An InDel molecular marker for identifying the multilocular trait of Brassica napus and its primer set and application

Abstract

The present invention provides an InDel molecular marker for identifying the multi-locular trait of Brassica napus, and a primer set and application thereof, wherein the InDel molecular marker includes N21 and N30. The N21 and N30 molecular markers are linked to the Brassica napus multi-locular gene Bnml1 and can be detected by ordinary PCR and denaturing polyacrylamide gel electrophoresis. If the genomic DNA of the Brassica napus leaf to be tested is used as a template, a primer pair for amplifying N21 and a primer pair for amplifying N30 are used to perform a PCR amplification reaction, if the length of the N21 amplification product is 236 bp and the length of the N30 amplification product is 144 bp, it indicates that the Brassica napus to be tested has an extreme multi-locular trait.

Description

Technical Field

[0001] The invention relates to the technical field of molecular assisted breeding, and in particular to an InDel molecular marker for identifying the multi-locular trait of Brassica napus and a primer set and application thereof. Background Art

[0002] Rapeseed is the largest oil crop in my country. With the increasing demand for edible oil in my country, the current self-sufficiency rate of edible oil in my country is insufficient. Therefore, the development of the rapeseed industry is of great significance to ensure the safety of edible oil in my country. The use of molecular assisted breeding and other technical means to cultivate new varieties and reasonable supporting cultivation methods are currently effective ways to increase rapeseed production.

[0003] The components of rapeseed yield per plant include the number of effective siliques per plant, the number of grains per silique, and the thousand-grain weight. Studies have shown that multi-locular rapeseed increases the yield per plant by increasing the number of grains per silique. Therefore, the study of multi-locular traits is of great significance to the improvement of rapeseed yield traits.

[0004] The inheritance of multilocular traits in Brassica rapa and Brassica juncea is relatively simple. In Brassica rapa, multilocular traits are controlled by a pair of genes, while in Brassica juncea, multilocular traits are controlled by two pairs of genes, and the two-locular trait is completely dominant over multilocular. The location of the multilocular genes in Brassica rapa and Brassica juncea has been completed, and the multilocular genes have been cloned by the map-based cloning method. However, the location of the multilocular gene in Brassica rapa and Brassica juncea and the molecular markers linked to the gene have not been reported. Summary of the invention

[0005] The object of the present invention is to provide an InDel molecular marker for identifying the multilocular trait of Brassica napus and a primer set and application thereof.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides an InDel molecular marker for identifying a multilocular trait of Brassica napus. The InDel molecular marker comprises N21 and N30; N21 is located at 18005958-18006193 bp of ChrA03; N30 is located at 22842092-22842239 bp of ChrA03; and the loci of N21 and N30 are based on the Brassica napus Darmor v4.1 reference genome.

[0008] The present invention also provides a primer set for amplifying the InDel molecular marker described in the above scheme, including a primer pair N21-F and N21-R for amplifying N21 and a primer pair N30-F and N30-R for amplifying N30; the nucleotide sequence of the N21-F is shown in SEQ ID NO.1, and the nucleotide sequence of the N21-R is shown in SEQ ID NO.2; the nucleotide sequence of the N30-F is shown in SEQ ID NO.3, and the nucleotide sequence of the N30-R is shown in SEQ ID NO.4.

[0009] The present invention also provides the use of the InDel molecular marker or the primer set described in the above scheme in rapeseed molecular assisted breeding.

[0010] The present invention also provides the use of the InDel molecular marker or the primer set described in the above scheme in identifying the multi-locular trait of Brassica napus.

[0011] Preferably, the Brassica napus includes Brassica napus multilocularis 1332.

[0012] Preferably, the application comprises the following steps:

[0013] 1) Extracting genomic DNA from leaves of Brassica napus to be tested;

[0014] 2) using the genomic DNA of the Brassica napus leaf to be tested as a template, performing PCR amplification reactions using a primer pair for amplifying N21 and a primer pair for amplifying N30, respectively, to obtain an N21 amplification product and an N30 amplification product, respectively;

[0015] 3) Using denaturing polyacrylamide gel electrophoresis to detect the N21 amplification product and the N30 amplification product respectively; if the length of the N21 amplification product is 236 bp and the length of the N30 amplification product is 144 bp, it indicates that the Brassica napus to be tested has an extreme multilocular trait.

