Bcma chimeric antigen receptors and uses thereof

Abstract

The present invention provides compositions and methods for treating diseases associated with BCMA expression. The present invention also relates to chimeric antigen receptors (CARs) specific for BCMA, vectors encoding the same, and recombinant T cells comprising the BCMA CAR. The present invention also includes methods of administering genetically modified T cells expressing a CAR comprising a BCMA binding domain.

Description

[0001] Cross-references to related applications

[0002] This application claims priority to U.S. Serial No. 62 / 684,628, filed June 13, 2018, and U.S. Serial No. 62 / 832,991, filed April 12, 2019, the contents of each of which are incorporated herein by reference in their entirety.

[0003] sequence list

[0004] This application contains a sequence list submitted electronically in ASCII format and hereby incorporated in its entirety by reference. The ASCII copy, created on June 11, 2019, is named N2067-7155WO_SL.txt and is 228,604 bytes in size. Technical Field

[0005] This invention generally relates to the use of immune effector cells (e.g., T cells, NK cells) engineered to express chimeric antigen receptors (CARs) in the treatment of diseases associated with B cell maturation antigen protein (BCMA) expression. Background Technology

[0006] B-cell maturation antigen (BCMA) is expressed by members of the tumor necrosis family receptor (TNFR) in the B-cell lineage. BCMA expression is highest on terminally differentiated B cells. BCMA is involved in regulating plasma cell survival to maintain long-term humoral immunity. BCMA expression has recently been associated with many cancers, autoimmune disorders, and infectious diseases. Cancers with increased BCMA expression include some hematologic malignancies such as multiple myeloma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, various leukemias, and glioblastoma. Summary of the Invention

[0007] In one aspect, the invention is characterized by an isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an anti-BCMA binding domain (e.g., a human anti-BCMA binding domain, such as the human anti-BCMA binding domain described herein), a transmembrane domain, and an intracellular signal transduction domain.

[0008] In another aspect, the present invention provides a separate CAR, wherein the CAR comprises an anti-BCMA binding domain (e.g., a human anti-BCMA binding domain, such as the human anti-BCMA binding domain described herein), a transmembrane domain, and an intracellular signal transduction domain.

[0009] In some embodiments, the anti-BCMA binding domain (e.g., the human anti-BCMA binding domain) comprises one or more (e.g., all three) heavy chain complementarity-determining regions 1 (HC CDR1), 2 (HC CDR2), and 3 (HC CDR3) of the anti-BCMA binding domain described herein, and / or one or more (e.g., all three) light chain complementarity-determining regions 1 (LC CDR1), 2 (LC CDR2), and 3 (LC CDR3) of the anti-BCMA binding domain described herein. In some embodiments, the anti-BCMA binding domain comprises a heavy chain variable region (e.g., in Tables 2, 6, or 10) and / or a light chain variable region (e.g., in Tables 2, 6, or 10). In some embodiments, the anti-BCMA binding domain comprises an scFv containing the light and heavy chains of the amino acid sequences of Tables 2, 6, or 10. In some embodiments, the anti-BCMA binding domain comprises the scFv described herein (e.g., in Tables 2, 6, or 10). In some embodiments, the CAR comprises the CAR sequence disclosed herein (e.g., in Tables 2, 6, or 10).

[0010] In some embodiments, the anti-BCMA binding domain comprises any anti-BCMA heavy chain binding domain amino acid sequence listed in Tables 2-13 (or a sequence having at least about 85%, 90%, 95%, or 99% sequence identity with it, or a sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions)) of HC CDR1, HC CDR2, and HC CDR3. In some embodiments, the anti-BCMA binding domain comprises any anti-BCMA light chain binding domain amino acid sequence listed in Tables 2-13 (or a sequence having at least about 85%, 90%, 95%, or 99% sequence identity with it, or a sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions) of LCCDR1, LCCDR2, and LCCDR3).

[0011] In some embodiments, HC CDR1, HC CDR2, and HC CDR3 are HC CDR sequences listed in Tables 3-5 (e.g., in a single row of Tables 3-5) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions)). In some embodiments, LC CDR1, LC CDR2, and LC CDR3 are LC CDR sequences listed in Tables 3-5 (e.g., in a single row of Tables 3-5) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions)). In some embodiments, HC CDR1, HCCDR2, and HC CDR3 respectively comprise amino acid sequences of SEQ ID NO:44, 45, and 84 (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, such as conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, such as conservative substitutions)). In some embodiments, HC CDR1, HC CDR2, and HC CDR3 each comprise: (i) the amino acid sequences of SEQ ID NO:44, 45, and 46, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); (ii) the amino acid sequences of SEQ ID NO:44, 45, and 68, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); or (iii) SEQ ID NO:44, 45, and 68. The amino acid sequences of NO:44, 45 and 76, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution).

[0012] In some embodiments, LC CDR1, LC CDR2 and LC CDR3 respectively comprise amino acid sequences of SEQ ID NO:54, 55 and 56, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g. conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g. conservative substitution).

[0013] In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 each comprise: (i) the amino acid sequences of SEQ ID NO: 44, 45, 46, 54, 55, and 56, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions); (ii) the amino acid sequences of SEQ ID NO: 44, 45, 68, 54, 55, and 56, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions); or (iii) SEQ ID NO: 44, 45, 68, 54, 55, and 56. The amino acid sequences of NO:44, 45, 76, 54, 55 and 56, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution).

[0014] In some embodiments, the anti-BCMA binding domain includes a heavy chain variable region (VH) comprising an amino acid sequence of SEQ ID NO: 52, 70, or 78, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity with it, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions).

[0015] In some embodiments, the anti-BCMA binding domain includes VH, wherein the nucleic acid molecule includes a nucleic acid sequence encoding VH, wherein the nucleic acid sequence includes the nucleic acid sequence of SEQ ID NO: 53, 71 or 79, or a nucleic acid sequence having at least about 85%, 90%, 95% or 99% sequence identity with it.

[0016] In some embodiments, the anti-BCMA binding domain includes a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO:61, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity with it, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions).

[0017] In some embodiments, the anti-BCMA binding domain includes VL, wherein the nucleic acid molecule includes a nucleic acid sequence encoding VL, wherein the nucleic acid sequence includes the nucleic acid sequence of SEQ ID NO:62, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity with it.

[0018] In some embodiments, the anti-BCMA binding domain comprises VH and VL, wherein VH and VL respectively comprise: (i) the amino acid sequences of SEQ ID NO: 52 and 61, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions), (ii) the amino acid sequences of SEQ ID NO: 70 and 61, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions), or (iii) SEQ ID NO: 52 and 61. The amino acid sequences of NO:78 and 61, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than 30, 20 or 10 modifications (e.g. substitution, e.g., conservative substitution).

[0019] In some embodiments, the anti-BCMA binding domain comprises a single-stranded variable fragment (scFv) comprising the amino acid sequence of SEQ ID NO: 64, 72, or 80, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conserved substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conserved substitutions). In some embodiments, the anti-BCMA binding domain comprises a single-stranded variable fragment (scFv), wherein the nucleic acid molecule comprises a nucleic acid sequence encoding the scFv, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 65, 73, or 81, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0020] In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 66, 74, or 82, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the nucleic acid molecule comprises the nucleic acid sequence of SEQ ID NO: 67, 75, or 83, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0021] In some embodiments, HC CDR1, HC CDR2, and HC CDR3 are HC CDR sequences listed in Tables 7-9 (e.g., in a single row of Tables 7-9) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., permutations, e.g., conservative permutations) but no more than seven, six, or five modifications (e.g., permutations, e.g., conservative permutations)). In some embodiments, LC CDR1, LC CDR2, and LC CDR3 are LC CDR sequences listed in Tables 7-9 (e.g., in a single row of Tables 7-9) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., permutations, e.g., conservative permutations) but no more than seven, six, or five modifications (e.g., permutations, e.g., conservative permutations)).

[0022] In some embodiments, HC CDR1, HC CDR2, and HC CDR3 respectively comprise amino acid sequences of SEQ ID NO: 86, 130, and 88 (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, such as conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, such as conservative substitutions)). In some embodiments, HC CDR1, HC CDR2, and HC CDR3 each comprise: (i) the amino acid sequences of SEQ ID NO: 86, 87, and 88, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); (ii) the amino acid sequences of SEQ ID NO: 86, 109, and 88, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); or (iii) SEQ ID NO: 86, 87, and 88. The amino acid sequences of NO:86, 109 and 88, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution).

[0023] In some embodiments, LC CDR1, LC CDR2 and LC CDR3 respectively comprise the amino acid sequences of SEQ ID NO: 95, 131 and 132, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution). In some embodiments, LC CDR1, LC CDR2, and LC CDR3 each comprise: (i) the amino acid sequences of SEQ ID NO: 95, 96, and 97, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); (ii) the amino acid sequences of SEQ ID NO: 95, 114, and 115, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); or (iii) SEQ ID NO: 95, 96, and 97. The amino acid sequences of NO:95, 114 and 97, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution).

[0024] In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 each comprise: (i) the amino acid sequences of SEQ ID NO: 86, 87, 88, 95, 96, and 97, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions); (ii) the amino acid sequences of SEQ ID NO: 86, 109, 88, 95, 114, and 115, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions); or (iii) SEQ ID NO: 86, 109, 88, 95, 114, and 115. The amino acid sequence of NO:86, 109, 88, 95, 114 and 97, or a sequence having at least about 85%, 90%, 95% or 99% sequence identity with it, or a sequence having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution).

[0025] In some embodiments, the anti-BCMA binding domain includes a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 93 or 112, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the anti-BCMA binding domain includes VH, wherein the nucleic acid molecule includes a nucleic acid sequence encoding VH, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 260, 94, or 113, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0026] In some embodiments, the anti-BCMA binding domain includes a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 102, 118, or 124, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the anti-BCMA binding domain includes a VL, wherein the nucleic acid molecule includes a nucleic acid sequence encoding the VL, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 261, 103, 119, or 125, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0027] In some embodiments, the anti-BCMA binding domain comprises VH and VL, wherein VH and VL respectively comprise: (i) the amino acid sequences of SEQ ID NO: 93 and 102, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions), (ii) the amino acid sequences of SEQ ID NO: 112 and 118, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions), or (iii) SEQ ID NO: 93 and 102. The amino acid sequences of NO:112 and 124, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than 30, 20 or 10 modifications (e.g. substitution, e.g., conservative substitution).

[0028] In some embodiments, the anti-BCMA binding domain comprises a single-stranded variable fragment (scFv) comprising the amino acid sequence of SEQ ID NO: 105, 120, or 126, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the anti-BCMA binding domain comprises a single-stranded variable fragment (scFv), wherein the nucleic acid molecule comprises a nucleic acid sequence encoding the scFv, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 253, 106, 121, or 127, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0029] In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 107, 122, or 128, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the nucleic acid molecule comprises the nucleic acid sequence of SEQ ID NO: 259, 108, 123, or 129, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith. In some embodiments, the nucleic acid molecule comprises the nucleic acid sequence of SEQ ID NO: 258, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0030] In some embodiments, HC CDR1, HC CDR2, and HC CDR3 are HC CDR sequences listed in Tables 11-13 (e.g., in a single row of Tables 11-13) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions)). In some embodiments, LC CDR1, LC CDR2, and LC CDR3 are LC CDR sequences listed in Tables 11-13 (e.g., in a single row of Tables 11-13) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions)).

[0031] In some embodiments, HC CDR1, HC CDR2 and HC CDR3 respectively comprise the amino acid sequences of SEQ ID NO:179, 180 and 181, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution). In some embodiments, HC CDR1, HC CDR2, and HC CDR3 respectively comprise: (i) the amino acid sequences of SEQ ID NO: 137, 138, and 139, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions); or (ii) the amino acid sequences of SEQ ID NO: 160, 161, and 162, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions).

[0032] In some embodiments, LC CDR1, LC CDR2 and LC CDR3 respectively comprise amino acid sequences of SEQ ID NO:147, 182 and 183, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution). In some embodiments, LC CDR1, LC CDR2 and LC CDR3 respectively comprise: (i) the amino acid sequence of SEQ ID NO: 147, 148 and 149, or an amino acid sequence having at least about 85%, 90%, 95% or 99% sequence identity with it, or an amino acid sequence having at least one, two or three modifications (e.g. substitution, e.g. conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g. conservative substitution); or (ii) the amino acid sequence of SEQ ID NO: 147, 170 and 171, or an amino acid sequence having at least about 85%, 90%, 95% or 99% sequence identity with it, or an amino acid sequence having at least one, two or three modifications (e.g. substitution, e.g. conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g. conservative substitution).

