql-2017 cohort (Figure 5). Application of the optimized SUM-PMR threshold (SUM-PMR=0) of the WID-qCIN test to discriminate between prevalent <CIN1 and CIN2+ cases in the KLql-2017 cohort led to an AUC of 0.81 (95% CI: 0.78-0.84) [Figure 6]. Information on assay WO 2025 / 168613                                   PCT / EP2025 / 052932 performance in the complete KI-ql-2017 cohort is provided in detail in the main section of the manuscript. Statistical time-to-event analysis In the analysis of incident CIN2+ cases there were 271 CIN2+ events and 1,579 censored observations. Time to censoring was defined as the time from sample collection to the most recent negative test. A negative test was defined as HPV negative (n=906), pathology negative (n=353), HPV negative and cytology negative (n=301), or cytology negative in the absence of any HPV results (n=19). Atotal of 221 samples were removed from the analysis of incident cases (186 with no follow-up data available within 13-72 months and 35 without a negative test with which to define a censoring time). The logistic Weibull mixture model was fitted using the PIMixture R function with default settings4. Atotal of 306 women were defined as having a prevalent CIN2+ case (confirmed by histopathology results within 0-12 months), 46 were defined as disease free at baseline and having an incident CIN2+ case (disease free status confirmed by histopathology results within 0-12 months and incident CIN2+ case confirmed by histopathology results within 13-72 months), 225 were defined as unknown at baseline and having an incident CIN2+ case (histopathology results unavailable within 0-12 months and incident CIN2+ case confirmed by histopathology results within 13-72 months), 1,647 were defined as unknown status at baseline and disease free at censor time (histopathology results unavailable within 0-12 months, censoring times defined as above), and 153 were defined as uninformative (118 with no follow-up data available within 0-72 months and 35 without a negative test with which to define a censoring time). Logistic Weibull mixture model results are depicted in Figure 7 and Table 7. References 1. Bustin SA, Benes V, Garson JA, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chern 2009;55(4):611-22. (In eng). DOI: 10.1373 / clinchem.2008.112797. 2. Armbruster DA, Pry T. Limit of blank, limit of detection and limit of quantitation. Clin Biochem Rev 2008;29 Suppl l(Suppl l):S49-52. (In eng). 3. Herzog C, Sundstrbm K, Jones A, et al. DNA methylation-based detection and prediction of cervical intraepithelial neoplasia grade 3 and invasive cervical cancer with the WID™-qCIN test. Clin Epigenetics 2022; 14(1): 150. (In eng). DOI: 10.1186 / sl3148-022-01353-0. 