[0016] Preferably, the Brassica napus leaves in step 1) are Brassica napus leaves in the seedling stage.

[0017] Preferably, the PCR amplification reaction performed by the primer pair for amplifying N21 includes the following components in 10 μL: 1 μL of template, 0.8 μL of dNTPs, 0.1 μL of taq enzyme, 1 μL of 10× buffer, 0.5 μL of N21-F, 0.5 μL of N21-R and 6.1 μL of ddH2O;

[0018] The PCR amplification reaction performed by the primer pair for amplifying N30 is based on 10 μL and includes the following components: 1 μL of template, 0.8 μL of dNTPs, 0.1 μL of taq enzyme, 1 μL of 10× buffer, 0.5 μL of N30-F, 0.5 μL of N30-R and 6.1 μL of ddH2O.

[0019] Preferably, the reaction procedure of the PCR amplification reaction in step 2) is: 94°C, 10 min; 94°C, 10 s, 55°C, 30 s, 72°C, 45 s, 34 cycles; 72°C, 10 min; 4°C, 30 min.

[0020] Beneficial effects of the present invention: The present invention provides an InDel molecular marker for identifying the multi-locular trait of Brassica napus, wherein the InDel molecular marker includes N21 and N30. The N21 and N30 molecular markers are linked to the Brassica napus multi-locular gene Bnml1 and can be detected by ordinary PCR and polyacrylamide gel electrophoresis. If the genomic DNA of the Brassica napus leaf to be tested is used as a template, a primer pair for amplifying N21 and a primer pair for amplifying N30 are used to perform a PCR amplification reaction, and if fragments with lengths of 236 bp and 144 bp are amplified at the same time, it indicates that the Brassica napus to be tested has an extreme multi-locular trait. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The amplification results of molecular marker N21 in BC1 population 1345-1376;

[0022] Figure 2 This is the amplification result of molecular marker N30 in BC1 population 1345-1376. DETAILED DESCRIPTION

[0023] The present invention provides an InDel molecular marker for identifying the multi-locular trait of Brassica napus, wherein the N21 is located at 18005958-18006193bp of ChrA03, the two-locular parent is missing 6bp at the position of 18006041-18006046bp compared with the multi-locular parent, and the specific sequence of the deletion is GCTGCA; the N30 is located at 22842092-22842239bp of ChrA03, the multi-locular parent is missing 4bp at the position of 22842205-22842208bp compared with the two-locular parent, and the specific sequence is CTTT. In the present invention, the sites of the N21 and N30 are based on the Brassica napus Darmor v4.1 as a reference genome.

[0024] In the present invention, the N21 and N30 molecular markers are linked to the Brassica napus multilocular gene Bnml1 and can be detected by ordinary PCR and polyacrylamide gel electrophoresis. The amplified fragment of N21 in the Brassica napus multilocular rape is 236 bp, and the amplified fragment of N30 in the Brassica napus multilocular rape is 144 bp. If the genomic DNA of the Brassica napus leaf to be tested is used as a template, a primer pair for amplifying N21 and a primer pair for amplifying N30 are used to perform a PCR amplification reaction, if fragments with lengths of 236 bp and 144 bp are amplified at the same time, it indicates that the Brassica napus to be tested has an extreme multilocular trait.

[0025] The present invention also provides a primer set for amplifying the InDel molecular marker described in the above scheme, including a primer pair N21-F and N21-R for amplifying N21 and a primer pair N30-F and N30-R for amplifying N30; the nucleotide sequence of the N21-F is shown in SEQ ID NO.1, specifically: aacaaccaggttctgcagca; the nucleotide sequence of the N21-R is shown in SEQ ID NO.2, specifically: tcactcacccgattgttgct; the nucleotide sequence of the N30-F is shown in SEQ ID NO.3, specifically: ttggtttcgcccctgttgat; the nucleotide sequence of the N30-R is shown in SEQ ID NO.4, specifically: gggtggatggcagtttcttt.