[0033] In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2 and LC CDR3 respectively comprise: (i) the amino acid sequences of SEQ ID NO: 137, 138, 139, 147, 148 and 149, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or sequences having at least one, two or three modifications (e.g. substitution, e.g. conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g. conservative substitution); or (ii) the amino acid sequences of SEQ ID NO: 160, 161, 162, 147, 170 and 171, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or sequences having at least one, two or three modifications (e.g. substitution, e.g. conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g. conservative substitution).

[0034] In some embodiments, the anti-BCMA binding domain includes a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 145 or 168, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the anti-BCMA binding domain includes VH, wherein the nucleic acid molecule comprises a nucleic acid sequence encoding VH, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 146 or 169, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0035] In some embodiments, the anti-BCMA binding domain comprises a light chain variable region (VL) containing the amino acid sequence of SEQ ID NO: 154 or 173, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the anti-BCMA binding domain comprises a VL, wherein the nucleic acid molecule comprises a nucleic acid sequence encoding the VL, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 155 or 174, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0036] In some embodiments, the anti-BCMA binding domain comprises VH and VL, wherein VH and VL respectively comprise: (i) the amino acid sequences of SEQ ID NO: 145 and 154, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions), or (ii) the amino acid sequences of SEQ ID NO: 168 and 173, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions).

[0037] In some embodiments, the anti-BCMA binding domain comprises a single-stranded variable fragment (scFv) comprising the amino acid sequence of SEQ ID NO: 156 or 175, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conserved substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conserved substitutions). In some embodiments, the anti-BCMA binding domain comprises a single-stranded variable fragment (scFv) wherein the nucleic acid molecule comprises a nucleic acid sequence encoding the scFv, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 157 or 176, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0038] In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 158 or 177, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the nucleic acid molecule comprises the nucleic acid sequence of SEQ ID NO: 159 or 178, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0039] In some embodiments, the anti-BCMA binding domain comprises VH and VL, wherein VH and VL are connected by a linker (e.g., the linker described herein), optionally wherein the linker comprises an amino acid sequence of SEQ ID NO: 63 or 104, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity with it.

[0040] In some embodiments, the transmembrane domain comprises a transmembrane domain of a protein selected from the α, β, or ζ chain of the T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154. In some embodiments, the transmembrane domain comprises the amino acid sequence of SEQ ID NO:6, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conserved substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conserved substitutions). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding the transmembrane domain, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:17, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0041] In some embodiments, the anti-BCMA binding domain is connected to the transmembrane domain via a hinge region. In some embodiments, the hinge region comprises the amino acid sequence of SEQ ID NO: 2, 3, or 4, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding the hinge region, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 13, 14, or 15, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0042] In some embodiments, the transmembrane domain and hinge region comprise the amino acid sequence of SEQ ID NO:202, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the transmembrane domain and hinge region are encoded by the nucleic acid sequence of SEQ ID NO:254, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0043] In some embodiments, the intracellular signal transduction domain comprises a primary signal transduction domain, such as the primary signal transduction domain described herein, optionally wherein the primary signal transduction domain comprises a functional signal transduction domain derived from CD3ζ, TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278 (ICOS), FcεRI, DAP10, DAP12, or CD66d. In some embodiments, the primary signal transduction domain comprises the amino acid sequence of SEQ ID NO: 9 or 10, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a primary signal transduction domain, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 20 or 21, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a primary signal transduction domain, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 256, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0044] In some embodiments, the intracellular signal transduction domain includes a co-stimulatory signal transduction domain, such as the co-stimulatory signal transduction domain described herein, optionally wherein the co-stimulatory signal transduction domain includes molecules derived from MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signal transduction lymphocyte activation molecules (SLAM proteins), activating NK cell receptors, BTLA, Toll ligand receptors, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, 4-1BB (CD137), B7-H3, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (L IGHTR), KIRDS2, SLAMF7, NKp80(KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα , ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, L FA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRTAM, Ly9(CD229), CD160(BY55), PS Functional signal transduction domains of GL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, CD28-OX40, CD28-4-1BB, or ligands that specifically bind to CD83. In some embodiments, the co-stimulatory signal transduction domain comprises the amino acid sequence of SEQ ID NO:7, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions).In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a co-stimulatory signal transduction domain, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:18, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a co-stimulatory signal transduction domain, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:255, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0045] In some embodiments, the intracellular signal transduction domain comprises a functional signal transduction domain derived from 4-1BB and a functional signal transduction domain derived from CD3ζ, optionally wherein the intracellular signal transduction domain comprises the amino acid sequence of SEQ ID NO:7 (or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions)) and the amino acid sequence of SEQ ID NO:9 or 10 (or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions)), optionally wherein the intracellular signal transduction domain comprises the amino acid sequence of SEQ ID NO:7 and the amino acid sequence of SEQ ID NO:9 or 10.

[0046] In some embodiments, the CAR further comprises a leader sequence containing the amino acid sequence of SEQ ID NO:1.

[0047] In some embodiments, the CAR comprises one or more (e.g., one, two, or all) of the following properties: (i) when expressed in cells (e.g., T cells), the CAR activates NFAT signaling in the cells expressing BCMA in the presence of such cells, for example as measured by the JNL screening reporter assay described in Example 1, for example as described in Example 1 regarding Figure 1A or Figure 1C The method described is evaluated as follows: (ii) when expressed in cells (e.g., T cells), the CAR induces cytotoxicity in cells expressing BCMA, for example, as described in Example 1. Figure 3A The method described is evaluated; and (iii) when expressed in cells (e.g., T cells), CAR induces the expression of cytokines (e.g., IFN-γ) in the presence of cells expressing BCMA, for example, as described in Example 1. Figure 3C The method described was evaluated.

[0048] In another aspect, the present invention provides an anti-BCMA binding domain comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein the heavy chain variable region comprises a heavy chain complementarity-determining region 1 (HC CDR1), a heavy chain complementarity-determining region 2 (HC CDR2), and a heavy chain complementarity-determining region 3 (HC CDR3), and the light chain variable region comprises a light chain complementarity-determining region 1 (LC CDR1), a light chain complementarity-determining region 2 (LC CDR2), and a light chain complementarity-determining region 3 (LC CDR3), wherein HC CDR1, HC CDR2, HC CDR3, LCCDR1, LC CDR2, and LC CDR3 comprise the CDR amino acid sequences disclosed herein.

[0049] In some embodiments, HC CDR1, HC CDR2, and HC CDR3 are HC CDR sequences listed in Tables 3-5 (e.g., in a single row of Tables 3-5) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions)). In some embodiments, LC CDR1, LC CDR2, and LC CDR3 are LC CDR sequences listed in Tables 3-5 (e.g., in a single row of Tables 3-5) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions)). In some embodiments, HC CDR1, HCCDR2, and HC CDR3 respectively comprise amino acid sequences of SEQ ID NO:44, 45, and 84 (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, such as conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, such as conservative substitutions)). In some embodiments, HC CDR1, HC CDR2, and HC CDR3 each comprise: (i) the amino acid sequences of SEQ ID NO:44, 45, and 46, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); (ii) the amino acid sequences of SEQ ID NO:44, 45, and 68, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); or (iii) SEQ ID NO:44, 45, and 68. The amino acid sequences of NO:44, 45 and 76, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution).

[0050] In some embodiments, LC CDR1, LC CDR2 and LC CDR3 respectively comprise amino acid sequences of SEQ ID NO:54, 55 and 56, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g. conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g. conservative substitution).

[0051] In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 each comprise: (i) the amino acid sequences of SEQ ID NO: 44, 45, 46, 54, 55, and 56, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions); (ii) the amino acid sequences of SEQ ID NO: 44, 45, 68, 54, 55, and 56, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions); or (iii) SEQ ID NO: 44, 45, 68, 54, 55, and 56. The amino acid sequences of NO:44, 45, 76, 54, 55 and 56, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution).

[0052] In some embodiments, the anti-BCMA binding domain includes a heavy chain variable region (VH) comprising an amino acid sequence of SEQ ID NO: 52, 70, or 78, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity with it, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions).

[0053] In some embodiments, the anti-BCMA binding domain includes VH, wherein the nucleic acid molecule includes a nucleic acid sequence encoding VH, wherein the nucleic acid sequence includes the nucleic acid sequence of SEQ ID NO: 53, 71 or 79, or a nucleic acid sequence having at least about 85%, 90%, 95% or 99% sequence identity with it.

[0054] In some embodiments, the anti-BCMA binding domain includes a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO:61, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity with it, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions).

[0055] In some embodiments, the anti-BCMA binding domain includes VL, wherein the nucleic acid molecule includes a nucleic acid sequence encoding VL, wherein the nucleic acid sequence includes the nucleic acid sequence of SEQ ID NO:62, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity with it.

[0056] In some embodiments, the anti-BCMA binding domain comprises VH and VL, wherein VH and VL respectively comprise: (i) the amino acid sequences of SEQ ID NO: 52 and 61, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions), (ii) the amino acid sequences of SEQ ID NO: 70 and 61, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions), or (iii) SEQ ID NO: 52 and 61. The amino acid sequences of NO:78 and 61, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than 30, 20 or 10 modifications (e.g. substitution, e.g., conservative substitution).

[0057] In some embodiments, HC CDR1, HC CDR2, and HC CDR3 are HC CDR sequences listed in Tables 7-9 (e.g., in a single row of Tables 7-9) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., permutations, e.g., conservative permutations) but no more than seven, six, or five modifications (e.g., permutations, e.g., conservative permutations)). In some embodiments, LC CDR1, LC CDR2, and LC CDR3 are LC CDR sequences listed in Tables 7-9 (e.g., in a single row of Tables 7-9) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., permutations, e.g., conservative permutations) but no more than seven, six, or five modifications (e.g., permutations, e.g., conservative permutations)).

[0058] In some embodiments, HC CDR1, HC CDR2, and HC CDR3 respectively comprise amino acid sequences of SEQ ID NO: 86, 130, and 88 (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, such as conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, such as conservative substitutions)). In some embodiments, HC CDR1, HC CDR2, and HC CDR3 each comprise: (i) the amino acid sequences of SEQ ID NO: 86, 87, and 88, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); (ii) the amino acid sequences of SEQ ID NO: 86, 109, and 88, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); or (iii) SEQ ID NO: 86, 87, and 88. The amino acid sequences of NO:86, 109 and 88, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution).

[0059] In some embodiments, LC CDR1, LC CDR2 and LC CDR3 respectively comprise the amino acid sequences of SEQ ID NO: 95, 131 and 132, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution). In some embodiments, LC CDR1, LC CDR2, and LC CDR3 each comprise: (i) the amino acid sequences of SEQ ID NO: 95, 96, and 97, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); (ii) the amino acid sequences of SEQ ID NO: 95, 114, and 115, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitution, e.g., conservative substitution) but no more than seven, six, or five modifications (e.g., substitution, e.g., conservative substitution); or (iii) SEQ ID NO: 95, 96, and 97. The amino acid sequences of NO:95, 114 and 97, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution).

[0060] In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 each comprise: (i) the amino acid sequences of SEQ ID NO: 86, 87, 88, 95, 96, and 97, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions); (ii) the amino acid sequences of SEQ ID NO: 86, 109, 88, 95, 114, and 115, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions); or (iii) SEQ ID NO: 86, 109, 88, 95, 114, and 115. The amino acid sequence of NO:86, 109, 88, 95, 114 and 97, or a sequence having at least about 85%, 90%, 95% or 99% sequence identity with it, or a sequence having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution).

[0061] In some embodiments, the anti-BCMA binding domain includes a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 93 or 112, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the anti-BCMA binding domain includes VH, wherein the nucleic acid molecule includes a nucleic acid sequence encoding VH, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 260, 94, or 113, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0062] In some embodiments, the anti-BCMA binding domain includes a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 102, 118, or 124, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the anti-BCMA binding domain includes a VL, wherein the nucleic acid molecule includes a nucleic acid sequence encoding the VL, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 261, 103, 119, or 125, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0063] In some embodiments, the anti-BCMA binding domain comprises VH and VL, wherein VH and VL respectively comprise: (i) the amino acid sequences of SEQ ID NO: 93 and 102, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions), (ii) the amino acid sequences of SEQ ID NO: 112 and 118, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions), or (iii) SEQ ID NO: 93 and 102. The amino acid sequences of NO:112 and 124, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than 30, 20 or 10 modifications (e.g. substitution, e.g., conservative substitution).

[0064] In some embodiments, HC CDR1, HC CDR2, and HC CDR3 are HC CDR sequences listed in Tables 11-13 (e.g., in a single row of Tables 11-13) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions)). In some embodiments, LC CDR1, LC CDR2, and LC CDR3 are LC CDR sequences listed in Tables 11-13 (e.g., in a single row of Tables 11-13) (or sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions)).

