Method for preparing retinal pigment epithelial cells

Abstract

The present invention provides a method for preparing retinal pigment epithelial cells, comprising the following steps: (1) a first step of culturing pluripotent stem cells in a culture medium containing at least one selected from the group consisting of an FGF receptor inhibitor and a MEK inhibitor for a period of no more than 30 days, and (2) a second step of culturing the cells obtained in the first step in a culture medium containing at least one selected from the group consisting of a Rho signal transduction pathway inhibitor and a cell apoptosis inhibitor to form retinal pigment epithelial cells. Using this method, it is possible to prepare retinal pigment epithelial cells from pluripotent stem cells in a more efficient and convenient manner.

Description

Technical Field

[0001] The present invention relates to a method for preparing retinal pigment epithelial (RPE) cells, etc. Background Art

[0002] Retinal pigment epithelial cells are pigment epithelial cells present in the outermost layer of the retina, and play an important role in the maintenance of photoreceptor cells such as the phagocytosis of the outer segments of photoreceptor cells, the recycling of visual substances. Age-related macular degeneration caused by the abnormality of retinal pigment epithelial cells caused by aging, etc., is an ophthalmic disease causing central visual loss or blindness, and it is expected to develop an effective method for treating the disease. Recently, as a new treatment method for age-related macular degeneration, the cell transplantation therapy that supplements or replaces retinal pigment epithelial cells has attracted a lot of attention, and it is expected that retinal pigment epithelial cells will be used as a transplant material for cell therapy. So far, although there have been some reports (non-patent literature 1 and 2, patent literature 1,2,3 and 4) about the method for inducing differentiation into retinal pigment epithelial cells using human pluripotent stem cells, due to the need to stably prepare a large number of high-quality retinal pigment epithelial cells in the regenerative medicine industry, it is therefore expected that a more efficient and convenient preparation method.

[0003] Prior art literature

[0004] Patent Literature

[0005] Patent Document 1: International Publication No. WO 2012 / 173207

[0006] Patent Document 2: International Publication No. WO 2015 / 053375

[0007] Patent Document 3: International Publication No. WO 2015 / 053376

[0008] Patent Document 4: US Publication No. US 2013 / 0224156

[0009] Non-patent literature

[0010] Non-patent document 1: Stem Cell Reports, 2(2), 205-218 (2014)

[0011] Non-patent document 2: Cell Stem Cell, 10(6), 771-785 (2012) Summary of the invention

[0012] Technical Problems to be Solved by the Invention

[0013] In order to stably produce a large amount of retinal pigment epithelial cells derived from pluripotent stem cells when using the cells in regenerative medicine, etc., it is urgently necessary to develop a more efficient and convenient production method.

[0014] Means of solving the problem

[0015] In view of the above circumstances, the inventors of the present invention have conducted intensive studies and, as a result, have completed the present invention.

[0016] That is, the present invention relates to the following contents.

[0017] [1] A method for preparing retinal pigment epithelial cells, comprising the following steps:

[0018] (1) in a first step, culturing pluripotent stem cells in a medium containing at least one selected from the group consisting of an FGF receptor inhibitor and a MEK inhibitor for a period not exceeding 30 days, and

[0019] (2) In the second step, the cells obtained in the first step are cultured in a medium containing at least one selected from the group consisting of a Rho signaling pathway inhibitor and a cell apoptosis inhibitor to form retinal pigment epithelial cells.

[0020] [2] The method according to the above-mentioned [1], wherein the first step is performed under serum-free conditions.

[0021] [3] The method according to [1] or [2] above, wherein the first step is performed in the absence of feeder cells.

[0022] [4] The production method according to any one of [1] to [3] above, wherein the culture medium in the first step further contains a factor for maintaining an undifferentiated state.

[0023] [5] The preparation method according to the above [4], wherein the factor for maintaining the undifferentiated state is an FGF signal transduction pathway agonist.

[0024] [6] The method according to the above-mentioned [5], wherein the FGF signal transduction pathway agonist is bFGF.

[0025] [7] The method according to any one of [1] to [6] above, wherein the FGF receptor inhibitor is at least one selected from the group consisting of PD173074 and SU5402.

[0026] [8] The method according to any one of [1] to [7] above, wherein the MEK inhibitor is at least one selected from the group consisting of PD0325901, PD184352, U0126, TAK-733 and AZD-8330.

[0027] [9] The method according to any one of [1] to [8] above, wherein the culture medium in the second step does not contain an exogenous Nodal signaling pathway inhibitor or an exogenous Wnt signaling pathway inhibitor.

[0028]

[10] The method according to any one of [1] to [8] above, wherein the culture medium in the second step does not contain exogenous substances that affect differentiation induction of pluripotent stem cells other than Rho signaling pathway inhibitors and apoptosis inhibitors.

[0029]

[11] The method according to any one of [1] to [8] above, wherein the culture medium in the second step does not contain exogenous substances that affect the differentiation induction of pluripotent stem cells into ectoderm cells other than Rho signaling pathway inhibitors and apoptosis inhibitors.

[0030]

[12] The method according to any one of [1] to

[11] above, wherein the Rho signaling pathway inhibitor is at least one selected from the group consisting of a Rho-associated protein kinase (ROCK) inhibitor and a myosin inhibitor.

[0031]

[13] The method according to the above-mentioned

[12] , wherein the Rho-associated protein kinase (ROCK) inhibitor is at least one selected from the group consisting of Y27632 and fasudil.

[0032]

[14] The method according to any one of [1] to

[13] above, wherein the apoptosis inhibitor is a caspase inhibitor.

[0033]

[15] The method according to the above-mentioned

[14] , wherein the caspase inhibitor is Z-VAD-FMK.

[0034]

[16] The preparation method according to any one of [1] to

[15] above, wherein the pluripotent stem cells are primate pluripotent stem cells.

[0035]

[17] The production method according to any one of [1] to

[16] above, wherein the pluripotent stem cells are human pluripotent stem cells.

[0036] [18'] The method according to any one of [1] to

[17] above, wherein the culture period in the first step is sufficient to induce gene expression of at least one eye region transcription factor.

[0037] [19'] The method according to any one of [1] to

[17] above, wherein the culture period in the first step is a period sufficient to induce gene expression of at least one of PAX6, LHX2 and SIX3.

[0038]

[18] The method according to any one of [1] to

[17] , [18'] and [19'] above, wherein the culture period in the first step is 2 to 13 days.

[0039]

[19] The method according to any one of [1] to

[18] , [18'] and [19'] above, wherein the culture period in the first step is 4 to 6 days.

[0040]

[20] A reagent for evaluating the toxicity or efficacy of a test substance, comprising retinal pigment epithelial cells prepared by the preparation method according to any one of [1] to

[19] , [18'] and [19'] above.

[0041]

[21] A method for evaluating the toxicity or efficacy of a test substance, comprising contacting retinal pigment epithelial cells prepared according to the preparation method described in any one of [1] to

[19] , [18'] and [19'] above with the substance, and determining the effect of the substance on the cells.

[0042]

[22] A therapeutic agent for treating a disease based on retinal pigment epithelial cell disorders, comprising retinal pigment epithelial cells prepared by the method according to any one of [1] to

[19] , [18'] and [19'] above.

[0043]

[23] A method for treating a disease based on retinal pigment epithelial cell disorders, comprising transplanting an effective amount of retinal pigment epithelial cells prepared by the method according to any one of [1] to

[19] , [18'] and [19'] above into a subject in need of treatment.

[0044]

[24] Retinal pigment epithelial cells prepared by the method according to any one of [1] to

[19] , [18'] and [19'] above, for use in treating a disease based on a retinal pigment epithelial cell disorder.

[0045]

[25] A pharmaceutical composition comprising, as an active ingredient, retinal pigment epithelial cells prepared by the method according to any one of [1] to

[19] , [18'] and [19'] above.

[0046] Effects of the Invention

[0047] The present invention makes it possible to provide a method for preparing retinal pigment epithelial cells that is more efficient and convenient than existing differentiation induction methods. Therefore, the method of the present invention is useful in effectively preparing retinal pigment epithelial cells, which can be transplant materials for cell therapy, or reagents or materials for evaluating the toxicity or efficacy of chemical substances, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] [ Figure 1 ] shows a photograph of a 6-well culture plate containing iPS cell (1231A3 line) derived retinal pigment epithelial cells on day 42 of culture, which were prepared in the presence of ROCK inhibitor Y-27632 (10 μM Y-27632) in the second step after the FGF receptor inhibitor treatment step (first step), and a photograph of a 6-well culture plate containing iPS cell (1231A3 line) derived differentiated cells on day 42 of culture, which were prepared in the absence of Y-27632 (untreated). FGFRi: FGF receptor inhibitor (100 nM PD173074).

[0050] [ Figure 2-1 ] shows photographs of 6-well culture plates containing iPS cell (1231A3 line) derived retinal pigment epithelial cells on day 48 of culture, which were prepared in the presence of ROCK inhibitor Y-27632 (1 μM, 3 μM, 10 μM, 30 μM, 100 μM Y-27632) in the second step after the FGF receptor inhibitor or MEK inhibitor treatment step (first step), and photographs of 6-well culture plates containing iPS cell (1231A3 line) derived differentiated cells on day 48 of culture, which were prepared in the absence of Y-27632 (untreated). FGFRi: FGF receptor inhibitor (100 nM PD173074), MEKi: MEK inhibitor (1 μM PD0325901).

[0051] [ Figure 2-2 ] shows photographs of 6-well culture plates containing iPS cell (QHJI01 line) derived retinal pigment epithelial cells at day 50 of culture, which were prepared in the presence of ROCK inhibitor Y-27632 (1 μM, 3 μM, 10 μM, 30 μM, 100 μM Y-27632) in the second step after the FGF receptor inhibitor or MEK inhibitor treatment step (first step), and photographs of 6-well culture plates containing iPS cell (QHJI01 line) derived differentiated cells at day 50 of culture, which were prepared in the absence of Y-27632 (untreated). FGFRi: FGF receptor inhibitor (100 nM PD173074), MEKi: MEK inhibitor (1 μM PD0325901).

[0052] [ Figure 3] shows a photograph of a 6-well culture plate containing iPS cell (QHJI01 line) derived retinal pigment epithelial cells at day 50 of culture, which were prepared by exposure to a low concentration (1 μM) of ROCK inhibitor Y-27632 at 10 times the total number of seeded cells in the second step after the FGF receptor inhibitor or MEK inhibitor treatment step (first step), and a photograph of a 6-well culture plate containing iPS cell (QHJI01 line) derived differentiated cells at day 50 of culture, which were prepared in the absence of Y-27632 (untreated). FGFRi: FGF receptor inhibitor (100 nM PD173074), MEKi: MEK inhibitor (1 μM PD0325901).

[0053] [ Figure 4 ] shows a photograph of a 12-well culture plate containing iPS cell (QHJI01 line) derived retinal pigment epithelial cells at day 49 of culture, which were prepared by exposure to the ROCK inhibitor Y-2763 for 23 days to 20 days (3 days, 6 days, 9 days, 12 days, 16 days, 20 days) in the second step after the MEK inhibitor treatment step (first step). MEKi: MEK inhibitor (1 μM PD0325901).

[0054] [ Figure 5 ] shows photographs of 6-well culture plates containing iPS cell (1231A3 line, QHJI01 line) derived retinal pigment epithelial cells prepared by exposure to ROCK inhibitor fasudil (10 μM, 30 μM, 100 μM fasudil) at 10 times or 5 times the total number of seeded cells in the second step after the FGF receptor inhibitor treatment step (first step) and 6-well culture plates containing differentiated cells derived from iPS cells (1231A3 line, QHJI01 line) prepared in the absence of fasudil (untreated) at 41 days or 48 days of culture. FGFRi: FGF receptor inhibitor (100 nM PD173074).

[0055] [ Figure 6] shows a photograph of a 6-well culture plate containing iPS cell (QHJI01 line) derived retinal pigment epithelial cells at culture day 67, which were prepared by exposure to the caspase inhibitor Z-VAD-FMK (20 μM Z-VAD-FMK) at 10 times the total number of seeded cells in the second step after the MEK inhibitor treatment step (first step), and a photograph of a 6-well culture plate containing iPS cell (QHJI01 line) derived differentiated cells at culture day 65, which were prepared in the absence of Z-VAD-FMK (untreated). MEKi: MEK inhibitor (1 μM PD0325901).

[0056] [ Figure 7 ] shows a photograph of a 6-well culture plate containing retinal pigment epithelial (RPE) cells derived from iPS cells (201B7 or 1231A3) after 38-42 days of culture, wherein the retinal pigment epithelial cells are prepared by the preparation method of Reference Example 1, wherein the preparation method comprises using MEK inhibitor treatment steps for AK03 medium or Essential 8 medium. MEKi: MEK inhibitor (when used 1 μM PD0325901 when using AK03 medium; 0.03 μM PD0325901 when using Essential 8 medium).

[0057] [ Figure 8 ] shows (a) photograph, (b) low magnification phase contrast microscopic image and (c) high magnification bright field microscopic image of a 6-well culture plate containing iPS cell (201B7) derived RPE cells after 55 days of culture, wherein the RPE cells were prepared by the preparation method of Reference Example 1, wherein the preparation method includes the step of MEK inhibitor treatment. MEKi: MEK inhibitor (1 μM PD0325901).

[0058] [ Fig. 9 ] shows a photograph of a 6-well culture plate containing differentiated cells derived from iPS cells (201B7 or 1231A3) after 38-42 days of culture, wherein the differentiated cells were prepared by the preparation method of Reference Comparative Example 1, wherein the preparation method does not include the use of Steps for MEK inhibitor treatment of AK03 medium or Essential 8 medium.

[0059] [ Fig.10 ] shows a photograph of a 6-well culture plate containing retinal pigment epithelial (RPE) cells derived from iPS cells (201B7 or 1231A3) after 38-42 days of culture, wherein the retinal pigment epithelial cells are prepared by the preparation method of Reference Example 2, wherein the preparation method comprises using Steps of FGF receptor inhibitor treatment of AK03 medium, Essential 8 medium or StemSure hPSC medium Δw / o bFGF. FGFRi: FGF receptor inhibitor (100 nM PD173074).

[0060] [ Fig.11 ] shows (a) photograph, (b) low magnification phase contrast microscopic image and (c) high magnification bright field microscopic image of a 6-well culture plate containing iPS cell (201B7) derived RPE cells after 55 days of culture, wherein the RPE cells were prepared by the preparation method of Reference Example 2, wherein the preparation method includes the step of FGF receptor inhibitor treatment. FGFRi: FGF receptor inhibitor (100 nM PD173074).

[0061] [ Fig.12 ] shows a photograph of a 6-well culture plate containing differentiated cells derived from iPS cells (201B7 or 1231A3) after 38-42 days of culture, wherein the differentiated cells were prepared by the preparation method of Reference Comparative Example 2, wherein the preparation method does not include the use of Steps for FGF receptor inhibitor treatment of AK03 medium, Essential8 medium, or StemSure hPSC medium Δw / o bFGF.

[0062] [ Fig.13] show the photo of 6-well culture plates containing iPS cell (201B7 or 1231A3) derived RPE cells after cultivating 38-47 days, described RPE cell is prepared by the preparation method of reference example 3, and described preparation method comprises the step of processing with the combination of MEK inhibitor and / or FGF receptor inhibitor and various inhibitors, signal transduction pathway inhibitor or signal transduction pathway agonist.For comparison, also show the photo of 6-well culture plates containing iPS cell derived RPE cells, described RPE cells are prepared by the preparation method of reference comparative example 1 not excluding MEK inhibitor treatment step and the preparation method of reference example 1 comprising the step of MEK inhibitor treatment (" untreated " and " MEKi " in the upper figure of the figure), and also show the photo of 6-well culture plates containing iPS cell derived RPE cells, described RPE cells are prepared by the preparation method of reference comparative example 2 not excluding FGF receptor inhibitor treatment step and the preparation method of reference example 2 comprising FGF receptor inhibitor treatment step (" untreated " and " FGFRi " in the lower figure of the figure). MEKi: MEK inhibitor (1 μM PD0325901), FGFRi: FGF receptor inhibitor (100 nM PD173074), BMPRi: BMP receptor inhibitor (100 nM LDN193189), Shh ag: Shh signaling pathway agonist (30 nM SAG), PKCi: PKC inhibitor (2 μM Go6983).

[0063] [ Fig.14] show (A) when the results are classified into a 6-point scale of 0 to 5 according to the percentage of RPE cells in the entire well, representative photographs of 6-well culture plates for each scale, (B) by the preparation method of reference comparative example 1 not including a MEK inhibitor treatment step (untreated), the preparation method of reference example 1 including a MEK inhibitor treatment step (MEKi), and the preparation method including a combination of a MEK inhibitor and various inhibitors or signal transduction pathway inhibitors (MEKi+PKCi, MEKi+PKCi+BMPRi, MEKi+FGFRi, MEKi+FGFRi+BMPRi, MEKi+FGFRi+PKCi, MEKi+FGFRi+PKCi+BMPRi) The result of the preparation method of the reference example 3 of the step of processing is summarized, and (C) by the preparation method of the reference comparative example 2 not including the FGF receptor inhibitor processing step (untreated), the preparation method of the reference example 2 including the FGF receptor inhibitor processing step (FGFRi) and the result of the preparation method of the reference example 3 of the step of processing including the combination (FGFRi+PKCi, FGFRi+PKCi+BMPRi, FGFRi+MEKi, FGFRi+MEKi+BMPRi, FGFRi+MEKi+PKCi, FGFRi+MEKi+PKCi+BMPRi) of FGF receptor inhibitor and various inhibitors or signal transduction pathway inhibitors is summarized. The vertical axis of chart shows the percentage of RPE cells in whole hole with 6 point scales. These values ​​are represented by means ± standard deviation, and n represents the number of times of experiment. MEKi: MEK inhibitor (1 μM PD0325901), FGFRi: FGF receptor inhibitor (100 nM PD173074), BMPRi: BMP receptor inhibitor (100 nM LDN193189), PKCi: PKC inhibitor (2 μM Go6983).

[0064] [ Fig.15 ] shows a photograph of a 6-well culture plate containing retinal pigment epithelial (RPE) cells derived from iPS cells (Ff-I01 or QHJI01) after 43 days of culture, wherein the retinal pigment epithelial cells were prepared by the preparation method of Reference Example 4, wherein the preparation method comprises using MEK inhibitor or FGF receptor inhibitor treatment step (MEKi or FGFRi) of AK03N medium. For comparison, a photograph of a 6-well culture plate containing iPS cell-derived differentiated cells after 43 days of culture is also shown, wherein the differentiated cells are prepared by the preparation method of Reference Comparative Example 1 and Reference Comparative Example 2 without the MEK inhibitor and / or FGF receptor inhibitor treatment step (untreated). MEKi: MEK inhibitor (1 μM PD0325901), FGFRi: FGF receptor inhibitor (100 nM PD173074).

[0065] [ Fig.16 ] shows a photograph of a 6-well culture plate containing iPS cell (QHJI01)-derived retinal pigment epithelial (RPE) cells after 48 days of culture, wherein the retinal pigment epithelial cells were prepared by the preparation method of Reference Example 5, wherein the preparation method comprises using MEK inhibitor or FGF receptor inhibitor treatment step (MEKi (PD0325901) or FGFRi (PD173074)) of AK03N culture medium. The effects of exposure to inhibitors for 1 to 6 days were tested. MEKi: MEK inhibitor (1 μM PD0325901), FGFRi: FGF receptor inhibitor (100 nM PD173074).

[0066] [ Fig.17 ] shows a photograph of a 6-well culture plate containing iPS cell (1231A3)-derived retinal pigment epithelial (RPE) cells after 37 days of culture, wherein the retinal pigment epithelial cells were prepared by the preparation method of Reference Example 6, wherein the preparation method comprises using MEK inhibitor treatment step of AK03N medium (MEKi (PD0325901)). For comparison, a photograph of a 6-well culture plate containing iPS cell-derived differentiated cells after 37 days of culture is also shown, wherein the differentiated cells were prepared by the preparation method of Reference Comparative Example 1, which preparation method did not include the MEK inhibitor treatment step (untreated). The effect of exposure to the inhibitor for 1 day, 3 days, 6 days, and 13 days was examined. MEKi: MEK inhibitor (1 μM PD0325901).

[0067] [ Fig.18 ] shows the percentage of iPS cell (Ff-I01 or QHJI01) derived retinal pigment epithelial (RPE) cells in the whole well after 43 days of culture, wherein the retinal pigment epithelial cells are prepared by the preparation method of Reference Example 7, wherein the preparation method comprises using MEK inhibitor or FGF receptor inhibitor treatment step of AK03N culture medium, the percentage is based on Fig.14A Results by visual judgment, and expression values ​​(signals) and markers (detection) of PAX6, LHX2 and SIX3 are shown at the end of the first step (MEKi or FGFRi). For comparison, the percentage results of visual judgment of differentiated cells derived from iPS cells in the whole well of RPE cells are shown, and the differentiated cells are prepared by the preparation method of reference comparative example 1, and the preparation method does not include a MEK inhibitor and / or FGF receptor inhibitor treatment step (untreated), and the expression values ​​(signals) and markers (detection) of PAX6, LHX2 and SIX3 corresponding to the end of the first step are shown. MEKi: MEK inhibitor (1 μM PD0325901), FGFRi: FGF receptor inhibitor (100 nM PD173074).