[0026] The present invention also provides the use of the InDel molecular marker or the primer set described in the above scheme in rapeseed molecular assisted breeding.

[0027] The present invention also provides the use of the InDel molecular marker or the primer set described in the above scheme in identifying the multi-locular trait of Brassica napus.

[0028] In the present invention, the application preferably comprises the following steps:

[0029] 1) Extracting genomic DNA from leaves of Brassica napus to be tested at the seedling stage;

[0030] 2) Using the genomic DNA of the Brassica napus leaf to be tested as a template, a PCR amplification reaction was performed using a primer pair for amplifying N21 and a primer pair for amplifying N30 to obtain an N21 amplification product and an N30 amplification product, respectively:

[0031] 3) Using denaturing polyacrylamide gel electrophoresis to detect the N21 amplification product and the N30 amplification product respectively; if the length of the N21 amplification product is 236 bp and the length of the N30 amplification product is 144 bp, it indicates that the Brassica napus to be tested has an extreme multilocular trait.

[0032] The present invention has no particular limitation on the method for extracting genomic DNA from the Brassica napus leaves to be tested, and the method for extracting genomic DNA from conventional plants in the art can be used.

[0033] After obtaining the genomic DNA of the Brassica napus leaf to be tested, the present invention uses the genomic DNA of the Brassica napus leaf to be tested as a template, and uses a primer pair for amplifying N21 and a primer pair for amplifying N30 to perform PCR amplification reactions respectively, to obtain N21 amplification products and N30 amplification products respectively; the PCR amplification reaction performed using the primer pair for amplifying N21 preferably includes the following components in 10 μL: template 1 μL, dNTPs 0.8 μL, taq enzyme 0.1 μL, 10×buffer 1 μL, N21-F 0.5 μL, N21-R 0.5 μL and ddH2O 6.1 μL; the PCR amplification reaction performed using the primer pair for amplifying N30 preferably includes the following components in 10 μL: template 1 μL, dNTPs 0.8 μL, taq enzyme 0.1 μL, 10×buffer 1 μL, N30-F 0.5 μL, N30-R 0.5 μL and ddH2O 6.1 μL.

[0034] After obtaining the PCR amplification products, the present invention uses denaturing polyacrylamide gel electrophoresis to respectively detect the N21 amplification products and the N30 amplification products; if the length of the N21 amplification product is 236 bp and the length of the N30 amplification product is 144 bp, it indicates that the Brassica napus to be tested has an extreme multi-chamber trait.

[0035] In the present invention, the nucleotide sequence of the amplified sequence of N21 in multilocular rapeseed is shown in SEQ ID NO.5, specifically (5'-3'):

[0036]

[0037] The nucleotide sequence of the amplified sequence of N30 in multi-chambered rapeseed is shown in SEQ ID NO.6, specifically (5'-3'):

[0038]

[0039] In the present invention, the nucleotide sequence of the amplified sequence of N21 in the two-chamber parent is shown in SEQ ID NO.7, specifically (5'-3'):

[0040]

[0041] The nucleotide sequence of the amplified sequence of N30 in the two-chamber parent is shown in SEQ ID NO.8, specifically (5'-3'):

[0042]

[0043] The funding projects for this invention include:

[0044] 1. Sub-project on breeding of new transgenic rapeseed varieties in spring rapeseed area (2018ZX0802-0001-009);

[0045] 2. Qinghai Province’s “Thousands of High-end Innovative Talents Plan”.

[0046] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0047] Example 1

[0048] (1) The Brassica napus L. two-locular rapeseed Qingyou 14 was used as the female parent and the Brassica napus L. multi-locular rapeseed 1332 was used as the male parent to obtain the F1 hybrid, and the Brassica napus L. multi-locular rapeseed was used as the recurrent parent to obtain the BC1 population. The Brassica napus L. multi-locular rapeseed has the same characteristics as the common Brassica napus L. (the rapeseed with two-locular siliques) except for the multi-locular siliques.