4. Clarke MA, Cheung LC, Castle PE, et al. Five-Year Risk of Cervical Precancer Following pl6 / Ki-67 Dual-Stain Triage of HPV-Positive Women. JAMA Oncol 2019;5(2): 181-186. (In eng). DOI: 10.1001 / jamaoncol.2018.4270. EXAMPLE 2 - Assay optimisation Summary 1. Latest clinical performance analyses of the optimised WID-qCIN assay were conducted in a large, population-based cohort study including primary high-risk (hr) human papillomavirus (HPV)-screened women >30 years of age. 2377 hrHPV-positive liquid-based cytology (LBC) samples were analysed with the optimised WID-qCIN test and corresponding patient information received from a population-based cancer register. The pre-defined SUM-PMR threshold of 0 (established during assay recalibration) was applied to differentiate between histopathologically confirmed CIN2+ and <CIN1 cases. Importantly, these data outline that the WID-qCIN test complements hrHPV-based screening, thereby outperforming cytology-based triaging of hrHPV-positive women. 2. Potential clinical implementation of the previously reported WID-qCIN test required further assay optimisation aiming at high-throughput applicability. The latter was achieved by transitioning from a singleplex- to a duplex-based assay setup. Technical optimisation and verification following standardised qPCR reliability measures ensured assay stability and reproducibility. Assay optimization entailed recalibration of the clinical assay threshold (i.e. the WID-qCIN SUM-PMR) in a separate set of patient samples. Overall, assay optimisation ensured (i) improved high-throughput applicability, (ii) thorough technical optimisation and validation following published qPCR standards and (iii) recalibration in patient samples. Details Primary WID-qCIN validation covered a total of 761 liquid-based cytology (ThinPrep) samples from (nested) case-control study settings. Samples were received from women 26-40 years of age where matched high-risk human papillomavirus (hrHPV) test results were available. In detail, diagnostic assay performance was assessed in 421 <CIN1 controls and 85 CIN3+ cases. Predictive assay performance identifying future CIN3+ cases was analysed in 124 controls without precancerous cervical lesions (<CIN1) and 131 cases with CIN3+ after 4 year follow-up screens. All 761 samples were analysed in technical duplicates and assessed with WID-qCIN reactions DPP6 (Chr7:153584008-153584079), RALYL (Chr8:85095492-85095580), GSX1 (Chrl3:28366785-28366866) and COL2A1 (Chrl2:48381229-48381320) in singleplex reactions. 1.     Duplex-combinations of DPP6 (Chr7:153584008-153584079), RALYL (Chr8:85095492-85095580), GSX1 (Chrl3:28366785-28366866) and COL2A1 (Chrl2:48381229-48381320) were tested with primer and fluorescently-labelled hydrolysis-probes at various concentrations. Furthermore, all possible combinations of target-specific hydrolysis-probes and matched fluorophores 6’-FAM or Cy5 were tested in duplex-reactions to enhance assay linearity. Duplex experiments revealed preferable reaction combination of COL2A1 (Chrl2:48381229-48381320) with RALYL (Chr8:85095492-85095580), and GSX1 (Chrl3:28366785-28366866) with DPP6 (Chr7:153584008-153584079). Improved assay stability was further achieved by using 6’-FAM-labelled hydrolysis-probes for COL2A1 (Chrl2:48381229-48381320) and GSX1 (Chrl3:28366785-28366866) reactions, but Cy5-labelled hydrolysis-probes for RALYL (Chr8:85095492-85095580) and DPP6 (Chr7:153584008-153584079) reactions. Optimised primer-probe concentrations for duplex-reactions are detailed in the technical assay setup section. Comparability