A hemorrhagic fever host animal murine hantavirus IgG antibody detection kit and detection method
By using enzyme-linked immunosorbent assay (ELISA) with recombinant hantavirus nucleoprotein and enzyme-labeled antibodies, sensitive, specific and accurate detection of murine hantavirus IgG antibodies has been achieved. This solves the problems of complex operation, high cost and long time consumption in the existing technology, and has the ability to perform qualitative and quantitative analysis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- XIAN HUAYUAN HENGJIAN BIOTECHNOLOGY CO LTD
- Filing Date
- 2026-03-10
- Publication Date
- 2026-06-12
AI Technical Summary
Existing technologies for detecting Hantavirus infection in rodent hosts are complex, costly, time-consuming, and difficult to perform quantitative analysis, thus failing to meet the needs of large-scale screening.
The enzyme-linked immunosorbent assay (ELISA) method was used to detect Hantavirus IgG antibodies in rodent serum, plasma and tissues by using a recombinant Hantavirus nucleoprotein-coated ELISA plate and combining it with horseradish peroxidase-labeled goat anti-mouse IgG antibody.
It achieves sensitive, specific, and accurate detection of Hantavirus IgG antibodies, is simple to operate, low in cost, suitable for large-scale screening, and has qualitative and quantitative analysis capabilities.
Smart Images

Figure CN122193570A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection technology, specifically relating to a detection kit and method for Hantavirus IgG antibody in rodents, hosts of hemorrhagic fever. Background Technology
[0002] Hantavirus belongs to the genus Hantavirus in the family Bunyaviridae. It is the pathogen that causes hemorrhagic fever with renal syndrome or epidemic hemorrhagic fever and Hantavirus pulmonary syndrome. Rodents are its natural host and main source of infection. Humans are infected with Hantavirus by inhaling or coming into contact with rodent secretions or excrement.
[0003] In recent years, the incidence of hemorrhagic fever in existing endemic areas has increased significantly, and new endemic areas are constantly emerging. High-risk exposure groups within these endemic areas are mainly young and middle-aged people in rural areas, people working in forests, and people who travel to or reside in forests. Hantavirus not only endangers public health and safety but also has a serious impact on socio-economic development, becoming a significant public health issue. Rodents are its natural host and main source of infection, capable of carrying and being infected with Hantavirus. Infected rodents produce specific IgG antibodies against Hantavirus, and these antibodies persist for a long time or even lifelong. Early infection in rodents results in high IgG antibody concentrations, which gradually decrease or remain at a certain level as the infection progresses. Qualitative and quantitative detection of specific IgG antibodies can be used to investigate past Hantavirus infection history in rodents or to analyze infection markers. Combined with rodent virus carriage information, this can provide an epidemiological risk basis for early warning of human hemorrhagic fever infection. Therefore, conducting rodent-borne epidemiology and pathogen surveillance for hemorrhagic fever with renal syndrome (HFRS) is particularly important. Timely understanding of the dynamics and epidemic patterns of hemorrhagic fever, and monitoring the infection status and pathogen distribution in rodent hosts, are crucial for the prevention and control of hemorrhagic fever.
[0004] Currently, the main technologies used for detecting and monitoring hantavirus infection in rodent hosts include nucleic acid detection in rodent tissues, virus isolation, immunofluorescence detection of hantavirus antigens in rodent lung tissues, and antibody detection using immunofluorescence on cell antigen slides. Among these, nucleic acid detection is cumbersome and complex, easily affected by factors such as sample quality, reagents, and instruments, and is time-consuming and costly. Virus isolation has a long cycle, complex procedures, and requires aseptic operation and biosafety laboratory conditions. Immunofluorescence technology is complex, requires a fluorescence microscope, relies on subjective judgment, and cannot achieve quantitative analysis. Enzyme-linked immunosorbent assay (ELISA) can not only qualitatively detect the presence of target substances in rodent samples but also quantitatively analyze the concentration of target substances using a standard curve method. ELISA is a simple and mature technology, does not require complex equipment, is easy to learn and operate, has high sensitivity and specificity, and is suitable for large-scale screening.
[0005] Therefore, a sensitive, specific, accurate, convenient, low-cost detection method and kit for hemorrhagic fever host animal rodent hantavirus IgG antibodies provides technical support and kit application guarantee for the detection and monitoring of hemorrhagic fever hantavirus rodent IgG antibodies. Summary of the Invention
[0006] To address the aforementioned problems, the present invention aims to provide a detection method and kit for hantavirus IgG antibodies in rodents, a host animal of hemorrhagic fever, that is highly sensitive and specific, accurate, easy to operate, and capable of both qualitative and quantitative analysis.
[0007] To achieve the above objectives, the present invention provides the following technical solution: a detection kit for hemorrhagic fever host animal murine hantavirus IgG antibody, comprising an enzyme-labeled plate, an enzyme-labeled conjugate, a sample diluent, a murine antibody negative control, murine anti-hantavirus IgG standard, chromogenic solution A, chromogenic solution B, a stop solution, and a concentrated washing solution; The wells of the enzyme-labeled plate are coated with recombinant Hantavirus nucleoprotein. The enzyme-labeled conjugate is horseradish peroxidase-labeled goat anti-mouse IgG antibody; The sample diluent was a phosphate buffer containing 10% fetal bovine serum and 0.1% Tween-20; The mouse antibody negative control was hantavirus nucleoprotein antibody-negative mouse serum; The mouse anti-hantavirus IgG standard is a mouse-derived anti-hantavirus nucleoprotein IgG monoclonal antibody. The colorimetric solution A is a citrate buffer containing hydrourea peroxide; The colorimetric solution B is a citrate buffer containing 3,3',5,5'-tetramethylbenzidine; The terminating solution is a 2 mol / L sulfuric acid solution; The concentrated washing solution is a phosphate buffer containing 0.5% Tween-20.