[0065] In some embodiments, HC CDR1, HC CDR2 and HC CDR3 respectively comprise the amino acid sequences of SEQ ID NO:179, 180 and 181, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution). In some embodiments, HC CDR1, HC CDR2, and HC CDR3 respectively comprise: (i) the amino acid sequences of SEQ ID NO: 137, 138, and 139, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions); or (ii) the amino acid sequences of SEQ ID NO: 160, 161, and 162, or amino acid sequences having at least about 85%, 90%, 95%, or 99% sequence identity with them, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than seven, six, or five modifications (e.g., substitutions, e.g., conservative substitutions).

[0066] In some embodiments, LC CDR1, LC CDR2 and LC CDR3 respectively comprise amino acid sequences of SEQ ID NO:147, 182 and 183, or amino acid sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or amino acid sequences having at least one, two or three modifications (e.g. substitution, e.g., conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g., conservative substitution). In some embodiments, LC CDR1, LC CDR2 and LC CDR3 respectively comprise: (i) the amino acid sequence of SEQ ID NO: 147, 148 and 149, or an amino acid sequence having at least about 85%, 90%, 95% or 99% sequence identity with it, or an amino acid sequence having at least one, two or three modifications (e.g. substitution, e.g. conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g. conservative substitution); or (ii) the amino acid sequence of SEQ ID NO: 147, 170 and 171, or an amino acid sequence having at least about 85%, 90%, 95% or 99% sequence identity with it, or an amino acid sequence having at least one, two or three modifications (e.g. substitution, e.g. conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g. conservative substitution).

[0067] In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2 and LC CDR3 respectively comprise: (i) the amino acid sequences of SEQ ID NO: 137, 138, 139, 147, 148 and 149, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or sequences having at least one, two or three modifications (e.g. substitution, e.g. conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g. conservative substitution); or (ii) the amino acid sequences of SEQ ID NO: 160, 161, 162, 147, 170 and 171, or sequences having at least about 85%, 90%, 95% or 99% sequence identity with them, or sequences having at least one, two or three modifications (e.g. substitution, e.g. conservative substitution) but no more than seven, six or five modifications (e.g. substitution, e.g. conservative substitution).

[0068] In some embodiments, the anti-BCMA binding domain includes a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 145 or 168, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the anti-BCMA binding domain includes VH, wherein the nucleic acid molecule comprises a nucleic acid sequence encoding VH, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 146 or 169, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0069] In some embodiments, the anti-BCMA binding domain comprises a light chain variable region (VL) containing the amino acid sequence of SEQ ID NO: 154 or 173, or an amino acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions). In some embodiments, the anti-BCMA binding domain comprises a VL, wherein the nucleic acid molecule comprises a nucleic acid sequence encoding the VL, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 155 or 174, or a nucleic acid sequence having at least about 85%, 90%, 95%, or 99% sequence identity therewith.

[0070] In some embodiments, the anti-BCMA binding domain comprises VH and VL, wherein VH and VL respectively comprise: (i) the amino acid sequences of SEQ ID NO: 145 and 154, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions), or (ii) the amino acid sequences of SEQ ID NO: 168 and 173, or sequences having at least about 85%, 90%, 95%, or 99% sequence identity therewith, or amino acid sequences having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions).

[0071] In one aspect, the present invention provides isolated polypeptide molecules encoded by the nucleic acid molecules described herein. In another aspect, the present invention provides a vector comprising the nucleic acid molecules described herein, or a nucleic acid molecule encoding a CAR described herein. In some embodiments, the vector is selected from DNA vectors, RNA vectors, plasmids, lentiviral vectors, adenoviral vectors, or retroviral vectors. In some embodiments, the vector comprises an EF-1 promoter comprising the nucleic acid sequence of SEQ ID NO:11. In one aspect, the present invention provides cells (e.g., T cells or NK cells) comprising the nucleic acid molecules described herein, the CAR described herein, the polypeptide molecules described herein, or the vector described herein. In some embodiments, the cell also expresses an inhibitor comprising a first polypeptide comprising at least a portion of an inhibitory molecule, associated with a second polypeptide comprising a positive signal from an intracellular signal transduction domain, optionally wherein the inhibitor comprises a first polypeptide containing at least a portion of PD-1 and a second polypeptide comprising a co-stimulatory domain and a primary signal transduction domain.

[0072] In one aspect, the present invention provides a method for preparing cells, the method comprising transducing cells (e.g., T cells or NK cells) using a vector described herein. In another aspect, the present invention provides a method for preparing RNA-engineered cells, the method comprising introducing in vitro transcribed RNA or synthetic RNA into cells (e.g., T cells or NK cells), wherein the RNA comprises a nucleic acid molecule described herein, or a nucleic acid molecule encoding a CAR described herein.

[0073] In one aspect, the present invention provides a method for providing antitumor immunity in a subject, the method comprising administering an effective amount of the cells described herein to the subject. In one aspect, the present invention provides a method for treating a subject suffering from a disease associated with BCMA expression, the method comprising administering an effective amount of the cells described herein to the subject. In some embodiments, the cells are autologous T cells or allogeneic T cells. In some embodiments, the disease associated with BCMA expression is: (i) cancer or malignancy, or a precancerous condition selected from one or more of the following: myelodysplastic syndrome, myelodysplastic syndrome, or preleukemia, or (ii) a non-cancer-related indication associated with BCMA expression. In some embodiments, the disease is a hematologic malignancy or a solid tumor. In some embodiments, the disease is selected from: acute leukemia, B-cell acute lymphoblastic leukemia (“BALL”), T-cell acute lymphoblastic leukemia (“TALL”), acute lymphoblastic leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell tumor, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorder, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplastic syndromes, non-Hodgkin lymphoma, plasmablastic lymphoma, plasmablastic lymphoma. Cellular plasmacytoid dendritic cell tumor, Waldenstrom macroglobulinemia, prostate cancer (e.g., castration-resistant or treatment-resistant prostate cancer or metastatic prostate cancer), pancreatic cancer, lung cancer, plasma cell proliferative disorders (e.g., asymptomatic myeloma (smoking multiple myeloma or indolent myeloma), monoclonal globulinemia of undetermined significance (MGUS), Waldenstrom macroglobulinemia, plasmacytoma (e.g., malignant plasma cell proliferation, solitary myeloma, solitary plasmacytoma, extramedullary plasmacytoma, and multiple plasmacytoma), systemic amyloid light chain amyloidosis or POEMS syndrome (also known as Crow-Fukase syndrome, Takatsuki disease, and PEP syndrome)), or a combination of said diseases. In some embodiments, the disease is multiple myeloma. In some embodiments, the method further includes administering a second therapeutic agent to the subject. In some embodiments, the second therapeutic agent is a PD-1 inhibitor, optionally wherein the PD-1 inhibitor is selected from the group consisting of PDR001, nivolumab, pembrolizumab, pilizumab, MEDI0680, REGN2810, TSR-042, PF-06801591 and AMP-224.In some embodiments, the second therapeutic agent is a PD-L1 inhibitor, optionally wherein the PD-L1 inhibitor is selected from the group consisting of FAZ053, atezolizumab, avelumab, durvalumab, and BMS-936559. In some embodiments, the second therapeutic agent is a LAG-3 inhibitor, optionally wherein the LAG-3 inhibitor is selected from the group consisting of LAG525, BMS-986016, TSR-033, MK-4280, and REGN3767. In some embodiments, the second therapeutic agent is a TIM-3 inhibitor, optionally wherein the TIM-3 inhibitor is selected from the group consisting of MBG453, TSR-022, and LY3321367. In some embodiments, the second therapeutic agent is a CTLA-4 inhibitor, optionally wherein the CTLA-4 inhibitor is ipilimumab or trimelimumab. In some embodiments, the second therapeutic agent is an interleukin-15 (IL-15) peptide, an interleukin-15 receptor α (IL-15Ra) peptide, or a combination of an IL-15 peptide and an IL-15Ra peptide (e.g., hetIL-15). In some embodiments, the second therapeutic agent is an interleukin-12 (IL-12) peptide. In some embodiments, the second therapeutic agent is an mTOR inhibitor, optionally wherein the mTOR inhibitor is RAD001 or rapamycin.

[0074] The anti-BCMA binding domain disclosed in this article and CARs containing such anti-BCMA binding domains have improved properties compared to previous anti-BCMA binding domains and CARs containing such anti-BCMA binding domains, such as increased binding affinity to BCMA, increased cellular (e.g., T cells or NK cells) CAR expression levels, and / or enhanced ability to mediate cytotoxicity and / or cellular (e.g., T cells or NK cells) cytokine production.

[0075] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While methods and materials similar to or equivalent to those described herein may be used in the practice or testing of this invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. Furthermore, materials, methods, and examples are illustrative only and not intended to be limiting. Titles, subheadings, or numbering or letter elements, such as (a), (b), (i), etc., are presented solely for readability. The use of titles, numbering, or letter elements in this document does not require that steps or elements be performed in alphabetical order, or that steps or elements must be discrete from each other. Other features, objectives, and advantages of the invention will become apparent from the specification, drawings, and claims. Attached Figure Description

[0076] Figures 1A to 1H The Jurkat NFAT luciferase (JNL) reporter gene assay, using an automated system, was used to test the function of BCMA CARs. The antigen-dependent activity of the CAR clone was assessed in the JNL reporter gene assay. JNL cells containing the specified CAR clone or untransduced JNL cells (UTD) were cultured separately in a culture medium (…). Figure 1G and 1H ) or with the target cell line (KMS11 (as a BCMA-positive cell line)) Figure 1A and 1C ) and NALM6 (as a BCMA-negative cell line) Figure 1E and 1F Clones were co-cultured in varying proportions, and luciferase activity was measured, which was used as the luminescence intensity. Clones were considered active when the luminescence intensity exceeded twice the UTD cell level in the presence of cells expressing the antigen. Luminescence readout was a direct measurement of CAR stimulation. Figure 1B and Figure 1D This is a graph showing the expression level of BCMA CAR on JNL cells using flow cytometry with recombinant human (r)BCMA_Fc-AF647. A 1× or 2× platform represents seeding of 40,000 or 80,000 H293 cells for virus production.

[0077] Figure 2 Expression levels of BCMA CAR on primary human T cells. Cells were stained with human rBCMA_Fc-AF647 reagent and the results were determined by flow cytometry. The percentages of CAR+ cells and MFI are shown in the graphs for days 5 and 9 of cell culture. Data are summarized in Table 17, which includes viral titers obtained for each CAR.

[0078] Figures 3A to 3C To evaluate the ability of T cells expressing a specified CAR to mediate cell lysis and cytokine production in KMS11 target cell lines expressing firefly luciferase (KMS11-luc). Figure 3A CART cells were co-cultured with KMS11-luc target cells at a specified E:T ratio. % cell killing was determined by the difference in luciferase signal between target cells without effector T cells (control) and target cells containing effector T cells (experiment), expressed as a percentage of control. UTD represents untransduced T cells. Figure 3B Background killing effect was observed in BCMA-negative NALM6. Figure 3CIFNγ was measured by MSD in the supernatant collected from these co-culture systems (E:T ratio 2.5) after 24 hours. All data are expressed as mean + / - standard deviation. Detailed Implementation

[0079] definition

[0080] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0081] The term "a / an" refers to one or more (i.e., at least one) grammatical object of the article. By way of example, "an element" means one or more elements.

[0082] When referring to measurable values ​​such as quantity, time interval, etc., the term “about” is intended to cover variations of ±20% or, in some cases, ±10%, or, in some cases, ±5%, or, in some cases, ±1%, or, in some cases, ±0.1% from the specified value, because such variations are appropriate for performing the disclosed method.

[0083] The compositions and methods of the present invention cover polypeptides and nucleic acids having a specified sequence, or a sequence substantially identical or similar thereto, such as sequences having at least 85%, 90%, or 95% or higher identity with the specified sequence. In the context of amino acid sequences, the term “substantially identical” is used herein to mean that the first amino acid sequence contains a sufficient or minimum number of amino acid residues i) identical to the aligned amino acid residues in the second amino acid sequence, or ii) being conserved substitutions of the aligned amino acid residues in the second amino acid sequence, such that the first and second amino acid sequences can have a common domain and / or common functional activity, for example, an amino acid sequence containing a common domain having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with a reference sequence (e.g., the sequence provided herein).

[0084] In the context of nucleotide sequences, the term “substantially identical” is used herein to mean that the first nucleic acid sequence contains a sufficient or minimum number of nucleotides that are identical to the aligned nucleotides in the second nucleic acid sequence, such that the first and second nucleotide sequences encode polypeptides with common functional activities, or encode common structural polypeptide domains or common functional polypeptide activities, for example, nucleotide sequences that have at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with a reference sequence (e.g., the sequence provided herein).