[0049] (2) Investigate the multilocular silique rate of individual plants in the BC1 population. Count the total number of siliques and the number of multilocular siliques of each individual plant during the green-ripening period, and calculate the multilocular silique rate of each individual plant. Sort the multilocular silique rates of individual plants from small to large, and select 23 plants with the highest and lowest multilocular silique rates, respectively.

[0050] Multilocular silique rate = (multilocular silique number / total silique number) * 100%

[0051] (3) BSA analysis

[0052] (a) DNA extraction: DNA was extracted using the CTAB method from 46 plants of parent Qingyou 14, Brassica napus multilocularis 1332, and the plants with the highest and lowest multilocular silique rates, one plant of the two-locular parent, and one plant of the multilocular parent, for a total of 48 plants.

[0053] (b) DNA from the 23 plants with the lowest multi-locular silique rate was mixed in equal amounts to construct a two-locular mixed pool, and DNA from the 23 plants with the highest multi-locular silique rate was mixed in equal amounts to construct a multi-locular mixed pool.

[0054] (c) Library construction and sequencing: The parental samples and the extreme single strains of the isolated population used for sequencing were mixed for quality inspection, and the qualified samples were used for the construction of PE library. One PE library was built for each sample DNA. The genomic DNA was randomly sheared into fragments of 300-500 bp and connected to the sequencing adapter. After preparing DNA clusters on the sequencing chip, PE150 sequencing was performed on the Illumina HiSeq sequencer.

[0055] (d) Variant detection: Cutadapt and Trimmomatic software were used to perform quality control on the raw data, and the obtained high-quality clean data was compared with the reference genome (Darmor v4.1) for variant detection. The BAM file that can be used for variant calling was obtained by processing with BWA software, Samtools software, and SortSam in the Picard tool. Finally, the HaplotypeCaller module of GATK was used to detect SNP and InDel variants. The distribution of SNP and InDel variants on each chromosome is shown in Table 1.

[0056] Table 1 Distribution of available SNPs and InDels on each chromosome

[0057]

[0058] Note: Chr is the chromosome number, Length is the chromosome length, SNPs is the number and density of SNPs, and InDels is the number and density of InDels.

[0059] (e) Determination of candidate intervals.

[0060] Based on the SNP / InDel markers obtained after screening, in order to exclude the influence of unreliable markers, SNP-index was first screened. The conditions used were: the sequencing depth of both parents was greater than 8, the sequencing depth of both pools was greater than 10, the SNP-index values ​​of the two pools could not be greater than 0.8 or less than 0.2 at the same time, and there was polymorphism between the parents (the difference in SNP-index values ​​was greater than 0.8). Based on the screened markers, Δ(SNP-index) and G' were calculated using QTLseqr software, and the sliding window size was set to 2Mb. The thresholds of Δ(SNP-index) and G' were determined at 98.5% and 99.99% confidence levels, respectively. The regions above the thresholds were selected as the regions associated with the trait, and the overlapping regions under the two algorithms were taken as the final candidate intervals.

[0061] (4) Development of InDel markers

[0062] According to the resequencing results, InDel primers within the target interval were selected, and polymorphisms were detected in the parental and extreme gene pools, and 15 pairs of polymorphic InDel markers were obtained.

[0063] (5) Construction of local genetic linkage map

[0064] The screened InDel polymorphic primers were used to detect the extreme phenotypes in the BC1 population, and the results of each marker were statistically analyzed. The genetic linkage map was constructed using JionMap 4.0, and the recombination rate was converted into genetic distance through the Kosambi function to draw a genetic map, and finally Bnml1 was limited between N21 and N30.

[0065] Example 2

[0066] 1) After investigating the multi-locular silique rate in BC1, which is different from the above-mentioned strains, the multi-locular silique rate was sorted from small to large, and after sorting, 20 extreme two-locular plants and 20 multi-locular plants were selected.

[0067] 2) The DNA of these 40 strains was extracted using the CTAB method.

[0068] 3) After PCR amplification using N21 and N30 markers, the results were detected by polyacrylamide gel electrophoresis.