[0008] Furthermore: the recombinant Hantavirus nucleoprotein was prepared using genetic engineering and recombinant protein expression and purification techniques. Specifically, the preparation method is as follows: Using the Hantavirus S sequence gene (nucleoprotein genome sequence) as a template, codon optimization was performed using an E. coli expression host system to synthesize the codon-optimized gene sequence. After ligation with the linear pET-28(+) vector, the sequence was transformed into E. coli to construct a fusion expression vector. After plasmid extraction and sequencing identification of the plasmid insertion sequence, the recombinant fusion protein with a histidine tag was induced to express using IPTG. The expression product was purified by nickel column affinity chromatography to obtain recombinant Hantavirus nucleoprotein. The recombinant Hantavirus nucleoprotein expression gene sequence is shown in SEQ ID NO.1, and the recombinant Hantavirus nucleoprotein expression amino acid sequence is shown in SEQ ID NO.2.
[0009] Furthermore: the method for preparing recombinant Hantavirus nucleoprotein coated in the wells of the ELISA plate includes the following steps: 1) Coating: The recombinant Hantavirus nucleoprotein was diluted to 0.5 µg / mL with carbonate buffer (pH 9.6) and added to the wells of the ELISA plate at a rate of 100 µL / well. The plate was then incubated at 4–8 °C for 24 h. 2) Blocking: Discard the coating solution, add 200µL of blocking solution to each well of the microplate, and block at 4~8℃ for 24h. 3) Dry and seal for storage: Discard the blocking solution, place the ELISA plate containing the blocking solution from step 2) in a 37°C drying oven for 8 hours, remove the ELISA plate, put it into an aluminum foil bag, and seal it quickly for storage.
[0010] Furthermore: the blocking solution is a phosphate buffer containing 1% bovine serum albumin component V.
[0011] Furthermore: the murine anti-hantavirus nucleoprotein IgG monoclonal antibody was prepared by routinely immunizing BALB / c mice with recombinant hantavirus nucleoprotein as the antigen, and then grinding the spleen of the immunized BALB / c mice and preparing the anti-hantavirus nucleoprotein IgG monoclonal antibody using hybridoma fusion technology.
[0012] A detection method for a hantavirus IgG antibody detection kit for rodents, a host animal of hemorrhagic fever, includes the following steps: S1. Sample addition: Take the ELISA strip coated with recombinant Hantavirus nucleoprotein, add 100 µL of sample diluent to each well, add 2 µL of serum or plasma to the wells of the sample to be tested, and if the sample is mouse tissue extract, do not add sample diluent, but add 100 µL of mouse tissue extract directly to each well. Add 2 µL of mouse antibody negative control and 2 µL of mouse anti-Hantavirus IgG standard to the wells of the mouse antibody negative control and mouse anti-Hantavirus IgG standard, respectively. Gently shake to mix, attach the sealing film, and incubate at 37°C for 30 minutes. S2. Add enzyme-labeled conjugate: Discard the solution in the wells of the enzyme-labeled plate, wash the plate 6 times with washing buffer, pat dry, add 100µL of enzyme-labeled conjugate to each well, attach the sealing film, and incubate at 37℃ for 30 minutes. S3. Color development: Discard the solution in the wells of the microplate, wash the microplate 6 times with washing buffer, pat dry, add 50 µL of color development solution A and 50 µL of color development solution B to each well, incubate at 37℃ for 10 minutes, and add 50 µL of stop solution to each well. S4. Absorbance measurement: Set the detection wavelength to 450nm on the microplate reader and measure the absorbance value OD450 of each well at 450nm wavelength. S5. Result determination: The validity of the test is verified based on the absorbance value measured in step S4. The test is valid when the absorbance value of the mouse antibody negative control is <0.15 and the absorbance value of the mouse anti-Hantavirus IgG standard is >1.0. The test is considered negative when the absorbance value of the sample to be tested is <0.15 and positive when the absorbance value of the sample to be tested is ≥0.15.
[0013] The washing solution is a working washing solution obtained by diluting the concentrated washing solution with distilled water at a ratio of 1:20.
[0014] A detection method for a hantavirus IgG antibody detection kit for rodents, a host animal of hemorrhagic fever, also includes a quantitative detection method, the specific steps of which are as follows: S1. The mouse anti-hantavirus IgG standard was serially diluted with sample diluent to prepare working solutions of 200 ng / mL, 100 ng / mL, 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, and 1.5625 ng / mL. S2. Sample addition: Take the ELISA strip coated with recombinant Hantavirus nucleoprotein, add 100µL of sample diluent to each well, add 2µL of serum or plasma to the wells designated for testing, if the sample is mouse tissue extract, do not add sample diluent, but add 100µL of mouse tissue extract directly to each well, add 2µL of mouse antibody negative control to the wells designated for mouse antibody negative control, and add 100µL of working solution of mouse anti-Hantavirus IgG standard in the following order to the wells designated for mouse anti-Hantavirus IgG standard: 0 ng / mL (sample diluent), 1.5625 ng / mL, 3.125 ng / mL, 6.25 ng / mL, 12.5 ng / mL, 25 ng / mL, 50 ng / mL, 100 ng / mL, and 200 ng / mL, respectively. Gently shake to mix, seal with the film, and incubate at 37°C for 30 minutes. S3. Add enzyme-labeled conjugate: Discard the solution in the wells of the enzyme-labeled plate, wash the plate 6 times with washing buffer, pat dry, add 100µL of enzyme-labeled conjugate to each well, attach the sealing film, and incubate at 37℃ for 30 minutes. S4. Color development: Discard the solution in the wells of the microplate, wash the microplate 6 times with washing buffer, pat dry, add 50µL of color development solution A and 50µL of color development solution B to each well, incubate at 37℃ for 10 minutes, and add 50µL of stop solution to each well. S5. Absorbance measurement: Set the detection wavelength to 450nm on the microplate reader and measure the absorbance value OD450 of each well at 450nm wavelength. S6. Result determination: Based on the absorbance values of the serially diluted mouse anti-hantavirus IgG standard working solutions and the protein concentration of the mouse anti-hantavirus IgG standard working solutions determined in step S5, a four-parameter fitting standard curve is used, and the concentration of mouse anti-hantavirus IgG antibody in the mouse serum, plasma, and mouse tissue extract samples is calculated in combination with the standard curve.
