Radiation tolerant phenol red reagent and use thereof

Abstract

The present application relates to a kind of radiation-tolerant phenol red reagent and its application, belong to the technical field of protective agent improvement.It is added in phenol red indicator or the reagent containing phenol red, and it can be mixed after being fully mixed.The present application adds protective agent in the solution containing phenol red, can make phenol red resist gamma ray or electron beam irradiation, can change the way that the sterile reagent containing phenol red needs to filter sterilization or high-pressure sterilization, can be directly irradiated to the reagent configured, need not to treat the solution bottle of reagent, also need not subsequent processing, can improve the production efficiency of the solution containing phenol red, reduce production difficulty, reduce production cost, reduce the probability of contamination in production link, can improve one-time qualified rate.

Description

Technical Field

[0001] This invention relates to an irradiation-resistant phenol red reagent and its application, belonging to the field of protective agent improvement technology. Background Technology

[0002] Phenol red indicator is a 0.02%–0.05% alcoholic solution prepared from phenol red (Phenolsulfonphthalein). When the pH of the test solution is less than 6.8, the indicator shows a yellow acidic reaction; if the pH of the test solution is greater than 8.4, the indicator shows a red alkaline reaction.

[0003] Phenol red is a commonly used indicator in the preparation of culture media (Hanks equilibration solution, IMDM 1640 medium, MEM) and chemical reagents. However, phenol red solutions are sensitive to gamma rays or electron beams. If the prepared reagents containing phenol red need to be sterile, they mostly need to be sterilized by aseptic filtration or autoclaving. However, these two sterile methods require a lot of manpower and financial resources and are not convenient for large-scale production.

[0004] Irradiation offers advantages such as rapid sterilization, thoroughness, and simple production processes, and has been widely used in food, medical devices, and other fields. However, phenol red indicator itself cannot withstand irradiation. Therefore, there is an urgent need to provide a modified phenol red indicator that can withstand irradiation. Summary of the Invention

[0005] The purpose of this invention is to overcome the above-mentioned shortcomings and provide an irradiation-resistant phenol red reagent and its application, which allows phenol red to withstand gamma ray or electron beam irradiation and can improve production efficiency.

[0006] The technical solution of the present invention is an irradiation-resistant phenol red reagent, which is obtained by adding a phenol red protective agent to a phenol red indicator and mixing thoroughly.

[0007] The phenol red protective agent is specifically one or more of cysteine, cystamine, cystamine, aminoethyl isothiourea, aminopropylaminoethyl thiophosphate monosodium salt, and ascorbic acid.

[0008] The irradiation-resistant phenol red reagent as described in claim 1, wherein the amount of phenol red protective agent added is specifically 0.01% to 5%.

[0009] The application of phenol red reagent, which is resistant to radiation, allows the mixed reagent to undergo irradiation treatment.

[0010] The irradiation specifically refers to gamma ray or electron beam irradiation, with a dose of 0.1-30 kGy.

[0011] The beneficial effects of this invention are as follows: By adding a protective agent to a solution containing phenol red, this invention enables phenol red to withstand irradiation by gamma rays or electron beams. This changes the requirement for filtration or autoclaving of sterile reagents containing phenol red, allowing the prepared reagents to be directly irradiated without the need for treatment of the solution bottles or subsequent processing. This improves the production efficiency of phenol red-containing solutions, reduces production difficulty and costs, lowers the probability of contamination during production, and increases the first-pass yield. Detailed Implementation

[0012] Example 1: Hanks Equilibrium Solution (containing phenol red)

[0013] When cysteine, a protective agent, is added to the Hanks equilibrium solution at a concentration of 0.1%, the Hanks equilibrium solution (containing phenol red) remains red after irradiation. The Hanks equilibrium solution without the protective agent becomes colorless.

[0014] Cytotoxicity assay

[0015] The cytotoxicity was demonstrated using the HeLa cell line and CCK-8 solution. The specific experimental results are shown in Table 1 below. The results show that the irradiated Hanks equilibrium solution (containing phenol red) did not have obvious cytotoxicity.

[0016] Table 1

[0017]

[0018] Storage capability verification:

[0019] Respiratory-associated viruses, including parainfluenza virus and influenza A virus H1N1, were used to verify preservation capabilities. Primer sequences are shown in Table 2, and amplification systems are shown in Table 3. Amplification conditions were 63℃ for 1 min, 60 cycles, and FAM fluorescence was collected.