[0085] The term "variant" refers to a polypeptide having a substantially identical amino acid sequence to a reference amino acid sequence, or encoded by a substantially identical nucleotide sequence. In some embodiments, a variant is a functional variant.

[0086] The term "functional variant" refers to a polypeptide that has a substantially identical amino acid sequence to a reference amino acid sequence, or is encoded by a substantially identical nucleotide sequence, and is capable of having one or more activities of the reference amino acid sequence.

[0087] As used herein, the term “BCMA” refers to the B cell maturation antigen. BCMA (also known as TNFRSF17, BCM, or CD269) is a member of the tumor necrosis receptor (TNFR) family and is primarily expressed on terminally differentiated B cells (e.g., memory B cells) and plasma cells. Its ligands are called TNF family (BAFF) B cell activators and proliferation-inducing ligands (APRIL). BCMA is involved in regulating plasma cell survival to maintain long-term humoral immunity. The BCMA gene is encoded on chromosome 16, producing a 994-nucleotide primary mRNA transcript (NCBI accession number NM_001192.2) that encodes a 184-amino acid protein (NP_001183.2). A second antisense transcript derived from the BCMA locus has been described that can play a role in regulating BCMA expression (Laabi Y. et al., Nucleic Acids Res., 1994, 22:1147-1154). Additional transcript variants with unknown significance have been described (Smirnova AS et al., Mol Immunol. [Molecular Immunology], 2008, 45(4):1179-1183). A second isotype, also known as TV4 (Uniprot identifier Q02223-2), has been identified. As used herein, “BCMA” includes proteins containing mutations such as point mutations, fragments of full-length wild-type BCMA, insertions, deletions, and splice variants.

[0088] The term "chimeric antigen receptor" or "CAR" refers to a recombinant polypeptide construct that comprises at least an extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain") comprising a functional signaling domain derived from a stimulatory molecule as defined below. In some embodiments, the domains in the CAR polypeptide construct are located on the same polypeptide chain, for example, in a chimeric fusion protein. In some embodiments, such as those provided in RCAR as described herein, the domains in the CAR polypeptide construct are not contiguous with each other, for example, on different polypeptide chains.

[0089] In one aspect, the cytoplasmic signaling domain comprises a primary signaling domain (e.g., the primary signaling domain of CD3-ζ). In one aspect, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one co-stimulatory molecule as defined below. In one aspect, the co-stimulatory molecule is selected from 41BB (i.e., CD137), CD27, ICOS, and / or CD28. In one aspect, the CAR comprises a chimeric fusion protein (which comprises an extracellular antigen recognition domain), a transmembrane domain, and an intracellular signaling domain (which comprises a functional signaling domain derived from the stimulatory molecule). In one aspect, the CAR comprises a chimeric fusion protein (which comprises an extracellular antigen recognition domain), a transmembrane domain, and an intracellular signaling domain (which comprises a functional signaling domain derived from the co-stimulatory molecule and a functional signaling domain derived from the stimulatory molecule). In one aspect, the CAR comprises a chimeric fusion protein (which comprises an extracellular antigen recognition domain) | a transmembrane domain and an intracellular signaling domain (which comprises two functional signaling domains derived from one or more co-stimulatory molecules and a functional signaling domain derived from the stimulatory molecule). In one aspect, the CAR comprises a chimeric fusion protein (which includes an extracellular antigen recognition domain) | a transmembrane domain and an intracellular signal transduction domain (which includes at least two functional signal transduction domains derived from one or more co-stimulatory molecules and a functional signal transduction domain derived from a stimulatory molecule). In one aspect, the CAR comprises an optional leader sequence at the N-terminus (N-ter) of the CAR fusion protein. In one aspect, the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen recognition domain, wherein the leader sequence is optionally cleaved from the antigen recognition domain (e.g., scFv) during cellular processing and CAR localization to the cell membrane.

[0090] A CAR containing an antigen-binding domain (e.g., scFv (a single-domain antibody)) or a TCR (e.g., a TCRα-binding domain or a TCRβ-binding domain) that targets a specific tumor marker X (where X can be a tumor marker as described herein) is also called an XCAR. For example, a CAR containing an antigen-binding domain that targets BCMA is called a BCMA CAR. CARs can be expressed in any cell type, such as immune effector cells (e.g., T cells or NK cells) as described herein.

[0091] The term "signal transduction domain" refers to the functional portion of a protein that functions by transmitting information within the cell to regulate cellular activity via defined signal transduction pathways, either by generating a second messenger or by acting as an effector in response to such a messenger.

[0092] As used herein, the term "antibody" refers to a protein or polypeptide sequence derived from an immunoglobulin molecule that binds specifically to an antigen. Antibodies can be polyclonal or monoclonal, multi-chain or single-chain, or intact immunoglobulins, and can be derived from natural or recombinant sources. Antibodies can be tetramers of immunoglobulin molecules.

[0093] The term "antibody fragment" refers to at least a portion of a complete antibody or its recombinant variants, and specifically to an antigen-binding domain (e.g., the antigenic determination variable region of a complete antibody) sufficient to confer recognition and specific binding of the antibody fragment to a target (e.g., an antigen). Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2 and Fv fragments, scFv antibody fragments, linear antibodies, single-domain antibodies (e.g., sdAb(VL or VH)), camelid VHH domains, and multispecific molecules formed from antibody fragments such as bivalent fragments containing two or more (e.g., two) Fab fragments linked by disulfide bridges in a hinge region, or two or more (e.g., two) separate CDRs or other epitope-binding fragments of the linked antibody. Antibody fragments can also be incorporated into single-domain antibodies, multi-antibodies, microantibodies, nanobodies, intracellular antibodies, biantibodies, triantibodies, tetraantibodies, v-NARs, and dual scFvs (see, for example, Hollinger and Hudson, Nature Biotechnology 23:1126-1136, 2005). Antibody fragments can also be grafted into peptide-based scaffolds such as fibronectin type III (Fn3) (see U.S. Patent No. 6,703,199, which describes fibronectin peptide microantibodies).

[0094] The term "scFv" refers to a fusion protein comprising at least one antibody fragment containing a light chain variable region and at least one antibody fragment containing a heavy chain variable region, wherein the light and heavy chain variable regions are continuously linked by a short, flexible peptide linker and are capable of being expressed as a single-chain polypeptide, wherein the scFv retains the specificity of the complete antibody from which it is derived. Unless otherwise stated, as used herein, the scFv may, for example, have VL and VH variable regions in any order relative to the N-terminus and C-terminus of the polypeptide, and the scFv may comprise VL-linker-VH or may comprise VH-linker-VL.

[0095] As used herein, the term “complementarity-determining region” or “CDR” refers to the amino acid sequence within an antibody variable region that confers antigen specificity and binding affinity. For example, generally, there are three CDRs (e.g., HCDR1, HCDR2, and HCDR3) in each heavy chain variable region and three CDRs (LCDR1, LCDR2, and LCDR3) in each light chain variable region. The precise amino acid sequence boundaries of a given CDR can be determined using any of many well-known schemes, including those described below: Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th edition. Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme); Al-Lazikani et al., (1997) JMB 273, 927-948 (“Chothia” numbering scheme), or combinations thereof. In the combined Cabat and Josiah numbering schemes, in some embodiments, the CDR corresponds to an amino acid residue that is a part of a Cabat CDR, a Josiah CDR, or both.

[0096] The portion of the CAR composition of the present invention comprising an antibody or an antibody fragment thereof can be present in a variety of forms, such as wherein the antigen-binding domain is expressed as a portion of a polypeptide chain (including, for example, a single-domain antibody fragment (sdAb), a single-chain antibody (scFv), or, for example, a human or humanized antibody) (Harlow et al., 1999, in: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, in: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA, 85:5879-5883; Bird et al., 1988, Science, 242:423-426). In one aspect, the antigen-binding domain of the CAR composition of the present invention comprises an antibody fragment. In another respect, CAR contains antibody fragments containing scFv.

[0097] As used herein, the term "binding domain" or "antibody molecule" (also referred to herein as "anti-target binding domain") means a protein containing at least one immunoglobulin variable domain sequence, such as an immunoglobulin chain or fragment thereof. The term "binding domain" or "antibody molecule" encompasses both antibodies and antibody fragments. In one embodiment, the antibody molecule is a multispecific antibody molecule, for example, containing a plurality of immunoglobulin variable domain sequences, wherein a first immunoglobulin variable domain sequence of the plurality has binding specificity to a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity to a second epitope. In one embodiment, the multispecific antibody molecule is a bispecific antibody molecule. A bispecific antibody is specific to no more than two antigens. A bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence having binding specificity to a first epitope and a second immunoglobulin variable domain sequence having binding specificity to a second epitope.

[0098] The term "antibody heavy chain" refers to the larger of the two types of polypeptide chains present in the naturally occurring conformation of an antibody molecule, and it usually determines the category to which the antibody belongs.

[0099] The term "antibody light chain" refers to the smaller of two types of polypeptide chains present in the naturally occurring conformation of an antibody molecule. Kappa (κ) and lambda (λ) light chains refer to the two main isotypes of antibody light chains.

[0100] The term "recombinant antibody" refers to an antibody produced using recombinant DNA technology, such as antibodies expressed by phage or yeast expression systems. The term should also be interpreted as meaning an antibody produced by synthesizing a DNA molecule encoding the antibody and a DNA molecule expressing the antibody protein or specifying the amino acid sequence of the antibody, wherein the DNA or amino acid sequence has been obtained using recombinant DNA or amino acid sequencing technologies available and well-known in the art.

[0101] The term "antigen" or "Ag" refers to a molecule that elicits an immune response. An immune response may involve antibody production or activation of specific immune-active cells, or both. Those skilled in the art will understand that virtually any macromolecule, including all proteins or peptides, can act as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. Those skilled in the art will understand that any DNA containing a nucleotide sequence or a portion of a protein encoding an immune response therefore encodes an "antigen" (as used herein). Furthermore, those skilled in the art will understand that an antigen does not necessarily need to be encoded solely by the full-length nucleotide sequence of a gene. It is apparent that the invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in various combinations to encode polypeptides that elicit a desired immune response. Additionally, those skilled in the art will understand that an antigen does not necessarily need to be encoded by a "gene". It is apparent that antigens can be synthesized or derived from biological samples, or can be macromolecules other than polypeptides. Such biological samples can include, but are not limited to, tissue samples, tumor samples, cells, or fluids containing other biological components.

[0102] The term "antitumor effect" refers to biological effects that can be manifested through various means, including but not limited to, reducing tumor volume, reducing the number of tumor cells, reducing the number of tumor metastases, increasing life expectancy, reducing tumor cell proliferation, reducing tumor cell survival, or improving various physiological symptoms associated with cancer. "Antitumor effect" can also be manifested through the ability of the peptides, polynucleotides, cells, and antibodies of this invention to prevent tumor development.

[0103] The term "anticancer effect" refers to biological effects that can be manifested through various means, including but not limited to, reductions in tumor volume, number of cancer cells, number of metastases, life expectancy, cancer cell proliferation, cancer cell survival, or improvement of various physiological symptoms associated with cancer. "Anticancer effects" can also be manifested through the ability of peptides, polynucleotides, cells, and antibodies to prevent cancer from developing in the first place. The term "antitumor effect" refers to biological effects that can be manifested through various means, including but not limited to, reductions in tumor volume, number of tumor cells, tumor cell proliferation, or tumor cell survival. The term "autologous" refers to any material derived from the same individual as that subsequently reintroduced into the individual.

[0104] The term "alien" refers to any material derived from different animals of the same species as the individual to which the material was introduced. Two or more individuals are said to be alliens of each other when the genes at one or more loci are different. In some respects, allien materials from individuals of the same species can be genetically sufficiently different to interact antigenically.

[0105] The term "heterogeneous" refers to grafts derived from animals of different species.

[0106] As used herein, the term “apheresis” refers to an in vitro procedure recognized in the art in which blood from a donor or patient is removed from the donor or patient and passed through a device that separates one or more selected specific components, and the remainder is returned to the donor or patient’s circulation (e.g., by retransfusion). Thus, in the context of “single sample,” it refers to a sample obtained using apheresis.

[0107] The term "cancer" refers to a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread locally or to other parts of the body via the bloodstream and lymphatic system. This article describes examples of various cancers, including but not limited to breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, and lung cancer. Preferred cancers that can be treated using the methods described herein include multiple myeloma, Hodgkin's lymphoma, or non-Hodgkin's lymphoma.

[0108] The terms “tumor” and “cancer” are used interchangeably in this document; for example, both terms include solid and liquid, such as diffuse or circulating tumors. As used herein, the terms “cancer” or “tumor” include both pre-existing and malignant cancers and tumors.