in assay linearity and reproducibility of the WID-qCIN singleplex- versus duplex setup was assessed with gBLOCK (IDT) and bisulfite converted, fully methylated or unmethylated control DNA (Zymo) in 2-3 technical replicates depending on sample-type. Linear amplification was observed in both, singleplex and duplex reactions, within a range of 100,000 - 10 copies of the target sequence per reaction. These results suggested comparable assay linearity in singleplex and duplex setups (Figure 8). Analytical sensitivity tests resulted in stable target amplification in samples with 0.50.1% of bisulfite converted, methylated target DNA diluted in unmethylated target DNA depending on the reaction in the singleplex setup. Strikingly, improved analytical sensitivity was observed in the duplex setup of the WID-qCIN assay reaching stable target amplification in samples with 0.1% of bisulfite converted, methylated target DNA diluted in unmethylated target DNA for all reactions (Figure 9). Technical validation of the optimised WID-qCIN assay was performed by assessing qPCR quality parameters such as limit of detection or limit of blank following MIQE guidelines (data not shown). Ultimately, recalibration of the WID-qCIN SUM-PMR threshold was performed in set of 168 hrHPV-tested samples received from women >23 years of age with histopathologically confirmed CIN2+ or <CIN1. Detailed information on assay recalibration is provided in the KI-ql-17 cohort manuscript (unpublished material). 5 Technical assay setup • 20 ul reactions in 384-well PCR plate: 5 pl with 20 ng bisulfite converted DNA per reaction (4 ng / pl). 10 pl 2x Luna Universal Probe qPCR mastermix (NEB). 10        5 pl of duplex 1: COL2A1 -FAM(BHQl) + RALFL-CY5(BHQ3) or 5 pl of duplex 2: GW-FAM(BHQl) + DPP6-CY5(BHQ3). Reaction 1 Reagent Stock Final concentration Input amount concentration LUNA 2x lx 10 pl mastermix RALYLJo 100 pM 400 nM 0.08 pl RALYL_re 100 pM 400 nM 0.08 pl RALYL-CY5 100 pM 200 nM 0.04 pl COL2Al_fo 100 pM 150 nM 0.03 pl COL2Al_re 100 pM 150 nM 0.03 pl COL2A1 -FAM 100 pM 250 nM 0.05 pl Water 4.69 pl DNA 4 ng / pl 20 ng 5 pl Total 20 pl Reaction 2 Reagent Stock Final concentration Input amount concentration LUNA 2x lx 10 pl mastermix DPP6J0 100 pM 150 nM 0.03 pl DPP6_re 100 pM 150 nM 0.03 pl WO 2025 / 168613 PCT / EP2025 / 052932 DPP6-CX5 100 pM 250 nM 0.05 pl GSXIJo 100 pM 150 nM 0.03 pl GSXl_re 100 pM 150 nM 0.03 pl GSX1-FAM 100 pM 250 nM 0.05 pl Water 4.78 pl DNA 4 ng / pl 20 ng 5 pl Total 20 pl • gBLOCK (ordered from IDT) is dsDNA complementary to all 4 WID-qCIN reactions and used for standard curve generation: details see below. • Methylated positive control for PMR calculation. 5      • Nuclease-free water as negative control. • All samples and controls are analysed in technical duplicates. • 90 samples per plate incl. 4 Std, 1 pos. control and 1 neg. control (96 samples in total). • Primer / Probe sequences: Gene Sequence (5'-3') DPP6 DPP6 (chr7:153584008-153584079) Forward primer TTATCGTAGTGTTTGTTTGTGGAAGTC Reverse primer CCCACTCCGCGCTAAACTAA Probe CGTGCGTCGCGCGCGTA Probe labelling Cy5 - BHQ-3 RALY L RALYL (chr8:85095492-85095580) Forward primer