[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention discloses a detection method for a detection kit for hantavirus IgG antibodies in rodents, a host animal of hemorrhagic fever. The kit comprises an ELISA plate, an ELISA conjugate, a sample diluent, a mouse antibody negative control, a rodent anti-hantavirus IgG standard, chromogenic solution A, chromogenic solution B, a stop solution, and a concentrated washing buffer. The wells of the ELISA plate are coated with recombinant hantavirus nucleoprotein, and the ELISA conjugate is horseradish peroxidase-labeled goat anti-mouse IgG antibody. This invention utilizes an enzyme-linked immunosorbent assay (ELISA) to qualitatively detect IgG antibodies in rodent serum, plasma, and rodent tissue extracts, as well as to quantitatively detect these antibodies. The kit and detection method of this invention exhibit high sensitivity and specificity, strong repeatability and stability, simple operation, and low detection cost, making them suitable for widespread application. Attached Figure Description
[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only for more clearly illustrating the technical solutions in the embodiments of the present invention or the prior art. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0017] Figure 1 This is a schematic diagram illustrating the SDS-PAGE results analysis of affinity chromatography protein purification and distribution after expression of recombinant Hantavirus nucleoprotein in this invention. Figure 2 Western blot analysis of the 4D8 mouse-derived anti-recombinant hantavirus nucleoprotein IgG monoclonal antibody of this invention; Figure 3 This is a schematic diagram of the four-parameter fitting standard curve and equation for the quantitative detection method of Hantavirus IgG antibody in murine hemorrhagic fever host animals of the present invention; Figure 4 This is a schematic diagram of the linear regression standard curve and equation for the quantitative detection method of Hantavirus IgG antibody in rodents, the host animal of hemorrhagic fever, according to the present invention. Detailed Implementation
[0018] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below with reference to specific embodiments. However, the embodiments are only for illustration and are not intended to limit the present invention.
[0019] Example 1: A detection kit for hemorrhagic fever host animal murine hantavirus IgG antibody, comprising an enzyme-labeled plate, enzyme-labeled conjugate, sample diluent, murine antibody negative control, murine anti-hantavirus IgG standard, chromogenic solution A, chromogenic solution B, stop solution and concentrated washing solution; The wells of the enzyme-labeled plate are coated with recombinant Hantavirus nucleoprotein. The enzyme-labeled conjugate is horseradish peroxidase-labeled goat anti-mouse IgG antibody; The sample diluent was a phosphate buffer containing 10% fetal bovine serum and 0.1% Tween-20; The mouse antibody negative control was hantavirus nucleoprotein antibody-negative mouse serum; The mouse anti-hantavirus IgG standard is a mouse-derived anti-hantavirus nucleoprotein IgG monoclonal antibody. The colorimetric solution A is a citrate buffer containing hydrourea peroxide; The colorimetric solution B is a citrate buffer containing 3,3',5,5'-tetramethylbenzidine; The terminating solution is a 2 mol / L sulfuric acid solution; The concentrated washing solution is a phosphate buffer containing 0.5% Tween-20.
[0020] The method for preparing the recombinant Hantavirus nucleoprotein is as follows: Using the Hantavirus S sequence gene (nucleoprotein genome sequence) as a template, codon optimization was performed using *E. coli* as the expression host. The codon-optimized gene sequence was synthesized and ligated into a linear pET-28(+) vector. The ligation product was transformed into *E. coli* DH5α competent cells. After *E. coli* DH5α cells were cultured and proliferated on a shaker, bacterial cells were collected, and the plasmid pET-28(+) / NP was extracted. After confirmation by plasmid sequencing, the pET-28(+) / NP plasmid was transformed into *E. coli* BL21(DE3) competent cells. *E. coli* BL21(DE3) cells were cultured on a shaker, and IPTG was used to induce the formation of *E. coli* cells containing the recombinant plasmid. BL21(DE3) cells were used for protein expression. The bacterial cells were collected, and the cells were sonicated to release the recombinant protein. The supernatant was collected by centrifugation, and the recombinant Hantavirus nucleoprotein with the His tag was purified using a protein chromatography purification system equipped with a Ni-NTA affinity chromatography column. The purified recombinant Hantavirus nucleoprotein was identified by SDS-PAGE electrophoresis, and the recombinant Hantavirus nucleoprotein was finally obtained.
[0021] The preferred Hantavirus nucleoprotein DNA sequence is 1290 bp, containing 429 amino acids. The recombinant Hantavirus nucleoprotein of this invention is the full-length open reading frame of the Hantavirus S gene. The purified recombinant Hantavirus nucleoprotein exhibits good sensitivity and specificity. The recombinant Hantavirus nucleoprotein expression gene sequence is shown in SEQ ID NO.1, and the amino acid sequence of the recombinant Hantavirus nucleoprotein is shown in SEQ ID NO.2.
[0022] As a further improvement of the present invention, the recombinant Hantavirus nucleoprotein has a molecular weight of 55 kDa and a purity of ≥95%. The recombinant Hantavirus nucleoprotein was identified by SDS-PAGE gel electrophoresis, and the results are as follows: Figure 1 As shown, SDS-PAGE electrophoresis identified a clear protein band at a molecular weight of 55 kDa in the purified recombinant hantavirus nucleoprotein.