[0068] [ Fig.19 ] shows a photograph of a 6-well culture plate containing iPS cell (QHJI01)-derived retinal pigment epithelial (RPE) cells after 36 or 49 days of culture, wherein the retinal pigment epithelial cells are prepared by the preparation method of Reference Example 8, wherein the preparation method comprises using MEK inhibitor or FGF receptor inhibitor treatment step (MEKi (PD0325901) or FGFRi (PD173074)) of AK03N medium. For comparison, a photograph of a 6-well culture plate containing iPS cell-derived differentiated cells after 49 days of culture is also shown, wherein the differentiated cells were prepared by the preparation methods of Reference Comparative Example 1 and Reference Comparative Example 2, and the preparation methods did not include a MEK inhibitor and / or FGF receptor inhibitor treatment step (untreated). The effects of a MEK inhibitor at a concentration of 0.25 μM to 4 μM or an FGF receptor inhibitor at a concentration of 25 nM to 400 nM were detected. MEKi: MEK inhibitor (PD0325901), FGFRi: FGF receptor inhibitor (PD173074).

[0069] [ Fig. 20 ] shows a photograph of a 6-well culture plate containing iPS cell (QHJI01)-derived retinal pigment epithelial (RPE) cells after 49 days of culture, wherein the retinal pigment epithelial cells were prepared by the preparation method of Reference Example 9, wherein the preparation method comprises using MEK inhibitor or FGF receptor inhibitor treatment step (MEKi (PD0325901) or FGFRi (PD173074)) of AK03N culture medium was measured. The number of cells seeded at the beginning of the second step (0.2×10 4 -4.0×10 4 Cells / cm 2MEKi: MEK inhibitor (1 μM PD0325901), FGFRi: FGF receptor inhibitor (100 nM PD173074).

[0070] [ Fig.21 ] shows a photograph of a 6-well culture plate containing retinal pigment epithelial (RPE) cells derived from iPS cells (QHJI01 or 1231A3) after 49 days or 50 days of culture, wherein the retinal pigment epithelial cells are prepared by the preparation method of Reference Example 10, wherein the preparation method comprises using MEK inhibitor treatment step of AK03N medium (MEKi (PD0325901), MEKi (PD184352), MEKi (U0126), MEKi (TAK-733) or MEKi (AZD-8330)). For comparison, a photograph of a 6-well culture plate containing iPS cell-derived differentiated cells after 49 days of culture is also shown, wherein the differentiated cells are prepared by the preparation method of Reference Comparative Example 1, wherein the preparation method does not include a MEK inhibitor treatment step (untreated). MEKi: MEK inhibitor (1 μM PD0325901, 1.5 μM, 3 μM or 6 μM PD184352, 5 μM or 10 μM U0126, 0.3 μM TAK-733, 0.3 μM AZD-8330).

[0071] [ Fig. 22 ] shows a photograph of a 6-well culture plate containing iPS cell (QHJI01 or 1231A3) derived retinal pigment epithelial (RPE) cells after 49 days of culture, wherein the retinal pigment epithelial cells were prepared by the preparation method of Reference Example 11, wherein the preparation method comprises using FGF receptor inhibitor treatment step of AK03N medium (FGFRi (PD173074) or FGFRi (SU5402)). For comparison, a photograph of a 6-well culture plate containing iPS cell-derived differentiated cells after 49 days of culture is also shown, wherein the differentiated cells were prepared by the preparation method of Reference Comparative Example 2, wherein the preparation method does not include the FGF receptor inhibitor treatment step (untreated). FGFRi: FGF receptor inhibitor (100nM PD173074, 5μM, 10μM or 20μM SU5402).

[0072] [ Fig.23 ] shows a photograph of a 12-well culture plate containing iPS cell (QHJI01)-derived retinal pigment epithelial (RPE) cells after 43 days of culture, wherein the retinal pigment epithelial cells were prepared by the preparation method of Reference Example 12, wherein the preparation method comprises using a medium containing a MEK inhibitor (NODALi+WNTI, NODALi or WNTI) After the first step of AK03N medium, in the second step, culture was carried out in the presence of a Nodal signaling pathway inhibitor and / or a Wnt signaling pathway inhibitor. The differentiation induction effect of exposure to a Nodal signaling pathway inhibitor or a Wnt signaling pathway inhibitor alone in the second step was examined. NODALi: Nodal signaling pathway inhibitor (5 μM SB431542), WNTi: Wnt signaling pathway inhibitor (3 μM CKI-7).

[0073] [ Fig.24 ] shows the percentage of iPS cell (201B7) derived retinal pigment epithelial (RPE) cells in the whole well after 39 days of culture, wherein the retinal pigment epithelial cells were prepared by the preparation method of Reference Example 13, wherein the preparation method comprises using MEK inhibitor and BMP receptor inhibitor treatment steps of AK03N culture medium, the percentages are based on Fig.14 A (in the upper part in the figure, MEKi 6 days+BMPRi 1 day, or MEKi 6 days+BMPRi 6 days) is by the result of visual judgment, and shows the comparative result (in the lower part in the figure, the percentage of RPE cells in the whole hole (6-point scale "3" and "5") of the expression level of early marker RAX in eye formation by real-time RT-PCR method after 39 days of cultivation). For comparison, also show the percentage results of the visual judgment of RPE in the whole hole of iPS cell-derived differentiated cells after 39 days of cultivation, the differentiated cells are prepared by the preparation method of reference comparative example 1, the preparation method does not include MEK inhibitor and / or BMP receptor inhibitor treatment step (in the upper part in the figure, "untreated"), and show the expression level of BEST1, MITF and RAX (in the lower part in the figure, the percentage of RPE cells in the whole hole (6-point scale "1")). The gene expression level in each sample was normalized with the expression level of GAPDH, and the expression level in iPS cells cultured under conditions maintaining an undifferentiated state was defined as 1, and the comparison of the expression amount of BEST1, MITF, or RAX is shown as a relative amount (lower part of the figure, "Undifferentiated").

[0074] [ Fig.25 ] shows a photograph of a 6-well culture plate containing iPS cell (1231A3)-derived retinal pigment epithelial (RPE) cells after 43 days of culture, wherein the retinal pigment epithelial cells were prepared by the preparation method of Reference Example 14, wherein the preparation method comprises using The MEK inhibitor or FGF receptor inhibitor treatment step of AK03N culture medium (on the right side of the figure, MEKi (PD0325901) and FGFRi (PD173074)), and the confirmation results of the expression of retinal pigment epithelial markers RPE65, BEST1 and CRALBP and endogenous control GAPDH by RT-PCR method after 43 days of culture are shown (on the left side of the figure, MEKi (PD0325901) and FGFRi (PD173074)). For comparison, a photograph of a 6-well culture plate containing iPS cell-derived differentiated cells after 43 days of culture is also shown, wherein the differentiated cells are prepared by the preparation method of reference comparative example 1, wherein the preparation method does not have a MEK inhibitor and / or FGF receptor inhibitor treatment step (on the right side of the figure, untreated), and the results of RT-PCR for RPE65, BEST1, CRALBP and GAPDH (on the left side of the figure, untreated). Primary human RPE was used as a positive control (left side in the figure, hRPE), and iPS cells cultured under conditions for maintaining an undifferentiated state were used as a negative control (left side in the figure, undifferentiated iPSCs) for the RT-PCR method. DETAILED DESCRIPTION OF THE INVENTION

[0076] 1. Definition

[0077] In the present specification, "pluripotent stem cells" means cells with self-renewal ability and pluripotency, that is, stem cells that can be cultured in vitro and have the ability (pluripotency) to differentiate into all cell lineages belonging to the three germ layers (ectoderm, mesoderm, endoderm).

[0078] Examples of pluripotent stem cells include embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), etc. The pluripotent stem cells to be used in the present invention are mammalian pluripotent stem cells, preferably rodent or primate pluripotent stem cells, more preferably human pluripotent stem cells. As mammals here, primates such as humans, monkeys, etc., rodents such as mice, rats, hamsters, guinea pigs, etc., and other dogs, cats, pigs, cattle, goats, horses, sheep, rabbits, etc. can be mentioned.

[0079] Embryonic stem cells can be prepared, for example, by culturing the internal cell mass present in the blastocyst stage embryo before implantation on feeder cells or in a culture medium containing LIF. For example, the specific preparation method of embryonic stem cells is described in WO96 / 22362, WO 02 / 101057, US 5,843,780, US 6,200,806 and US 6,280,718, etc. Human embryonic stem cells can also be prepared without destroying human embryos, for example, by the method described in WO2003 / 046141 and Chung et al. (Cell Stem Cell, February 2008, Vol. 2, pp. 113-117). Embryonic stem cells can be obtained from designated institutions, or commercially available products can be purchased. For example, human embryonic stem cells KhES-1, KhES-2 and KhES-3 can be obtained from Kyoto University's Institute for Frontier Medical Sciences. EB5 cells, which are mouse embryonic stem cells, are available from the Incorporated Administrative Agency RIKEN, and the D3 cell line, which is mouse embryonic stem cells, is available from ATCC.

[0080] Nuclear transplanted ES cells (ntES cells) are one of ES cells and can be established from cloned embryos generated by transplanting the nucleus of a somatic cell into an enucleated egg.

[0081] "Induced pluripotent stem cells" are cells induced to have pluripotency by reprogramming somatic cells by known methods, etc. Specifically, it can be mentioned that somatic cells (such as fibroblasts, skin cells, peripheral blood mononuclear cells, etc.) are reprogrammed and induced to have pluripotency by introducing any combination of multiple reprogramming factors selected from genes such as Oct3 / 4, Sox2, Klf4, Myc (c-Myc, N-Myc, L-Myc), Glis1, Nanog, Sall4, Lin28 and Esrrb. Examples of preferred combinations of reprogramming factors may include (1) Oct3 / 4, Sox2, Klf4 and Myc (c-Myc or L-Myc) and (2) Oct3 / 4, Sox2, Klf4, Lin28 and L-Myc (Stem Cells, 2013; 31: 458-466).

[0082] Induced pluripotent stem cells were first established by Yamanaka et al. in mouse cells in 2006 (Cell, 2006, 126(4), pp.663-676), and were also established in human fibroblasts in 2007 (Cell, 2007, 131(5) pp.861-872; Science, 2007, 318(5858) pp.1917-1920; Nat. Biotechnol., 2008, 26(1) pp.101-106). Since then, various improvements have been made in the induction method of induced pluripotent stem cells, and for example, a specific method for preparing mouse induced pluripotent stem cells is described in Cell. 2006 Aug 25; 126(4): 663-76, and a specific method for preparing human induced pluripotent stem cells is described in Cell. 2007 Nov 30; 131(5): 861-72, etc.

[0083] In addition to the production method based on direct reprogramming by gene expression, induced pluripotent stem cells can also be obtained from somatic cells by adding compounds or the like (Science, 2013, 341, pp. 651-654).

[0084] Established induced pluripotent stem cells can also be obtained, for example, human induced pluripotent cell lines established by Kyoto University such as 201B7 cells, 201B7-Ff cells, 253G1 cells, 253G4 cells, 1201C1 cells, 1205D1 cells, 1210B2 cells, or 1231A3 cells, etc. can be obtained from Kyoto University and iPS Academia Japan, Inc. As established induced pluripotent stem cells, for example, Ff-I01 cells and Ff-I14 cells established by Kyoto University and QHJI01 cells can be obtained from Kyoto University.

[0085] Although there is no particular limitation on the somatic cells used to obtain induced pluripotent stem cells, specifically mentioned are fibroblasts, blood lineage cells (e.g., peripheral blood mononuclear cells or T cells, cord blood-derived cells), etc. As fibroblasts, those derived from dermis, etc. can be mentioned.

[0086] When reprogramming is performed by expression of several types of reprogramming factors to prepare induced pluripotent stem cells, there is no particular limitation on the means for gene expression. Gene transfer methods known to those of ordinary skill in the art or direct injection methods of proteins can be used. Specific examples of the aforementioned gene transfer methods include infection methods using viral vectors (e.g., retroviral vectors, lentiviral vectors, Sendai virus (Sendaivirus) vectors, adenoviral vectors, adeno-associated viral vectors), calcium phosphate methods, lipid transfection methods, RetroNectin methods, electroporation methods, each of which uses a plasmid vector (e.g., a plasmid vector, a free-type vector) or an RNA vector, etc.

[0087] Induced pluripotent stem cells can be prepared in the presence of feeder cells or in the absence of feeder cells (no feeder cells). When induced pluripotent stem cells are prepared in the presence of feeder cells, induced pluripotent stem cells can be prepared by known methods in the presence of factors for maintaining an undifferentiated state. Although there is no particular limitation on the culture medium for preparing induced pluripotent stem cells in the absence of feeder cells, known maintenance culture mediums for embryonic stem cells and / or induced pluripotent stem cells, and culture mediums for establishing induced pluripotent stem cells under feeder-free conditions can be used. Examples of culture mediums for establishing induced pluripotent stem cells under feeder-free conditions can include feeder-free culture mediums, such as Essential 8 culture medium (E8 culture medium), Essential 6 culture medium, TeSR culture medium, mTeSR culture medium, mTeSR-E8 culture medium, stable Essential 8 culture medium and StemFit (registered trademark) etc. When preparing induced pluripotent stem cells, for example, it can be prepared by transferring Oct3 / 4, Sox2, Klf4 and Myc 4 factor genes into somatic cells using Sendai virus vectors in the absence of feeder cells.

[0088] The pluripotent stem cells used in the present invention are preferably rodent or primate induced pluripotent stem cells, more preferably human induced pluripotent stem cells.

[0089] Although a person skilled in the art can maintain or expand the culture of pluripotent stem cells by known methods, from the perspective of safety of transplant cell preparation, pluripotent stem cells are preferably maintained or expanded under serum-free conditions and in the absence of feeder cells.

[0090] Genetically modified pluripotent stem cells can be prepared by using, for example, homologous recombination technology. Examples of genes to be modified on chromosomes include cell marker genes, histocompatibility antigen genes, genes associated with diseases due to pigment epithelial cell disorders, etc. The target gene on the chromosome can be modified using the methods described in the following: Manipulating the Mouse Embryo, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1994); Gene Targeting, A Practical Approach, IRL Press at Oxford University Press (1993); Biomanual Series 8, Gene Targeting, Making of Mutant Mouse using ES cell, YODOSHA CO., LTD. (1995); Nature, 478: 391-394 (2011); PNAS, 111: 1461-17466 (2014); Nat Methods, 8: 753-755 (2011) and the like.

[0091] Specifically, for example, genomic DNA containing a target gene to be modified (e.g., a cell marker gene, a tissue compatibility antigen gene, a disease-related gene, etc.) is isolated, and a targeting vector for homologous recombination of the target gene is prepared using the isolated genomic DNA. The prepared targeting vector is introduced into stem cells, and cells showing homologous recombination between the target gene and the targeting vector are selected, thereby preparing stem cells with modified genes on chromosomes.

[0092] Examples of methods for isolating genomic DNA containing a target gene include known methods described in the following: Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1989), Current Protocols in Molecular Biology, John Wiley & Sons (1987-1997), etc. The genomic DNA containing the target gene can also be separated using a genomic DNA library screening system (manufactured by Genome Systems), Universal Genome Walker Kits (manufactured by CLONTECH), etc. A polynucleotide encoding a target protein can also be used instead of genomic DNA. The polynucleotide can be obtained by amplifying the corresponding polynucleotide by a PCR method.

[0093] Preparation of targeting vectors for homologous recombination of target genes and efficient selection of homologous recombinants can be carried out according to the methods described in the following: Gene Targeting, A Practical Approach, IRL Press at Oxford University Press (1993); Biomanual Series 8, Gene Targeting, Making of Mutant Mouse using ES cell, YODOSHA CO., LTD. (1995) and the like. As targeting vectors, either replacement type or insertion type can be used. As selection methods, methods such as positive selection, promoter selection, negative selection and polyA selection can be used.

[0094] Examples of the method for selecting desired homologous recombinants from the selected cell line include Southern hybridization method for genomic DNA, PCR method and the like.

[0095] The "eye region transcription factor" in this specification is a gene expressed in the eye region in the early developmental stage, and ET (Tbx3), Rx1 (Rax), Pax6, Six3, Lhx2, Tlx (Nr2e1), and Optx2 (Six6) have been identified. These eye region transcription factors can be used as markers for the early eye formation stage.

[0096] "Retinal pigment epithelial cells" in this specification refers to epithelial cells present on the outside of neural retinal tissue in the retina in vivo. Whether a cell is a retinal pigment epithelial cell can be easily confirmed by a person of ordinary skill in the art based on, for example, the expression of cell markers (RPE65, Mitf, CRALBP, MERTK and BEST1, etc.), the presence of melanin granules (brown black), tight binding between cells, typical polygonal, cobblestone-like cell morphology, etc. Whether a cell has the function of a retinal pigment epithelial cell can be easily confirmed by the secretion capacity of cytokines (such as VEGF and PEDF, etc.), etc.

[0097] The term "suspension culture" as used herein refers to culture under conditions for maintaining cells or cell aggregates suspended in a culture medium, that is, culture is performed under conditions where strong cell-matrix connections are not formed between cells or cell aggregates and a culture container or the like.

[0098] "Adhesion culture" refers to culture under conditions that allow cells or cell aggregates to adhere to culture container materials, etc. In this case, cell adhesion means that strong cell-matrix bonds are formed between cells or cell aggregates and culture container materials. That is, adhesion culture refers to culture under conditions that form strong cell-matrix connections between cells or cell aggregates and culture container materials, etc.

[0099] In the cell aggregates in suspension culture, planar cell-cell adhesion (planar adhesion) is formed. In the cell aggregates of suspension culture, cell-matrix combination is hardly formed with culture vessels, etc., even if it is formed, its contribution is also very small. In some embodiments, in the cell aggregates of suspension culture, endogenous cell-matrix connection is present inside the aggregate, but cell-matrix combination is hardly formed with culture vessels, etc., even if it is formed, its contribution is also very small. Planar cell-cell adhesion means that cells are attached to another cell through a plane. More specifically, planar cell-cell adhesion means that, for example, not less than 1%, preferably not less than 3%, more preferably not less than 5% of the surface area of ​​the cell adheres to the surface of another cell. The surface of the cell can be observed by staining with a membrane-staining reagent (e.g., DiI), immunostaining of cell adhesion molecules (e.g., E-cadherin and N-cadherin).

[0100] There is no particular limitation on the culture container for adhesion culture, as long as "adhesion culture" can be carried out, and those of ordinary skill in the art can appropriately select suitable culture containers according to the culture scale, culture conditions and culture period of the culture. Examples of such culture containers include tissue culture bottles, culture dishes, tissue culture dishes, multi-layer dishes (multidish), microplates, microwell plates, multi-layer plates (multiplate), multi-well plates, cell culture slides (chamberslide), plates (schale), test tubes, trays, culture bags, microcarriers, beads, rotating bottles and roller bottles. In order to achieve adhesion culture, these culture containers are preferably cell-adhesive. The culture container for cell adhesion includes a culture container whose surface has been artificially treated to improve cell adhesion, and specifically, a culture container whose interior is coated with a coating agent can be mentioned. Examples of coating agents include extracellular matrices such as laminin [including laminin α5β1γ1 (hereinafter referred to as laminin 511), laminin α1β1γ1 (hereinafter referred to as laminin 111), etc. and laminin fragments (laminin 511E8, etc.)], entactin, collagen, gelatin, vitronectin, Synthemax (Corning Incorporated), matrigel, etc., or polymers such as polylysine, polyornithine, etc., etc. It is also possible to use a culture container whose surface is treated by positive charge treatment, etc. More preferably, a culture container coated with laminin 511E8 is used because stable and efficient induction of retinal pigment epithelial cells can be performed (WO 2015 / 053375). As laminin 511E8, commercially available products (e.g., iMatrix-511, Nippi) can be used.