[0020] Table 2

[0021] pH1N1-HA-100-F3 ACATCCGATCACAATTGGAA pH1N1-HA-100-B3 CCTACTGCTGTGAACTGTG pH1N1-HA-100-FIP CCTTCAATGAAACCGGCAATGGCCACAGGATTGAGGAATGTC pH1N1-HA-100-BIP ATCAAAATGAGCAGGGGTCAGGTCTCGTCAATGGCATTCTG pH1N1-HA-100-LF GGCCTCTAGATTGAATAGACGG pH1N1-HA-100-LB ATATGCAGCCGACCTGAAG HPIV-2-N-2-F3 GCTTCAACTTTCACAATCAAGA HPIV-2-N-2-B3 CTAGACTCTGATAATGTAGCATG HPIV-2-N-2-FIP CCATTCCRCTGTGTTCAATGTATTAGCAAACCGCTAYTATGC HPIV-2-N-2-BIP ATATGGACTTGGAACAAGATGGCCAGAGCTTTTAATTTCTGGAGTTC HPIV-2-N-2-LF TTGCCAATGTCTCCYACCA HPIV-2-N-2-LB GCTCTTGCAGCATTYTCWGGK

[0022] Table 3

[0023] Component Volume (μL) Mix 10 <![CDATA[Primer ε > 1 Template 5 Bst enzyme 1 AMV 0.05 <![CDATA[H2O]]> 7.95

[0024] The results are shown in Table 4 below. The experimental results indicate that the irradiated Hanks equilibrium solution (containing phenol red) has good preservation ability.

[0025] Table 4

[0026] Preservative solution Parainfluenza virus Influenza A virus H1N1 0h 13.90 14.85 24h 14.89 16.43 48h 14.46 15.93

[0027] Example 2 Virus delivery culture medium (containing phenol red)

[0028] When the protective agent cystamine was added to the virus transport medium at a concentration of 0.2%, the virus transport medium remained red after irradiation. The equilibrated virus transport medium without the protective agent became colorless.

[0029] Cytotoxicity assay

[0030] The cytotoxicity was demonstrated using the HeLa cell line and CCK-8 solution. The specific experimental results are shown in Table 5 below. The results show that the irradiated virus delivery medium (containing phenol red) did not have obvious cytotoxicity.

[0031] Table 5

[0032]

[0033] Storage capability verification:

[0034] Respiratory-associated viruses, including parainfluenza virus and influenza A virus H1N1, were used to verify preservation capabilities. Primer sequences are shown in Table 6, and amplification systems are shown in Table 7. Amplification conditions were 63℃ for 1 min, 60 cycles, and FAM fluorescence was collected.

[0035] Table 6

[0036] pH1N1-HA-100-F3 ACATCCGATCACAATTGGAA pH1N1-HA-100-B3 CCTACTGCTGTGAACTGTG pH1N1-HA-100-FIP CCTTCAATGAAACCGGCAATGGCCACAGGATTGAGGAATGTC pH1N1-HA-100-BIP ATCAAAATGAGCAGGGGTCAGGTCTCGTCAATGGCATTCTG pH1N1-HA-100-LF GGCCTCTAGATTGAATAGACGG pH1N1-HA-100-LB ATATGCAGCCGACCTGAAG HPIV-2-N-2-F3 GCTTCAACTTTCACAATCAAGA HPIV-2-N-2-B3 CTAGACTCTGATAATGTAGCATG HPIV-2-N-2-FIP CCATTCCRCTGTGTTCAATGTATTAGCAAACCGCTAYTATGC HPIV-2-N-2-BIP ATATGGACTTGGAACAAGATGGCCAGAGCTTTTAATTTCTGGAGTTC HPIV-2-N-2-LF TTGCCAATGTCTCCYACCA HPIV-2-N-2-LB GCTCTTGCAGCATTYTCWGGK

[0037] Table 7

[0038] Components Volume (μL) Mix 10 <![CDATA[Primer ε > 1 template 5 Bst enzyme 1 AMV 0.05 <![CDATA[H2O]]> 7.95

[0039] The results are shown in Table 8 below. The experimental results show that the irradiated Hanks equilibrium solution (containing phenol red) has good preservation ability.

[0040] Table 8

[0041] Preservative Parainfluenza virus Influenza A virus H1N1 0h 12.42 15.43 24h 12.90 14.97 48h 12.64 14.78

[0042] A phenol red protectant was added to the original reagent to achieve the property that the phenol red retains its original color after irradiation sterilization.

Claims

1. A radiation-resistant phenol red reagent, characterized in that: in The phenol red indicator or reagent containing phenol red is prepared by adding a phenol red protective agent and mixing thoroughly. The phenol red protective agent is specifically one or more of cysteine, cystamine, cystamine, aminoethyl isothiourea, aminopropylaminoethyl thiophosphate monosodium salt, and ascorbic acid. The amount of the phenol red protective agent added is specifically 0.01% to 0.2%. The phenol red reagent can withstand irradiation by gamma rays or electron beams at a dose of 0.1-30 kGy.

2. The application of the radiation-resistant phenol red reagent according to claim 1, characterized in that: The mixed reagent can be subjected to irradiation treatment, specifically gamma ray or electron beam irradiation, with a dose of 0.1-30 kGy.

Images