[0023] SEQ ID NO.1 1 ATGGCAACTA TGGAAGAACT GCAACGCGAA ATCAACGCTC ACGAAGGTCA GCTGGTCATTGCACGTCAGA 71 AAGTGCGTGA CGCCGAAAAG CAGTACGAAA AAGACCCGGA CGAGCTGAAC AAACGCACGCTGACTGATCG 141 TGAGGGCGTT GCTGCCTCTA TCCAGGCCAA GATCGACGAG CTGAAACGTC AACTGGCGGATCGCATCGCG 211 ACCGGTAAAA ATCTGGGTAA AGAACAGGAT CCGACTGGTG TCGAGCCGGG CGATCACCTGAAAGAACGTT 281 CTATGCTGTC CTACGGTAAC GTGCTGGATC TGAACCACCT GGACATTGAC GAGCCGACTGGTCAAACCGC 351 AGATTGGCTG AGCATCGTTA TCTATCTGAC CTCCTTCGTT GTGCCAATCC TGCTGAAGGCCCTGTACATG 421 CTGACTACTC GTGGTCGTCA GACCACCAAG GATAACAAAG GTACGCGTAT CCGTTTCAAAGACGACTCTT 491 CTTTCGAGGA TGTTAACGGT ATCCGTAAGC CGAAGCACCT GTACGTGTCT CTGCCGAACGCCCAGTCCTC 561 CATGAAGGCT GAAGAAATCA CGCCGGGTCG CTACCGCACT GCTATCTGCG GTCTGTATCCAGCTCAGATC 631 AAAGCACGCC AAATGATCTC CCCGGTCATG TCCGTGATCG GCTTCCTGGC CCTGGCTAAGGACTGGTCTG 701 ACCGTATTGA ACAGTGGCTG TCTGAACCGGT GTAAGCTGCT GCCGGATACC GCAGCCGTTTCCCTGCACGG 771 TGGTCCGGCG ACTAACCGCG ACTACCTGCG TCAGCGTCAA GTTGCTCTGG GCAACATGGAAACTAAAGAG 841 TCCAAAGCAA TTCGCCAGCA CGCGGAATCC GCGGGTTGTA GCATGATCGA AGACATCGAATCCCCGTCCA 911 GCATCTGGGT ATTCGCCGGC GCACCGAATC GCTGTCCACC GACTTGCCTG TTCATTGCGGGCATCGCCGA 981 ACTGGGTGCG TTTTTCAGCA TCCTGCAGGA CATGCGTAAC ACCATTATGG CTTCTAAAACTGTGGGTACG 1051 TCTGAGGAGA AACTGCGCAA GAAAAGCTCC TTCTATCAGT CCTACCTGCGTCGTACTCAG TCTATGGGCA 1121 TTCAGCTGGA TCAACGCATC ATCGTACTGT TTATGGTAGC CTGGGGCAAAGAAGCTGTTG ATAACTTCCA 1191 TCTGGGTGAC GACATGGATC CTGAGCTGCG TACCCTGGCT CAGTCCCTGATCGATGTGAA AGTGAAAGAG 1261 ATCTCCAACC AGGAACCGCT GAAGCTGTAA SEQ ID NO.2 1 MATMEELQRE INAHEGQLVI 21 ARQKVRDAEK QYEKDPDELN 41 KRTLTDREGV AASIQAKIDE 61 LKRQLADRIA TGKNLGKEQD 81 PTGVEPGDHL KERSMLSYGN 101 VLDLNHLDID EPTGQTADWL 121 SIVIYLTSFV VPILLKALYM 141 LTTRGRQTTK DNKGTRIRFK 161 DDSSFEDVNG IRKPKHLYVS 181 LPNAQSSMKA EEITPGRYRT 201 AICGLYPAQI KARQMISPVM 221 SVIGFLALAK DWSDRIEQWL 241 SEPCKLLPDT AAVSLHGGPA 261 TNRDYLRQRQ VALGNMETKE 281 SKAIRQHAES AGCSMIEDIE 301 SPSSIWVFAG APNRCPPTCL 321 FIAGIAELGA FFSILQDMRN 341 TIMASKTVGT SEEKLRKKSS 361 FYQSYLRRTQ SMGIQLDQRI 381 IVLFMVAWGK EAVDNFHLGD 401 DMDPELRTLA QSLIDVKVKE 421 ISNQEPLKL* The method for preparing recombinant hantavirus nucleoprotein coated in the wells of the enzyme-labeled plate includes the following steps: 1) Coating: The recombinant Hantavirus nucleoprotein was diluted to 0.5 µg / mL with carbonate buffer (pH 9.6) and added to the wells of the ELISA plate at a rate of 100 µL / well. The plate was then incubated at 4–8 °C for 24 h. 2) Blocking: Discard the coating solution, add 200µL of blocking solution to each well of the microplate, and block at 4~8℃ for 24h. 3) Dry and seal for storage: Discard the blocking solution, place the ELISA plate containing the blocking solution from step 2) in a 37°C drying oven for 8 hours, remove the ELISA plate, put it into an aluminum foil bag, and seal it quickly for storage.
[0024] Preferably, the blocking solution is a phosphate buffer containing 1% bovine serum albumin component V.
[0025] The method for preparing the murine anti-hantavirus nucleoprotein IgG monoclonal antibody includes the following: Purified recombinant hantavirus nucleoprotein was mixed with complete Freund's adjuvant and emulsified completely, then administered subcutaneously to BALB / c mice (female, 8 weeks old, weighing 18–20 g). Two weeks later, purified recombinant hantavirus nucleoprotein was mixed with incomplete Freund's adjuvant and emulsified completely, then administered as a booster immunization at 100 µg per mouse. Three days before fusion, purified recombinant hantavirus nucleoprotein was administered intraperitoneally to mice at 100 µg per mouse. The spleen of the immunized mice was aseptically harvested, ground, and mixed with the mouse myeloma cell line Sp2 / 0. Cell fusion was performed using 50% PEG4000 solution. The fused cells were added to 96-well culture plates containing feeder cells and cultured in HAT medium for selection. The hybridoma cell culture supernatant was detected by indirect ELISA. Positive wells were subcloned using the limiting dilution method to establish a hybridoma cell line secreting monoclonal antibodies. Positive hybridoma cells were cultured in RPMI 1640 medium (containing 10% fetal bovine serum), and the hybridoma cells were harvested and counted. Each cell was cultured at a concentration of 1.0 × 10⁶ cells / cell. 4 BALB / c mice were injected intraperitoneally with cells, and ascites fluid was collected approximately 10 days later. The mouse ascites fluid was purified into monoclonal antibodies using Protein G affinity chromatography.
[0026] The monoclonal antibody used in this invention is a 4D8 murine anti-hantavirus nucleoprotein IgG monoclonal antibody, and the concentration of the murine anti-hantavirus IgG standard is 10 µg / mL. Figure 2The reaction characteristics of the 4D8 murine anti-hantavirus nucleoprotein IgG monoclonal antibody and recombinant hantavirus nucleoprotein were analyzed by Western blotting. HRP-labeled rabbit anti-His-Tag mAb specifically bound to the recombinant hantavirus nucleoprotein, indicating that the recombinant hantavirus nucleoprotein was successfully expressed and purified. The binding bands of the 4D8 murine anti-hantavirus nucleoprotein IgG monoclonal antibody and the recombinant hantavirus nucleoprotein were in the same position as the bands of HRP-labeled rabbit anti-His-Tag mAb specifically binding to the recombinant hantavirus nucleoprotein, indicating that the 4D8 murine anti-hantavirus nucleoprotein IgG monoclonal antibody can specifically bind to the recombinant hantavirus nucleoprotein.