GCGTTTGAGAGCGGTAATATTAGTG Reverse primer CCTACTCGTCTAAACTCACAACGAAA Probe AGCGGTAGTTCGCGGCGAGGTT Probe labelling Cy5 - BHQ-3 GSX1 GSX1 (chrl3:28366785- 28366866) Forward primer CGTAGAGGGCGGGTTGGT Reverse primer GCGCAACACTAACGAATCCA Probe CGATCGCGCGTCGG Probe labelling 6-FAM - BHQ-1 COL2 Al COL2A1 (chrl2:48381229-48381320) Forward primer TCTAACAATTATAAACTCCAACCACCA A Reverse primer GGGAAGATGGGATAGAAGGGAATAT Probe CCTTCATTCTAACCCAATACCTATCCCA CCTCTAAA Probe labelling 6-FAM - BHQ-1 • gBLOCK sequences (5’ to 3’): / l / T^single CAGACTGTACTCTAGGACCTGATAGTTGATCGATACACACTTATCGTAGT GTTTGTTTGTGGAAGTCGAGCGTGCGTGCGTCGCGCGCGTATTTAGTTTA GCGCGGAGTGGGCATCGAGTGCGCACTATCAAGAGTGTTCCAGTCACGA CAT Rl£F£single TACGTGTCGAAGTCTCAGCTCCCACAATCATCGTAGGTGTGCGTTTGAGA GCGGTAATATTAGTGGCGGTAGTAGCGGTAGCGGTAGTTCGCGGCGAGG TTGTTTTCGTTGTGAGTTTAGACGAGTAGGAAGTTCGGTGCTCAGTTCCG AAGTCAAACGTTGGCTCTAG GSA / single TGCATGATCTACGTGCGTCACATGCAGTACCACTAGCTCAGATTCAGTAG ACCGCTGTTGCGTAGAGGGCGGGTTGGTTGCGGGGCGATCGCGCGTCGG GGTTATGTCGCGTTTTTTTTTGGTGGATTCGTTAGTGTTGCGCTAGTAATG CAGACACTTGCGGTCCATCTCGAGCTGTCAGCACTACTAACTTGCGGTCA GT COL2A1 single (hgl9) CTCACTTGTAGAACGGTGATTGATCGTTGAAGTCGACCTAGGGAAGATG GGATAGAAGGGAATATATTTAGAGGTGGGATAGGTATTGGGTTAGAATG AAGGTTTGGTGGTTGGAGTTTATAATTGTTAGACGTCCAAGACATACTGC GTTCTCCTTAGCGATGCACATCA WID-qCIN single gBLOCK oligos are combined in a 1:1 ratio for standard curve material. Standard curve dilution steps: - Stdl: 100,000 copies per reaction. - Std2: 10,000 copies per reaction. - Std3: 1,000 copies per reaction. - Std4: 100 copies per reaction. • PMR calculation: .              t , „ Cq Uarqet}-Intercept(tarqet standard curve) Calculation!:     input amount = 10 —-------------—------------------ Slope (target standard curve) ts Calculation 2:       PMR =   * 100 Where t refers to the mean input amount of the target, c refers to the mean input amount of COL2A1 (Chrl2:48381229-48381320), s refers to the sample, and g refers to the gBLOCK pos control. PMR is calculated for RALYL (Chr8:85095492-85095580), GSX1 (Chrl3:28366785-28366866) and DPP6 (Chr7:153584008-153584079), respectively. The final result is reported as SUM-PMR QT’MR). Calculation 3:     ^PMR = PMR[RALYL} + PMR[DPP6} + PMR[GSX1] TABLE 1 i ante i. Characteristics of HPV-positive women of the KI-ql-2017 cohort attending cervical cancer screening in Greater Stockholm between January 1, and March 31, 2017.* All WID-qCIN negative WID-qCIN positive WID-qCIN inadequate Characteristic (N=2377) (N=1601) (N=686) (N=90) Age - yr Mean (Range) 40.8 (30-64) 40.2 (30-64) 42.0 (30-63) 42.6 (30-62) Cytology result at baseline visit - no. (%) Negative 1661 (69.9) 1249 (78.0) 346 (50.4) 66 (73.3) Positive 711 (29.9) 352 (22.0) 339 (49.4) 20 (22.2) Inadequate 5 (0.2) 0 (0.0) 1 (0.1) 4 (4.4) HPV16 / 18 test result at baseline visit - no. (%) Negative 1720 (72.4) 1251 (78.1) 402 (58.6) 67 (74.4) Positive 654 (27.5) 347 (21.7) 284(41.4) 23 (25.6) Inadequate 3 (0.1) 3 (0.2) 0 (0.0) 0 (0.0) Prevalent (0-12 months) Histopathological diagnosis - no. (%) Normal / CINl 385 (16.2) 263 (16.4) 115(16.8) 7 (7.8) CIN2 28(1.2) 12 (0.7) 16 (2.3) 0 (0.0) CIN3 95 (4.0) 13 (0.8) 78(11.4) 4 (4.4) HSIL 160 (6.7) 38 (2.4) 111 (16.2) 11 (12.2) AIS 12 (0.5) 3 (0.2) 9(1.3) :         0 (0.0) CC 11 (0.5) 1 (0.1) 10(1.5) 0 (0.0) No biopsy performed 1686 (70.9) 1271 (79.4) 347 (50.6) 68 (75.6) Incident (13-72 months)! Histopathological diagnosis - no. (%) Normal / CINl 551 (23.2) 413 (25.8) 124(18.1) 14(15.6) CIN2..... 