[0109] "Derived from" (as used herein) indicates a relationship between the first and second molecules. It generally refers to the structural similarity between the first and second molecules and does not imply or include limitations on the process or origin of the first molecule derived from the second molecule. For example, in the case of an intracellular signal transduction domain derived from the CD3ζ molecule, the intracellular signal transduction domain retains sufficient CD3ζ structure to enable it to perform the desired function, i.e., the ability to generate a signal under appropriate conditions. It does not imply or include limitations on the specific process for generating the intracellular signal transduction domain; for example, it does not imply that, in order to provide the intracellular signal transduction domain, one must start with the CD3ζ sequence and delete unwanted sequences, or impose mutations to reach the intracellular signal transduction domain.

[0110] The phrase “diseases associated with BCMA expression” includes, but is not limited to, diseases or conditions associated with cells expressing BCMA (e.g., wild-type or mutant BCMA), including, for example, proliferative disorders (such as cancer or malignancy) or precancerous conditions (such as myelodysplastic syndrome, myelodysplastic syndrome, or preleukemia); or non-cancer-related indications associated with cells expressing BCMA (e.g., wild-type or mutant BCMA). For the avoidance of ambiguity, diseases associated with BCMA expression can include conditions associated with cells that previously expressed BCMA but do not currently express it (e.g., due to downregulation of BCMA expression, such as from treatment with a molecule targeting BCMA (e.g., a BCMA inhibitor described herein)). In one aspect, cancers associated with BCMA (e.g., wild-type or mutant BCMA) expression are hematologic malignancies. In another aspect, hematologic malignancies are leukemia or lymphoma. In another aspect, cancers associated with BCMA (e.g., wild-type or mutant BCMA) expression are malignancies of differentiated plasma B cells. In one aspect, cancers associated with BCMA (e.g., wild-type or mutant BCMA) expression include cancers and malignancies, including but not limited to: one or more acute leukemias, including but not limited to B-cell acute lymphoblastic leukemia (“BALL”), T-cell acute lymphoblastic leukemia (“TALL”), and acute lymphoblastic leukemia (ALL); and one or more chronic leukemias, including but not limited to chronic myeloid leukemia (CML) and chronic lymphocytic leukemia (CLL). Other cancers or hematologic disorders associated with BCMA (e.g., wild-type or mutant BCMA) expression include, but are not limited to, B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell tumor, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplastic syndromes and myelodysplastic syndromes, non-Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell tumor, Waldenström macroglobulinemia, and "preleukemia" (a diverse set of hematologic disorders associated with ineffective production (or dysplasia) of myeloid blood cells), etc. In some embodiments, the cancer is multiple myeloma, Hodgkin lymphoma, non-Hodgkin lymphoma, or glioblastoma.In the embodiments, diseases associated with BCMA expression include plasma cell proliferation disorders such as asymptomatic myeloma (smoking multiple myeloma or indolent myeloma), monoclonal gammopathy of undetermined significance (MGUS), Waldenström macroglobulinemia, plasmacytomas (e.g., malignant plasmacytosis, solitary myeloma, solitary plasmacytoma, extramedullary plasmacytoma, and multiple plasmacytoma), systemic amyloid light chain amyloidosis, and POEMS syndrome (also known as Crohn's-Fox syndrome, Goyuey disease, and PEP syndrome). Other diseases associated with BCMA expression (e.g., wild-type or mutant BCMA) include, but are not limited to, atypical and / or non-classical cancers, malignancies, precancerous conditions or proliferative disorders associated with BCMA expression (e.g., wild-type or mutant BCMA), such as the cancers described herein, such as prostate cancer (e.g., castration-resistant or treatment-resistant prostate cancer or metastatic prostate cancer), pancreatic cancer, or lung cancer.

[0111] Non-cancer-related conditions associated with BCMA (e.g., wild-type or mutant BCMA) include viral infections, such as HIV; fungal infections, such as Cryptococcus neoformans; autoimmune diseases, such as rheumatoid arthritis, systemic lupus erythematosus (SLE or lupus), pemphigus vulgaris, and Sjogren's syndrome; inflammatory bowel disease, ulcerative colitis; transplant-related allogeneic-specific immune disorders related to mucosal immunity; and undesirable immune responses to biologics (such as factor VIII), where humoral immunity is important. In embodiments, non-cancer-related indications associated with BCMA expression include, but are not limited to, autoimmune diseases (e.g., lupus), inflammatory disorders (allergic reactions and asthma), and transplantation. In some embodiments, cells expressing tumor antigens express or at any time express mRNA encoding tumor antigens. In one embodiment, cells expressing tumor antigens produce tumor antigen proteins (e.g., wild-type or mutant), and the tumor antigen proteins may be present at normal or reduced levels. In one embodiment, cells expressing tumor antigens produce detectable levels of tumor antigen proteins at a point in time and subsequently produce substantially no detectable tumor antigen proteins.

[0112] The term "conserved sequence modification" refers to amino acid modifications that do not significantly affect or alter the binding characteristics of an antibody or antibody fragment containing an amino acid sequence. Such conserved modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies or antibody fragments of the present invention using standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. A conserved substitution is a substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids having basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, one or more amino acid residues in the CAR of the present invention can be replaced by other amino acid residues from the same side chain family, and the modified CAR can be tested using the functional assays described herein.

[0113] The term "stimulus" refers to a signal transduction event mediated by the induction of a primary response through the binding of a stimulating molecule (e.g., the TCR / CD3 complex) to its homologous ligand, such as, but not limited to, signal transduction via the TCR / CD3 complex. Stimulus can mediate altered expression of certain molecules, such as downregulation of TGF-β and / or remodeling of the cytoskeleton.

[0114] The term "stimulatory molecule" refers to a molecule expressed by T cells that provides one or more primary cytoplasmic signaling sequences that stimulately regulate primary activation of the TCR complex at least some aspects of the T cell signaling pathway. In some embodiments, the ITAM-containing domain within the CAR reproduces primary TCR signaling independently of the endogenous TCR complex. In one aspect, primary signaling is initiated, for example, by the binding of the TCR / CD3 complex to an MHC molecule carrying a peptide, and this leads to the mediation of T cell responses (including, but not limited to, proliferation, activation, differentiation, etc.). The stimulated primary cytoplasmic signaling sequence (also referred to as the "primary signaling domain") may contain a signaling motif known as an immune receptor tyrosine-based activation motif or an ITAM. Examples of primary cytoplasmic signaling sequences containing ITAM that are particularly useful in this invention include, but are not limited to, those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS"), FcεRI and CD66d, DAP10 and DAP12. In a particular CAR of this invention, the intracellular signaling domain in any one or more CARs of this invention contains an intracellular signaling sequence, such as a primary signaling sequence of CD3ζ. The term "antigen-presenting cell" or "APC" refers to immune system cells, such as helper cells (e.g., B cells, dendritic cells, etc.), that display foreign antigens complexed with the major histocompatibility complex (MHC) on their surface. T cells can recognize these complexes using their T cell receptors (TCRs). APCs process antigens and present them to T cells.

[0115] As used herein, the term "intracellular signaling domain" refers to the intracellular portion of a molecule. In the embodiments, intracellular signaling domains transduce effector functional signals and direct the cell to perform specialized functions. While the entire intracellular signaling domain can be used, in many cases it is not necessary to use the entire chain. Regarding the use of a truncated portion of an intracellular signaling domain, such a truncated portion can be used instead of the complete chain, provided that the truncated portion transduces effector functional signals. Therefore, the term "intracellular signaling domain" means any truncated portion of an intracellular signaling domain that is sufficient to transduce effector functional signals.

[0116] Intracellular signal transduction domains generate signals that promote immune effector functions in CAR-containing cells (e.g., CAR-T cells). Examples of immune effector functions, such as in CAR-T cells, include cytolytic activity and cofactor activities (including cytokine secretion).

[0117] In one embodiment, an intracellular signaling domain may include a primary intracellular signaling domain. Exemplary primary intracellular signaling domains include those derived from molecules responsible for primary stimulation or antigen-dependent mimicry. In one embodiment, an intracellular signaling domain may include a co-stimulatory intracellular domain. Exemplary co-stimulatory intracellular signaling domains include those derived from molecules responsible for co-stimulatory signals or antigen-independent stimulation. For example, in the case of CAR-T, the primary intracellular signaling domain may include a cytoplasmic sequence of a T cell receptor, and the co-stimulatory intracellular signaling domain may include a cytoplasmic sequence from a co-receptor or co-stimulatory molecule.

[0118] Primary intracellular signaling domains may contain signaling motifs known as immune receptor tyrosine-based activation motifs or ITAMs. Examples of primary cytoplasmic signaling sequences containing ITAMs include, but are not limited to, those derived from CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS"), FcεRI, CD66d, DAP10, and DAP12.

[0119] The terms “ζ” or “ζ chain,” “CD3-ζ” or “TCR-ζ” refer to CD247. Swiss-Prot accession number P20963 provides an exemplary human CD3ζ amino acid sequence. “ζ-stimulatory domain” or “CD3-ζ-stimulatory domain” or “TCR-ζ-stimulatory domain” refers to the stimulatory domain of CD3-ζ or a variant thereof (e.g., a molecule with a mutation (e.g., point mutation), fragment, insertion, or deletion). In some embodiments, the cytoplasmic domain of ζ comprises residues 52 to 164 of GenBank accession number BAG36664.1 or a variant thereof (e.g., a molecule with a mutation (e.g., point mutation), fragment, insertion, or deletion). In some embodiments, “ζ-stimulatory domain” or “CD3-ζ-stimulatory domain” is the sequence provided in SEQ ID NO:9 or 10 or a variant thereof (e.g., a molecule with a mutation (e.g., point mutation), fragment, insertion, or deletion).

[0120] The term "co-stimulatory molecule" refers to a homologous binding partner on a T cell that specifically binds to a co-stimulatory ligand, thereby mediating a co-stimulatory response in T cells, such as, but not limited to, proliferation. Co-stimulatory molecules are cell surface molecules other than antigen receptors or their ligands required for an effective immune response. Co-stimulatory molecules include, but are not limited to, MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signal transduction lymphocyte activation molecules (SLAM proteins), activating NK cell receptors, BTLA, Toll ligand receptors, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, and ICOS (CD278). GITR, BAFFR, LIGHT, HVEM(LIGHTR), KIRDS2, SLAMF7, NKp80(KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD 8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD 103. ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C , TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRTAM, Ly9(CD22 9) CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, CD28-OX40, CD28-4-1BB and ligands that specifically bind to CD83.

[0121] The intracellular signal transduction domain of a costimulatory molecule refers to the intracellular portion of the costimulatory molecule.

[0122] Intracellular signal transduction domains can contain the entire intracellular portion of the molecule from which they originate, or the entire natural intracellular signal transduction domain or a functional fragment thereof.

[0123] The term "4-1BB" refers to CD137 or tumor necrosis factor receptor superfamily member 9. Swiss-Prot accession number P20963 provides an exemplary human 4-1BB amino acid sequence. "4-1BB co-stimulatory domain" refers to a co-stimulatory domain of 4-1BB or a variant thereof (e.g., a molecule with a mutation (e.g., point mutation), fragment, insertion, or deletion). In some embodiments, the "4-1BB co-stimulatory domain" is the sequence provided in SEQ ID NO:7 or a variant thereof (e.g., a molecule with a mutation (e.g., point mutation), fragment, insertion, or deletion).

[0124] When used in this document, “immune effector cells” refers to cells that participate in an immune response (e.g., promote immune effector responses). Examples of immune effector cells include T cells, such as α / β T cells and γ / δ T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and bone marrow-derived phagocytes.

[0125] When used herein, "immune effector function or immune effector response" refers, for example, to a function or response of immune effector cells that enhances or promotes the immune attack of target cells. For instance, an immune effector function or response refers to the property of promoting the killing of target cells or inhibiting the growth or proliferation of T or NK cells. In the case of T cells, primary stimulation and co-stimulation are examples of immune effector functions or responses.

[0126] The term "effective function" refers to a cell's specialized function. For example, the effector functions of T cells can be cytolytic activity or helper activity (including cytokine secretion).

[0127] The term "coding" refers to the inherent property of a specific nucleotide sequence in a polynucleotide (such as a gene, cDNA, or mRNA) as a template for the synthesis of other polymers and macromolecules having defined nucleotide sequences (e.g., rRNA, tRNA, and mRNA) or defined amino acid sequences in biological processes, and the resulting biological properties. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, then the gene, cDNA, or RNA encodes that protein. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is usually provided in the sequence listing) and the non-coding strand (which serves as a template for the transcription of the gene or cDNA) can be referred to as encoding a protein or other product of that gene or cDNA.

[0128] Unless otherwise stated, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate and encode the same amino acid sequence. A nucleotide sequence encoding a protein or RNA phrase may also contain introns, to the extent that the nucleotide sequence encoding the protein may contain one or more introns in some form.