[0027] The detection method of the hemorrhagic fever host animal, murine hantavirus IgG antibody detection kit includes the following steps: S1. Sample addition: Take the ELISA strip coated with recombinant Hantavirus nucleoprotein, add 100 µL of sample diluent to each well, and then add 2 µL of serum or plasma to the wells designated for testing. If the sample is mouse tissue extract, do not add sample diluent and add 100 µL of mouse tissue extract directly to each well. Add 2 µL of mouse antibody negative control and 2 µL of mouse anti-Hantavirus IgG standard to the wells designated for mouse anti-Hantavirus IgG standard, respectively. Gently shake to mix, attach the sealing film, and incubate at 37°C for 30 minutes. S2. Add enzyme-labeled conjugate: Discard the solution in the wells of the enzyme-labeled plate, wash the plate 6 times with washing buffer, pat dry, add 100 µL of enzyme-labeled conjugate to each well, attach the sealing film, and incubate at 37°C for 30 minutes. S3. Color development: Discard the solution in the wells of the microplate, wash the microplate 6 times with washing buffer, pat dry, add 50 µL of color development solution A and 50 µL of color development solution B to each well, incubate at 37°C for 10 minutes, and add 50 µL of stop solution to each well. S4. Absorbance measurement: Set the detection wavelength to 450nm on the microplate reader and measure the absorbance value (OD450) of each well at 450nm wavelength. S5. Result determination: The validity of the test is verified based on the absorbance value measured in step S4. The test is valid when the absorbance value of the mouse antibody negative control is <0.15 and the absorbance value of the mouse anti-Hantavirus IgG standard is >1.0. The test is considered negative when the absorbance value of the sample to be tested is <0.15 and positive when the absorbance value of the sample to be tested is ≥0.15.
[0028] Furthermore, the detection method for the hemorrhagic fever host animal, murine hantavirus IgG antibody detection kit, can also employ a quantitative detection method. The specific detection steps are as follows: S1. Serially dilute the 4D8 murine anti-hantavirus IgG standard (concentration of 10 µg / mL) with sample diluent to prepare standard working solutions of 200 ng / mL, 100 ng / mL, 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, and 1.5625 ng / mL; S2. Sample addition: Take the ELISA strip coated with recombinant hantavirus nucleoprotein, add 100 µL of sample diluent to each well, then add 2 µL of serum or plasma to the wells designated for testing. If the sample is mouse tissue extract, add 100 µL of mouse tissue extract directly to each well without adding sample diluent. Add 2 µL of mouse antibody negative control to each well designated for mouse antibody negative control. Add 100 µL of mouse anti-hantavirus IgG standard working solution to each well designated for mouse anti-hantavirus IgG standard in sequence: 0 ng / mL (sample diluent), 1.5625 ng / mL, 3.125 ng / mL, 6.25 ng / mL, 12.5 ng / mL, 25 ng / mL, 50 ng / mL, 100 ng / mL, and 200 ng / mL. Gently shake to mix, seal with the film, and incubate at 37°C for 30 minutes. S3. Add enzyme-labeled conjugate: Discard the solution in the wells of the ELISA plate, wash the ELISA plate 6 times with washing buffer, pat dry, add 100 µL of enzyme-labeled conjugate to each well, attach the sealing film, and incubate at 37°C for 30 minutes; S4. Color development: Discard the solution in the wells of the microplate, wash the microplate 6 times with washing buffer, pat dry, add 50 µL of color development solution A and 50 µL of color development solution B to each well, incubate at 37℃ for 10 minutes, and add 50 µL of stop solution to each well. S5. Absorbance Measurement: Set the detection wavelength to 450 nm on the microplate reader and measure the absorbance value (OD) of each well at 450 nm. 450 ); S6. Result determination: Based on the absorbance values of the serially diluted mouse anti-hantavirus IgG standard working solutions and the protein concentration of the mouse anti-hantavirus IgG standard working solutions determined in step S5, standard curves were plotted using four-parameter fitting and linear regression. The concentrations of mouse anti-hantavirus IgG antibodies in the serum, plasma, and mouse tissue extract samples were calculated using the standard curves.
[0029] The washing solution is a working washing solution obtained by diluting the concentrated washing solution with distilled water at a ratio of 1:20.
[0030] Example 2 Sensitivity and specificity of qualitative detection methods for hantavirus IgG antibodies in rodents, hosts of hemorrhagic fever: A comparative analysis was conducted using a qualitative detection method for hantavirus IgG antibodies in hemorrhagic fever host animals (mice) and a hantavirus nucleic acid detection method for mouse lung tissue (Hantavirus universal nucleic acid detection reagent from Xi'an Huayuan Hengjian Biotechnology Co., Ltd., catalog number: H0402). After hantavirus infection in mice, when the mice are in a virus-carrying or virus-infected state, the hantavirus nucleic acid detection in mouse lung tissue is positive. This traditional detection method for hantavirus nucleic acid detection in mouse lung tissue, indicating hantavirus infection or carriage, has high sensitivity and specificity; therefore, it was used as the gold standard in this comparison. The qualitative detection method for hantavirus IgG antibodies in hemorrhagic fever host animals (mice) was performed on IgG antibodies in the lung tissue extracts of 122 mice. The steps of the qualitative detection method for hantavirus IgG antibodies in hemorrhagic fever host animals (mice) were the same as those in Example 1. The hantavirus nucleic acid detection method for mouse lung tissue was performed on hantavirus nucleic acid in the lung tissues of 122 mice. The results of the two methods are shown in Table 1.
[0031] Table 1. Qualitative detection methods for hantavirus IgG antibodies in rodents with hemorrhagic fever and hantavirus in mouse lung tissue. Comparison of nucleic acid testing methods
[0032] A paired design comparison was conducted between the qualitative detection method for hantavirus IgG antibodies in rodents with hemorrhagic fever and the hantavirus nucleic acid detection method in mouse lung tissue. SPSS 21.0 software was used for result analysis. There was no statistically significant difference between the two methods (McNemar's test, P > 0.05), and the consistency between the two methods was good (Kappa = 0.905, P < 0.01). The qualitative detection method for hantavirus IgG antibodies in rodents with hemorrhagic fever had a sensitivity of 92.59% and a specificity of 97.89%.