3 (0.1) 2(0.1) 1 (0.1) :         0 (0.0) CIN3 16 (0.7) 4 (0.2) 12(1.7) 0 (0.0) HSIL 225 (9.5) 122 (7.6) 92(13.4) 11(12.2) AIS 16 (0.7) 5 (0.3) 11 (1.6) 0 (0.0) CC 11 (0.5) 6 (0.4) 4 (0.6) : 1 (1-1) No biopsy performed 1028 (43.2) 814 (50.8) 174 (25.4) 40 (44.4) *Percentages may not total 100 due to rounding. AIS denotes adenocarcinoma in situ, CC cervical cancer, CIN1 / 2 / 3 cervical intraepithelial neoplasia grade 1 / 2 / 3, HPV human papillomavirus, and HSIL high grade squamous intraepithelial lesion (reflective of CIN2 or CIN3). Cytology positive refers to ASC-US+ (atypical squamous cells of undetermined significance or worse), and cytology negative to NILM (negative for intraepithelial lesion or malignancy). tlncident cases cover all histopathological findings excluding prevalent CIN2+ cases and samples without follow-up. TABLE 2 Performance of cytology, HPVI6 / I8 and WID-qCIN to detect prevalent disease.* Parameter Cytology HPV16 / 18 WID-qCIN WID-qCIN / HPV16 / 18 no. / total no. %(95%C1) no. / total no. %(95%C1) no. / total no. % (95% Cl) no. / total no. % (95% Cl) Specificity <CIN1 1656 / 2067 80.1 (78.3 81.8) 1577 / 2068 76.3 (74.4 78.1) 1534 / 1996 76.9 (74.9 78.7) 1210 / 1993 60.7 (58.5 62.9) Sensitivity CIN2+ 300 / 305 98.4 (96.0 99.4) 163 / 306 53.3 (47.5 58.9) 224 / 291 77.0 (71.6 81.6) 250 / 291 85.9 (81.3 89.6) CIN2 26 / 28 92.9 (75.0 98.8) 10 / 28 35.7 (19.3 55.9) 16 / 28 57.1 (37.4 75.0) 20 / 28 71.4 (51.1 86.0) I IS IL 157 / 160- 98.1 (94.2 99.5) 76 / 160 47.5 (39.6 55.5) 111 / 149 74.5 (66.6 81.1) 124 / 149 83.2 (76.0 88.7) CIN3 95 / 95 100.0 (95.2 100.0) 56 / 95 58.9 (48.4 68.8) 78 / 91 85.7 (76.4 91.9) 85 / 91 93.4 (85.7 97.3) AIS 12 / 12 ' 100.0 (69.9100.0) 10 / 12 83.3 (50.9 97.1) 9 / 12 75.0 (42.8 93.3) ■ 10 / 12 83.3 (50.9 97.1) CC 10 / 10 100.0 (65.5- 11 / 11 100.0 (67.9- 10 / 11 90.9(57.1 99.5) 11 / 11 100.0 (67.9- 100.0) 100.0) 100.0) PPV CIN2+ 300 / 711 42.2 (38.5 45.9) 163 / 654 24.9 (21.7 28.5) 224 / 686 32.7 (29.2 36.3) 250 / 1033 24.2 (21.6 27.0) NPV CIN2+ 1656 / 1661 99.7 (99.3 99.9) 1577 / 1720 91.7 (90.3 92.9) 1534 / 1601 95.8 (94.7 96.7) 1210 / 1251 96.7 (95.5 97.6) *AIS denotes adenocarcinoma in situ, CC cervical cancer, CIN1 / 2 / 3+ cervical intraepithelial neoplasia grade 1 / 2 / 3 or worse, HPV human papillomavirus, HSIL high grade squamous intraepithelial lesion (reflective of CIN2 or CIN3), NPV negative predictive value, and PPV positive predictive value. For performance assessments, five samples with inadequate cytology, three samples without HPV-subtype results and 90 samples with inconclusive WID-qCIN results were excluded from analyses. TABLE 3 i sose s Performance of cytology, HPV16 / 18 and WID-qCIN to predict incident disease.