[0129] The terms “effective amount” or “therapeutic effective amount” are used interchangeably herein and refer to the amount of a compound, formulation, material or composition as described herein that is effective in achieving a particular biological outcome.

[0130] The term "endogenous" refers to any material that originates from or is produced within an organism, cell, tissue, or system.

[0131] The term "exogenous" refers to any material introduced from or generated outside of an organism, cell, tissue, or system.

[0132] The term "expression" refers to the transcription and / or translation of a specific nucleotide sequence. In some embodiments, expression includes the translation of mRNA introduced into cells.

[0133] The term "transfer vector" refers to a composition of substances containing isolated nucleic acids and capable of delivering those isolated nucleic acids into cells. Many vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Therefore, the term "transfer vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to further include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral transfer vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, etc.

[0134] The term "expression vector" refers to a vector containing a recombinant polynucleotide that includes an expression control sequence operatively linked to a nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression; other elements for expression may be provided by a host cell or in an in vitro expression system. Expression vectors include all expression vectors known in the art, including viscera, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating recombinant polynucleotides.

[0135] The term "lentivirus" refers to a genus within the family Retroviridae. Lentivirals are unique among retroviruses in that they can infect non-dividing cells; they can deliver significant amounts of genetic information into the host cell's DNA, making them one of the most efficient gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses.

[0136] The term "lentiviral vector" refers to a vector derived from at least a portion of a lentiviral genome, particularly including self-inactivated lentiviral vectors provided in Milone et al., Mol. Ther. [Molecular Therapy] 17(8):1453-1464 (2009). Other examples of lentiviral vectors that can be used clinically include, but are not limited to, those from Oxford BioMedica. LENTIMAX, a gene delivery technology from Lentigen. TM Vector systems, etc. Non-clinical lentiviral vectors are also available and are known to those skilled in the art.

[0137] The terms "homologous" or "identical" refer to the identity of subunit sequences between two polymer molecules (e.g., between two nucleic acid molecules (such as two DNA molecules or two RNA molecules), or between two polypeptide molecules). Subunit positions in both molecules are occupied by the same monomeric subunit; for example, if a position in each of two DNA molecules is occupied by adenine, then they are homologous or identical at that position. Homology between two sequences is a direct function of the number of matching or homologous positions; for example, if half the positions in two sequences (e.g., five positions in a polymer of ten subunits) are homologous, then the two sequences are 50% homologous; if 90% of the positions (e.g., nine out of ten) are matching or homologous, then the two sequences are 90% homologous.

[0138] Humanized forms of non-human (e.g., mouse) antibodies are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')2, or other antigen-binding sequences of the antibody) containing minimal sequences derived from non-human immunoglobulins. In most cases, humanized antibodies and their fragments are human immunoglobulins (receptor antibodies or antibody fragments) in which residues from the receptor's complementarity-determining region (CDR) are replaced by residues from the CDR of a non-human species (donor antibody) (such as a mouse, rat, or rabbit with the desired specificity, affinity, and ability). In some cases, Fv frame region (FR) residues of human immunoglobulins are replaced by corresponding non-human residues. Furthermore, humanized antibodies / antibody fragments may contain residues not found in the receptor antibody or in the introduced CDR or frame sequence. These modifications can further improve and optimize antibody or antibody fragment performance. Typically, humanized antibodies or antibody fragments thereof will contain substantially all of the following: at least one (typically two) variable domains, wherein all or substantially all CDR regions correspond to those CDR regions of non-human immunoglobulins, and all or a significant portion of FR regions are those of human immunoglobulin sequences. Humanized antibodies or antibody fragments may also contain at least a portion of the immunoglobulin constant region (Fc), typically at least a portion of the constant region of human immunoglobulins. For further details, see Jones et al., Nature, 321:522-525, 1986; Reichmann et al., Nature, 332:323-329, 1988; Presta, Curr. Op. Struct. Biol., 2:593-596, 1992.

[0139] "Complete human" refers to immunoglobulins, such as antibodies or antibody fragments, in which the whole molecule is of human origin or consists of the same amino acid sequence as the human form of the antibody or immunoglobulin.

[0140] The term "isolated" means altered or removed from its natural state. For example, nucleic acids or peptides naturally present in living animals are not "isolated," but the same nucleic acids or peptides that are partially or completely separated from their natural coexisting material are "isolated." Isolated nucleic acids or proteins can exist in a substantially purified form or can exist in non-natural environments (such as host cells).

[0141] In the context of this invention, the following abbreviations for common nucleic acid bases are used: “A” for adenosine, “C” for cytosine, “G” for guanosine, “T” for thymidine, and “U” for uridine.

[0142] The term "operably linked" or "transcriptional control" refers to a functional link between a regulatory sequence and a heterologous nucleic acid sequence that results in the expression of the latter. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is positioned to have a functional relationship with the second nucleic acid sequence. Similarly, a promoter is operably linked to a coding sequence if it affects the transcription or expression of that coding sequence. Operatively linked DNA sequences can be adjacent to each other and, for example, in cases where two protein-coding regions need to be linked, they are located within the same reading frame.

[0143] The term “parenteral” administration of immunogenic compositions includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection, intratumoral, or infusion techniques.

[0144] The terms “nucleic acid,” “nucleic acid molecule,” “polynucleotide,” or “polynucleotide molecule” refer to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in single-stranded or double-stranded form and their polymers. Unless specifically defined, the term covers nucleic acids containing known natural nucleotide analogs that have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. In some embodiments, “nucleic acid,” “nucleic acid molecule,” “polynucleotide,” or “polynucleotide molecule” includes nucleotide / nucleoside derivatives or analogs. Unless otherwise stated, a particular nucleic acid sequence also implicitly covers variants of its conserved modifications (e.g., degenerate codon substitutions, such as conserved substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as explicitly stated sequences. Specifically, degenerate codon substitutions (e.g., conserved substitutions) can be achieved by producing sequences in which the third position of one or more selected (or all) codons is replaced by mixed bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

[0145] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to compounds containing amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can constitute a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids linked together by peptide bonds. As used herein, the term refers to short chains, such as those commonly referred to in the art as peptides, oligopeptides, and oligomers; and also to longer chains, commonly referred to in the art as proteins, of which there are many types. “Polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include native peptides, recombinant peptides, or combinations thereof.

[0146] The term "promoter" refers to a DNA sequence that is recognized by the cellular synthetic machinery or introduced synthetic machinery and is required to initiate the specific transcription of a polynucleotide sequence.

[0147] The term "promoter / regulatory sequence" refers to the nucleic acid sequence required to express a gene product operatively linked to a promoter / regulatory sequence. In some cases, this sequence may be a core promoter sequence, and in others, it may also contain enhancer sequences and other regulatory elements required to express the gene product. A promoter / regulatory sequence may be, for example, a promoter / regulatory sequence that expresses a gene product in a tissue-specific manner.

[0148] The term “constitutive” promoter refers to the nucleotide sequence that, when operatively linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in the cell under most or all physiological conditions of the cell.

[0149] The term "inducible" promoter refers to a nucleotide sequence that, when operatively linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in the cell essentially only when the inducer corresponding to the promoter is present in the cell.

[0150] The term "tissue-specific" promoter refers to a nucleotide sequence that, when operatively linked to a polynucleotide encoding or specified by a gene, causes the gene product to be produced in the cell primarily only when the cell is a cell of the tissue type corresponding to the promoter.

[0151] The terms “cancer-associated antigen” or “tumor antigen” are interchangeable to refer to molecules (typically proteins, carbohydrates, or lipids) expressed fully or as fragments (e.g., MHC / peptides) on the surface of cancer cells, and can be used to preferentially target pharmacological agents to cancer cells. In some embodiments, the tumor antigen is a marker expressed by both normal cells and cancer cells, such as a lineage marker, such as CD19 on B cells. In some embodiments, the tumor antigen is a cell surface molecule overexpressed in cancer cells compared to normal cells, for example, 1-fold, 2-fold, 3-fold, or more overexpression compared to normal cells. In some embodiments, the tumor antigen is a cell surface molecule inappropriately synthesized in cancer cells, for example, a molecule containing deletions, additions, or mutations compared to molecules expressed on normal cells. In some embodiments, the tumor antigen will be expressed fully or as fragments (e.g., MHC / peptides) only on the surface of cancer cells and will not be synthesized or expressed on the surface of normal cells. In some embodiments, the CAR of the present invention comprises an antigen-binding domain (e.g., an antibody or antibody fragment) that binds to an MHC-presented peptide. Typically, peptides derived from endogenous proteins fill the pockets of major histocompatibility complex (MHC) class I molecules and are recognized by the T cell receptor (TCR) on CD8+ T lymphocytes. MHC class I complexes are constitutively expressed by all nucleated cells. In cancer, virus-specific and / or tumor-specific peptide / MHC complexes represent a unique class of cell surface targets for immunotherapy. TCR-like antibodies targeting peptides derived from viral or tumor antigens in the context of human leukocyte antigen (HLA)-A1 or HLA-A2 have been described (see, for example, Sastry et al., J Virol. 2011 85(5):1935-1942; Sergeeva et al., Blood. 2011 117(16):4262-4272; Verma et al., J Immunol. 2010 184(4):2156-2165; Willemsen et al., GeneTher. 20018(21):1601-1608; Dao et al., Sci Transl Med. 20135(176):176ra33; Tassev et al., Cancer Gene Ther. 201219(2):84-100). For example, TCR-like antibodies can be identified from screening libraries (such as human scFv phage display libraries).

[0152] The terms "tumor-supporting antigen" or "cancer-supporting antigen" are used interchangeably to refer to molecules (typically proteins, carbohydrates, or lipids) expressed on the surface of cells that are not cancerous themselves but support cancer cells, for example, by promoting their growth or survival, such as through resistance to immune cells. Exemplary cells of this type include stromal cells and myeloid-derived suppressor cells (MDSCs). The tumor-supporting antigen itself does not need to function on tumor-supporting cells, as long as the antigen is present on cells supporting cancer cells.

[0153] As used in the context of scFv, the term "flexible peptide linker" or "linker" refers to a peptide linker composed of amino acid residues (such as glycine and / or serine) used alone or in combination to link a variable heavy chain region and a variable light chain region together. In some embodiments, the flexible peptide linker is a Gly / Ser linker and comprises the amino acid sequence (Gly-Gly-Gly-Ser)n, where n is a positive integer equal to or greater than 1. For example, n = 1, n = 2, n = 3, n = 4, n = 5, and n = 6, n = 7, n = 8, n = 9, and n = 10 (SEQ ID NO: 42). In some embodiments, the flexible peptide linker includes, but is not limited to, (Gly4Ser)4 (SEQ ID NO: 27) or (Gly4Ser)3 (SEQ ID NO: 28). In another embodiment, the linker comprises multiple repeats of (Gly2Ser), (GlySer), or (Gly3Ser) (SEQ ID NO: 29). The connector described in WO 2012 / 138475 is also included within the scope of this invention, which is incorporated herein by reference.

[0154] As used herein, a 5' cap (also known as an RNA cap, RNA 7-methylguanosine cap, or RNA m7G cap) is a modified guanine nucleotide added to the "front" or 5' end of eukaryotic messenger RNA shortly after transcription begins. The 5' cap consists of a terminal group linked to the first transcribed nucleotide. Its presence is essential for recognition by ribosomes and protection against RNases. Cap addition is transcriptionally coupled and occurs co-transcribedly, so that each affects the other. Shortly after transcription begins, the 5' end of the synthesized mRNA is bound to a cap-synthesizing complex associated with RNA polymerase. This enzymatic complex catalyzes the chemical reactions required for mRNA capping. Synthesis proceeds as a multi-step biochemical reaction. The capping portion can be modified to modulate mRNA function, such as its stability or translation efficiency.

[0155] As used herein, "in vitro transcribed RNA" refers to RNA synthesized in vitro, preferably mRNA. Typically, in vitro transcribed RNA is produced by an in vitro transcription vector. The in vitro transcription vector contains a template for producing in vitro transcribed RNA.

[0156] As used herein, “poly(A)” refers to a series of adenosines attached to mRNA via polyadenylation. In preferred embodiments of the construct used for transient expression, the number of poly(A) sequences is between 50 and 5000 (SEQ ID NO:30), preferably greater than 64, more preferably greater than 100, and most preferably greater than 300 or 400. The poly(A) sequence may be chemically or enzymatically modified to modulate mRNA function, such as localization, stability, or translation efficiency.