[0101] There is no particular limitation on the culture container used when performing suspension culture, as long as it can be "suspended culture", and it can be appropriately selected by a person of ordinary skill in the art. Examples of such culture containers include flasks, tissue culture flasks, culture dishes, petri dishes, tissue culture dishes, multidishes, microplates, microporous plates, micropores, multiplates, multiporous plates, chamber slides, schale, test tubes, trays, culture bags, spinner flasks, roller bottles, etc. In order to be able to perform suspension culture, these culture containers are preferably non-cell-adhesive. Non-cell-adhesive culture containers include culture containers whose surfaces have not yet undergone artificial treatment for improving cell adhesion (e.g., coating treatment with extracellular matrix such as laminin, nestin, collagen, gelatin, etc., or coating treatment with polymers such as polylysine, polyornithine, etc., or surface treatment such as positive charge treatment, etc.). As the non-cell-adhesive culture container, a culture container whose surface has been artificially treated to reduce adhesion to cells (for example, superhydrophilic treatment using MPC polymer or the like, protein low adsorption treatment, etc.) can be used.

[0102] The culture medium used for culturing cells in this specification can be prepared from a culture medium that is usually used as a basal culture medium for culturing animal cells. Examples of commercially available basal culture media include culture media that can be used to culture animal cells, such as BME culture media, BGJb culture media, CMRL 1066 culture media, Glasgow MEM (GMEM) culture media, modified MEMZinc Option culture media, IMDM culture media, Medium 199 culture media, Eagle MEM culture media, αMEM culture media, DMEM culture media, F-12 culture media, DMEM / F-12 culture media, IMDM / F12 culture media, Ham culture media, RPMI 1640 culture media, Fischer culture media, etc. A single culture medium or a combination of two or more thereof can be used, but the culture medium is not limited thereto.

[0103] As used herein, aforementioned basal medium can contain one or more additives, and the additive is suitably selected from regulator (such as buffer (such as HEPES)), salt (such as inorganic salts such as sodium chloride, sodium bicarbonate etc.), antioxidant (such as, 2-mercaptoethanol) etc., nutritional supplement (such as amino acid (such as non-essential amino acid), fatty acid, sugar, vitamin, lipid or pyruvic acid etc.), antibiotic (such as penicillin, streptomycin), extracellular matrix (such as matrigel, laminin, laminin fragment, laminin 511-E8 fragment) and dyestuff (such as, phenol red) etc., but additive is not limited to these.In addition, cytokine or growth factor can be contained in the above-mentioned basal medium as additive to the degree that does not affect the induced differentiation from pluripotent stem cell to RPE cell.

[0104] When the above-mentioned additives are not contained in the basal medium, they may be appropriately added to the basal medium.

[0105] "Serum medium" in this specification means a medium containing unadjusted or unpurified serum. Although serum derived from any animal can be used, serum derived from mammals (such as cattle, humans, etc.) can be preferably used. When cell culture is intended for autologous transplantation, the patient's own serum can also be used.

[0106] There is no particular limitation on the concentration of serum as long as it can efficiently induce differentiation of retinal pigment epithelial cells. For example, it can be appropriately set within the range of about 0.5%-30% (v / v). The concentration can be constant or can be varied in each step.

[0107] "Serum-free medium" means a medium that does not contain unadjusted or unpurified serum. In the present invention, serum-free medium also includes a medium containing purified blood-derived components and animal tissue-derived components (e.g., growth factors), unless unadjusted or unpurified serum is contained therein.

[0108] "Serum-free conditions" means conditions that do not contain unadjusted or unpurified serum, particularly conditions using serum-free culture medium.

[0109] The serum-free medium may contain a serum substitute. Examples of serum substitutes include serum substitutes that appropriately contain albumin, transferrin, fatty acids, collagen precursors, trace elements, 2-mercaptoethanol or 3'thioglycerol or equivalents thereof, etc. Such serum substitutes can be prepared by the method described in WO 98 / 30679, for example. The serum substitute may be a commercially available product. Examples of such commercially available serum substitutes include Knockout TMSerum Replacement (Life Technologies, hereinafter sometimes referred to as KSR), Chemically Defined Lipid Concentrate (manufactured by Life Technologies), and Glutamax TM (manufactured by Life Technologies), B27 (manufactured by Life Technologies), and N2 (manufactured by Life Technologies).

[0110] In order to avoid complicated preparation, a serum-free medium to which a suitable amount (e.g., about 0.5% to about 30%, preferably about 5% to about 20%) of commercially available KSR (manufactured by Life Technologies) (e.g., Glasgow MEM medium to which KSR within the above concentration range is added) can be used as such a serum-free medium.

[0111] In order to avoid contamination with chemically undefined components, the medium to be used in the present invention is preferably a chemically defined medium (chemically defined medium; CDM) whose components are defined.

[0112] In the present invention, it is preferred to culture under xeno-free conditions. "Xeno-free" means a condition that eliminates components (proteins, etc.) derived from species different from the cells to be cultured.

[0113] In the present specification, "a medium containing substance X" and "in the presence of substance X" refer to a medium supplemented with exogenous substance X or a medium containing exogenous substance X, or in the presence of exogenous substance X, and in the presence of exogenous substance X, respectively. On the other hand, "a medium not containing substance X" and "in the absence of substance X" refer to a medium not supplemented with exogenous substance X or a medium not containing exogenous substance X, or in the absence of exogenous substance X, respectively. That is, when the cells present in the medium endogenously express, secrete or produce substance X, the endogenous substance X is distinguished from the exogenous substance X, and a medium not containing exogenous substance X is considered to fall outside the category of "a medium containing substance X" (even when it contains endogenous substance X) but falls within the category of "a medium not containing substance X".

[0114] For example, "a medium containing an FGF signaling pathway agonist" is a medium supplemented with an exogenous FGF signaling pathway agonist or a medium containing an exogenous FGF signaling pathway agonist.

[0115] In this specification, "feeder cells" refer to cells other than pluripotent stem cells that coexist when culturing stem cells. Examples of feeder cells used to culture pluripotent stem cells while maintaining an undifferentiated state include mouse fibroblasts (MEF), human fibroblasts, SNL cells, etc. As feeder cells, feeder cells that are preferably subjected to growth inhibition treatment. Examples of growth inhibition treatments include treatments with growth inhibitors (e.g., mitomycin C), gamma irradiation, etc. Feeder cells used to culture pluripotent stem cells while maintaining an undifferentiated state contribute to maintaining the undifferentiated state of pluripotent stem cells by secreting humoral factors (preferably factors for maintaining an undifferentiated state) or preparing a scaffold (extracellular matrix) for cell adhesion.

[0116] In this specification, in the absence of feeder cells (no feeder cells) means culturing in the absence of feeder cells. As the case where there are no feeder cells, for example, no feeder cells are added or substantially no feeder cells are included (for example, the ratio of the number of feeder cells to the total number of cells is not more than 3%).

[0117] In the present specification, "Rho signal transduction pathway" means upstream and downstream signal transduction pathways mediated by Rho (which is a low molecular weight G protein). Specifically, it is a signal transduction pathway mediated by factors constituting the Rho signal transduction pathway, such as GDP-GTP exchange factor (GEF; guanine nucleotide exchange factor, such as abr (ActiveBcr-related)), Rho (e.g., RhoA, RhoB, RhoC), ROCK (Rho-associated coiled-coil kinase / Rho-binding kinase) located downstream of Rho, myosin light chain located downstream of ROCK, etc. (sometimes referred to as Rho signal transduction pathway components).

[0118] In this specification, "apoptosis" is a controlled cell suicide mechanism, also known as programmed cell death. It differs from necrosis in that it is regulated by genes that determine cell death or survival. Apoptosis can be distinguished from necrosis by annexin V staining, etc.

[0119] In this specification, "caspase" is a group of caspases that constitute a signal transduction pathway that causes cells to undergo apoptosis. To date, at least 18 species have been identified in mammals, and at least 12 species (caspase-1 to -10, -12, -14) have been identified in humans. Among them, at least caspase-2, -3, -6, -7, -8, -9, -10, -12 are known to be involved in the progression of apoptosis.

[0120] There are multiple pathways for inducing apoptosis. For example, there are pathways via mitochondria, pathways via endoplasmic reticulum, pathways via death ligands (such as Fas ligand, etc.), and in all pathways, apoptosis is induced by activation of caspase. It is known that apoptosis is induced by activating caspase via the mitochondrial pathway after activating the Rho signal transduction pathway in human pluripotent stem cells through dispersed culture (Ohgushi et al., Cell Stem Cell 7, 225-39 (2010)).

[0121] In the present specification, various chemical substances such as ROCK inhibitor, FGF receptor inhibitor, MEK inhibitor, etc. each include free form, salt, etc. For example, Y-27632 includes free form of Y-27632 and its hydrochloride, Y-27632 dihydrochloride, etc.

[0122] 2. Preparation of retinal pigment epithelial cells

[0123] The preparation method of the present invention is a preparation method of retinal pigment epithelial cells, comprising the following steps (1)-(2):

[0124] (1) in a first step, culturing pluripotent stem cells in a medium containing at least one selected from the group consisting of an FGF receptor inhibitor and a MEK inhibitor for a period not exceeding 30 days, and

[0125] (2) In the second step, the cells obtained in the first step are cultured in a medium containing at least one selected from the group consisting of a Rho signaling pathway inhibitor and a cell apoptosis inhibitor to form retinal pigment epithelial cells.

[0126] (1) First step

[0127] As preferred pluripotent stem cells in the first step, embryonic stem cells (also referred to as ES cells) or pretreated pluripotent stem cells, such as induced pluripotent stem cells (also referred to as iPS cells), etc., can be mentioned, preferably human pretreated pluripotent stem cells. As pluripotent stem cells, preferably induced pluripotent stem cells can be mentioned, more preferably human induced pluripotent stem cells. The preparation method of induced pluripotent stem cells is not particularly limited, and can be prepared by the methods known to those of ordinary skill in the art as described above. It is also desirable to perform the step of preparing induced pluripotent stem cells (i.e., the step of reprogramming somatic cells to establish pluripotent stem cells) under feeder-free conditions.

[0128] The pluripotent stem cells are usually carried out in the first step after the maintenance culture or expansion culture. The maintenance culture or expansion culture of the pluripotent stem cells can be carried out by methods known to those of ordinary skill in the art, preferably in the absence of feeder cells. Although the maintenance and expansion culture of the pluripotent stem cells can be carried out by adhesion culture or suspension culture, it is preferably carried out by adhesion culture.

[0129] In the absence of feeder cells, the maintenance culture or expanded culture of pluripotent stem cells can be carried out in a culture medium containing factors for maintaining an undifferentiated state. The factors for maintaining an undifferentiated state are not particularly limited, as long as they are substances that have the effect of inhibiting the differentiation of pluripotent stem cells. They are usually factors derived from mammals for maintaining an undifferentiated state. Since the factors for maintaining an undifferentiated state may have cross-reactivity between mammalian species, as long as the undifferentiated state of the pluripotent stem cells to be cultured can be maintained, any mammalian factor for maintaining an undifferentiated state can also be used. It is preferred to use a factor for maintaining an undifferentiated state of a mammal of the same species as the cells to be cultured.

[0130] In the case of pretreated pluripotent stem cells, examples of factors widely used by those of ordinary skill in the art for maintaining an undifferentiated state include FGF signal transduction pathway agonists, TGFβ family signal transduction pathway agonists, etc. As FGF signal transduction pathway agonists, fibroblast growth factors (e.g., bFGF, FGF4, FGF8) can be specifically mentioned. As TGFβ family signal transduction pathway agonists, TGFβ signal transduction pathway agonists (e.g., TGFβ1, TGFβ2), Nodal / activin signal transduction pathway agonists (e.g., Nodal, activin A, activin B) can be mentioned. When culturing human pluripotent stem cells (human ES cells, human iPS cells), the factors used to maintain an undifferentiated state are preferably bFGF and TGFβ.

[0131] The concentration of the factor for maintaining the undifferentiated state in the culture medium to be used in the maintenance culture or expansion culture of pluripotent stem cells is a concentration capable of maintaining the undifferentiated state of the pluripotent stem cells to be cultured, and can be appropriately determined by a person of ordinary skill in the art. For example, specifically, when bFGF is used as a factor for maintaining the undifferentiated state, its concentration is generally about 4-500 ng / mL, preferably 10-200 ng / mL, and more preferably about 30-150 ng / mL.

[0132] As a medium containing factors for maintaining an undifferentiated state (hereinafter sometimes referred to as a feeder-free medium), a commercially available medium can also be used as a medium for stem cells as appropriate. For example, Essential 8 (manufactured by Life Technologies), hESF9 (Proc Natl Acad Sci USA. 2008 Sep 9; 105(36): 13409-14), S-medium (manufactured by DS Pharma Biomedical), StemPro (manufactured by Life Technologies), mTeSR1 (manufactured by STEMCELL Technologies), mTeSR2 (manufactured by STEMCELL Technologies), TeSR-E8 (manufactured by STEMCELL Technologies), (manufactured by Ajinomoto Co., Inc.) etc. are commercially available. Using these media, pluripotent stem cells can be maintained or expanded.

[0133] When the pluripotent stem cells undergoing maintenance culture or expanded culture are recovered, the dispersed pluripotent stem cells are prepared by a dispersion operation. The dispersion operation of the pluripotent stem cells may include mechanical dispersion treatment, cell dispersion solution treatment, and cell protectant addition treatment. These treatments may be combined. Preferably, the cell dispersion solution treatment and cell protectant addition treatment are carried out simultaneously, followed by mechanical dispersion treatment.

[0134] As the cytoprotectant to be used for the cytoprotectant addition treatment, heparin, serum, or serum substitute can be mentioned.

[0135] As the cell dispersion solution to be used for the cell dispersion treatment, there can be mentioned a solution containing any of enzymes such as trypsin, collagenase, hyaluronidase, elastase, pronase, DNase, papain, etc., and a chelating agent such as ethylenediaminetetraacetic acid, etc. Commercially available cell dispersion solutions such as TrypLE Select (manufactured by Life Technologies) and TrypLE Express (manufactured by Life Technologies) can also be used.

[0136] As a method of mechanical dispersion treatment, there may be mentioned a pipetting treatment or scraping by a spatula.

[0137] The dispersed pluripotent stem cells can be seeded in a new culture vessel and the first step can be performed.

[0138] In order to suppress cell death induced by dispersion (particularly cell death of human pluripotent stem cells), pluripotent stem cells can be seeded in a new culture container, and maintenance culture can be continuously performed in the presence of a ROCK inhibitor, and then the first step can be started. Although there is no particular limitation on the period of treatment with a ROCK inhibitor, as long as cell death induced by dispersion can be suppressed, it is generally about 12-24 hours.

[0139] A person skilled in the art can appropriately set the concentration of pluripotent stem cells at the beginning of the first step. For example, in an adherent culture, the concentration of pluripotent stem cells is 1.0×10 2 Cells / cm 2 Up to 1×10 6 Cells / cm 2 , preferably 2.0×10 2 Cells / cm 2 Up to 2×10 5 Cells / cm 2 , more preferably 5×10 2 Cells / cm 2 Up to 1×10 5 Cells / cm 2 or 1×10 3 Cells / cm 2 Up to 1×10 4 Cells / cm 2 .

[0140] In order to avoid contamination by chemically undefined components, the culture medium used in the first step is preferably a culture medium whose components are chemically defined.

[0141] The culture medium to be used in the first step may be a serum culture medium or a serum-free culture medium. In order to avoid being contaminated by chemically undefined components, it is preferably a serum-free culture medium.

[0142] The culture medium used in the first step optionally contains a ROCK (Rho-associated coiled-coil kinase / Rho-associated kinase) inhibitor to inhibit cell death (apoptosis). As ROCK inhibitors, Y-27632, fasudil or H-1152 and the like can be mentioned. Only one ROCK inhibitor can be used, or two or more thereof can be used in combination. The concentration of the ROCK inhibitor can be appropriately set by a person of ordinary skill in the art, for example, it can be set within a concentration range showing ROCK inhibitory activity corresponding to about 50 nM-200 μM of Y-27632.

[0143] The culturing in the first step may be performed in the presence of feeder cells. In order to avoid contamination with chemically undefined components, the culturing is preferably performed in the absence of feeder cells.

[0144] The culture medium used in the first step may or may not contain exogenous factors for maintaining the undifferentiated state, regardless of whether it is cultured in the absence of feeder cells or in the presence of feeder cells. In the first step of the present invention, it is more preferably carried out in a culture medium containing factors for maintaining the undifferentiated state in the absence of feeder cells. The factors for maintaining the undifferentiated state are not particularly limited as long as they are substances that have the effect of inhibiting the differentiation of pluripotent stem cells. Preferably, it contains an FGF signal transduction pathway agonist, more preferably bFGF.

[0145] The concentration of the factor for maintaining the undifferentiated state in the medium to be used in the first step may be within the concentration range of the factor for maintaining culture or expanding the culture for maintaining the undifferentiated state of pluripotent stem cells. For example, when bFGF is used as a factor for maintaining the undifferentiated state in the absence of feeder cells, its concentration is generally about 4-500 ng / mL, preferably 10-200 ng / mL, and more preferably about 30-150 ng / mL.

[0146] The culture medium to be used in the first step contains at least one selected from the group consisting of an FGF receptor inhibitor and a MEK inhibitor. The culture medium may contain additional components (e.g., any agonist or inhibitor of a signal transduction pathway) as long as the efficiency of preparing retinal pigment epithelial cells by the preparation method of the present invention is not reduced (e.g., the same level as or not greater than the efficiency level without the first step). For example, the culture medium may also contain a BMP receptor inhibitor, a Sonic Hedgehog signal transduction pathway agonist, or a PKC inhibitor alone, or a combination of any one of the following (1)-(4): (1) a BMP receptor inhibitor and a Sonic hedgehog signal transduction pathway agonist; (2) a BMP receptor inhibitor and a PKC inhibitor; (3) a Sonic hedgehog signal transduction pathway agonist and a PKC inhibitor; (4) a BMP receptor inhibitor, a Sonic hedgehog signal transduction pathway agonist, and a PKC inhibitor. Alternatively, the culture medium may not contain any of the BMP receptor inhibitor, the Sonic Hedgehog signal transduction pathway agonist, and the PKC inhibitor.

[0147] In the present invention, there is no particular limitation on the FGF receptor inhibitor, as long as it is a substance capable of inhibiting signal transduction mediated by FGF, and it can be any of proteins, nucleic acids and low molecular weight compounds. Here, FGF forms a family containing at least 22 species. As representative FGF receptors, FGFR1, FGFR2, FGFR3, FGFR4, etc. can be mentioned, and the FGF receptor inhibitor is a substance that inhibits one, multiple or all of these. Examples of the substance include, but are not limited to, substances that directly act on FGF or FGF receptors (e.g., antibodies, aptamers, etc.), substances that inhibit the expression of genes encoding FGF or FGF receptors (e.g., antisense oligonucleotides, siRNA, etc.), substances that inhibit the binding of FGF receptors and FGF (e.g., soluble FGF receptors, FGF antagonists, etc.), substances that inhibit the physiological activity caused by the signal transduction of FGF receptors [e.g., low molecular weight compounds, such as PD173074 (N-[2-[[4-(diethylamino)butyl]amino]-6-(3 , 5-dimethoxyphenyl)pyrido[2,3-d]pyrimidin-7-yl]-N'-(1,1-dimethylethyl)urea), SU5402 (2-[(1,2-dihydro-2-oxo-3H-indol-3-ylidene)methyl]-4-methyl-1H-pyrrole-3-propionic acid) or PD161570 (1-tert-butyl-3-[6-(2,6-dichlorophenyl)-2-[[4-(diethylamino)butyl]amino]pyrido[2,3-d]pyrimidin-7-yl]urea) and the like], which inhibit the tyrosine kinase activity of the FGF receptor by ATP competition. Only one of the substances may be used or two or more of the substances may be used in combination. PD173074 and SU5402 are known FGF receptor inhibitors, and commercially available products and the like may be obtained as appropriate. As the FGF receptor inhibitor, for example, PD173074 or SU5402 is preferred.

[0148] In the present invention, there is no particular limitation on the concentration of the FGF receptor inhibitor contained in the culture medium in the first step, as long as retinal pigment epithelial cells can be prepared by the method of the present invention, and it can be appropriately determined by a person of ordinary skill in the art according to the type of the FGF receptor inhibitor. For example, the concentration of the FGF receptor inhibitor corresponds to 1-1000nM, preferably 10-500nM, more preferably 25-400nM, and particularly preferably 30-300nM of PD173074 in the concentration range showing FGF receptor inhibitory activity. For example, the concentration range of SU5402 of 0.1-500μM, preferably 1-100μM, more preferably 5-20μM can be mentioned. The concentration can be constant throughout the first step, or can vary in each step, as long as retinal pigment epithelial cells can be prepared by the method of the present invention.