* Test All Incident cases Hazard ratio (95% Cl) P Value no. no. / total no. (%) CIN2+ Cytology Negative 1511 220 / 269 (81.8) - Positive 336 49 / 269 (18.2) 0.96(0.70-1.31) 0.78 HPV16 / 18 Negative 1412 147 / 270 (54.4) Positive 435 123 / 270 (45.6) 2.72 (2.14-3.45) <0.01 WID-qCIN Negative 1366 139 / 259 (53.7) - Positive 418 120 / 259 (46.3) 3.01(2.36-3.85) <0.01 WID-qCIN / HPV16 / 18 Negative 1078 79 / 258 (30.6) Positive 703 179 / 258 (69.4) 3.55 (2.73-4.63) <0.01 CC Cytology Negative 1511 8 / 10 (80.0) Positive 336 2 / 10 (20.0) 0.93 (0.20-4.40) 0.92 HPV16 / 18 Negative 1412 5 / 11 (45.5) - Positive 435 6 / 11 (54.5) 3.87(1.18-12.68) 0.03 WID-qCIN Negative 1366 6 / 10 (60.0) Positive 418 4 / 10 (40.0) 2.46(0.69-8.72) 0.16 WID-qCIN / HPV16 / 18 Negative 1078 2 / 10 (20.0) - Positive 703 8 / 10 (80.0) 6.44 (1.37-30.35) 0.02 *CC denotes cervical cancer, CIN2+ cervical intraepithelial neoplasia grade 2 or worse, and HPV human papillomavirus. Cytology positive refers to ASC-US+ (atypical squamous cells of undetermined significance or worse), and cytology negative to NILM (negative for intraepithelial lesion or malignancy). TABLE 4. Estimation of colposcopy referrals in the KI-ql-2017 cohort.* Colposcopy referrals Test CIN2+ detections CC detection Colposcopy referrals required per CIN2+ detection no. / total % (95% CI) no. / total % (95% CI) no. no. no. no. Cytology 349 / 574 60.8 (56.7-64.8) 14 / 22 63.6 (40.8-82.0) 1432 4.10 11PV16 / 18 286 / 576 49.7 (45.5-53.8) 18 / 24 75.0 (52.9-89.4) 654 2.29 WID-qCIN 344 / 550 62.5 (58.3-66.6) 16 / 23 69.6 (47.0-85.9) 686 1.99 WID-qCIN / lIPVI6 / l8 429 / 549 78.1 (74.4-81.5) 21 / 23 91.3 (70.5-98.5) 1033 2.41 *CC denotes cervical cancer, CIN2+ cervical intraepithelial neoplasia grade 2 or worse, and HPV human papillomavirus. Table 5. Characteristics of the WID-qCIN calibration set.* Characteristic Calibration set <CIN1 (N=123) CIN2+ (N=45) CIN2 (N=17) CIN3+(N=28) Age - yr Mean (Range) 33.7 (23-59) 33.8 (23-53) 33.9 (23-53) 33.7 (23-51) HPV test result - no. (%) Negative 73 (59.3) 0 (0.0) 0 (0.0) 0 (0.0) Positive 50 (40.7) 45 (100.0) 17 (100.0) 28 (100.0) *CINl / 2 / 3+ denotes cervical intraepithelial neoplasia grade 1 / 2 / 3 or worse, and HPV human papillomavirus. Table 6. Performance of the WID-qCIN to detect prevalent disease in the calibration set. * Dataset Specificity Sensitivity Calibration <CIN 1 no. / total no.        % (95% Cl) 118 / 123        95.9 (90.3-98.5) CIN2+ no. / total no.        % (95% CI) 32 / 45         71.1 (55.5-83.2) *CINl / 2+ denotes cervical intraepithelial neoplasia grade 1 / 2 or worse. Table 7. Cumulative incidence rates of incident CIN2+ in the KI-ql-2017 cohort according to logistic Weibull mixture model analysis.* Test Odds ratio (95% Cl) Hazard ratio (95% Cl) CIN2+ cumulative incidencet WID-qCIN Negative - - 0.15 (0.13-0.17) Positive 7.75 (6.06-9.90) 2.31 (1.31-4.08) 0.54 (0.50-0.58) HPV16 / 18 Negative - - 0.19 (0.17-0.21) Positive 3.99 (3.20-4.97) 2.47 (1.40-4.37) 0.48 (0.44-0.52) WID- qCIN / HPV16 / 18 Negative - - 0.11 (0.10-0.14) Positive 7.55 (5.73-9.93) 2.83 (1.55-5.16) 0.46 (0.42-0.49) *CIN2+ denotes cervical intraepithelial neoplasia grade 2 or worse, and HPV human papillomavirus. +CIN2+ cumulative incidence rates were calculated for a time span of 72 months.