[0157] As used herein, “polyadenylation” refers to the covalent attachment of a polyadenylated moiety or a modified variant thereof to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' poly(A) tail is a long sequence of adenine nucleotides (usually hundreds) added to the pre-mRNA by the action of an enzyme (polyadenylate polymerase). In higher eukaryotes, the poly(A) tail is added to transcripts containing a specific sequence (the polyadenylation signal). The poly(A) tail and the proteins bound to it help protect mRNA from degradation by exonucleases. Polyadenylation is also important for transcription termination, the export of mRNA from the nucleus, and translation. Polyadenylation occurs immediately in the nucleus after DNA is transcribed into RNA, but can also occur later in the cytoplasm. After transcription has terminated, the mRNA chain is cleaved by an endonuclease complex associated with RNA polymerase. A cleavage site is typically characterized by the presence of the base sequence AAUAAA near the cleavage site. After mRNA is cleaved, adenosine residues are added to the free 3' end at the cleavage site.

[0158] As used in this article, “transient” refers to the expression of a non-integrating transgene that lasts for hours, days, or weeks, where the duration of expression is shorter than the duration of expression of a gene when it is integrated into the genome or contained within a stable plasmid replicon in the host cell.

[0159] As used herein, the terms "treat," "treatment," and "treating" refer to reducing or improving the progression, severity, and / or duration of a proliferative disorder, or improving one or more symptoms (preferably one or more identifiable symptoms) of a proliferative disorder, caused by the administration of one or more therapies (e.g., one or more therapeutic agents, such as the CAR of the present invention). In specific embodiments, the terms "treat," "treatment," and "treating" refer to improving at least one measurable physical parameter of a proliferative disorder, such as tumor growth, which is not necessarily identifiable by the patient. In other embodiments, the terms "treat," "treatment," and "treating" refer to inhibiting the progression of a proliferative disorder physically, for example, by stabilizing identifiable symptoms, or physiologically, for example, by stabilizing physical parameters, or both. In other embodiments, the terms "treat," "treatment," and "treating" refer to reducing or stabilizing tumor size or cancer cell count.

[0160] The term "signal transduction pathway" refers to the biochemical relationships among various signal transduction molecules that play a role in transmitting signals from one part of the cell to another. The phrase "cell surface receptors" includes molecules and molecular complexes that can receive and transmit signals across the cell membrane.

[0161] The term "subject" is intended to include living organisms (e.g., mammals, humans) in which an immune response can be elicited.

[0162] The term "substantially purified" cells refer to cells that are essentially free of other cell types. Substantially purified cells also refer to cells that have been isolated from other cell types normally associated with their natural state of existence. In some cases, a substantially purified cell population refers to a homogeneous cell population. In other cases, the term refers only to cells that have been isolated from cells naturally associated with their natural state. In some respects, cells are cultured in vitro. In other respects, cells are not cultured in vitro.

[0163] As used in this article, the term "therapeutic agent" means treatment. Therapeutic effects are achieved by reducing, suppressing, alleviating, or eradicating a disease state.

[0164] As used in this article, the term "prevention" refers to preventive or protective treatment of a disease or disease state.

[0165] In the context of this invention, "tumor antigen" or "hyperplastic disorder antigen" or "antigen associated with hyperplastic disorder" refers to antigens commonly found in specific hyperplastic disorders. In some aspects, the hyperproliferative disorder antigens of the present invention are derived from cancer, including but not limited to primary or metastatic melanoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non-Hodgkin lymphoma, Hodgkin lymphoma, leukemia, uterine cancer, cervical cancer, bladder cancer, kidney cancer, and adenocarcinoma (such as breast cancer, prostate cancer (e.g., castration-resistant or treatment-resistant prostate cancer or metastatic prostate cancer), ovarian cancer, pancreatic cancer, etc.) or plasma cell proliferation disorders, such as asymptomatic myeloma (smoldering multiple myeloma or indolent myeloma), monoclonal globulinemia of undetermined significance (MGUS), Waldenström macroglobulinemia, plasmacytomas (e.g., malignant proliferation of plasma cells, solitary myeloma, solitary plasmacytoma, extramedullary plasmacytoma, and multiple plasmacytomas), systemic amyloid light chain amyloidosis, and POEMS syndrome (also known as Crohn-Fox syndrome, Goyuey disease, and PEP syndrome).

[0166] The terms "transfected," "transformed," or "transduced" refer to the process of transferring or introducing exogenous nucleic acids into host cells. "Transfected," "transformed," or "transduced" cells are cells that have been transfected, transformed, or transduced with exogenous nucleic acids. Cells include primary host cells and their progeny.

[0167] The term "specific binding" refers to an antibody or ligand that recognizes and binds to homologous binding partners (e.g., stimulatory and / or costimulatory molecules present on T cells) proteins present in a sample, but in which the antibody or ligand substantially does not recognize or bind to other molecules in the sample.

[0168] As used herein, a “tunable chimeric antigen receptor (RCAR)” refers to a group of peptides (typically two in the simplest embodiment) that, when in immune effector cells, provide the cell with specificity for a target cell (typically a cancer cell) and have intracellular signaling. In some embodiments, an RCAR comprises at least an extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an “intracellular signaling domain”), the cytoplasmic signaling domain comprising a functional signaling domain derived from a stimulatory molecule and / or a co-stimulatory molecule as defined herein in the context of a CAR molecule. In some embodiments, the peptide group in an RCAR is not sequential, for example, in different peptide chains. In some embodiments, an RCAR includes a dimerization switch that can couple the peptides to each other in the presence of a dimerizing molecule, for example, coupling the antigen-binding domain to the intracellular signaling domain. In some embodiments, an RCAR is expressed in cells as described herein (e.g., immune effector cells), such as cells expressing RCARs (also referred to herein as “RCARX cells”). In one embodiment, RCARX cells are T cells and are referred to as RCART cells. In one embodiment, RCARX cells are NK cells and are referred to as RCARN cells. RCARs can provide RCAR-expressing cells with specificity for target cells (typically cancer cells) and have modulated intracellular signaling or proliferation, which can optimize the immune effector properties of RCAR-expressing cells. In embodiments, RCAR cells rely at least in part on an antigen-binding domain to provide specificity for target cells containing antigens bound by that antigen-binding domain.

[0169] When used in this document, “membrane anchor” or “membrane chain domain” refers to a polypeptide or portion (e.g., myristoyl) sufficient to anchor an extracellular or intracellular domain to the plasma membrane.

[0170] When used herein (e.g., when referring to RCAR), a “switch domain” refers to an entity (typically a peptide-based entity) that associates with another switch domain in the presence of a dimerizing molecule. This association results in a functional coupling between a first entity attached to (e.g., fused to) a first switch domain and a second entity attached to (e.g., fused to) a second switch domain. The first and second switch domains are collectively referred to as a dimerizing switch. In embodiments, the first and second switch domains are identical to each other, for example, they are peptides having the same primary amino acid sequence, and are collectively referred to as homodimerizing switches. In embodiments, the first and second switch domains are different from each other, for example, they are peptides with different primary amino acid sequences, and are collectively referred to as heterodimerizing switches. In embodiments, the switch is intracellular. In embodiments, the switch is extracellular. In embodiments, the switch domain is a peptide-based entity (e.g., based on FKBP or FRB), and the dimerizing molecule is a small molecule (e.g., a rapalogue analog). In embodiments, the switch domain is based on a polypeptide entity (e.g., an scFv binding a myc peptide), and the dimer is a polypeptide, a fragment thereof, or a multimer of a polypeptide, such as a myc ligand or a multimer of myc ligands binding one or more myc scFvs. In embodiments, the switch domain is based on a polypeptide entity (e.g., a myc receptor), and the dimer is an antibody or a fragment thereof, such as a myc antibody.

[0171] When used herein (e.g., when referring to RCAR), "dimerizing molecule" means a molecule that promotes association between a first switch domain and a second switch domain. In embodiments, the dimerizing molecule does not occur naturally in the subject or does not occur at concentrations that result in significant dimerization. In embodiments, the dimerizing molecule is a small molecule, such as rapamycin or a rapamycin analog, such as RAD001.

[0172] When used in combination with an mTOR inhibitor (e.g., an allosteric mTOR inhibitor, such as RAD001 or rapamycin, or a catalytic mTOR inhibitor), the term "low immunostimulatory dose" refers to a dose of the mTOR inhibitor that partially, but not completely, inhibits mTOR activity, for example, as measured by inhibition of P70 S6 kinase activity. Methods for evaluating mTOR activity, such as by inhibiting P70 S6 kinase, are discussed herein. The dose is insufficient to cause complete immunosuppression but sufficient to enhance the immune response. In one embodiment, a low immunostimulatory dose of the mTOR inhibitor results in a decrease in the number of PD-1 positive T cells and / or an increase in the number of PD-1 negative T cells, or an increase in the ratio of PD-1 negative T cells to PD-1 positive T cells. In one embodiment, a low immunostimulatory dose of the mTOR inhibitor results in an increase in the number of naïve T cells. In one embodiment, a low immunostimulatory dose of the mTOR inhibitor results in one or more of the following:

[0173] Increased expression of one or more of the following markers, for example, on memory T cells (e.g., memory T cell precursors): CD62L 高 CD127 高 CD27 + and BCL2;

[0174] KLRG1 expression is reduced on, for example, memory T cells (e.g., memory T cell precursors); and

[0175] An increase in the number of memory T cell precursors, such as cells exhibiting any one or a combination of the following characteristics: increased CD62L 高 The added CD127 高 The added CD27 + The decrease in KLRG1 and the increase in BCL2;

[0176] For example, any of the above changes occur at least momentarily compared to untreated subjects.

[0177] As used herein, "refractory" refers to a disease that does not respond to treatment, such as cancer. In this embodiment, refractory cancer may be resistant to treatment before or at the start of treatment. In other embodiments, refractory cancer may become resistant during treatment. Refractory cancer is also known as resistant cancer.

[0178] As used herein, “relapsed” or “recurrence” refers to the return or recurrence of a disease (e.g., cancer) or its signs and symptoms (e.g., improvement or response period, such as after prior treatment with a therapy (e.g., cancer therapy)). An initial response may involve a decrease in cancer cell levels below a certain threshold, such as below 20%, 1%, 10%, 5%, 4%, 3%, 2%, or 1%. Recurrence may involve an increase in cancer cell levels above a certain threshold, such as above 20%, 1%, 10%, 5%, 4%, 3%, 2%, or 1%. For example, in the context of B-ALL, recurrence may involve, for example, the recurrence of blast cells in the blood, bone marrow (>5%), or any extramedullary site after a complete response. In this context, a complete response may involve <5% BM blast cells. More generally, in one embodiment, a response (e.g., a complete response or a partial response) may involve the absence of detectable MRD (minimal residual disease). In one embodiment, the initial response period lasts for at least 1, 2, 3, 4, 5, or 6 days; at least 1, 2, 3, or 4 weeks; at least 1, 2, 3, 4, 6, 8, 10, or 12 months; or at least 1, 2, 3, 4, or 5 years.

[0179] Scope: Throughout this disclosure, various aspects of the invention can be presented in a scope format. It should be understood that the scope format description is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Therefore, the scope description should be considered to have all possible sub-scopes of the exact disclosure and individual numerical values ​​within that scope. For example, a scope such as 1 to 6 should be considered to have exactly disclosed sub-scopes such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and individual numbers within that scope, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. As another example, a scope such as 95%-99% identity includes having 95%, 96%, 97%, 98%, or 99% identity, and includes sub-scopes such as 96%-99%, 96%-98%, 96%-97%, 97%-99%, 97%-98%, and 98%-99% identity. This applies regardless of the width of the range.

[0180] When used herein, “gene editing system” refers to a system, such as one or more molecules, that directs and influences alterations (e.g., deletions) of one or more nucleic acids at or near a genomic DNA site targeted by the system. Gene editing systems are known in the art and are described more fully below.

[0181] As used herein, “combined” administration means the delivery of two (or more) different treatments to a subject during the course of their illness, such as after the subject has been diagnosed with the condition and before the condition is cured or cleared, or before treatment is terminated for other reasons. In some embodiments, the delivery of the first treatment is still in progress when the delivery of the second treatment begins, so there is overlap in terms of administration. This is sometimes referred to herein as “simultaneous delivery” or “parallel delivery.” In other embodiments, the delivery of one treatment ends before the delivery of another treatment begins. In some embodiments of each case, the treatment is more effective due to the combined administration. For example, the second treatment is more effective than the results observed when the second treatment is administered in the absence of the first treatment, such as observing an equivalent effect with less second treatment, or the second treatment reducing symptoms to a greater extent, or observing a similar effect to the first treatment. In some embodiments, the delivery results in a greater reduction in symptoms or other parameters related to the condition than the results observed when the second treatment is administered in the absence of the other treatment. The effects of the two treatments may be partially additive, fully additive, or greater than additive. The delivery may ensure that the effect of the first treatment delivered remains detectable when the second treatment is delivered.

[0182] Various aspects of the compositions and methods described herein are further described in detail below. Additional definitions are set forth throughout the application.

[0183] describe

[0184] This article provides material compositions and methods of use for treating diseases such as cancer using cells expressing BCMA chimeric antigen receptor (CAR) (e.g., CART-BCMA).