[0033] The qualitative detection method for hantavirus IgG antibodies in rodents, the host of hemorrhagic fever, of this invention exhibits good detection sensitivity and specificity. Furthermore, in this study, two out of 122 mice tested negative by nucleic acid detection but positive by antibody qualitative detection, indicating that antibody detection can detect previously infected rodents (i.e., rodents previously infected with hantavirus whose lung tissue has been completely cleared of the virus, and antibodies persist). The fact that two out of the 122 mice tested positive by nucleic acid detection but negative by antibody qualitative detection suggests that these two mice were in the early stages of hantavirus infection, with the virus present in their lungs or newly infected, and the immune response, especially humoral immunity, was not yet complete; anti-hantavirus IgG antibodies were not produced in the early stages of infection. Therefore, this application can detect not only currently infected or carrier rodents but also previously infected rodents, and by combining it with nucleic acid detection, it can provide information on the history or progression of hantavirus infection in rodents.
[0034] Example 3: Standard Curve Analysis of Quantitative Detection Method for Hantavirus IgG Antibody in Murine Hosts of Hemorrhagic Fever The murine anti-hantavirus IgG standard (4D8 murine anti-hantavirus nucleoprotein IgG monoclonal antibody, concentration 10 µg / mL) was serially diluted using sample diluent to produce working solutions with IgG standard concentrations of 200 ng / mL, 100 ng / mL, 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, and 1.5625 ng / mL. Take the ELISA strip coated with recombinant Hantavirus nucleoprotein, and add 100 µL / well of each of the following mouse anti-Hantavirus IgG standard working solutions: 1.5625 ng / mL, 3.125 ng / mL, 6.25 ng / mL, 12.5 ng / mL, 25 ng / mL, 50 ng / mL, 100 ng / mL, and 200 ng / mL. Gently shake to mix, seal the plate, and incubate at 37°C for 30 minutes. The other steps are the same as the quantitative detection method for mouse Hantavirus IgG antibodies in hemorrhagic fever host animals in Example 1.
[0035] The detection results were plotted using the concentration of mouse anti-hantavirus IgG standard as the independent variable (X) and the absorbance value corresponding to each concentration as the dependent variable (Y). Four-parameter fitting was performed using Thermo Scientific Skanlt Software 7.1, and linear regression was performed using WPS Office software to plot the standard curve. The standard curve R0 obtained from the four-parameter fitting was... 2 The value is 0.99893, such as Figure 3 As shown, it is close to 1; while the standard curve R obtained from linear regression is... 2 The value is 0.93300, such as Figure 4 As shown in the figure. Comparison of standard curves plotted using two linear fitting methods shows that the standard curve obtained by the four-parameter fitting is better, and the mouse anti-hantavirus IgG standard has a good linear relationship with the corresponding absorbance value in the range of 1.5625 ng / mL to 200 ng / mL.
[0036] Example 4: Application of qualitative and quantitative detection method for hantavirus IgG antibody in rodents, hosts of hemorrhagic fever Preparation of standard dilution: The murine anti-hantavirus IgG standard (4D8 murine anti-hantavirus nucleoprotein IgG monoclonal antibody, concentration of 10 µg / mL) was serially diluted with sample diluent to produce working solutions of IgG standard concentrations of 200 ng / mL, 100 ng / mL, 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, and 1.5625 ng / mL.
[0037] Sample selection: Lung tissue extracts from 122 mice in Example 2 were selected as the samples for qualitative detection of hemorrhagic fever host animal Hantavirus IgG antibody.
[0038] Lung tissue extracts from 27 mice that tested positive for antibodies using the qualitative detection method for hemorrhagic fever host animal Hantavirus IgG antibodies in Example 2 were selected as the antibody quantitative test samples.
[0039] Sample addition and qualitative or quantitative detection of IgG antibodies: Take the ELISA strip coated with recombinant Hantavirus nucleoprotein, add 100 µL of mouse tissue extract to each well, add 2 µL of mouse antibody negative control to each well, and add 100 µL of working solution of mouse anti-Hantavirus IgG standard at concentrations of 0 ng / mL (sample diluent), 1.5625 ng / mL, 3.125 ng / mL, 6.25 ng / mL, 12.5 ng / mL, 25 ng / mL, 50 ng / mL, 100 ng / mL, and 200 ng / mL to each well of mouse anti-Hantavirus IgG standard. Gently shake to mix, seal the plate, and incubate at 37°C for 30 minutes. Other steps are the same as the qualitative and quantitative detection methods for mouse Hantavirus IgG antibodies in hemorrhagic fever host animals in Example 1.
[0040] Results analysis: Qualitative detection of IgG antibodies against hemorrhagic fever host animal Hantavirus in rodents yielded 27 positive IgG antibody samples from the lung tissue extracts of 122 mice.
[0041] The results of the quantitative detection method for Hantavirus IgG antibodies in rodents, the host animals of hemorrhagic fever, were obtained by using the concentration of rodent anti-Hantavirus IgG standard as the independent variable (X) and the detection absorbance value corresponding to each concentration as the dependent variable (Y). ThermoScientific Skanlt Software 7.1 was used to fit a standard curve with four parameters. The quantitative detection results of IgG antibodies are shown in Table 2.
[0042] Table 2. Quantitative detection results of hantavirus IgG antibodies in rodents, hosts of hemorrhagic fever.
[0043] Example 5 Reproducibility of detection methods and kits for hantavirus IgG antibodies in murine hemorrhagic fever hosts: Standard dilution: The murine anti-hantavirus IgG standard (4D8 murine anti-hantavirus nucleoprotein IgG monoclonal antibody, concentration 10 µg / mL) was diluted with sample diluent to standard working solutions of 100 ng / mL, 12.5 ng / mL, and 1.5625 ng / mL, respectively.