[0149] In the present invention, there is no particular limitation on the MEK inhibitor, as long as it is a substance that inhibits the expression or activity of MEK family kinases, and it may be any of proteins, nucleic acids, and low molecular weight compounds. As representative MEK family kinases, MEK1, MEK2, MEK3, etc. may be mentioned, and the MEK inhibitor is a substance that inhibits the expression or activity of one, multiple, or all of these MEK family kinases. Examples of the substance include, but are not limited to, substances that inhibit the expression of genes encoding various MEKs (e.g., antisense oligonucleotides, siRNA, etc.), substances that inhibit the enzymatic activity of various MEKs [low molecular weight compounds such as PD0325901 (N-[(2R)-2,3-dihydroxypropoxy]-3,4-difluoro-2-[(2-fluoro-4-iodophenyl)amino]-benzamide), PD184352 ((2-[(2-chloro-4-iodophenyl)amino]-N-cyclopropylmethoxy)-3,4-difluorobenzamide), PD98059 (2'-amino 3'-methoxyflavone), U0126 (1,4-diamino-2,3-dicyano-1,4-bis[2-aminophenylthio]butadiene), MEK162 (5-[(4-bromo-2-fluorophenyl)amino]-4-fluoro-N-(2-hydroxyethoxy)-1-methyl-1H-benzimidazole-6-carboxamide), SL327 (α-[amino[(4-aminophenyl)thio]methylene]-2-(trifluoromethyl)benzylacetonitrile), TAK-733 ((R)-3-(2,3-dihydroxypropyl)-6-fluoro-5-(2-fluoro-4-iodophenylamino)-8-methylpyrido[2,3-d]pyrimidine-4,7(3H,8H)-dione) or AZD-8330 (2-(2-fluoro-4-iodophenylamino)-N-(2-hydroxyethoxy)-1,5-dimethyl-6-oxo-1,6-dihydropyridine-3-carboxamide) etc. etc. Only one substance may be used or two or more substances may be used in combination. PD0325901, PD184352, PD98059, U0126, MEK162, SL327, TAK-733 and AZD-8330 are known MEK inhibitors, and commercially available products etc. can be obtained as appropriate. As the MEK inhibitor, for example, PD0325901, PD184352, U0126, TAK-733 or AZD-8330 is preferred.

[0150] In the present invention, the concentration of the MEK inhibitor contained in the culture medium in the first step is not particularly limited, as long as retinal pigment epithelial cells can be prepared by the method of the present invention, and it can be appropriately determined by a person of ordinary skill in the art according to the type of MEK inhibitor. For example, the concentration of the MEK inhibitor corresponds to 0.001-10 μM, preferably 0.005-5 μM, more preferably 0.1-4 μM, more preferably 0.25-4 μM, and particularly preferably 0.25-2 μM PD0325901 in the concentration range showing MEK inhibitory activity. For example, 0.01-20 μM, preferably 0.1-10 μM, more preferably 1.5-6 μM PD184352 concentration range can be mentioned. The concentration can be constant throughout the first step, or can be changed in each step, as long as retinal pigment epithelial cells can be prepared by the method of the present invention.

[0151] In the present invention, there is no particular limitation on the BMP receptor inhibitor, as long as it is a substance capable of inhibiting signal transduction mediated by BMP, and it may be any of a protein, a nucleic acid, and a low molecular weight compound. As representative BMPs, BMP2, BMP4, BMP7, GDF7, etc. may be mentioned. The BMP receptor (BMPR) herein exists as a heterodimer of a TYPE I receptor (ALK (activin receptor-like kinase) -1, ALK-2, ALK-3, ALK-6) and a TYPE II receptor (ActRII, BMPRII). Examples of BMP receptor inhibitors include, but are not limited to, substances that directly act on BMP or BMP receptor (e.g., antibodies, aptamers, etc.), substances that inhibit the expression of genes encoding BMP or BMP receptor (e.g., antisense oligonucleotides, siRNA, etc.), substances that inhibit the binding of BMP receptors and BMP (e.g., soluble BMP receptors, BMP antagonists, etc.), substances that inhibit physiological activity caused by signal transduction of BMP receptors [low molecular weight compounds such as LDN193189 (4-[6-(4-piperazin-1-ylphenyl)pyrazolo[1,5-a]pyrimidin-3-yl]quinoline) or Dorsomorphin (6-[4-[2-(1-piperidinyl)ethoxy]phenyl]-3-(4-pyridinyl)-pyrazolo[1,5-a]pyrimidine), etc., etc.], etc. Only one such substance may be used or two or more such substances may be used in combination. LDN193189 and Dorsomorphin are known BMP type I receptor inhibitors, and commercially available products and the like can be obtained as appropriate. As the BMP receptor inhibitor, preferred is, for example, LDN193189.

[0152] There is no particular limitation on the Sonic hedgehog (hereinafter sometimes referred to as Shh) signal transduction pathway agonist in the present invention as long as it is a substance capable of enhancing signal transduction mediated by Shh, and it may be any of a protein, a nucleic acid, and a low molecular weight compound. Examples of the Shh signal transduction pathway agonist include, but are not limited to, proteins belonging to the Hedgehog family (e.g., Shh and Ihh), Shh receptors, Shh receptor agonists [low molecular weight compounds such as Purmorphamine (9-cyclohexyl-N-[4-(4-morpholinyl)phenyl]-2-(1-naphthyloxy)-9H-purin-6-amine) or SAG (Smoothened Agonist; N-methyl-N'-(3-pyridylbenzyl)-N'-(3-chlorobenzo[b]thiophene-2-carbonyl)-1,4-diaminocyclohexane), etc.], etc. Only one such substance may be used or two or more such substances may be used in combination. Purmorphamine and SAG are known Shh signal transduction pathway agonists, and commercially available products and the like can be obtained as appropriate. As the Shh signal transduction pathway agonist, preferred is, for example, SAG.

[0153] In the present invention, there is no particular limitation on the PKC inhibitor, as long as it is a substance capable of inhibiting the expression or activity of protein kinase C (PKC), and it can be any one of a protein, a nucleic acid and a low molecular weight compound. PKC herein is a protein family consisting of at least 10 isozymes, and a PKC inhibitor is a substance that inhibits the expression or activity of one, multiple or all of these PKC families. Examples of the substance include, but are not limited to, substances that inhibit the expression of genes encoding PKC (e.g., antisense oligonucleotides, siRNA, etc.), substances that inhibit the enzymatic activity of PKC [e.g., low molecular weight compounds such as Go6983 (3-[1-[3-(dimethylamino)propyl]-5-methoxy-1H-indol-3-yl]-4-(1H-indol-3-yl)-1H-pyrrole-2,5-dione), etc., etc.]. Only one of the substances can be used or two or more of the substances can be used in combination. Go6983 is a known PKC inhibitor, and commercially available products can be obtained as appropriate. As the PKC inhibitor, preferred is, for example, Go6983.

[0154] In the present invention, the concentrations of the BMP receptor inhibitor, the Sonic hedgehog signal transduction pathway agonist and the PKC inhibitor contained in the culture medium in the first step can be appropriately determined by a person of ordinary skill in the art to fall within the range within which retinal pigment epithelial cells can be obtained by the method of the present invention. For example, the concentration of the BMP receptor inhibitor is within the concentration range showing BMP receptor inhibitory activity, corresponding to 1-1000 nM, preferably 10-500 nM, more preferably 30-300 nM LDN193189. The concentration of the Shh signal transduction pathway agonist is within the concentration range showing Shh signal transduction effect, corresponding to 1-2000 nM, preferably 3-1000 nM, more preferably 10-500 nM SAG. The concentration of the PKC inhibitor is within the concentration range showing PKC inhibitory activity, corresponding to 0.05-20 μM, preferably 0.2-10 μM, more preferably 0.5-5 μM Go6983.

[0155] The concentration may be constant throughout the first step, or may be varied in each step, as long as retinal pigment epithelial cells can be prepared by the method of the present invention.

[0156] In the first step, pluripotent stem cells may be cultured under any conditions of suspension culture and adherence culture (preferably adherence culture).

[0157] There is no particular limitation on the culture container to be used for adhesion culture of pluripotent stem cells, as long as it can carry out cell adhesion culture. It is preferably a cell adhesion culture container. As a cell adhesion culture container, a culture container that is artificially treated to improve cell adhesion can be used, and specifically, the aforementioned culture container coated with a coating agent inside it can be mentioned. Examples of preferred coating agents include extracellular matrix, such as laminin [including laminin α5β1γ1 (laminin 511), laminin α1β1γ1 (laminin 111), etc. and laminin fragments (laminin 511E8, etc.)], nestin, collagen, gelatin, vitronectin, Synthemax (Corning Incorporated), matrigel, etc., or polymers such as polylysine, polyornithine, etc., and laminin 511E8 is more preferred (WO 2015 / 053375). Laminin 511E8 may be a commercially available product (eg, iMatrix-511, Nippi).

[0158] There is no particular limitation on the culture container to be used for suspension culture of pluripotent stem cells, as long as it is capable of suspension culture of cells. It is preferably non-cell-adhesive.

[0159] The culture conditions in the first step (such as culture temperature and CO2 concentration) can be appropriately determined. Although there is no particular limitation on the culture temperature, it is, for example, about 30° C. to 40° C., preferably about 37° C. The CO2 concentration is, for example, about 1% to about 10%, preferably about 5%.

[0160] The culture medium can be replaced in the middle of the first step. There is no particular restriction on the method of culture medium replacement, and the initial culture medium of the entire amount can be replaced with a fresh culture medium, or only a portion of the initial culture medium can be replaced with a fresh culture medium. When a portion of the initial culture medium is replaced with a fresh culture medium, the final concentration of the substance (MEK inhibitor, FGF receptor inhibitor, etc.) contained in the culture medium of the first step is first calculated, and then a fresh culture medium containing the substance at a concentration corresponding to the ratio of the culture medium to be replaced is prepared and replaced with the culture medium. The final concentration of the substance contained in the culture medium of the first step can change during the culture period.

[0161] While the tool used for the medium replacement operation is not particularly limited, there can be mentioned, for example, a pipette, a micropipette, a multichannel micropipette, a continuous dispenser, etc. For example, when a 96-well plate is used as a culture container, a multichannel Pipetman can be used.

[0162] The number of days of the first step is not particularly limited, as long as it is within the period during which the cells prepared by exposing the pluripotent stem cells to the above-mentioned FGF receptor inhibitors and / or MEK inhibitors, etc. maintain the differentiation potential to retinal pigment epithelial cells. The pluripotent stem cell culture in the first step is no more than 30 days. This period can be changed according to the line of the pluripotent stem cells to be used, etc. It is usually not less than 2 days, preferably not less than 3 days, and more preferably not less than 4 days. In the first step, the pluripotent stem cells are more preferably cultured for 2-13 days or 2-6 days, and further preferably 4-6 days.

[0163] The number of days in the first step can also be determined using a specific marker expressed in pluripotent stem cells treated with at least one selected from the group consisting of the above-mentioned FGF receptor inhibitor and MEK inhibitor as an index. Specifically, for example, the first step of culturing is performed during a period sufficient to induce the expression of an early eye formation marker (such as PAX6 (paired box protein 6), LHX2 (LIM homeobox 2) and SIX3 (SIX homeobox 3), and specifically, at least one gene of an eye region transcription factor), and then the second step can be performed. That is, examples of the "period not exceeding 30 days" in the first step include "a period sufficient to induce the expression of at least one early eye formation marker (specifically, an eye region transcription factor) and not more than 30 days" and "a period sufficient to induce the gene expression of at least one of PAX6, LHX2 and SIX3 and not more than 30 days". In these embodiments, the upper limit of the culture period is, for example, a period not exceeding 30 days, a period not exceeding 13 days, or a period not exceeding 6 days, etc.

[0164] Whether a given culture period under given culture conditions is "a period sufficient to induce the expression of at least one eye formation early marker (specifically, an eye region transcription factor)" or "a period sufficient to induce the gene expression of at least one of PAX6, LHX2 and SIX3" can be determined by confirming whether the expression of at least one of these genes can be significantly detected in the cell population after culture under the conditions for the period, compared with an untreated control. A person of ordinary skill in the art can detect the expression of these genes by methods such as Northern blot, RT-PCR, microarray, etc.

[0165] PAX6, LHX2, and SIX3 are genes encoding eye region transcription factors expressed in the eye region in the early developmental stage, and are designated as Genbank Accession No.: NM_001127612, Genbank Accession No.: NM_004789, Genbank Accession No.: NM_005413 as human genes, respectively. These genes in other animal species such as mice and the like can be easily designated by a person of ordinary skill in the art, and can be designated by the base sequences of the genes described in, for example, http: / / www.ncbi.nlm.nih.gov.

[0166] That is, in one embodiment of the present invention, there is provided a method for preparing retinal pigment epithelial cells comprising the following steps:

[0167] (1) a first step of culturing pluripotent stem cells in a medium containing at least one selected from the group consisting of an FGF receptor inhibitor and a MEK inhibitor for a period of time sufficient to induce gene expression of at least one eye region transcription factor, and

[0168] (2) In the second step, the cells obtained in the first step are cultured in a medium containing at least one selected from the group consisting of a Rho signaling pathway inhibitor and a cell apoptosis inhibitor to form retinal pigment epithelial cells.

[0169] That is, in another embodiment of the present invention, there is provided a method for preparing retinal pigment epithelial cells comprising the following steps:

[0170] (1) a first step of culturing pluripotent stem cells in a medium containing at least one selected from the group consisting of an FGF receptor inhibitor and a MEK inhibitor for a period sufficient to induce gene expression of at least one of PAX6, LHX2 and SIX3, and

[0171] (2) In the second step, the cells obtained in the first step are cultured in a medium containing at least one selected from the group consisting of a Rho signaling pathway inhibitor and a cell apoptosis inhibitor to form retinal pigment epithelial cells.

[0172] When the first step is performed by adherence culture, the cells can also be recovered by detaching the cells from the culture vessel.

[0173] There is no particular limitation on the method for dissociating cells from the culture container, as long as it is generally known as a method for dissociating cells. A cell dissociation solution containing an enzyme (such as trypsin, etc.) can be used. In addition, a commercially available cell dissociation solution [TrypLE select (Life Technologies), etc.] can also be used. The dissociated and recovered cells are usually washed with PBS (phosphate buffered saline) and / or the culture medium used in the second step, and then used in the second step.

[0174] The cell obtained in the first step can be passaged (maintaining culture), stored as the intermediate product of preparing retinal pigment epithelial cells, or other processes are carried out, as long as their differentiation state and survival state are maintained. The method for the cell obtained in the first step for cold storage is not particularly limited, as long as it is usually known as the method for cold storage of cells. For example, the cell obtained in the first step can be suspended in the culture medium containing cold storage agent (such as DMSO or glycerol etc.) and cold storage. In addition, commercially available cell cold storage solution [StemCellBanker (Zenoaq)] can also be used.

[0175] (2) Step 2

[0176] The second step of culturing the cells obtained in the first step in a medium containing at least one selected from the group consisting of a Rho signaling pathway inhibitor and an apoptosis inhibitor to form retinal pigment epithelial cells is explained below.

[0177] A person skilled in the art can appropriately set the cell concentration at the beginning of the second step. In the case of adherent culture, for example, 1×10 2 Cells / cm 2 Up to 2×10 7 Cells / cm 2 , preferably 1×10 3 Cells / cm 2 Up to 5×10 6 Cells / cm 2 , more preferably 1×10 4 Cells / cm 2 Up to 1×10 6 Cells / cm 2 , and more preferably 2×10 4 Cells / cm 2 Up to 2×10 5 Cells / cm 2 .

[0178] The culture medium used in the second step is not particularly limited, as long as it can induce pluripotent stem cells to differentiate into retinal pigment epithelial cells. Specifically, it can be prepared by the basal culture medium described in the above definition. The culture medium to be used in the second step can be a serum-containing culture medium or a serum-free culture medium. In order to avoid the contamination of chemically unclear components, it is preferred to use a serum-free culture medium in the present invention. In order to avoid complicated preparation, for example, a serum-free culture medium of a basal culture medium supplemented with an appropriate amount of commercially available serum substitutes (such as KSR, etc.) (for example, Glasgow MEM culture medium supplemented with KSR in a concentration range of 0.5% to 30%) can be used. As the culture medium used in the second step, a culture medium that does not contain factors for maintaining an undifferentiated state can be used.

[0179] In the method of the present invention, the Rho signal transduction pathway inhibitor is not particularly limited as long as it can inhibit the expression or activity of any Rho signal transduction pathway component (e.g., GEF (e.g., Abr), Rho, ROCK, and myosin light chain), and may be any one of a protein, a nucleic acid, and a low molecular weight compound. Examples include antibodies against Rho signal transduction pathway components, substances that inhibit the expression of genes encoding Rho signal transduction pathway components (e.g., antisense oligonucleotides, siRNA, etc.), low molecular weight compounds that inhibit the physiological activity of Rho signal transduction pathway components, and the like. As the Rho signal transduction pathway inhibitor, for example, a ROCK inhibitor or a myosin inhibitor may be mentioned.

[0180] Specific examples of ROCK inhibitors include, but are not limited to, Y-27632 (trans-4-[(1R)-1-aminoethyl]-N-4-pyridylcyclohexanecarboxamide), fasudil (1-(5-isoquinolinesulfonyl)homopiperazine), H-1152 ((S)-(+)-4-glycyl-2-methyl-1-[(4-methyl-5-isoquinolyl)sulfonyl]-hexahydro-1H-1,4-diazepine), etc. Y-27632, fasudil and H-1152 are known ROCK inhibitors and can be appropriately obtained as commercially available products, etc. As ROCK inhibitors, Y-27632 and fasudil are preferred, and Y-27632 is more preferred.

[0181] The concentration of the ROCK inhibitor can be appropriately set by a person of ordinary skill in the art according to the type of cells and the number of cells. For example, for Y-27632, it is 50nM-200μM, preferably 100nM-200μM, more preferably 500nM-200μM, and further preferably 1-200μM; for fasudil, it is 100nM-200μM, more preferably 500nM-200μM, and further preferably 1-200μM. In the case of other ROCK inhibitors, it can be set within a concentration range showing ROCK inhibitory activity corresponding to the above. Throughout the second step, the concentration can be constant or gradually changed, as long as retinal pigment epithelial cells can be prepared by the method of the present invention.

[0182] As substances that inhibit the activity of myosin light chain (myosin inhibitors), specifically mentioned are Blebbistatin ((3aS)-3a-hydroxy-6-methyl-1-phenyl-1,2,3,3a-tetrahydro-4H-pyrrolo[2,3-b]quinolin-4-one) and the like.

[0183] In the method of the present invention, there is no particular limitation on the apoptosis inhibitor, as long as it can inhibit apoptosis, and it can be any one of a protein, a nucleic acid, and a low molecular weight compound. Examples of apoptosis inhibitors include, but are not limited to, caspase inhibitors, substances that inhibit mitochondrial function associated with apoptosis, and the like.

[0184] Examples of mitochondrial functions associated with apoptosis include, but are not limited to, electrochemical gradient collapse of the mitochondrial membrane, subsequent release of cytochrome C from mitochondria, and the like.

[0185] Examples of caspase inhibitors include antibodies against caspases, substances that inhibit the expression of genes encoding caspases (e.g., antisense oligonucleotides, siRNA, etc.), low molecular weight compounds that inhibit the physiological activity of caspases, etc. Specifically, pan-caspase inhibitors Z-VAD-FMK (aka: Z-VAD(OMe)-FMK, Z-Val-Ala-DL-Asp(OMe)-fluoromethylketone, benzyloxycarbonyl-Val-Ala-DL-Asp(OMe)-fluoromethylketone), Emricasan (3-[2-(2-tert-butyl-phenylaminooxalyl)-amino]-propionylamino]-4-oxo-5-(2,3,5,6-tetrafluoro-phenoxy)-pentanoic acid), Z-DEVD-FMK (aka: Z- Asp(OMe)-Glu(OMe)-Val-Asp(OMe)-FMK), caspase 3 specific inhibitor PAC-1 (4-(phenylmethyl)-[[2-hydroxy-3-(2-propenyl)phenyl]methylene]hydrazide, 1-piperazineacetic acid), caspase 8 specific inhibitor Z-IETD-FMK (aka: Z-Ile-Glu(OMe)-Thr-Asp(OMe)-FMK), caspase 9 specific inhibitor Z-LEHD-FMK (aka: Z-Leu-Glu(OMe)-His-Asp(OMe)-FMK). As caspase inhibitors, inhibitors of caspase-2, -3, -6, -7, -8, -9, and -12 involved in apoptosis are preferred, pan-caspase inhibitors are more preferred, and Z-VAD-FMK is further preferred.

[0186] Those skilled in the art can appropriately set the concentration of the caspase inhibitor according to the type of cells and the number of cells. For example, for Z-VAD-FMK, the concentration is 100 nM-200 μM, preferably 500 nM-100 μM, more preferably 1-50 μM. In the case of other caspase inhibitors, it can be set from the concentration range showing the caspase inhibitory activity corresponding to the above.