Claims

1. An assay for assessing the presence, absence or development of cervical intraepithelial neoplasia grade 2 or higher (CIN2+) and / or cervical cancer (CC) in an individual, the assay comprising:a. providing a sample which has been taken from the individual, the sample comprising a population of DNA molecules;b. determining in the population of DNA molecules in the sample the methylation status of a test panel of three or more CpGs, wherein:i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 2, and wherein the at least one CpG is denoted by CG; andii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 3 and SEQ ID NO 4, and wherein the at least one CpG is denoted by CG; andiii. at least one CpG in the test panel is contained within a third DMR comprised in the population of DNA molecules, the third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 5 and SEQ ID NO 6, and wherein the at least one CpG is denoted by CG; andc. assessing the presence, absence or development of CIN2+ and / or CC in the individual based on the methylation status of the CpGs in the test panel.

2. An assay according to claim 1, wherein:a. at least two CpGs denoted by CG contained within the first DMR, at least three CpGs denoted by CG contained within the first DMR, at least four CpGs denoted by CG contained within the first DMR, at least five CpGs denoted by CG contained within the first DMR, or all of the CpGs denoted by CG contained within the first DMR, are in the test panel of CpGs;b. at least two CpGs denoted by CG contained within the second DMR, at least three CpGs denoted by CG contained within the second DMR, at least four CGs denoted by CG contained within the second DMR, at least five CpGs denoted by CG contained within the second DMR, or all of the CpGs denoted by CG contained within the second DMR, are in the test panel of CpGs; and / orc. at least two CpGs denoted by CG contained within the third DMR, at least three CpGs denoted by CG contained within the third DMR, at least four CGs denoted by CG contained within the third DMR, at least five CpGs denoted by CG contained within the third DMR, or all of the CpGs denoted by CG contained within the third DMR, are in the test panel of CpGs.

3. An assay according to claim 1 or claim 2, wherein when the CpGs of the test panel of three or more CpGs are determined to be methylated, the individual is assessed as having CIN2+ and / or CC, or as being at risk of development of CIN2+ and / or CC.

4. An assay according to any one of claims 1 to 3, wherein the step of determining the methylation status of the CpGs in the test panel comprises an amplification-based technique, preferably wherein:i. the amplification-based technique is PCR, optionally wherein the PCR comprises quantification; and / orii. the amplification-based technique comprises a detection system, optionally wherein the system comprises a probe comprising a detection moiety.

5. An assay according to claim 4, wherein the step of determining the methylation status of the CpGs contained within the first, second and third DMRs by PCR comprises:a. a duplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by CG in the first DMR, and PCR amplification of a region comprising one or more CpGs denoted by CG in the third DMR; andb. a duplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by CG in the second DMR, and PCR amplification of a control sequence within the same reaction vessel,WO 2025 / 168613                                   PCT / EP2025 / 052932preferably wherein the control sequence does not comprise any CpG dinucleotides, denoted by CG.

6. An assay according to claim 5, wherein the control sequence is defined according to SEQ ID NO: 7 or SEQ ID NO: 8.

7. An assay according to any one of claims 4-6, wherein prior to PCR, the three or more CpGs in the test panel have been subject to bisulfite treatment.

8. An assay according to claim 7, wherein:a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 11; and / orb. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 14; and / orc. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 17; and / ord. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising an a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 8 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 20; and / or optionallye. the assay comprises a negative control PCR reaction, preferably wherein the negative control reaction does not comprise a template nucleic acid sequence.

9. An assay according to claim 8, wherein the assessing of the presence, absence or development of CIN2+ and / or CC in the individual based on methylation of the CpGs in the test panel comprises determining mean percent of fully methylated reference (PMR) values for each DMR based on the methylation status of the CpGs from each DMR comprised in the test panel.

10. An assay according to any one of claims 1 to 9, wherein the test panel of three or more CpGs consists of the CpGs denoted by CG contained with the first strand of the firstWO 2025 / 168613                                   PCT / EP2025 / 052932DMR defined according to SEQ ID NO 1, the CpGs denoted by CG contained within the first strand of the second DMR defined according to SEQ ID NO 3, and the CpGs denoted by CG contained within the first strand of the third DMR defined according to SEQ ID NO 5.

11. An assay according to any one of claims 1 to 10, further comprising determining in a sample which has been taken from the individual the presence or absence of human papilloma virus (HPV) subtype 16 and / or 18.

12. An assay according to claim 11, wherein the determining of the presence or absence of HPV 16 and / or HPV 18 comprises testing for the presence of DNA from HPV 16 and / or HPV18, preferably wherein said determining comprises genotyping.

13. A system for a PCR assay, the system comprising:- a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated;- a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and- a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence ofWO 2025 / 168613                                   PCT / EP2025 / 052932SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated,14. A system according to claim 13, further comprising:- a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 7 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment of SEQ ID NO: 7.

15. A system according to claim 14, wherein:i. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 11; andii. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 14;iii. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 17; andiii. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 20.