[0069] 4) The combination of N21 and N30 markers can distinguish between extreme bilocular and multilocular plants, where A represents the bilocular parent genotype of N21 marker, B represents the multilocular parent genotype of N21 marker, H represents the heterozygous type of N21 marker, b represents the homozygous multilocular genotype of N21 marker, C represents the bilocular parent genotype of N30 marker, D represents the multilocular parent genotype of N30 marker, E represents the heterozygous type of N30 marker, and d represents the homozygous multilocular genotype of N30 marker. The results of molecular markers showed that the amplification results of N21 and N30 markers with a multilocular silique rate ranging from 0% to 8.42% were all heterozygous genotypes, and the amplification results of N21 and N30 markers with a multilocular silique rate ranging from 77.25% to 98.41% were all recessive homozygous genotypes consistent with the multilocular parent. Therefore, N21 and N30 markers can distinguish between extreme bilocular and multilocular traits in the BC1 population. Combining the results of the two molecular markers can distinguish between extreme bilocular and multilocular plants. If the fragments of 236bp and 144bp are amplified at the same time, it means that the Brassica napus to be tested has an extreme multilocular trait; if the fragments of 230bp and 148bp appear at the same time, it means that the Brassica napus to be tested has an extreme bilocular trait.

[0070] The results are shown in Table 2. Figure 1 and Figure 2 .

[0071] Table 2 The extreme multilocular silique rate per plant in the BC1 population and the results of genotyping of markers N21 and N30

[0072]

[0073]

[0074] It can be seen from Table 2 that the lengths of the bands amplified by the N21 marker in the two-chamber parent and the multi-chamber parent are 230 bp and 236 bp, respectively. The bands amplified in the extreme two-chamber material of the BC1 population include two bands of 230 bp and 236 bp, and only the 236 bp band is amplified in the extreme multi-chamber material. The lengths of the bands amplified by the N30 marker in the two-chamber parent and the multi-chamber parent are 148 bp and 144 bp, respectively. The bands amplified in the extreme two-chamber material of the BC1 population include two bands of 148 bp and 144 bp, and only the 144 bp band is amplified in the extreme multi-chamber material.

[0075] Figure 1 and Figure 2 Among them, holes 1 and 2 are the amplified band patterns of the two-locular parent Qingyou 14, holes 3 and 4 are the amplified band patterns of the multi-locular parent 1332, holes 5 to 24 are the amplified band patterns of the individual plants with an extreme two-locular phenotype, and the multi-locular silique rates are shown in Table 2, holes 25 to 44 are the amplified band patterns of the individual plants with an extreme multi-locular phenotype, and the multi-locular silique rates are shown in Table 2. Figure 1 and Figure 2 The amplification results showed that N21 and N30, as co-dominant markers, can distinguish dominant homozygous, heterozygous and recessive homozygous genotypes. The scanning results of N21 and N30 for extreme two-chamber plants were all heterozygous genotypes, and the scanning results for extreme multi-chamber plants were recessive homozygous. Therefore, the results of the combined scanning of the two molecular markers N21 and N30 have a good correspondence with the phenotypes of extreme two-chamber and multi-chamber in the BC1 population.

[0076] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> Qinghai Academy of Agriculture and Forestry Sciences <120> An InDel molecular marker for identifying the multilocular trait of Brassica napus and its primer set and application <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 aacaaccagg ttctgcagca 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tcactcaccc gattgttgct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 ttggtttcgc ccctgttgat 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 gggtggatgg cagtttcttt 20 <210> 5 <211> 236 <212> DNA <213> Brassica napus L. <400> 5 aacaaccagg ttctgcagca gcgtgtcctc cagttagcac cacgggatcc gttatggcca 60 cttcagatcc agcgaaagcc atggctgcag cagcagcagg caataactta aaaggaggag 120 ggaagacgca gcaacatcag ctgggacctc ctgggttcgg gctcccgtat gttcacgcgg 180 ttccctgtgc agttcaagtt aaacctgtag atcagaagca acaatcgggt gagtga <210> 6 <211> 144 <212> DNA <213> Vegetables (Brassica napus L.) <400> 6 ttggtttcgc ccctgttgat aacagtacga aatatcgcta aagtcttacc cttttgtgat tgctaatcaa attack atgaacaaaa aaggaattca aaccaaagta aacttttggt cgaaaaaga actgccatcc accc 144 <210> 7 <211> 230 <212> DNA <213> Vegetables (Brassica napus L.) <400> 7 60. aacaaccagg ttctgcagca gcgtgtcctc cagttagcac cacgggatcc gttatggcca cttcagatcc agcgaaagcc atggcagcag caggcaata cttaaaagga ggaggaaga cgcagcaaca tcagctggga cctcctgggt tcgggctccc gtatgttcac gcggttccct 180 gtgcagttca agttaaacct gtagatcaga agcaacaatc gggtgagtga <210> 8 <211> 148 <212> DNA <213> Vegetables (Brassica napus L.) <400> 8 ttggtttcgc ccctgttgat aacgtacaa aatatcgcta aagtcttacc cttttgtgat 60 tgctaatcat attaattaaa atgaacaaaa aaagactca aaccaaagta aacctttttt 120 tggtcgaaaa agaaactgcc atccaccc 148