[0187] Specific examples of substances that inhibit mitochondrial function associated with apoptosis include, but are not limited to, Bcl-2 protein and Bcl-XL protein that inhibit the release of cytochrome c from mitochondria, S-15176 (N-[(3,5-di-tert-butyl-4-hydroxy-1-phenylthio)]-3-propyl-N'-(2,3,4-trimethoxybenzyl)piperazine) that prevents the collapse of the electrochemical gradient of the mitochondrial membrane, and UCF-101 (dihydro-5-[[5-(2-nitrophenyl)-2-furanyl]methylene]-1,3-diphenyl-2-thioxo-4,6(1H,5H)-pyrimidinedione) that is a selective inhibitor of the mitochondrial serine protease Omi / HtrA2.

[0188] Those of ordinary skill in the art can appropriately set the kind of suitable apoptosis inhibitor and the concentration of apoptosis inhibitor according to the kind of cell, the number of cells, operating methods, etc. For example, those of ordinary skill in the art can detect apoptosis by known methods (Annexin V staining, DNA gradient detection method, etc.). Utilize these apoptosis detection methods, the kind of suitable apoptosis inhibitor and the concentration of apoptosis inhibitor can be determined. In the whole second step, the concentration can be constant or gradually changed, as long as retinal pigment epithelial cells can be prepared by the method of the present invention.

[0189] Rho signaling pathway inhibitors also include those that can enhance the activity of factors that negatively regulate the Rho signaling pathway or Rho signaling pathway components (e.g., GTPase activator of Rho (GAP; GTPase activating protein), Rac (a low molecular weight G protein), myosin light chain phosphatase, etc.), and may be any of proteins, nucleic acids, and low molecular weight compounds.

[0190] In one embodiment of the present invention, the culture medium in the second step is a culture medium that does not contain exogenous Nodal signaling pathway inhibitor or Wnt signaling pathway inhibitor.

[0191] In the present specification, there is no particular limitation on the Nodal signal transduction pathway inhibitor, as long as it can inhibit the signal transduction mediated by Nodal, and can be any one of a protein, a nucleic acid and a low molecular weight compound. The signal mediated by Nodal is transduced by the Nodal receptor. The Nodal receptor exists as a heterodimer of TYPE I receptors (ALK (activin receptor-like kinase) -4, ALK-5, ALK-7) and TYPE II receptors (ActRII). Examples of Nodal signal transduction pathway inhibitors include, but are not limited to, substances that directly act on Nodal or Nodal receptors (anti-Nodal antibodies, anti-Nodal receptor antibodies, etc.), substances that inhibit the expression of genes encoding Nodal or Nodal receptors (e.g., antisense oligonucleotides, siRNA, etc.), substances that inhibit the binding of Nodal receptors to Nodal (Lefty-A, Lefty-B, Lefty-1, Lefty-2, soluble Nodal receptors, etc.), substances that inhibit the physiological activity caused by signal transduction by Nodal receptors [low molecular weight compounds, such as TGFβ inhibitors, etc., such as SB-431542 (SB431542) (4-[4-(1,3-benzodioxol-5-yl)-5-(pyridin-2-yl)-1H-imidazol-2-yl]benzamide) that inhibits the kinase activity of TYPE I receptors by ATP competition, etc.] and the like. As a typical Nodal signal inhibitor, for example, SB-431542 can be mentioned.

[0192] In the present specification, the Wnt signal transduction pathway inhibitor is not particularly limited, as long as it can inhibit Wnt-mediated signal transduction, and can be any of proteins, nucleic acids, low molecular weight compounds, etc. Wnt-mediated signals are transduced by Wnt receptors present as heterodimers of Frizzled (Fz) and LRP5 / 6 (low-density lipoprotein receptor-related protein 5 / 6). Examples of Wnt signal transduction pathway inhibitors include, but are not limited to, substances that directly act on Wnt or Wnt receptors (anti-Wnt antibodies, anti-Wnt receptor antibodies, etc.), substances that inhibit the expression of genes encoding Wnt or Wnt receptors (e.g., antisense oligonucleotides, siRNA, etc.), substances that inhibit the binding of Wnt receptors to Wnt (soluble Wnt receptors, dominant negative Wnt receptors, etc., Wnt antagonists, Dkk1, Cerberus proteins, etc.), substances that inhibit the physiological activity caused by signal transduction via Wnt receptors [low molecular weight compounds, such as casein kinase I inhibitors CKI-7 (N-(2-aminoethyl)-5-chloroisoquinoline-8-sulfonamide) and D4476 (4-[4-(2,3-dihydro-1,4-benzodioxan-6-yl)-5- [(2-pyridyl)-1H-imidazol-2-yl] benzamide), IWR-1-endo (IWR1e) (4-[(3aR,4S,7R,7aS)-1,3,3a,4,7,7a-hexahydro-1,3-dioxo-4,7-methano-2H-isoindol-2-yl]-N-8-quinolyl-benzamide) that stabilizes the β-catenin destruction complex by inhibiting the metabolic conversion of Axin, and IWP-2 (N-(6-methyl-2-benzothiazolyl)-2-[(3,4,6,7-tetrahydro-4-oxo-3-phenylthieno[3,2-d]pyrimidin-2-yl)thioacetamide) that inactivates Porcupine (Porcn) as a membrane-bound O-acyltransferase (MBOAT) and inhibits the palmitoylation of Wnt proteins, etc.] CKI-7, D4476, IWR-1-endo (IWR1e), IWP-2, etc. are known Wnt signal inhibitors. A typical Wnt signal inhibitor is CKI-7.

[0193] In one embodiment of the present invention, the culture medium in the second step does not contain an exogenous substance that affects the differentiation induction of pluripotent stem cells, in particular the differentiation induction of pluripotent stem cells to ectoderm [e.g., neural cells, retinal pigment epithelial cells or their progenitor cells, etc.], mesoderm or endoderm cells, preferably promotes differentiation induction, and the substance is not a Rho signal transduction pathway inhibitor and a cell apoptosis inhibitor. There is no particular limitation on the substance, as long as it affects the differentiation induction of pluripotent stem cells, preferably promotes differentiation induction. Examples of the substance include those contained in the following substance groups.

[0194] In one embodiment of the present invention, the culture medium in the second step does not contain one or more exogenous substances selected from the group of substances that affect differentiation induction of pluripotent stem cells, in particular, differentiation induction of pluripotent stem cells into ectoderm [e.g., neural cells, retinal pigment epithelial cells or their progenitor cells, etc.], mesoderm or endoderm cells, preferably exogenous substances that promote differentiation induction.

[0195] More specifically, examples of the substances included in the group of substances include, in addition to the above-mentioned Nodal signal transduction pathway inhibitors and Wnt signal transduction pathway inhibitors, FGF receptor inhibitors (PD173074, SU5402, etc.), MEK inhibitors (PD0325901, PD184352, PD98059, U0126, MEK162, SL327, TAK-733, AZD-8330, etc.), BMP receptor inhibitors (LDN193189, Dorsomorphin, etc.), Sonichedgehog signaling pathway agonists (Purmorphamine, SAG, shh, etc.), PKC inhibitors (Go6983, etc.), BMP signaling pathway agonists (BMP2, BMP4, BMP7, GDF7, etc.), activin signaling pathway agonists (activin A, activin B, etc.), activin signaling pathway inhibitors (follistatin, etc.), TGFβ signaling pathway agonists (TGFβ1, TGFβ2, TGFβ3, etc.), TGFβ signaling pathway inhibitors (Lefty, SB431542, LY-364947, SB-505124, A-83-01, etc.), Wnt signaling pathway agonists [ Wnt1, Wnt2, Wnt3a, Wnt8, R-spondin1, GSK3β inhibitors (CHIR99021, SB216763, etc.)], PPA receptor signaling pathway agonists (troglitazone, etc.), PPA receptor signaling pathway inhibitors (ciglitazone, etc.), sonic hedhog signaling pathway inhibitors (Vismodegib, Cyclopamine, LDE225, etc.), Notch signaling pathway inhibitors (DAPT, IMR-1, etc.), retinoic acid receptor agonists (retinoic acid, Isotretinoin, TTNPB, Am580, etc.), retinoic acid receptor inhibitors (BMS493 , AGS193109, etc.), chemokine receptor inhibitors (AMD3100Octahhydrochloride, SCH527123, etc.), LPA receptor inhibitors (Ki16425), PDK1 inhibitors (PS48, etc.), RasGAP inhibitors (SC-1, etc.), Src inhibitors (A419259, dasatinib, Saratanib, Bostinib, WH-4-023, etc.), phosphodiesterase inhibitors (EHNA hydrochloride, etc.), adenylate cyclase activators (Forskolin, etc.), PI3K inhibitors (LY294002, BKM120, Pictilisib, etc.), AMPK Activators (AICAR, A-769662, etc.), adenosine receptor inhibitors (Reversine, Istratefylline, etc.), histone acetyltransferase inhibitors (C646, MG149, etc.), histone deacetylase inhibitors (Trichostatin A, valproic acid, sodium butyrate, etc.), histone methyltransferase inhibitors (BIX01294, EPZ5676, GSK343, etc.), histone demethylase inhibitors (GSK-J4 hydrochloride, SP2509, etc.), DNA methylation inhibitors (azacitidine, 5-aza-2'-deoxycytidine, etc.) and DNA methyltransferase inhibitors (RG108, decitabine, etc.).

[0196] Furthermore, in one embodiment of the present invention, the culture medium in the second step does not contain substances that inhibit the induction of differentiation into ectoderm cells (eg, neural cells, retinal pigment epithelial cells or their precursors, etc.), more specifically, substances that inhibit the induction of differentiation into retinal pigment epithelial cells.

[0197] The second step of culturing may be carried out under any conditions of suspension culture and adhesion culture, but adhesion culture is preferred.

[0198] The culture container used in the adhesion culture in the second step is not particularly limited, as long as it can carry out cell adhesion culture, preferably a cell adhesion culture container. As a cell adhesion culture container, a culture container that is artificially treated to improve cell adhesion can be used, and specifically, the aforementioned culture container coated with a coating agent can be mentioned. Examples of preferred coating agents include extracellular matrix, such as laminin [including laminin α5β1γ1 (laminin 511), laminin α1β1γ1 (laminin 111), etc. and laminin fragments (laminin 511E8, etc.)], nestin, collagen, gelatin, vitronectin, Synthemax (Corning Incorporated), extracellular matrix such as matrigel, or polymers such as polylysine, polyornithine, etc. More preferably, laminin 511E8 (WO2015 / 053375) is used. As laminin 511E8, a commercially available product (eg, iMatrix-511, Nippi) can be used.

[0199] There is no particular limitation on the culture container used for suspension culture in the second step, as long as it can culture cells in suspension. It is preferably non-cell-adhesive.

[0200] The culture conditions in the second step (such as culture temperature, CO2 concentration, etc.) can be appropriately determined. The culture temperature is, for example, about 30° C. to about 40° C., preferably about 37° C. The CO2 concentration is, for example, about 1% to about 10%, preferably about 5%.

[0201] The culture medium can be replaced as appropriate in the middle of the second step. There is no particular restriction on the method for culture medium replacement, and the initial culture medium of the entire amount can be replaced with fresh culture medium, or only a portion of the initial culture medium can be replaced with fresh culture medium. When a portion of the initial culture medium is replaced with fresh culture medium, the final concentration of the substance (Rho signal transduction pathway inhibitor, apoptosis inhibitor, KSR, etc.) contained in the culture medium of the second step is first calculated, and then the fresh culture medium containing the substance at the concentration corresponding to the ratio of the culture medium to be replaced can be prepared and replaced with the culture medium. The final concentration of the substance contained in the culture medium of the second step can change during the culture period.

[0202] While the tool used for the medium replacement operation is not particularly limited, for example, there can be mentioned a pipette, a micropipette, a multichannel micropipette, a continuous dispenser, etc. For example, when a 96-well plate is used as a culture container, a multichannel pipette can be used.

[0203] The culture period of the second step is not particularly limited as long as it is a period that can induce the target retinal pigment epithelial cells. As an example of such a culture period, retinal pigment epithelial cells can usually be prepared on the 2nd to 40th day from the start of the second step.

[0204] A person of ordinary skill in the art can confirm the generation of retinal pigment epithelial cells based on the expression of cell markers (RPE65 (retinal pigment epithelial cells), Mitf (retinal pigment epithelial cells), BEST1 (retinal pigment epithelial cells), CRALBP (retinal pigment epithelial cells), etc.), the presence of melanin granules (brown-black), tight binding between cells, characteristic polygonal or cobblestone-like cell morphology, etc., and can also determine the culture period by confirming them.

[0205] After second step is completed, the RPE cell obtained can also be used.But, preferably, culture medium is replaced with the maintenance medium (hereinafter sometimes expressed as RPE maintenance medium) for retinal pigment epithelial cells and further cultivated.As a result, the cell colony of melanin dye deposition and the polygonal flat cell colony that adheres to basement membrane can be observed more clearly.To the cultivation in RPE maintenance medium, there is no restriction, as long as the colony of retinal pigment epithelial cells can be formed.For example, when the culture medium of whole amount is replaced with the frequency of no less than every 3 days 1 time, cell is further cultivated about 5-20 days.

[0206] That is to say, the preparation method of the present invention can comprise the step of further cultivating retinal pigment epithelial cells after completing in the second step.For example, retinal pigment epithelial cells can be cultivated and amplified by the method described in WO2015 / 053375.According to the culture method described in WO2015 / 053375, the insufficient cell of induced differentiation contained in the cultured cells etc. can be removed by selection, and the by-product beyond the retinal pigment epithelial cells can be relatively reduced.Therefore, the culture step can also be the amplification step and the purification step of retinal pigment epithelial cells.Therefore, as an embodiment of the preparation method of RPE cell of the present invention, following method can be mentioned:

[0207] (1) In a first step, culturing pluripotent stem cells in a medium containing at least one selected from the group consisting of an FGF receptor inhibitor and a MEK inhibitor for a period not exceeding 30 days,

[0208] (2) a second step of culturing the cells obtained in the first step in a medium containing at least one selected from the group consisting of a Rho signaling pathway inhibitor and a cell apoptosis inhibitor to form retinal pigment epithelial cells, and

[0209] (3) The third step is to culture the retinal pigment epithelial cells obtained in the second step.

[0210] In addition, as one embodiment of the method for preparing RPE cells of the present invention, the following method can be mentioned:

[0211] (1) a first step of culturing pluripotent stem cells in a medium containing at least one selected from the group consisting of an FGF receptor inhibitor and a MEK inhibitor for a period sufficient to induce gene expression of at least one of PAX6, LHX2 and SIX3,

[0212] (2) a second step of culturing the cells obtained in the first step in a medium containing at least one selected from the group consisting of a Rho signaling pathway inhibitor and a cell apoptosis inhibitor to form retinal pigment epithelial cells, and

[0213] (3) The third step is to culture the retinal pigment epithelial cells obtained in the second step.

[0214] As a maintenance medium for retinal pigment epithelial cells, for example, those described in IOVS, March 2004, Vol. 45, No. 3, Masatoshi Haruta et al., IOVS, November 2011, Vol. 52, No. 12, Okamoto and Takahashi, J. Cell Science 122 (17), Fumitaka Osakada et al., IOVS, February 2008, Vol. 49, No. 2, Gamm et al. can be used, which are composed of a basal medium, serum and / or serum replacement and other components.

[0215] There is no particular limitation on the basal medium as long as it is as described in the above definition section. As serum, serum derived from mammals such as cattle, humans, etc. can be used. In the present invention, it is preferred to use a serum substitute, and B27 as a serum substitute for neural cells is particularly preferred from the aspect of quality management of target cells. Examples of other components include L-glutamine, sodium penicillin, streptomycin sulfate, etc.

[0216] Highly pure retinal pigment epithelial cells can be obtained by concentration or purification operation after the second step is completed. There is no particular limitation on the concentration or purification method, as long as it is generally known as a method for concentrating / purifying cells, and for example, methods such as filtration (e.g., WO2015 / 053376), centrifugation, perfusion separation, flow cytometer separation, capture separation (trap separation) of a carrier immobilized with an antibody can be used.

[0217] When the retinal pigment epithelial cells are prepared by suspension culture in the second step, the retinal pigment epithelial cells can be recovered as single cells and can be used as a suspension after the preparation.

[0218] When preparing retinal pigment epithelial cells by adhesion culture in the second step, retinal pigment epithelial cells can adhere to each other to form a sheet structure. Therefore, the sheet of retinal pigment epithelial cells that can be transplanted to the patient can be prepared. The cell colony that the sheet of retinal pigment epithelial cells is used as a cell transplantation therapeutic drug for the treatment of retinal diseases is particularly useful. The retinal pigment epithelial cells prepared by adhesion culture by the above method can also be dissociated, the retinal pigment epithelial cells as independent unicellular are recovered, and they are suspended in physiological aqueous solvents (saline, buffer, serum-free medium etc.) to obtain a suspension.

[0219] 3. Toxicity and efficacy evaluation methods

[0220] The retinal pigment epithelial cells prepared by the preparation method of the present invention can be used as normal or disease model cells, for the treatment of retinal diseases and other complications such as diabetes epilepsy, or the screening and efficacy evaluation of its preventive drugs, safety tests, stress tests, toxicity tests, side effect tests, infection / pollution tests of chemical substances, etc. On the other hand, they can also be used for toxicity studies, toxicity tests, etc., of the phototoxicity, retinal excitotoxicity, etc., which are unique to retinal cells. Its evaluation method includes stimulation and toxicity tests such as apoptosis evaluation, and tests for evaluating the effects of normal differentiation from progenitor cells to retinal pigment epithelial cells and photoreceptors (RT-PCR of various gene markers, analysis of protein expression of cytokines by ELISA, phagocytic ability tests, etc.), toxicity tests of phototoxicity, etc., retinal potential and transepithelial impedance about visual function, cytotoxicity tests caused by autoimmune reactions, etc. As cell materials for these tests, not only retinal pigment epithelial cells can be used, but also progenitor cells thereof, and for example, a plate, a cell suspension, a sheet or a compact thereof on which cells adhere by inoculation can be provided. They can be used as extrapolation tests for human and animal tests.

[0221] 4. Pharmaceutical Composition

[0222] The present invention provides a pharmaceutical composition, which contains an effective amount of retinal pigment epithelial cells prepared by the preparation method of the present invention.

[0223] The pharmaceutical composition contains an effective amount of retinal pigment epithelial cells prepared by the preparation method of the invention and a pharmaceutically acceptable carrier.

[0224] As a pharmaceutically acceptable carrier, a physiological aqueous solvent (saline, buffer, serum-free medium, etc.) can be used. If necessary, in transplantation therapy, the drug containing the tissue or cell to be transplanted may contain a conventionally used preservative, stabilizer, reducing agent, isotonic agent, etc.

[0225] The pharmaceutical composition of the present invention can be prepared as a suspension by suspending the retinal pigment epithelial cells prepared by the preparation method of the present invention in an appropriate physiological aqueous solvent. Where necessary, the composition can be added with a cryopreservation agent, refrigerated with liquid nitrogen, etc., thawed when used, washed with a buffer solution, and used for transplantation therapy.

[0226] The retinal pigment epithelial cells obtained by the production method of the present invention can also be cut into an appropriate size using tweezers or the like to obtain a sheet preparation.

[0227] The cells obtained by the production method of the present invention may also be subjected to adherence culture for differentiation induction in the second step to obtain cells in the form of a sheet to provide a sheet preparation.

[0228] The pharmaceutical composition of the present invention can be used as a therapeutic drug for diseases based on (or caused by) retinal pigment epithelial cell disorders.

[0229] 5. Drugs and treatments for retinal diseases

[0230] The retinal pigment epithelial cells (including the retinal pigment epithelial cells that experience the above-mentioned concentration and amplification operations, etc.) prepared by the preparation method of the present invention can be used as a cell transplantation therapeutic drug transplanted into a living organism for the treatment of retinal diseases in the form of a suspension or a sheet. The present invention also provides a therapeutic method, which comprises administering therapeutic drugs to the patient. Retinal diseases here are ophthalmic diseases related to the retina and also include complications with other diseases such as diabetes, etc. Retinal diseases in the present invention include, for example, diseases based on retinal pigment epithelial cell disorders, such as age-related macular degeneration, retinitis pigmentosa, diabetic retinopathy or retinal detachment, etc. That is to say, the retinal pigment epithelial cells prepared by the preparation method of the present invention can be used to supplement the damaged parts of retinal pigment epithelial cells in patients.

[0231] In transplantation therapy, rejection due to differences in histocompatibility antigens is often a problem. This problem can be solved by using pluripotent stem cells (e.g., induced pluripotent stem cells) established from other people's somatic cells that are immunologically compatible with the recipient (e.g., part or all of the HLA type and MHC type are compatible), or pluripotent stem cells (e.g., induced pluripotent stem cells) established by the somatic cells of the transplant recipient.

[0232] That is, in a preferred embodiment, as the pluripotent stem cell in the method of the present invention, allogeneic retinal pigment epithelial cells or tissues containing them are prepared by pluripotent stem cells, and the pluripotent stem cells are established by somatic cells of other people whose immunity is compatible with the immunity of the recipient, and they are transplanted to the recipient. Alternatively, retinal pigment epithelial cells are prepared using pluripotent stem cells (e.g., induced pluripotent stem cells) established by the somatic cells of the recipient, which are immune self for the recipient, or tissues containing them, and they are transplanted to the recipient.