[0044] Intra-assay variation analysis: Using the same batch of hemorrhagic fever host animal mouse hantavirus IgG antibody detection kit, working solutions of mouse anti-hantavirus IgG standards at concentrations of 100 ng / mL, 12.5 ng / mL, and 1.5625 ng / mL were tested. Two replicate wells were set for each concentration, and the procedure was the same as the qualitative detection method for hemorrhagic fever host animal mouse hantavirus IgG antibodies in Example 1. The intra-assay variation results are shown in Table 3 below. The CV% among the replicate wells at the three standard concentrations was less than 10%.
[0045] Inter-batch variation analysis: Working solutions of 100 ng / mL, 12.5 ng / mL, and 1.5625 ng / mL rodent anti-hantavirus IgG standards were tested using two different production batches of the hemorrhagic fever host animal mouse hantavirus IgG antibody detection kit. The procedure was the same as the qualitative detection method for hemorrhagic fever host animal mouse hantavirus IgG antibodies described in Example 1. The results of the inter-batch variation analysis are shown in Table 4. The CV% of the three standard concentrations between the two production batches was less than 15%.
[0046] Table 3. Intra-batch variability in the detection of Hantavirus IgG antibodies in rodents, hosts of hemorrhagic fever.
[0047] Example 6 Detection methods and kits for detecting hantavirus IgG antibodies in rodents with hemorrhagic fever as hosts, and their stability. Test samples: For Hantavirus antibody positive enterprise quality control products, there are 2 samples of mouse serum, 2 samples of mouse plasma, and 6 samples of mouse lung tissue extract; for Hantavirus antibody negative enterprise quality control products, there are 4 samples of mouse serum, 4 samples of mouse plasma, and 6 samples of mouse lung tissue extract.
[0048] Using the same batch of hemorrhagic fever host animal (mouse) hantavirus IgG antibody detection kit, positive and negative quality control samples were tested at 3-month intervals. The testing procedure was the same as the qualitative detection method for hemorrhagic fever host animal hantavirus IgG antibodies in Example 1.
[0049] Three consecutive monitoring sessions were conducted over a period of six months. The results of the three monitoring sessions are shown in Table 5. The results from the three consecutive monitoring sessions within six months showed that the hantavirus antibody-positive enterprise quality control products (mouse serum, mouse plasma, and mouse lung tissue extract) were all detected, with a concordance rate of 10 / 10. The hantavirus antibody-negative enterprise quality control products (mouse serum, mouse plasma, and mouse lung tissue extract) were not detected, with a concordance rate of 14 / 14. As can be seen from Table 5, the detection method and kit for hantavirus IgG antibodies in rodents, the host animals of hemorrhagic fever, exhibit good detection stability.
[0050] Table 5. Results of stability monitoring of methods and reagents for detecting Hantavirus IgG antibodies in rodents, hosts of hemorrhagic fever.
[0051] The detection principle of murine hantavirus IgG antibody in this invention: First, recombinant Hantavirus nucleoprotein is coated onto an ELISA plate. The pre-coated recombinant Hantavirus nucleoprotein binds to specific antibodies in the serum, plasma, and tissue extracts of mice to be tested. Under the tracing and screening effect of horseradish peroxidase (HRP)-labeled goat anti-mouse IgG, a complex is formed consisting of recombinant Hantavirus nucleoprotein, specific antibodies in mouse serum, plasma, and tissue extracts, and horseradish peroxidase (HRP)-labeled goat anti-mouse IgG. Under the action of a TMB colorimetric system, after adding stop solution, the absorbance value is measured at a wavelength of 450 nm. According to the result interpretation method, anti-Hantavirus IgG antibodies in mouse samples are qualitatively detected. Alternatively, a standard curve can be plotted based on a series of diluted standards, and the concentration of the antibody to be tested can be calculated based on the standard curve, thereby performing quantitative detection of anti-Hantavirus IgG antibodies.
[0052] The qualitative and quantitative detection methods provided by this invention have the advantages of high sensitivity and specificity, good repeatability and stability, and are simple to operate, making them suitable for widespread application. They can be used for both qualitative detection of antibodies in mouse serum, plasma, and mouse tissue extracts, as well as quantitative detection. Furthermore, they exhibit high sensitivity and specificity, strong repeatability and stability, simple operation, and low cost.
[0053] All content not described in detail in this invention is prior art.
[0054] The above description is merely a preferred embodiment of the present invention and is not limited to the description in the specification and embodiments. Therefore, all equivalent changes or modifications made to the structure, features, and principles described in the claims of this invention should be included within the scope of this patent application.
Claims
1. A detection kit for hantavirus IgG antibodies in rodents, a host animal of hemorrhagic fever, characterized in that: Includes ELISA plate, ELISA conjugate, sample diluent, mouse antibody negative control, mouse anti-hantavirus IgG standard, chromogenic solution A, chromogenic solution B, stop solution and concentrated wash solution; The wells of the enzyme-labeled plate are coated with recombinant Hantavirus nucleoprotein. The enzyme-labeled conjugate is horseradish peroxidase-labeled goat anti-mouse IgG antibody; The sample diluent was a phosphate buffer containing 10% fetal bovine serum and 0.1% Tween-20; The mouse antibody negative control was hantavirus nucleoprotein antibody-negative mouse serum; The mouse anti-hantavirus IgG standard is a mouse-derived anti-hantavirus nucleoprotein IgG monoclonal antibody. The colorimetric solution A is a citrate buffer containing hydrourea peroxide; The colorimetric solution B is a citrate buffer containing 3,3',5,5'-tetramethylbenzidine; The terminating solution is a 2 mol / L sulfuric acid solution; The concentrated washing solution is a phosphate buffer containing 0.5% Tween-20.
2. The hemorrhagic fever host animal, murine hantavirus IgG antibody detection kit according to claim 1, characterized in that: The recombinant Hantavirus nucleoprotein was prepared using genetic engineering and recombinant protein expression and purification techniques. The specific preparation method is as follows: Using the Hantavirus S sequence gene (nucleoprotein genome sequence) as a template, codon optimization was performed using an E. coli expression host system to synthesize the codon-optimized gene sequence. After ligation with the linear pET-28(+) vector, the sequence was transformed into E. coli to construct a fusion expression vector. After plasmid extraction and sequencing identification of the plasmid insertion sequence, the recombinant fusion protein with a histidine tag was induced to express using IPTG. The expression product was purified by nickel column affinity chromatography to obtain recombinant Hantavirus nucleoprotein. The recombinant Hantavirus nucleoprotein expression gene sequence is shown in SEQ ID NO.1, and the recombinant Hantavirus nucleoprotein expression amino acid sequence is shown in SEQ ID NO.