Claims

1. An application of an InDel molecular marker primer set for identifying the multi-locular trait of Brassica napus in molecular assisted breeding of Brassica napus, wherein the Brassica napus is Brassica napus multi-locular 1332, and the primer set consists of a primer pair N21-F and N21-R for amplifying N21, and a primer pair N30-F and N30-R for amplifying N30; the nucleotide sequence of the N21-F is shown in SEQ ID NO.1, and the nucleotide sequence of the N21-R is shown in SEQ ID NO.2; the nucleotide sequence of the N30-F is shown in SEQ ID NO.3, and the nucleotide sequence of the N30-R is shown in SEQ ID NO.

4.

2. An application of an InDel molecular marker primer set for identifying the multi-locular trait of Brassica napus in identifying the multi-locular trait of Brassica napus, wherein the Brassica napus is Brassica napus multi-locular trait 1332, and the primer set consists of a primer pair N21-F and N21-R for amplifying N21, and a primer pair N30-F and N30-R for amplifying N30; the nucleotide sequence of the N21-F is shown in SEQ ID NO.1, and the nucleotide sequence of the N21-R is shown in SEQ ID NO.2; the nucleotide sequence of the N30-F is shown in SEQ ID NO.3, and the nucleotide sequence of the N30-R is shown in SEQ ID NO.

4.

3. The use according to claim 1 or 2, characterized in that: The application comprises the following steps: 1) Extracting genomic DNA from leaves of Brassica napus to be tested; 2) using the genomic DNA of the Brassica napus leaf to be tested as a template, performing PCR amplification reactions using a primer pair for amplifying N21 and a primer pair for amplifying N30, respectively, to obtain an N21 amplification product and an N30 amplification product, respectively; 3) Using denaturing polyacrylamide gel electrophoresis to detect the N21 amplification product and the N30 amplification product respectively; if the length of the N21 amplification product is 236 bp and the length of the N30 amplification product is 144 bp, it indicates that the Brassica napus to be tested has an extreme multilocular trait.

4. The use according to claim 3, characterized in that: The Brassica napus leaves in step 1) are Brassica napus leaves in the seedling stage.

5. The use according to claim 3, characterized in that: The PCR amplification reaction performed by the primer pair for amplifying N21 in step 2) is calculated as 10 μL and includes the following components: 1 μL template, 0.8 μL dNTPs, 0.1 μL taq enzyme, 1 μL 10× buffer, 0.5 μL N21-F, 0.5 μL N21-R and 6.1 μL ddH2O.

6. The use according to claim 3, characterized in that: The PCR amplification reaction performed by the primer pair for amplifying N30 in step 2) is calculated as 10 μL and includes the following components: 1 μL template, 0.8 μL dNTPs, 0.1 μL taq enzyme, 1 μL 10× buffer, 0.5 μL N30-F, 0.5 μL N30-R and 6.1 μL ddH2O.

7. The use according to claim 3, characterized in that: The reaction program of the PCR amplification reaction in step 2) is: 94°C, 10 min; 94°C, 10 s, 55°C, 30 s, 72°C, 45 s, 34 cycles; 72°C, 10 min; 4°C, 30 min.

Images