[0233] The substances (especially low molecular weight compounds etc.) used in the present invention include hydrates, salts etc. of the substances.

[0234] All references cited in this specification, including publications, patent documents, descriptions of patent applications, etc., are hereby incorporated by reference in their entirety to the extent that they are disclosed herein.

[0235] The present invention is explained in detail below by referring to examples, but the examples should not be construed as being limited thereto.

[0236] In the following examples, the cellulase obtained from Cellular Technology Limited, Kyoto University, was used. Established iPS cells from human peripheral blood-derived monocytes (1231A3, QHJI01).

[0237] Example 1: Study on the effect of ROCK inhibitor Y-27632 in the second step

[0238] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 8; 4:3594", human iPS cells (1231A3 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03 medium).

[0239] Retinal pigment epithelial (RPE) cells were prepared as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 3.0 × 10 4 10 cells were cultured in AK03N medium containing ROCK inhibitor Y-27632 (Wako Pure Chemical Industries, Ltd.) (final concentration 10 μM) at 37°C, 5% CO2. On the second day of seeding, FGF receptor inhibitor PD173074 (SIGMA) (final concentration 100 nM) was added to AK03N medium (start of the first step), the medium was replaced with AK03N medium supplemented with FGF receptor inhibitor every other day, and the cells were exposed to FGF receptor inhibitor for a total of 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and 2.0×10 5 Cells were seeded / well on a plate coated with iMatrix-511 (0.5 μg / cm 2) in a 6-well culture plate and cultured at 37°C, 5% CO2 (starting from the second step). On the first day of culture, AK03N medium supplemented with Y-27632 (final concentration 10 μM) or AK03N medium without Y-27632 was used as a comparison. For 2-13 days of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] supplemented with 10% KSR (Life Technologies) and Y-27632 (final concentration 10 μM) was used or a basal medium supplemented with only 10% KSR without Y-27632 was used as a comparison. For 14-30 days of culture, a basal medium supplemented with only 10% KSR was used, and from day 31 of culture onwards, an RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used. The entire amount of the medium was replaced every day.

[0240] The culture plate was observed on the 42nd day of culture. As a result, when Y-27632 was added in the second step, the appearance of a dark brown cell group could be visually confirmed ( Figure 1 : 10 μM Y-27632). Under microscopic observation, the cells showed typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology. On the other hand, when Y-27632 was not added in the second step, the appearance of dark brown cell groups could not be confirmed ( Figure 1 : Not processed).

[0241] Example 2: Study of Y-27632 concentration in the second step

[0242] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4:3594", human iPS cells (1231A3 line and QHJI01 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0243] Retinal pigment epithelial (RPE) cells were prepared as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 3.0 × 10 4 cells were cultured in AK03N medium containing ROCK inhibitor Y-27632 (Wako Pure Chemical Industries, Ltd.) (final concentration 10 μM) at 37°C, 5% CO2. On the second day of seeding, FGF receptor inhibitor PD173074 (SIGMA) (final concentration 100 nM) or MEK inhibitor PD0325901 (SIGMA) (final concentration 1 μM) was added to AK03N medium (start of the first step), and the medium was replaced with AK03N medium supplemented with FGF receptor inhibitor or MEK inhibitor every other day, and the cells were exposed to FGF receptor inhibitor or MEK inhibitor for a total of 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLEselect, dissociated with a cell scraper, dispersed into single cells by pipetting, and 2.0×10 5 Cells were seeded / well on a plate coated with iMatrix-511 (0.5 μg / cm 2) in a 6-well culture plate and cultured at 37°C, 5% CO2 (starting from the second step). In the case of the 1231A3 line, on the first day of culture, an AK03N medium supplemented with Y-27632 to a final concentration of 1 μM, 3 μM, 10 μM, 30 μM, or 100 μM was used, or as a comparison, an AK03N medium not supplemented with Y-27632 was used. The cells were cultured for 2-13 days, and a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] was used to supplement 10% KSR (Life Technologies) and Y-27632 (final concentration 1 μM, 3 μM, 10 μM, 30 μM or 100 μM) or a basal medium supplemented with only 10% KSR but not Y-27632 was used as a comparison. For 14-30 days of culture, a basal medium supplemented with only 10% KSR was used; and from 31 days after the start of culture, an RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9mM L-glutamine, 96U / ml penicillin-96μg / ml streptomycin] was used. In the case of the QHJI01 line, a basal medium supplemented with 10% KSR (Life Technologies), Y-27632 (final concentration 1μM, 3μM, 10μM, 30μM or 100μM) or a basal medium supplemented with only 10% KSR without Y-27632 was used as a comparison object for 1-12 days of culture. For 13-30 days of culture, a basal medium supplemented with only 10% KSR was used; from 31 days after the start of culture, an RPE maintenance medium was used. The entire amount of the medium was replaced every day.

[0244] In the case of the 1231A3 line, the culture plate was observed on the 48th day of culture. As a result, in both cases of exposure to the FGF receptor inhibitor or the MEK inhibitor in the first step, the appearance of a dark brown cell population could be visually confirmed at a Y-27632 concentration of not less than 10 μM ( Figure 2-1, 1231A3: 10μM, 30μM, 100μM Y-27632). Under microscopic observation, the cells showed typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology. On the other hand, when Y-27632 was not added in the second step, the appearance of dark brown cell groups could not be confirmed ( Figure 2-1 , 1231A3: untreated). In the case of the QHJI01 line, the culture plate was observed on the 50th day of culture. As a result, in both cases of exposure to the FGF receptor inhibitor or the MEK inhibitor in the first step, the appearance of a dark brown cell population could be visually confirmed at a Y-27632 concentration of not less than 3 μM ( Figure 2-2 , QHJI01: 3μM, 10μM, 30μM, 100μM Y-27632). Under microscopic observation, the cells showed typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology. On the other hand, when Y-27632 was not added in the second step, the appearance of dark brown cell populations could not be confirmed ( Figure 2-2 , QHJI01: untreated).

[0245] Example 3: Study of the number of plated cells by treatment with low concentration of Y-27632 in the second step

[0246] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (QHJI01 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0247] Retinal pigment epithelial (RPE) cells were prepared as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 3.0 × 10 4cells were cultured in AK03N medium containing ROCK inhibitor Y-27632 (WakoPure Chemical Industries, Ltd.) (final concentration 10 μM) at 37°C, 5% CO2. On the second day of seeding, FGF receptor inhibitor PD173074 (SIGMA) (final concentration 100 nM) or MEK inhibitor PD0325901 (SIGMA) (final concentration 1 μM) was added to AK03N medium (start of the first step), and the medium was replaced with AK03N medium supplemented with FGF receptor inhibitor or MEK inhibitor every other day, and the cells were exposed to FGF receptor inhibitor or MEK inhibitor for a total of 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and 2.0×10 6 The cells were seeded on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, with each well containing 10 times the total number of cells plated (2.0×10 5 ) and cultured at 37°C, 5% CO2 (from the second step). Cultured for 1-12 days, using a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] supplemented with 10% KSR (Life Technologies) and Y-27632 (final concentration 10 μM) or a basal medium supplemented with only 10% KSR without Y-27632 as a comparison. For 13-30 days of culture, a basal medium supplemented with only 10% KSR was used, and from day 31 of culture onwards, an RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used. The entire amount of the medium was replaced every day.

[0248] The culture plate was observed on the 50th day of culture. As a result, in both cases of exposure to the FGF receptor inhibitor or the MEK inhibitor in the first step, the appearance of a dark brown cell population could be visually confirmed by treatment with a low concentration (1 μM) of Y-27632 ( Figure 3:1μM Y-27632). Under microscope observation, the cells showed typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology. On the other hand, when Y-27632 was not added in the second step, the appearance of dark brown cell groups could not be confirmed ( Figure 3 : Not processed).

[0249] Example 4: Study of the exposure period of Y-27632 in the second step

[0250] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (QHJI01 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0251] Retinal pigment epithelial (RPE) cells were prepared as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 4 cells, cultured in AK03N medium containing ROCK inhibitor Y-27632 (Wako Pure Chemical Industries, Ltd.) (final concentration 10 μM) at 37°C, 5% CO2. On the second day of inoculation, MEK inhibitor PD0325901 (SIGMA) (final concentration 1 μM) was added to AK03N medium (start of the first step), the medium was replaced with AK03N medium supplemented with MEK inhibitor every other day, and the cells were exposed to MEK inhibitor for a total of 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and 0.8×10 5 Cells were seeded / well on a plate coated with iMatrix-511 (0.5 μg / cm 2The cells were placed in a 12-well culture plate and cultured at 37°C, 5% CO2 (starting from the second step). From the first day to the 30th day of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] supplemented with 10% KSR (Life Technologies) was used, and the cells were exposed to Y-27632 (final concentration 10 μM) for 3 days, 6 days, 9 days, 12 days, 16 days, or 20 days starting from the first day of culture. From day 31 of culture onwards, RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used, and the entire amount of the medium was replaced every day.

[0252] The culture plate was observed on the 49th day of culture. As a result, the appearance of a dark brown cell group could be visually confirmed by exposure to Y-27632 for not less than 6 days ( Figure 4 : 6 days, 9 days, 12 days, 16 days, 20 days). Under microscopic observation, the cells showed typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone-like morphology. On the other hand, during the second step of exposure to Y-2763 for 23 days, only a slight dark brown cell group was confirmed ( Figure 4 : 3 days).

[0253] Example 5: Study on the effect of ROCK inhibitor fasudil in the second step

[0254] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (1231A3 line and QHJI01 line) were cultured under feeder-free conditions to maintain the undifferentiated state. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0255] Retinal pigment epithelial (RPE) cells were prepared as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 3.0 × 10 4 cells, and cultured in AK03N medium containing ROCK inhibitor Y-27632 (Wako Pure Chemical Industries, Ltd.) (final concentration 10 μM) at 37°C, 5% CO2. On the second day of seeding, FGF receptor inhibitor PD173074 (SIGMA) (final concentration 100 nM) was added to AK03N medium (start of the first step), and the medium was replaced with AK03N medium supplemented with FGF receptor inhibitor every other day, and the cells were exposed to FGF receptor inhibitor for a total of 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and in the case of the 1231A3 line at 2.0×10 6 Cells were seeded / well on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, which is the total number of cells plated per well (2.0×10 5 ) is 10 times, and in the case of QHJI01 series, 1.0×10 6 Cells / well seeding, which is the total number of cells plated per well (2.0×10 5) and cultured at 37°C, 5% CO2 (from the second step). In the case of the 1231A3 line, on the first day of culture, AK03N medium supplemented with ROCK inhibitor fasudil (Wako PureChemical Industries, Ltd.) at a final concentration of 10 μM, 30 μM or 100 μM was used, or AK03N medium without fasudil was used as a comparison. The cells were cultured for 2-13 days, and a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] was used to supplement 10% KSR (Life Technologies) and fasudil (final concentration 10 μM, 30 μM or 100 μM) or a basal medium supplemented with only 10% KSR but not fasudil was used as a comparison. For 14-30 days of culture, a basal medium supplemented with only 10% KSR was used; and from 31 days after the start of culture, an RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9mM L-glutamine, 96U / ml penicillin-96μg / ml streptomycin] was used. In the case of the QHJI01 line, a basal medium supplemented with 10% KSR (Life Technologies) and fasudil (final concentration 10μM) or a basal medium supplemented with only 10% KSR without fasudil was used as a comparison object for 1-12 days of culture. For 13-30 days of culture, a basal medium supplemented with only 10% KSR was used; from 31 days after the start of culture, an RPE maintenance medium was used. The entire amount of the medium was replaced every day.

[0256] In the case of the 1231A3 line, the culture plate was observed on the 41st day of culture. As a result, the appearance of a dark brown cell group could be visually confirmed when the fasudil concentration was not less than 10 μM ( Figure 5 , 1231A3: 10μM, 30μM, 100μM fasudil). Under microscopic observation, the cells showed typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology. On the other hand, when fasudil was not added in the second step, the appearance of dark brown cell populations could not be confirmed ( Figure 5, 1231A3: untreated). In the case of the QHJI01 line, the culture plate was observed on the 48th day of culture. As a result, when fasudil was added in the second step, the appearance of a dark brown cell group could be visually confirmed ( Figure 5 , QHJI01: 10 μM fasudil). Under microscopic observation, the cells showed typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology. On the other hand, when fasudil was not added in the second step, the appearance of dark brown cell populations could not be confirmed ( Figure 5 , QHJI01: untreated).

[0257] Example 6: Study on the effect of caspase inhibitor Z-VAD-FMK in the second step

[0258] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (QHJI01 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0259] Retinal pigment epithelial (RPE) cells were prepared as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 3.0 × 10 4 cells, cultured in AK03N medium containing ROCK inhibitor Y-27632 (Wako Pure Chemical Industries, Ltd.) (final concentration 10 μM) at 37°C, 5% CO2. On the second day of inoculation, MEK inhibitor PD0325901 (SIGMA) (final concentration 1 μM) was added to AK03N medium (start of the first step), the medium was replaced with AK03N medium supplemented with MEK inhibitor every other day, and the cells were exposed to MEK inhibitor for a total of 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and plated at 2.0×10 6 Cells / well were seeded on a plate coated with iMatrix-511 (0.5 μg / cm 2) in a 6-well culture plate, which is the total number of cells plated per well (2.0×10 5 ) and cultured at 37°C, 5% CO2 (from the second step). For 1-12 days of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] was used to supplement 10% KSR (Life Technologies) and caspase inhibitor Z-VAD-FMK (Wako Pure Chemical Industries, Ltd.) (final concentration 20 μM) or a basal medium supplemented with only 10% KSR without Z-VAD-FMK was used as a comparison. From day 13 to 30 of culture, a basal medium supplemented with only 10% KSR was used; from day 31 of culture, an RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used. The entire amount of the medium was replaced every day.

[0260] The culture plate was observed on the 65th or 67th day of culture. As a result, when Z-VAD-FMK was added in the second step, the appearance of a dark brown cell population could be visually confirmed ( Figure 6 : 20 μM Z-VAD-FMK). Under microscopic observation, the cells showed typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology. On the other hand, when Z-VAD-FMK was not added in the second step, the appearance of dark brown cell groups could not be confirmed ( Figure 6 : Not processed).

[0261] (Reference example and reference comparative example)

[0262] In the following reference examples and comparative examples, iPS cells derived from human dermal fibroblasts (201B7, Kyoto University) and iPS cells obtained from Cellular Technology Limited by Kyoto University were used. Established iPS cells from human peripheral blood-derived monocytes (1231A3, Ff-I01, QHJI01).

[0263] Reference Example 1: A method for treating retinal pigment epithelial cells using human iPS cells and a MEK inhibitor treatment step Effective preparation

[0264] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4:3594", human iPS cells (201B7 line and 1231A3 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03 medium) or Essential 8 medium (Life Technologies).

[0265] Preparation of retinal pigment epithelial (RPE) cells including a MEK inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 1.2 × 10 4 Cells were cultured in AK03 medium or Essential 8 medium containing ROCK inhibitor [10 μM Y-27632 (Wako Pure Chemical Industries, Ltd.)] at 37°C and 5% CO2. On the second day of inoculation, PD0325901 (SIGMA) as a MEK inhibitor was added to AK03 medium at a final concentration of 1 μM or to Essential 8 medium at a final concentration of 0.03 μM (starting from the first step), and the cells were exposed to it for 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and inoculated on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, when AK03 medium was used, 2.0×10 5 cells / well, when using Essential 8 Medium, 5×10 5cells / well and cultured at 37°C, 5% CO2 (start of the second step). On the first day of culture, AK03 medium or Essential 8 medium was used, to which Y-27632 (final concentration 10 μM), SB-431542 (Wako Pure Chemical Industries, Ltd.) as a Nodal signal transduction pathway inhibitor (final concentration 5 μM), and CKI-7 (SIGMA) as a Wnt signal transduction pathway inhibitor (final concentration 3 μM) were added; for 2-5 days of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100U / ml penicillin-100μg / ml streptomycin (LifeTechnologies)]; for 6-9 days of culture, use a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), CKI-7 (final concentration 3μM); for 10-13 days of culture, use a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), CKI-7 (final concentration 3μM); for 14 to 30 days of culture, use a basal medium supplemented with only 10% KSR; from the 31st day of culture, use RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin]. The entire amount of the culture medium was replaced every day.

[0266] The culture plates were observed after culturing for 38-42 days. As a result, when both the AK03 medium and the Essential 8 medium were used, a dark brown cell group ( Figure 7 ). Under microscopic observation, the cells showed typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology ( Figure 8 ).

[0267] Reference Comparative Example 1: No MEK inhibitor treatment step and retinal pigment epithelial cells using human iPS cells Cellular

[0268] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4:3594", human iPS cells (201B7 line and 1231A3 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03 medium) or Essential 8 medium (Life Technologies).

[0269] Preparation of retinal pigment epithelial (RPE) cells without the MEK inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and cultured at 2.0×10 5 Cells / well were seeded on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, when using Essential 8, 5.0×10 5Cells were seeded / well and cultured at 37°C, 5% CO2. On the first day of culture, AK03 medium or Essential 8 medium was used, to which Y-27632 (Wako Pure Chemical Industries, Ltd.) as a ROCK inhibitor (final concentration of 10 μM), SB-431542 (Wako Pure Chemical Industries, Ltd.) as a Nodal signal transduction pathway inhibitor (final concentration of 5 μM), and CKI-7 (SIGMA) as a Wnt signal transduction pathway inhibitor (final concentration of 3 μM) were added; for 2-5 days of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100U / ml penicillin-100μg / ml streptomycin (LifeTechnologies)]; for 6-9 days of culture, use a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), and CKI-7 (final concentration 3μM); for 10-13 days of culture, use a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), and CKI-7 (final concentration 3μM); for 14-30 days of culture, use a basal medium supplemented with only 10% KSR; from the 31st day of culture, use RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin]. The entire amount of the culture medium was replaced every day.

[0270] The culture plates were observed for 38-42 days. As a result, only a few cells could be confirmed to show typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology ( Fig. 9 ).

[0271] Reference Example 2: Retinal pigment epithelial cells including an FGF receptor inhibitor treatment step and using human iPS cells Efficient production

[0272] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4:3594", human iPS cells (201B7 line and 1231A3 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03 medium) or Essential 8 medium (Life Technologies).

[0273] Preparation of retinal pigment epithelial (RPE) cells including the FGF receptor inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 1.2 × 10 4 cells, cultured in AK03 medium or Essential 8 medium containing ROCK inhibitor [10 μM Y-27632 (Wako Pure Chemical Industries, Ltd.)] at 37° C., 5% CO 2. On the second day of seeding, PD173074 (SIGMA), an FGF receptor inhibitor, was added to AK03 medium or Essential 8 at a final concentration of 100 nM (start of the first step), and the cells were exposed thereto for 6 days (completion of the first step). In one embodiment, in order to study the effect of FGF receptor inhibitors in a medium without a factor for maintaining an undifferentiated state (bFGF), StemSure hPSC MediumΔ (Wako Pure Chemical Industries, Ltd.) without the addition of bFGF (hereinafter referred to as StemSure hPSC MediumΔ w / o bFGF) was used. That is, PD173074 (SIGMA), an FGF receptor inhibitor, was added to StemSure hPSC MediumΔw / o bFGF at a final concentration of 100 nM (start of the first step), and the cells were exposed thereto for 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and when AK03 medium or StemSure hPSC MediumΔw / o bFGF was used, the concentration was 2.0×10 5Cells / well were seeded on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, when using Essential 8 medium, 5.0×10 5 Cells / well were inoculated and cultured at 37°C, 5% CO2 (start of the second step). On the first day of culture, AK03 medium, Essential 8 medium or StemSure hPSC MediumΔw / o bFGF was used, to which Y-27632 (Wako Pure Chemical Industries, Ltd.) as a ROCK inhibitor (final concentration of 10 μM), SB-431542 (Wako Pure Chemical Industries, Ltd.) as a Nodal signaling pathway inhibitor (final concentration of 5 μM), and CKI-7 (SIGMA) as a Wnt signaling pathway inhibitor (final concentration of 3 μM) were added; for 2-5 days of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.)] supplemented with 20% KSR (Life Technologies), Y-27632 (final concentration of 10 μM), SB-431542 (final concentration of 5 μM) and CKI-7 (final concentration of 3 μM) was used. Chemical Industries, Ltd.), 2mM L-glutamine (SIGMA), 100U / ml penicillin-100μg / ml streptomycin (Life Technologies)]; for 6-9 days of culture, use a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), CKI-7 (final concentration 3μM); for 10-13 days of culture, use a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), CKI-7 (final concentration 3μM); for 14-30 days of culture, use a basal medium supplemented with only 10% KSR; from the 31st day of culture, use RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin]. The entire amount of the culture medium was replaced every day.