2.
3. The hemorrhagic fever host animal, murine hantavirus IgG antibody detection kit according to claim 1, characterized in that: The method for preparing recombinant hantavirus nucleoprotein coated in the wells of the enzyme-labeled plate includes the following steps: 1) Coating: The recombinant Hantavirus nucleoprotein was diluted to 0.5 µg / mL with carbonate buffer (pH 9.6) and added to the wells of the ELISA plate at a rate of 100 µL / well. The plate was then incubated at 4–8 °C for 24 h. 2) Blocking: Discard the coating solution, add 200µL of blocking solution to each well of the microplate, and block at 4~8℃ for 24h; 3) Dry and seal for storage: Discard the blocking solution, place the ELISA plate containing the blocking solution from step 2) in a 37°C drying oven for 8 hours, remove the ELISA plate, put it into an aluminum foil bag, and seal it quickly for storage.
4. The hemorrhagic fever host animal, murine hantavirus IgG antibody detection kit according to claim 3, characterized in that: The blocking solution is a phosphate buffer containing 1% bovine serum albumin component V.
5. The hemorrhagic fever host animal, murine hantavirus IgG antibody detection kit according to claim 1, characterized in that: The murine anti-hantavirus nucleoprotein IgG monoclonal antibody was prepared by routinely immunizing BALB / c mice with recombinant hantavirus nucleoprotein as the antigen, and then grinding the spleen of the immunized BALB / c mice and preparing the anti-hantavirus nucleoprotein IgG monoclonal antibody using hybridoma fusion technology.
6. The detection method of the hemorrhagic fever host animal rodent hantavirus IgG antibody detection kit according to any one of claims 1 to 5, characterized in that: Includes the following steps: S1. Sample addition: Take the ELISA strip coated with recombinant Hantavirus nucleoprotein, add 100 µL of sample diluent to each well, add 2 µL of serum or plasma to the wells of the sample to be tested, and if the sample is mouse tissue extract, do not add sample diluent, but add 100 µL of mouse tissue extract directly to each well. Add 2 µL of mouse antibody negative control and 2 µL of mouse anti-Hantavirus IgG standard to the wells of the mouse antibody negative control and mouse anti-Hantavirus IgG standard, respectively. Gently shake to mix, attach the sealing film, and incubate at 37°C for 30 minutes. S2. Add enzyme-labeled conjugate: Discard the solution in the wells of the enzyme-labeled plate, wash the plate 6 times with washing buffer, pat dry, add 100µL of enzyme-labeled conjugate to each well, attach the sealing film, and incubate at 37℃ for 30 minutes. S3. Color development: Discard the solution in the wells of the microplate, wash the microplate 6 times with washing buffer, pat dry, add 50 µL of color development solution A and 50 µL of color development solution B to each well, incubate at 37℃ for 10 minutes, and add 50 µL of stop solution to each well. S4. Absorbance measurement: Set the detection wavelength to 450nm on the microplate reader and measure the absorbance value OD450 of each well at 450nm wavelength. S5. Result determination: The validity of the test is verified based on the absorbance value measured in step S4. The test is valid when the absorbance value of the mouse antibody negative control is <0.15 and the absorbance value of the mouse anti-Hantavirus IgG standard is >1.
0. The test is considered negative when the absorbance value of the sample to be tested is <0.15 and positive when the absorbance value of the sample to be tested is ≥0.
15.
7. The detection method of the hantavirus IgG antibody detection kit for hemorrhagic fever host animals (rodents) according to claim 6, characterized in that: The washing solution is a working washing solution obtained by diluting the concentrated washing solution with distilled water at a ratio of 1:
20.
8. The detection method of the hemorrhagic fever host animal, murine hantavirus IgG antibody detection kit according to claim 6, characterized in that: It also includes quantitative detection methods, specifically comprising the following steps: S1. The mouse anti-hantavirus IgG standard was serially diluted with sample diluent to prepare working solutions of 200 ng / mL, 100 ng / mL, 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, and 1.5625 ng / mL. S2. Sample addition: Take the ELISA strip coated with recombinant Hantavirus nucleoprotein, add 100µL of sample diluent to each well, add 2µL of serum or plasma to the wells designated for testing, if the sample is mouse tissue extract, do not add sample diluent, but add 100µL of mouse tissue extract directly to each well, add 2µL of mouse antibody negative control to the wells designated for mouse antibody negative control, and add 100µL of working solution of mouse anti-Hantavirus IgG standard in the following order to the wells designated for mouse anti-Hantavirus IgG standard: 0 ng / mL (sample diluent), 1.5625 ng / mL, 3.125 ng / mL, 6.25 ng / mL, 12.5 ng / mL, 25 ng / mL, 50 ng / mL, 100 ng / mL, and 200 ng / mL, respectively. Gently shake to mix, seal with the film, and incubate at 37°C for 30 minutes. S3. Add enzyme-labeled conjugate: Discard the solution in the wells of the enzyme-labeled plate, wash the plate 6 times with washing buffer, pat dry, add 100µL of enzyme-labeled conjugate to each well, attach the sealing film, and incubate at 37°C for 30 minutes. S4. Color development: Discard the solution in the wells of the microplate, wash the microplate 6 times with washing buffer, pat dry, add 50µL of color development solution A and 50µL of color development solution B to each well, incubate at 37℃ for 10 minutes, and add 50µL of stop solution to each well. S5. Absorbance measurement: Set the detection wavelength to 450nm on the microplate reader and measure the absorbance value OD450 of each well at 450nm wavelength. S6. Result determination: Based on the absorbance values of the serially diluted mouse anti-hantavirus IgG standard working solutions and the protein concentration of the mouse anti-hantavirus IgG standard working solutions determined in step S5, a four-parameter fitting standard curve is used, and the concentration of mouse anti-hantavirus IgG antibody in the mouse serum, plasma, and mouse tissue extract samples is calculated in combination with the standard curve.