16. A kit comprising:- a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence ofSEQ ID NO: 1 in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated and following bisulfite treatment;- a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 3 in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated and following bisulfite treatment of SEQ ID NO: 3; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated and following bisulfite treatment; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 5 in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated and following bisulfite treatment of SEQ ID NO: 5; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated and following bisulfite treatment.

17. A kit according to claim 16, further comprising:- a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 7 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment of SEQ ID NO: 7.

18. A kit according to claim 17, wherein:i. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 11; andii. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 14;WO 2025 / 168613                                   PCT / EP2025 / 052932iii. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 17; andiii. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 20.

19. An in vitro method of assaying DNA and detecting methylation of the DNA therein, the method comprising measuring a methylation status of a test panel of three or more CpGs, wherein:i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 2, and wherein the at least one CpG is denoted by CG;ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 3 and SEQ ID NO 4, and wherein the at least one CpG is denoted by CG; andiii. at least one CpG in the test panel is contained within a third DMR comprised in the population of DNA molecules, the third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 5 and SEQ ID NO 6, and wherein the at least one CpG is denoted by CG.

20. An in vitro method according to claim 19, wherein the test panel of two or more CpGs comprises:a. at least two CpGs denoted by CG contained within the first DMR, at least three CpGs denoted by CG contained within the first DMR, at least four CpGs denoted by CG contained within the first DMR, at least five CpGs denoted by CG contained within the first DMR, or all of the CpGs denoted by CG contained within the first DMR, are in the test panel of CpGs;b. at least two CpGs denoted by CG contained within the second DMR, at least three CpGs denoted by CG contained within the second DMR, at least four denoted by CG CpGs contained within the second DMR, at least five CpGs denoted by CG contained within the second DMR, or all of the CpGs denoted by CG contained within the second DMR, are in the test panel of CpGs; and / orc. at least two CpGs denoted by CG contained within the third DMR, at least three CpGs denoted by CG contained within the third DMR, at least four CGs denoted by CG contained within the third DMR, at least five CpGs denoted by CG contained within the third DMR, or all of the CpGs denoted by CG contained within the third DMR, are in the test panel of CpGs.

21. An in vitro method according to claim 19 or claim 20, wherein the method comprises PCR, optionally wherein the PCR comprises quantification.

22. An in vitro method according to claim 21, wherein the PCR comprises:a. a duplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by CG in the first DMR, and PCR amplification of a region comprising one or more CpGs denoted by CG in the third DMR; andb. a duplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by CG in the second DMR, and PCR amplification of a control sequence within the same reaction vessel, preferably wherein the control sequence does not comprise any CpG dinucleotides, denoted by CG.

23. An in vitro method according to claim 22, wherein the control sequence is defined according to SEQ ID NO: 7 or SEQ ID NO: 8.

24. An in vitro method according to claim 23, wherein:a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ IDNO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 1 are methylated; preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 9, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 10, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 11; and / orb. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 3 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 12, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 13, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 14; and / orc. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 5 following bisulfite treatment in which all CpGs denoted by CG in SEQ ID NO: 5 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 15, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 16, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 17d. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising an a detection moiety,wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 7 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 7 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 18, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 19, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 20; and / or optionallye. the assay comprises a negative control PCR reaction, preferably wherein the negative control reaction does not comprise a template nucleic acid sequence.

25. A method of treating and / or preventing CIN2+ and / or CC in an individual, the method comprising:i. assessing the presence, absence or development of CIN2+ and / or CC in an individual according to any one of claims 1 to 12; andii. administering one or more therapeutic or preventative treatments or measures to the individual based on the assessment.

26. A method of monitoring the CIN2+ or CC status and / or the risk of CIN2+ or CC in an individual, the method comprising: (a) assessing the presence, absence or development of CIN2+ and / or CC in an individual by performing the assay according to any one of claims 1 to 12 at a first time point; (b) assessing the presence, absence or development of CIN2+ and / or CC in the individual by performing the assay according to any one of claims 1 to 12 at one or more further time points; and (c) monitoring any change in the CIN2+ or CC status and / or the risk of CIN2+ and / or CC development of the individual.

Images