[0274] The culture plates were observed after culturing for 38-42 days. As a result, when AK03 medium, Essential 8, or StemSure hPSC MediumΔw / o bFGF was used, the appearance of a dark brown cell population could be confirmed in a wide area in the 201B7 line and / or 1231A3 line ( Fig.10 ). Under microscopic observation, the cells showed typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology ( Fig.11 ).

[0275] Reference Comparative Example 2: Excluding the FGF receptor inhibitor treatment step and using human iPS cells for retinal pigment epithelial cells Preparation of epithelial cells

[0276] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4:3594", culture of human iPS cells (201B7 line and 1231A3 line) in an undifferentiated state was performed under feeder-free conditions. AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03 medium) or Essential 8 medium (Life Technologies).

[0277] Preparation of retinal pigment epithelial (RPE) cells without the FGF receptor inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state or iPS cells cultured in StemSure hPSC Medium Δw / o bFGF (WakoPure Chemical Industries, Ltd.) for 6 days were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and 2.0×10 cells were added when AK03 medium or StemSure hPSC Medium Δw / obFGF was used. 5 Cells were seeded / well on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, when using Essential 8, 5.0×10 5Cells were seeded / well and cultured at 37°C, 5% CO2. On the first day of culture, AK03 medium, Essential 8 medium or StemSure hPSC Medium Δw / o bFGF was used, and Y-27632 (Wako Pure Chemical Industries, Ltd.) as a ROCK inhibitor (final concentration of 10 μM), SB-431542 (Wako Pure Chemical Industries, Ltd.) as a Nodal signaling pathway inhibitor (final concentration of 5 μM) and CKI-7 (SIGMA) as a Wnt signaling pathway inhibitor (final concentration of 3 μM) were added; for 2-5 days of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.)] supplemented with 20% KSR (Life Technologies), Y-27632 (final concentration of 10 μM), SB-431542 (final concentration of 5 μM) and CKI-7 (final concentration of 3 μM) was used. Chemical Industries, Ltd.), 2mM L-glutamine (SIGMA), 100U / ml penicillin-100μg / ml streptomycin (Life Technologies)]; for 6-9 days of culture, use a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), CKI-7 (final concentration 3μM); for 10-13 days of culture, use a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), CKI-7 (final concentration 3μM); for 14-30 days of culture, use a basal medium supplemented with only 10% KSR; from the 31st day of culture, use RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin]. The entire amount of the culture medium was replaced every day.

[0278] The culture plates were observed for 38-42 days. As a result, only a few cells could be confirmed to show typical characteristics of RPE cells, such as dark brown, polygonal, and cobblestone morphology ( Fig.12 ).

[0279] Reference Example 3: MEK inhibitors and / or FGF receptor inhibitors and various inhibitors, signal transduction pathway inhibitors Combination treatment steps of agonists or signal transduction pathway agonists and efficient retinal pigment epithelial cell transplantation using human iPS cells System

[0280] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4:3594", human iPS cells (201B7 line and 1231A3 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03 medium).

[0281] Preparation of retinal pigment epithelial (RPE) cells including a combined treatment step of a MEK inhibitor and / or an FGF receptor inhibitor and various inhibitors, signal transduction pathway inhibitors or signal transduction pathway agonists was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 1.2 × 10 4 The cells were cultured in AK03 medium containing ROCK inhibitor [10 μM Y-27632 (Wako Pure Chemical Industries, Ltd.)] at 37°C and 5% CO2. On the second day after cell seeding, PD0325901 (SIGMA) as a MEK inhibitor (final concentration 1 μM), PD173074 (SIGMA) as an FGF receptor inhibitor (final concentration 100 nM), LDN193189 (STEMGENT) as a BMP receptor inhibitor (final concentration 100 nM), SAG (Enzo Life Sciences) as an agonist of the Shh signal transduction pathway (final concentration 30 nM), and Go6983 (SIGMA) as a PKC inhibitor (final concentration 2 μM) were added to the culture medium. Fig.13 The indicated combinations were added to the culture medium (start of step 1) and the cells were exposed to them for 6 days (completion of step 1). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 5cells and cultured at 37°C, 5% CO2 (starting from the second step). On the first day of culture, AK03 medium was used to which Y-27632 (Wako Pure Chemical Industries, Ltd.) as a ROCK inhibitor (final concentration of 10 μM), SB-431542 (Wako Pure Chemical Industries, Ltd.) as a Nodal signal transduction pathway inhibitor (final concentration of 5 μM), and CKI-7 (SIGMA) as a Wnt signal transduction pathway inhibitor (final concentration of 3 μM) were added; for 2-5 days of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100U / ml penicillin-100μg / ml streptomycin (LifeTechnologies)]; for 6-9 days of culture, use a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), and CKI-7 (final concentration 3μM); for 10-13 days of culture, use a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), and CKI-7 (final concentration 3μM); for 14-30 days of culture, use a basal medium supplemented with only 10% KSR; from the 31st day of culture, use RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9mM L-glutamine, 96U / ml penicillin-96μg / ml streptomycin]. The entire amount of culture medium was replaced every day. At the same time, the experiment was also carried out under the conditions of Reference Example 1 containing a MEK inhibitor treatment step, Reference Comparative Example 1 not including a MEK inhibitor treatment step, Reference Example 2 containing an FGF receptor inhibitor treatment step, and Reference Comparative Example 2 not including an FGF receptor inhibitor treatment step.

[0282] The culture plates were observed for 38-47 days. As a result, under the conditions of Reference Comparative Example 1 and Reference Comparative Example 2, only a few cells were found to show typical characteristics of RPE cells, such as dark brown, polygonal, cobblestone-like morphology ( Fig.13, untreated). On the contrary, under the preparation conditions of reference example 1 containing a MEK inhibitor treatment step, the production conditions of reference example 2 containing a FGF receptor inhibitor treatment step, and the preparation conditions of a combination treatment step containing a MEK inhibitor and / or an FGF receptor inhibitor and various inhibitors, a signal transduction pathway inhibitor or a signal transduction pathway agonist, it can be confirmed that the typical features of RPE cells such as dark brown, polygonal, cobblestone-like morphology appear ( Fig.13 The proportion of RPE cells in the whole well was determined by visual observation and classified into 6 levels of 0-5 according to the proportion ( Fig.14 A) In Fig.14 In the treatment conditions of all the compound combinations shown in B and 14C, it was confirmed that a higher proportion of RPE cells appeared than in the untreated condition ( Fig.14 B and 14C).

[0283] Reference Example 4: A step of treating with a MEK inhibitor or an FGF receptor inhibitor and using human iPS cells Ff-I01, Efficient preparation of retinal pigment epithelial cells using QHJI01

[0284] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4:3594", human iPS cells (Ff-I01 line and QHJI01 line) were cultured under feeder-free conditions to maintain the undifferentiated state. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0285] Preparation of retinal pigment epithelial (RPE) cells including a MEK inhibitor or FGF receptor inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated using a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 4cells were cultured in AK03 medium containing ROCK inhibitor [10 μM Y-27632 (Wako PureChemical Industries, Ltd.)] at 37°C and 5% CO2. On the second day of inoculation, PD0325901 (SIGMA) as a MEK inhibitor (final concentration 1 μM) or PD173074 (SIGMA) as an FGF receptor inhibitor (final concentration 100 nM) was added to the AK03N medium (start of the first step), and the cells were exposed thereto for 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and inoculated on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 5cells, and cultured at 37°C, 5% CO2 (starting from the second step). From the first day to the fourth day of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM β-amino acid (β-amino acid) ... L-glutamine (SIGMA), 100U / ml penicillin-100μg / ml streptomycin (LifeTechnologies)]; for 5-8 days of culture, use a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), and CKI-7 (final concentration 3μM); for 9 to 12 days of culture, use a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), and CKI-7 (final concentration 3μM); for 13-30 days of culture, use a basal medium supplemented with only 10% KSR; from the 31st day of culture, use RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies) Technologies), 1.9mM L-glutamine, 96U / ml penicillin-96μg / ml streptomycin]. The entire amount of culture medium was replaced every day. At the same time, experiments were also conducted under the conditions of Reference Comparative Example 1 (condition that the AK03 culture medium was changed to AK03N culture medium) without the MEK inhibitor treatment step and Reference Comparative Example 2 (condition that the AK03 culture medium was changed to AK03N culture medium) without the FGF receptor inhibitor treatment step.

[0286] The culture plates were observed on the 43rd day of culture. As a result, under the conditions of Reference Comparative Example 1 and Reference Comparative Example 2, almost no cells showing typical characteristics of RPE cells such as dark brown, polygonal, and cobblestone morphology were found ( Fig.15 On the other hand, when exposed to MEK inhibitor and FGF receptor inhibitor, the appearance of dark brown cell population was confirmed over a wide area in both Ff-I01 and QHJI01 lines ( Fig.15 , MEKi, FGFRi).

[0287] Reference Example 5: Consider the number of days of exposure to each inhibitor during the MEK inhibitor or FGF receptor inhibitor treatment step

[0288] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (QHJI01 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0289] Preparation of retinal pigment epithelial (RPE) cells including a MEK inhibitor or FGF receptor inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBs(-)), dissociated using a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 4 Cells were cultured in AK03N medium containing ROCK inhibitor [10 μM Y-27632 (Wako PureChemical Industries, Ltd.)] at 37°C and 5% CO2. On the second day, 2 days, 3 days, 4 days, 5 days or 6 days after inoculation, PD0325901 (SIGMA) as a MEK inhibitor (final concentration of 1 μM) or PD173074 (SIGMA) as an FGF receptor inhibitor (final concentration of 100 nM) was added to the AK03N medium (start of the first step), and the cells were exposed thereto for 6 days, 5 days, 4 days, 3 days, 2 days or 1 day (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and inoculated on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 5Cells were cultured at 37°C and 5% CO2 (from the second step). From the first day to the fourth day of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] was used. Technologies)]; for 5-8 days of culture, a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM), and CKI-7 (final concentration 3 μM) was used; for 9-12 days of culture, a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM), and CKI-7 (final concentration 3 μM) was used; for 13-30 days of culture, a basal medium supplemented with only 10% KSR was used; from the 31st day of culture, RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used. The entire amount of culture medium was replaced every day.

[0290] The culture plate was observed on the 48th day of culture. As a result, in both treatments with the MEK inhibitor and the FGF receptor inhibitor, the brown-black cell population increased by exposure for not less than 2 days, and as the number of days of exposure increased until exposure to 6 days, the proportion of cells that developed color in the entire well increased ( Fig.16 ). In particular, a significant increase in the dark brown cell population was observed during 4-6 days of exposure.

[0291] Reference Example 6: Considerations of MEK inhibitor exposure period during MEK inhibitor treatment step

[0292] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (1231A3 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03 medium).

[0293] Preparation of retinal pigment epithelial (RPE) cells including a MEK inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated using a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 1.2 × 10 4 The cells were cultured in AK03 medium containing ROCK inhibitor [10 μM Y-27632 (Wako Pure Chemical Industries, Ltd.)] at 37°C and 5% CO2. On the second day, 4 days or 6 days after inoculation, PD0325901 (SIGMA) (final concentration 1 μM) as a MEK inhibitor was added to the AK03 medium (start of the first step), and the cells were exposed thereto for 6 days, 3 days or 1 day (completion of the first step). In addition, the cells exposed to the MEK inhibitor for 6 days were treated with 0.5×TrypLEselect, dissociated with a cell scraper, dispersed into single cells by pipetting, and inoculated on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, 0.8 × 10 4 Cells were exposed to MEK inhibitors for 13 days (first step completed) in AK03 medium containing Y-27632 (final concentration 10 μM) and PD0325901 (final concentration 1 μM) at 37°C, 5% CO2 for 7 days. Then, cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, 1.2 × 10 6cells and cultured at 37°C, 5% CO2 (starting from the second step). On the first day of culture, AK03 medium supplemented with Y-27632 (final concentration 10 μM), SB-431542 (Wako Pure Chemical Industries, Ltd.) as a Nodal signal transduction pathway inhibitor (final concentration 5 μM), and CKI-7 (SIGMA) as a Wnt signal transduction pathway inhibitor (final concentration 3 μM) was used; for 2-5 days of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] was used. Technologies)]; for 6-9 days of culture, a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM), and CKI-7 (final concentration 3 μM) was used; for 10-13 days of culture, a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM), and CKI-7 (final concentration 3 μM) was used; for 14-30 days of culture, a basal medium supplemented with only 10% KSR was used; from the 31st day of culture, RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used. The entire amount of culture medium was replaced every day. Meanwhile, RPE cells were also prepared under the conditions of Reference Comparative Example 1 excluding the MEK inhibitor treatment step.

[0294] The culture plates were observed on the 37th day of culture. As a result, under the conditions of reference example 1 and exposure to the MEK inhibitor for one day, almost no cells showing typical characteristics of RPE cells such as dark brown, polygonal, and cobblestone morphology were found ( Fig.17 , untreated, MEKi 1 day). On the other hand, by exposure to MEK inhibitor for 3 days and 6 days, the appearance of dark brown cell populations could be confirmed over a wide area ( Fig.17, MEKi 3 days, 6 days), and by exposure to 13 days, sufficient appearance of the colored cell population was similarly confirmed ( Fig.17 , MEKi 13 days).

[0295] Reference Example 7: Gene expression at the completion of the MEK inhibitor or FGF receptor inhibitor treatment step

[0296] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (Ff-I01 line and QHJI01 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0297] Preparation of retinal pigment epithelial (RPE) cells including a MEK inhibitor or FGF receptor inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated using a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 4 cells were cultured in AK03N medium containing ROCK inhibitor [10 μM Y-27632 (Wako PureChemical Industries, Ltd.)] at 37°C and 5% CO2. On the next day or 4 days after inoculation, PD0325901 (SIGMA) (final concentration 1 μM) as a MEK inhibitor or PD173074 (SIGMA) (final concentration 100 nM) as an FGF receptor inhibitor was added to the AK03N medium (start of the first step), and the cells were exposed thereto for 6 days or 3 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and the cells other than the cells to be transferred to the second step were used for RNA extraction as samples for microarray, and the cells to be transferred to the second step were centrifuged at 2.0×10 5 Cells were seeded / well onto cells coated with iMatrix-511 (0.5 μg / cm 2) in a 6-well culture plate and cultured at 37°C, 5% CO2 (start of the second step). On the first day of culture, AK03 medium supplemented with Y-27632 (final concentration 10 μM), SB-431542 (Wako Pure Chemical Industries, Ltd.) as a Nodal signaling pathway inhibitor (final concentration 5 μM), and CKI-7 (SIGMA) as a Wnt signaling pathway inhibitor (final concentration 3 μM), or a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)].When AK03 medium (containing Y-27632, SB-431542, and CKI-7) was used on day 1 of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] was used for 2-5 days of culture. Technologies)]; for 6-9 days of culture, a basal medium supplemented with 15% KSR, Y-27632 (final concentration of 10 μM), SB-431542 (final concentration of 5 μM), and CKI-7 (final concentration of 3 μM) was used; for 10-13 days of culture, a basal medium supplemented with 10% KSR, Y-27632 (final concentration of 10 μM), SB-431542 (final concentration of 5 μM), and CKI-7 (final concentration of 3 μM) was used; for 14-30 days of culture, a basal medium supplemented with only 10% KSR was used; from the 31st day of culture, RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used. When a basal medium (containing 20% ​​KSR, Y-27632, SB-431542, and CKI-7) was used on day 1 of culture, a medium supplemented with 20% KSR (Life Technologies), Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM) and CKI-7 (final concentration 3 μM) for 5-8 days of culture; basal medium supplemented with 15% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM) and CKI-7 (final concentration 3 μM) for 9-12 days of culture, basal medium supplemented with 10% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM) and CKI-7 (final concentration 3 μM) was used; basal medium supplemented with only 10% KSR was used for 13-30 days of culture; and RPE maintenance medium was used from the 31st day of culture.The entire amount of the medium was replaced every day. Meanwhile, under the conditions of Reference Comparative Example 1 excluding the MEK inhibitor treatment step (AK03 medium was changed to AK03N medium), recovery of samples for microarray and preparation of RPE cells were also performed.

[0298] RNA was extracted using RNeasy Mini Kit (QIAGEN), and microarray analysis was performed using GeneChip Human Genome U133 Plus 2.0 Array (Affymetrix). For microarray analysis, outsourced analysis through KURABO INDUSTRIES LTD. was used.

[0299] Based on images of culture plates observed on day 43 of culture and Fig.14 A, the results of the proportion of RPE cells in the whole well determined by visual observation (scored on a 6-point scale of 0-5 according to the proportion of RPE cells) and the expression values ​​(signal) and signature (detection) of the early eye formation markers PAX6, LHX2, SIX3 at the completion of the first step, which are the results of microarray analysis, are summarized in the table ( Fig.18 ). The symbol represents the credibility of the expression value, and P represents high credibility, and A represents low credibility. From these results, it is found that when the first step is completed, the correlation between the ratio of RPE cells in the whole hole and the expression value of PAX6, LHX2 and SIX3. Therefore, it is found that the transition time to the second step can be determined based on the expression of these genes.

[0300] Reference Example 8: Considerations of various inhibitor concentrations in the MEK inhibitor or FGF receptor inhibitor treatment step

[0301] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (QHJI01 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0302] Preparation of retinal pigment epithelial (RPE) cells including a MEK inhibitor or FGF receptor inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated using a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2) in a 6-well culture plate, 2.0 × 10 4 Cells were cultured in AK03N medium containing ROCK inhibitor [10 μM Y-27632 (Wako PureChemical Industries, Ltd.)] at 37°C and 5% CO2. On the second day of seeding, PD0325901 (SIGMA) at a final concentration of 0.25 μM, 0.5 μM, 1 μM, 2 μM or 4 μM as a MEK inhibitor and PD173074 (SIGMA) at a final concentration of 25 nM, 50 nM, 100 nM, 200 nM or 400 nM as an FGF receptor inhibitor were added to the AK03N medium (start of the first step), and the cells were exposed thereto for 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and 2.0×10 5 Cells were seeded / well onto cells coated with iMatrix-511 (0.5 μg / cm 2) in a 6-well culture plate and cultured at 37°C, 5% CO2 (start of the second step). From the first day to the fourth day of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] was used. Technologies)]; for 5-8 days of culture, a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM), and CKI-7 (final concentration 3 μM) was used; for 9-12 days of culture, a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM), and CKI-7 (final concentration 3 μM) was used; for 13-30 days of culture, a basal medium supplemented with only 10% KSR was used; from the 31st day of culture, RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used. The entire amount of culture medium was replaced every day. Meanwhile, RPE cells were prepared under the conditions of Reference Comparative Example 1 excluding the MEK inhibitor treatment step (changing AK03 medium to AK03N medium) and Reference Comparative Example 2 excluding the FGF receptor inhibitor treatment step (changing AK03 medium to AK03N medium).

[0303] The culture plates were observed on the 36th and 49th days of culture. As a result, under the conditions of Reference Comparative Example 1 and Reference Comparative Example 2, almost no cells showing typical characteristics of RPE cells such as dark brown, polygonal, cobblestone morphology were found ( Fig.19 On the other hand, the appearance of a dark brown cell population could be confirmed over a wide area at all MEK inhibitor concentrations (0.25-4 μM) and FGF receptor inhibitor concentrations (25-400 nM) studied ( Fig.19, MEKi: 0.25-4μM, FGFRi: 25-400nM).

[0304] Reference Example 9: Consideration of the number of cells to be seeded in the transition from step 1 to step 2

[0305] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (QHJI01 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0306] Preparation of retinal pigment epithelial (RPE) cells including a MEK inhibitor or FGF receptor inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated using a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 4 cells and cultured in AK03N medium containing ROCK inhibitor [10 μM Y-27632 (Wako PureChemical Industries, Ltd3] at 37°C and 5% CO2. On the second day of seeding, PD0325901 (SIGMA) as a MEK inhibitor (final concentration of 1 μM) or PD173074 (SIGMA) as an FGF receptor inhibitor (final concentration of 100 nM) was added to the AK03N medium (start of the first step), and the cells were exposed thereto for 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and seeded on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in 6-well culture plates, with 0.2, 0.4, 0.6, 1.0, 2.0 or 4.0 × 10 5 cells (0.2, 0.4, 0.6, 1.0, 2.0 or 4.0 × 10 5 Cells / cm 2) and cultured at 37°C, 5% CO2 (start of the second step). From the first day to the fourth day of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] was used. Technologies)]; for 5-8 days of culture, a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM), and CKI-7 (final concentration 3 μM) was used; for 9-12 days of culture, a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM), and CKI-7 (final concentration 3 μM) was used; for 13-30 days of culture, a basal medium supplemented with only 10% KSR was used; from the 31st day of culture, RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used. The entire amount of medium was replaced every day.

[0307] The culture plates were observed on day 49 of culture. As a result, the inoculated cell numbers (0.2, 0.4, 0.6, 1.0, 2.0 or 4.0 × 10 4 Cells / cm 2 ) the appearance of a dark brown cell group can be confirmed over a wide area ( Fig. 20 ).

[0308] Reference Example 10: Consideration of MEK inhibitors PD184352, U0126, TAK-733, and AZD-8330 in the first step

[0309] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4:3594", human iPS cells (QHJI01 line and 1231A3 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0310] Preparation of retinal pigment epithelial (RPE) cells including a MEK inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated using a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 4 Cells were cultured in AK03N medium containing ROCK inhibitor [10 μM Y-27632 (Wako Pure Chemical Industries, Ltd.)] at 37°C and 5% CO2. On the second day of inoculation, PD0325901 (SIGMA) (final concentration 1 μM), PD184352 (SIGMA) (final concentration 1.5 μM, 3 μM, 6 μM), U0126 (SIGMA) (final concentration 5 μM, 10 μM), TAK-733 (Selleck) (final concentration 0.3 μM) or AZD-8330 (Selleck) (final concentration 0.3 μM) as MEK inhibitors were added to AK03N medium (start of the first step), and the cells were exposed thereto for 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and inoculated on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, 2×10 5cells and cultured at 37°C, 5% CO2 (start of the second step). From the first day to the fourth day of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM β-amino acid solution (Sigma-Aldrich), 1 mM sodium pyruvate (Sigma-Aldrich), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM β-amino acid solution (Sigma-Aldrich), 1 mM sodium pyruvate (Sigma-Aldrich), 0.1 mM β-amino acid solution ...2 mM β-amino acid solution (Sigma-Aldrich), 0.2 mM β-amino acid solution (Sigma-Aldrich), 0.2 mM β-amino acid solution (Sigma-Aldrich), 0.2 mM β-amino acid solution (Sigma-Aldrich), 0.2 mM β-amino L-glutamine (SIGMA), 100U / ml penicillin-100μg / ml streptomycin (LifeTechnologies)]; for 5-8 days of culture, use a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), and CKI-7 (final concentration 3μM); for 9-12 days of culture, use a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), and CKI-7 (final concentration 3μM); for 13-30 days of culture, use a basal medium supplemented with only 10% KSR; from the 31st day of culture, use RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin]. The entire amount of the culture medium was replaced every day. Meanwhile, RPE cells were prepared under the conditions of Reference Comparative Example 1 excluding the MEK inhibitor treatment step (AK03 culture medium was changed to AK03N culture medium).

[0311] The culture plates were observed on the 49th and 50th days of culture. As a result, under the conditions of Reference Comparative Example 1, almost no cells showing typical characteristics of RPE cells such as dark brown, polygonal, cobblestone morphology were found ( Fig.21 On the other hand, in all the MEK inhibitors studied (PD0325901, PD184352, U0126, TAK-733, AZD-8330), the appearance of a dark brown cell population could be confirmed over a wide area ( Fig.21 , PD0325901, PD184352, U0126, TAK-733, AZD-8330).

[0312] Reference Example 11: Consideration of FGF receptor inhibitor SU5402 in the first step

[0313] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4:3594", human iPS cells (QHJI01 line and 1231A3 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0314] Preparation of retinal pigment epithelial (RPE) cells including the FGF receptor inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated with a cell scraper, dispersed into single cells by pipetting, and seeded in a 6-well culture plate coated with iMatrix-511 (Nippi) (0.5 μg / cm2) at 2.0×10 per well. 4 The cells were cultured in AK03N medium containing ROCK inhibitor [10 μM Y-27632 (Wako Pure Chemical Industries, Ltd.)] at 37°C and 5% CO2. On the second day of inoculation, PD173074 (SIGMA) (final concentration 100 nM) or SU5402 (SIGMA) (final concentration 5 μM, 10 μM, 20 μM) as FGF receptor inhibitors were added to the AK03N medium (start of the first step), and the cells were exposed to it for 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and inoculated on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 5cells and cultured at 37°C, 5% CO2 (start of the second step). From the first day to the fourth day of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] was used. Technologies)]; for 5-8 days of culture, a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM), and CKI-7 (final concentration 3 μM) was used; for 9-12 days of culture, a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM), and CKI-7 (final concentration 3 μM) was used; for 13-30 days of culture, a basal medium supplemented with only 10% KSR was used; from the 31st day of culture, RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used. The entire amount of medium was replaced every day. Meanwhile, RPE cells were also prepared under the conditions of Reference Comparative Example 2 excluding the FGF receptor inhibitor treatment step (AK03 medium was changed to AK03N medium).

[0315] The culture plates were observed on the 49th day of culture. As a result, under the conditions of Reference Comparative Example 2, almost no cells showing typical characteristics of RPE cells such as dark brown, polygonal, and cobblestone morphology were found ( Fig. 22 On the other hand, in all the investigated FGF receptor inhibitors (PD173074, SU5402), the appearance of a dark brown cell population was confirmed over a wide area ( Fig. 22 , PD173074, SU5402).

[0316] Reference Example 12: In the second step, exposure to Nodal signaling pathway inhibitor and Wnt signaling pathway inhibitor alone Considerations for the Differentiation-Inducing Effect of Preparations

[0317] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (QHJI01 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0318] Preparation of retinal pigment epithelial (RPE) cells including a MEK inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated using a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 4 The cells were cultured in AK03N medium containing ROCK inhibitor [10 μM Y-27632 (Wako Pure Chemical Industries, Ltd3] at 37°C and 5% CO2. On the second day of inoculation, PD0325901 (SIGMA) (final concentration 1 μM) as a MEK inhibitor was added to the AK03 medium (start of the first step), and the cells were exposed thereto for 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and inoculated on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 12-well culture plate, 0.8 × 10 5cells and cultured at 37°C, 5% CO2 (starting from the second step). In the second step, the following three culture media were used. From the first to the 12th day of culture, a basal culture medium [GMEM culture medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100 U / ml penicillin-100 μg / ml streptomycin (Life Technologies)] was used to supplement 10% KSR (Life Technologies), Y-27632 (final concentration 10 μM), SB-431542 (Wako Pure Chemical Industries, Ltd.) as a Nodal signal transduction pathway inhibitor (final concentration 5 μM), and CKI-7 (SIGMA) as a Wnt signal transduction pathway inhibitor (final concentration 3 μM)] ( Fig.23 , NODALi+WNTi), added with 10% KSR, Y-27632 (final concentration 10 μM), SB-431542 (final concentration 5 μM) ( Fig.23 , NODALi) basal medium, or medium supplemented with 10% KSR, Y-27632 (final concentration 10 μM) and CKI-7 (final concentration 3 μM) ( Fig.23 , WNTi). For 13-30 days of culture, a basal medium supplemented with only 10% KSR was used; and from day 31 of culture onwards, an RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9 mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin] was used. The entire amount of the medium was replaced every day.

[0319] The culture plates were observed on the 43rd day of culture. As a result, under the two treatment conditions of Nodal signaling pathway inhibitor and Wnt signaling pathway inhibitor (NODALi+WNTi) and under the single agent treatment condition of Nodal signaling pathway inhibitor (NODALi), it was confirmed that the appearance of cells showing the same level of typical characteristics of RPE cells such as dark brown, polygonal, and cobblestone morphology could be confirmed ( Fig.23 , NODALi+WNTi, NODALi). By treating the Wnt signaling pathway inhibitor (WNTi) with a single agent, the dark brown area in the entire well decreased; however, it was confirmed that a sufficient number of cells exhibited typical characteristics of RPE cells ( Fig.23From the above results, it can be confirmed that the presence of the Nodal signaling pathway inhibitor or the Wnt signaling pathway inhibitor is sufficient in the second step.

[0320] Reference Example 13: The area ratio of black and brown cells in the whole well and the expression of retinal pigment epithelial cell marker genes Relationship

[0321] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (201B7 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03 medium).

[0322] Preparation of retinal pigment epithelial (RPE) cells including MEK inhibitor and BMP receptor inhibitor treatment steps was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 1.2 × 10 4 cells were cultured in AK03 medium containing ROCK inhibitor [10 μM Y-27632 (Wako Pure Chemical Industries, Ltd.)] at 37°C and 5% CO2. When the MEK inhibitor was to be exposed for 6 days and the BMP receptor inhibitor was to be exposed for 1 day, PD0325901 (SIGMA) (final concentration 1 μM) as a MEK inhibitor was added to the AK03 medium on the second day of seeding (start of the first step), and LDN193189 (STEMGENT) (final concentration 100 nM) as a BMP receptor inhibitor was added to the AK03 medium 6 days after seeding, thereby exposing the cells to the MEK inhibitor and the BMP receptor inhibitor for 6 days and 1 day, respectively (completion of the first step). When the MEK inhibitor and the BMP receptor inhibitor were to be exposed for 6 days, PD0325901 (final concentration 1 μM) and LDN193189 (final concentration 100 nM) were added to the AK03 medium on the second day of seeding (start of the first step), and the cells were exposed thereto for 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (0.5 μg / cm 2) in a 6-well culture plate, 2.0 × 10 5 Cells were cultured at 37°C and 5% CO2 (start of the second step). On the first day of culture, AK03 medium was used, to which Y-27632 (final concentration 10 μM), SB-431542 (Wako Pure Chemical Industries, Ltd.3) as a Nodal signal transduction pathway inhibitor (final concentration 5 μM), and CKI-7 (SIGMA) (final concentration 3 μM) were added; for 2-5 days of culture, a basic medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM L-glutamine (SIGMA), 100U / ml penicillin-100μg / ml streptomycin (LifeTechnologies)]; for 6-9 days of culture, use a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), CKI-7 (final concentration 3μM); for 10-13 days of culture, use a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), CKI-7 (final concentration 3μM); for 14 to 30 days of culture, use a basal medium supplemented with only 10% KSR; from the 31st day of culture, use RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin]. The entire amount of the medium was replaced every day. Meanwhile, RPE cells were also prepared under the conditions of Reference Comparative Example 1 without the MEK inhibitor treatment step.

[0323] After observation on the 39th day of culture, cells were collected, RNA was extracted and real-time RT-PCR was performed. RNeasy Mini Kit (QIAGEN) was used for RNA extraction, and QuantiTect Probe RT-PCR Kit (QIAGEN) was used for real-time RT-PCR. Primers and probes for BEST1 (Hs00188249_m1), MITF (Hs01117294_m1), RAX (Hs00429459_m1), and GAPDH (Hs02758991_g1) were purchased from Applied Biosystems. The expression levels of BEST1, MITF, and RAX of each sample were normalized with the expression level of GAPDH and expressed as relative values ​​relative to the expression level of iPS cells (undifferentiated) cultured under conditions of maintaining an undifferentiated state (1).

[0324] Based on the images of the culture plates observed on day 39 of culture and Fig.14 A, The proportion of RPE cells in the whole well was determined by visual observation. As a result, the untreated condition was "1", the MEK inhibitor for 6 days + BMP receptor inhibitor for 1 day was "3", and the MEK inhibitor for 6 days + BMP receptor inhibitor for 6 days was "5" ( Fig.24 , upper side, cell photograph). The expression levels of BEST1, MITF, which are retinal pigment epithelial cell markers, and RAX, which is a marker for the early eye formation stage, were compared between these samples and iPS cell (undifferentiated) samples under continuous culture for maintaining an undifferentiated state by real-time RT-PCR. As a result, a correlation between the area of ​​black-brown cells and the expression levels of the above marker genes was found ( Fig.24 , lower side, chart). According to the above result, it is shown that the melanin cells express the marker genes of retinal pigment epithelial cell marker genes and the early stage of eye formation. In addition, it is also confirmed that the RPE cells are prepared by this preparation method by detecting these gene expression levels.

[0325] Reference Example 14: RPE prepared by a preparation method including a step of treating with a MEK inhibitor or a FGF receptor inhibitor Confirmation of cell marker gene expression

[0326] According to the method described in "Nakagawa, M. et al., Sci. Rep. 2014 Jan 18; 4: 3594", human iPS cells (1231A3 line) were cultured in an undifferentiated state without feeder cells. The culture medium used was AK03N medium (Ajinomoto Co., Inc.) (hereinafter referred to as AK03N medium).

[0327] Preparation of retinal pigment epithelial (RPE) cells including a MEK inhibitor or FGF receptor inhibitor treatment step was performed as follows. iPS cells in culture for maintaining an undifferentiated state were treated with 0.5×TrypLE select (a mixture of equal amounts of TrypLE select (Life Technologies) and 0.5 mM EDTA / PBS (-)), dissociated using a cell scraper, dispersed into single cells by pipetting, and plated on a plate coated with iMatrix-511 (Nippi) (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 4 Cells were cultured in AK03N medium containing ROCK inhibitor [10 μM Y-27632 (Wako PureChemical Industries, Ltd.)] at 37°C and 5% CO2. On the second day of inoculation, PD0325901 (SIGMA) as a MEK inhibitor (final concentration 1 μM) or PD173074 (SIGMA) as an FGF receptor inhibitor (final concentration 100 nM) was added to the AK03N medium (start of the first step), and the cells were exposed thereto for 6 days (completion of the first step). Then, the cells were treated with 0.5×TrypLE select, dissociated with a cell scraper, dispersed into single cells by pipetting, and inoculated on a plate coated with iMatrix-511 (0.5 μg / cm 2 ) in a 6-well culture plate, 2.0 × 10 5cells, and cultured at 37°C, 5% CO2 (starting from the second step). From the first day to the fourth day of culture, a basal medium [GMEM medium (SIGMA), 0.1 mM MEM non-essential amino acid solution (Life Technologies), 1 mM sodium pyruvate (SIGMA), 0.1 mM 2-mercaptoethanol (Wako Pure Chemical Industries, Ltd.), 2 mM β-amino acid (β-amino acid) ... L-glutamine (SIGMA), 100U / ml penicillin-100μg / ml streptomycin (LifeTechnologies)]; for 5-8 days of culture, use a basal medium supplemented with 15% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM) and CKI-7 (final concentration 3μM); for 9-12 days of culture, use a basal medium supplemented with 10% KSR, Y-27632 (final concentration 10μM), SB-431542 (final concentration 5μM), CKI-7 (final concentration 3μM); for 13-30 days of culture, use a basal medium supplemented with only 10% KSR; from the 31st day of culture, use RPE maintenance medium [67% DMEM low glucose (SIGMA), 29% F12 (SIGMA), 1.9% B-27 supplement (Life Technologies), 1.9mM L-glutamine, 96 U / ml penicillin-96 μg / ml streptomycin]. The entire amount of the medium was replaced every day. At the same time, the experiment was also conducted under the conditions of Reference Comparative Example 1 without the MEK inhibitor treatment step (AK03 medium was changed to AK03N medium).

[0328] After observation on the 43rd day of culture, cells were collected, RNA was extracted and RT-PCR was performed. RNeasy Micro Kit (QIAGEN) was used for RNA extraction, Oligo(dT) 12-18Primer (Invitrogen) and SuperScript III reverse transcriptase (Invitrogen) were used for reverse transcription reaction, and Blend Taq-Plus- (TOYOBO) was used for PCR. The primer sequences of RPE65, BEST1, CRLBP, and GAPDH are as follows. RPE65-F: TCCCCAATACAACTGCCACT (SEQ ID NO: 1); RPE65-R: CCTTGGCATTCAGAATCAGG (SEQ ID NO: 2); BEST1-F: TAGAACCATCAGCGCCGTC (SEQ ID NO: 3); BEST1-R: TGAGTGTAGTGTGTATGTTGG (SEQ ID NO: 4); CRALBP-F: GAGGGTGCAAGAGAAGGACA (SEQ ID NO: 5); CRALBP-R: TGCAGAAGCCATTGATTTGA (SEQ ID NO: 6); GAPDH-F: ACCACAGTCCATGCCATCAC (SEQ ID NO: 7); GAPDH-R: TCCACCACCCTGTTGCTGTA (SEQ ID NO: 8). For RPE65, BEST1, GAPDH, the number of PCR reactions was 30 cycles, and for CRALPP, the number of PCR reactions was 35 cycles. By agarose gel electrophoresis, single bands of PCR products were detected near 369bp for RPE65, near 261bp for BEST1, near 341bp for CRALBP and near 452bp for GAPDH. As a positive control, primary human RPE (hRPE) was used, and as a negative control, iPS cells (undifferentiated iPSC) cultured under conditions maintaining an undifferentiated state were used.

[0329] The culture plates were observed on the 43rd day of culture. As a result, under the conditions of Comparative Example 1, only a few cells could be confirmed to show typical characteristics of RPE cells, such as dark brown, polygonal, cobblestone-like morphology ( Fig.25 , right, cell photograph, untreated). On the other hand, when exposed to MEK inhibitor and FGF receptor inhibitor, the appearance of dark brown cell population can be confirmed over a wide area ( Fig.25 , right side, cell photos, MEKi, FGFRi). As a result of RT-PCR, under the conditions of Reference Comparative Example 1, the bands of retinal pigment epithelial cell markers RPE65, BEST1, and CRALPP were very thin ( Fig.25 , left, electropherogram, untreated). On the other hand, clear bands could be confirmed in samples exposed to MEK inhibitor and FGF receptor inhibitor ( Fig.25 , left, electrophoresis diagram, MEKi, FGFRi). From the above results, the efficient preparation of RPE cells by the preparation method including the MEK inhibitor and FGF receptor inhibitor treatment steps was also confirmed by detecting the expression levels of these genes.

[0330] Industrial Applicability

[0331] The preparation method of the present invention can efficiently and conveniently prepare retinal pigment epithelial cells from pluripotent stem cells.

[0332] (Description of related application)

[0333] This application is based on patent application No. 2017-44431 filed in Japan (filing date: March 8, 2017), the contents of which are incorporated herein in their entirety by reference.

Claims

1. A method for preparing retinal pigment epithelial cells, comprising the following steps: (1) a first step of culturing pluripotent stem cells in a medium containing at least one selected from the group consisting of an FGF receptor inhibitor and a MEK inhibitor for a period of no longer than 30 days; wherein the culturing period in the first step is a period sufficient to induce gene expression of at least one of PAX6, LHX2 and SIX3, and (2) a second step of culturing the cells obtained in the first step in a medium containing at least one selected from the group consisting of a Rho signaling pathway inhibitor and a cell apoptosis inhibitor to form retinal pigment epithelial cells; Wherein, the FGF receptor inhibitor is an FGFR1 inhibitor; the MEK inhibitor is a MEK1 and / or MEK2 inhibitor; the Rho signal transduction pathway inhibitor is a Rho-associated protein kinase (ROCK) inhibitor; and the cell apoptosis inhibitor is a caspase inhibitor.

2. The method according to claim 1, wherein the first step is performed under serum-free conditions.

3. The method according to claim 1 or 2, wherein the first step is performed in the absence of feeder cells.

4. The preparation method according to claim 1 or 2, wherein the culture medium in the first step further contains a factor for maintaining an undifferentiated state. The preparation method according to claim 4 , wherein the factor for maintaining the undifferentiated state is an FGF signal transduction pathway agonist. The method of claim 5 , wherein the FGF signaling pathway agonist is bFGF.

7. The method according to claim 1 or 2, wherein the FGF receptor inhibitor is at least one selected from the group consisting of PD173074 and SU5402.

8. The method according to claim 1 or 2, wherein the MEK inhibitor is at least one selected from the group consisting of PD0325901, PD184352, U0126, TAK-733 and AZD-8330.

9. The method according to claim 1 or 2, wherein the culture medium in the second step does not contain an exogenous Nodal signal transduction pathway inhibitor or an exogenous Wnt signal transduction pathway inhibitor.

10. The method according to claim 1 or 2, wherein the culture medium in the second step does not contain exogenous substances that affect differentiation induction of pluripotent stem cells other than Rho signal transduction pathway inhibitors and apoptosis inhibitors.

11. The method according to claim 1 or 2, wherein the culture medium in the second step does not contain exogenous substances that affect the differentiation induction of pluripotent stem cells into ectoderm cells except for Rho signal transduction pathway inhibitors and apoptosis inhibitors. 12 . The method according to claim 1 , wherein the Rho-associated protein kinase (ROCK) inhibitor is at least one selected from the group consisting of Y27632 and fasudil.

13. The method of claim 1, wherein the caspase inhibitor is Z-VAD-FMK. The preparation method according to claim 1 or 2, wherein the pluripotent stem cells are primate pluripotent stem cells.

15. The preparation method according to claim 1 or 2, wherein the pluripotent stem cells are human pluripotent stem cells.

16. The method according to claim 1 or 2, wherein the culture period in the first step is 2 days to 13 days.

17. The method according to claim 1 or 2, wherein the culture period in the first step is 4 to 6 days.

Images