[0185] In one aspect, the present invention provides cells engineered to express CAR (e.g., immune effector cells, such as T cells or NK cells), wherein CAR T cells (“CART”) or CAR NK cells exhibit antitumor properties. In one aspect, cells are transformed with CAR and CAR is expressed on the cell surface. In some embodiments, cells (e.g., immune effector cells, such as T cells or NK cells) are transduced with a viral vector encoding CAR. In some embodiments, the viral vector is a retroviral vector. In some embodiments, the viral vector is a lentiviral vector. In some such embodiments, the cells can stably express CAR. In another embodiment, cells (e.g., immune effector cells, such as T cells or NK cells) are transfected with a nucleic acid encoding CAR (e.g., mRNA, cDNA, DNA). In some such embodiments, the cells can transiently express CAR.

[0186] In one aspect, the CAR of the present invention combines the antigen-binding domain of a specific antibody with an intracellular signaling molecule. For example, in some aspects, the intracellular signaling molecule includes, but is not limited to, the CD3-ζ chain, 4-1BB, and CD28 signaling modules, and combinations thereof. In one aspect, the antigen-binding domain binds to BCMA.

[0187] Furthermore, the present invention provides BCMA CAR compositions and their use in medicaments or methods for treating (among other diseases) cancer or any malignant tumor or autoimmune diseases involving cells or tissues expressing BCMA.

[0188] In one aspect, the CAR of the present invention can be used to eradicate normal cells expressing BCMA, thereby being suitable for cell conditioning therapy prior to cell transplantation. In another aspect, the normal cells expressing BCMA are normal stem cells expressing BCMA, and the cell transplantation is a stem cell transplantation.

[0189] In one aspect, the present invention provides cells (e.g., T cells or NK cells) engineered to express a chimeric antigen receptor (CAR), wherein the CAR T cells (“CART”) or CAR NK cells exhibit antitumor properties. A preferred antigen is BCMA. In one aspect, the antigen-binding domain of the CAR comprises a human anti-BCMA antibody fragment. In another aspect, the antigen-binding domain of the CAR comprises a human anti-BCMA antibody fragment containing scFv. Therefore, the present invention provides BCMA-CARs comprising a human anti-BCMA binding domain and engineered into cells (e.g., T cells or NK cells), and methods for using them for adoptive therapy.

[0190] In one aspect, the BCMA-CAR includes at least one intracellular domain selected from the CD137(4-1BB) signaling domain, the CD28 signaling domain, the CD3ζ signaling domain, and any combination thereof. In another aspect, the BCMA-CAR includes at least one intracellular signaling domain derived from one or more co-stimulatory molecules other than CD137(4-1BB) or CD28.

[0191] Chimeric antigen receptor (CAR)

[0192] This invention provides a CAR (e.g., a CAR peptide) comprising an anti-BCMA binding domain (e.g., a human anti-BCMA binding domain as described herein), a transmembrane domain, and an intracellular signal transduction domain, wherein the anti-BCMA binding domain comprises heavy chain complementarity-determining region 1 (HCCDR1), heavy chain complementarity-determining region 2 (HC CDR2), and heavy chain complementarity-determining region 3 (HC CDR3) of any anti-BCMA heavy chain binding domain amino acid sequence listed in Tables 2-13. The anti-BCMA binding domain of the CAR may also comprise light chain complementarity-determining region 1 (LC CDR1), light chain complementarity-determining region 2 (LC CDR2), and light chain complementarity-determining region 3 (LC CDR3) of any anti-BCMA light chain binding domain amino acid sequence listed in Tables 2-13.

[0193] The present invention also provides nucleic acid molecules encoding CARs as described herein (e.g., CARs encoding an anti-BCMA binding domain (e.g., a human anti-BCMA binding domain as described herein), transmembrane domains, and intracellular signal transduction domains, wherein the anti-BCMA binding domain comprises HC CDR1, HC CDR2, and HC CDR3 of any anti-BCMA heavy chain binding domain amino acid sequence listed in Tables 2-13. In some embodiments, the anti-BCMA binding domain encoded by the CAR may further comprise LC CDR1, LC CDR2, and LC CDR3 of any anti-BCMA light chain binding domain amino acid sequence listed in Tables 2-13.

[0194] In one aspect, an exemplary BCMA CAR construct includes an optional leader sequence, an extracellular antigen-binding domain, a hinge, a transmembrane domain, and an intracellular stimulatory domain. An exemplary leader sequence is provided as SEQ ID NO:1. An exemplary nucleic acid sequence encoding the leader sequence is provided as SEQ ID NO:12. An exemplary hinge / spacer region sequence is provided as SEQ ID NO:2, 3, 4, or 5. An exemplary transmembrane domain sequence is provided as SEQ ID NO:6. An exemplary sequence of the intracellular signaling domain of the 4-1BB protein is provided as SEQ ID NO:7. An exemplary sequence of the intracellular signaling domain of CD27 is provided as SEQ ID NO:8. An exemplary CD3ζ domain sequence is provided as SEQ ID NO:9 or 10. In some embodiments, these domains are adjacent and within the same reading frame to form a single fusion protein. In other embodiments, the domains are in separate polypeptides, for example, in an RCAR molecule as described herein.

[0195] The CAR construct may include a Gly / Ser connector having one or more of the following sequences: GGGGS (SEQ ID NO:25); encompassing 1 to 6 “Gly Gly Gly Gly Ser” repeating units, such as GGGGSGGGGS GGGGSGGGGSGGGGSGGGS (SEQ ID NO:26); GGGGSGGGGS GGGGSGGGGS (SEQ ID NO:27); GGGGSGGGGS GGGGS (SEQ ID NO:28); GGGS (SEQ ID NO:29); or encompassing 1 to 10 “Gly Gly Gly Ser” repeating units, such as GGGSGGGSGG GSGGGSGGGS GGGSGGGSGGGSGGGSGGSGGSGGS (SEQ ID NO:42).

[0196] In several embodiments, the CAR construct comprises a polyA sequence, such as sequences comprising 50-5000 or 100-5000 adenines (SEQ ID NO 30 and 33, respectively) (e.g., SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, or SEQ ID NO:35), or sequences comprising 50-5000 thymines (SEQ ID NO:32) (e.g., SEQ ID NO:31, SEQ ID NO:32). Alternatively, the CAR construct may comprise a linker, for example, containing the sequence GSTGSSGKPGSGEGSTKG (SEQ ID NO:43).

[0197] In some embodiments, the full-length BCMA CAR molecule comprises the amino acid sequence of R1B6, R1F2, R1G5, PI61, B61-02, B61-10, Hy03, or Hy52 provided in Tables 2-13, or is encoded by the nucleotide sequence of R1B6, R1F2, R1G5, PI61, B61-02, B61-10, Hy03, or Hy52, or is substantially (e.g., 95%-99%) identical to it. In some embodiments, the BCMA CAR molecule or the anti-BCMA antigen-binding domain comprises the scFv amino acid sequence of R1B6, R1F2, R1G5, PI61, B61-02, B61-10, Hy03, or Hy52 provided in Tables 2, 6, and 10, or is substantially (e.g., 95%-99%) identical to it. In some embodiments, the BCMA CAR molecule or the anti-BCMA antigen binding domain comprises the heavy chain variable region and / or light chain variable region of R1B6, R1F2, R1G5, PI61, B61-02, B61-10, Hy03 or Hy52 provided in Tables 2, 6 and 10, or the sequence substantially (e.g., 95%-99%) identical thereto. In some embodiments, the BCMA CAR molecule or the anti-BCMA antigen binding domain comprises one, two, or three CDRs (e.g., HCDR1, HCDR2, and / or HCDR3) of the heavy chain variable region of R1B6, R1F2, R1G5, PI61, B61-02, B61-10, Hy03, or Hy52 provided in Tables 2-13, and / or one, two, or three CDRs (e.g., LCDR1, LCDR2, and / or LCDR3) of the light chain variable region of R1B6, R1F2, R1G5, PI61, B61-02, B61-10, Hy03, or Hy52 provided in Tables 2-13, or a sequence substantially (e.g., 95%–99%) identical to it.

[0198] The sequences of various components that may be part of the CAR molecule described herein are listed in Table 1, where aa represents an amino acid and na represents a nucleic acid encoding the corresponding peptide.

[0199] Table 1. Sequences of various components of CAR

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207] CAR antigen-binding domain

[0208] In one aspect, a portion of the CAR comprising an antigen-binding domain includes an antigen-binding domain that targets a tumor antigen (e.g., the tumor antigen described herein). In another aspect, the CAR of the present invention includes a binding domain that specifically binds to BCMA (e.g., human BCMA).

[0209] The antigen-binding domain can be any protein that binds an antigen, including but not limited to monoclonal antibodies, polyclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies, and their functional fragments, including but not limited to single-chain antibodies, such as the heavy chain variable domain (VH), light chain variable domain (VL), and variable domain (VHH) of camel-derived nanobodies, as well as any protein known in the art as an alternative scaffold for antigen-binding domains (such as recombinant fibronectin domains, etc.).

[0210] Exemplary anti-BCMA binding domain amino acid sequences are provided in Tables 2-13. In one aspect, the antigen-binding domain comprises a human antibody or a fragment of a human antibody. In some embodiments, the human anti-BCMA binding domain comprises one or more (e.g., all three) LC CDR1, LC CDR2, and LCCDR3 of the human anti-BCMA binding domains described herein (e.g., in Tables 2-13), and / or one or more (e.g., all three) HC CDR1, HC CDR2, and HC CDR3 of the human anti-BCMA binding domains described herein (e.g., in Tables 2-13). In some embodiments, the human anti-BCMA binding domain comprises the human VL and / or the human VH described herein (e.g., in Tables 2, 6, and 10). In some embodiments, the anti-BCMA binding domain is an scFv that comprises the VL and VH amino acid sequences of Tables 2, 6, and 10. In one embodiment, the anti-BCMA binding domain (e.g., scFv) comprises: a VL containing an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequences provided in Tables 2, 6, and 10, or a sequence having 95%-99% identity with the amino acid sequences in Tables 2, 6, and 10; and / or a VH containing an amino acid sequence having at least one, two, or three modifications (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequences provided in Tables 2, 6, and 10, or a sequence having 95%-99% identity with the amino acid sequences in Tables 2, 6, and 10.

[0211] Table 2. Amino acid and nucleic acid sequences of exemplary PALLAS-derived anti-BCMA molecules

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224] Table 3. Exemplary PALLAS-derived anti-BCMA molecules' Cabart CDRs

[0225]

[0226]

[0227] Table 4. Exemplary PALLAS-derived anti-BCMA molecules and their Josiah CDRs

[0228]

[0229]

[0230] Table 5. IMGT CDR of exemplary PALLAS-derived anti-BCMA molecules

[0231]

[0232]

[0233] Table 6. Amino acid and nucleic acid sequences of exemplary B cell-derived anti-BCMA molecules

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

[0246] Table 7. Exemplary B-cell-derived anti-BCMA molecules and their corresponding Cabard CDRs

[0247]

[0248]

[0249] Table 8. Exemplary Josiah CDRs of B-cell-derived anti-BCMA molecules

[0250]

[0251] Table 9. IMGT CDRs of exemplary B-cell-derived anti-BCMA molecules

[0252]

[0253]

[0254] Table 18. Amino acid and nucleic acid sequences of exemplary anti-BCMA molecules based on PI61

[0255]

[0256]

[0257]

[0258]

[0259]

[0260] Table 10. Amino acid and nucleic acid sequences of exemplary hybridoma-derived anti-BCMA molecules

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269] Table 11. Exemplary hybridoma-derived anti-BCMA molecules and their Carbato CDRs

[0270]

[0271]

[0272] Table 12. Exemplary hybridoma-derived anti-BCMA molecules and their corresponding Josiah CDRs

[0273]

[0274] Table 13. IMGT CDRs of exemplary hybridoma-derived anti-BCMA molecules

[0275]

[0276]

[0277] In some embodiments, the human anti-BCMA binding domain includes HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3.

[0278] In some embodiments, the CAR molecule described herein or the anti-BCMA binding domain described herein includes:

[0279] (1) Selected from one, two or three of the following light chain (LC) CDRs:

[0280] (i) LC CDR1 of SEQ ID NO:54, LC CDR2 of SEQ ID NO:55, and LCCDR3 of SEQ ID NO:56; and / or

[0281] (2) One, two, or three heavy chain (HC) CDRs selected from one of the following:

[0282] (i) HC CDR1 of SEQ ID NO:44, HC CDR2 of SEQ ID NO:45 and HCCDR3 of SEQ ID NO:84;

[0283] (ii) HC CDR1 of SEQ ID NO:44, HC CDR2 of SEQ ID NO:45 and HCCDR3 of SEQ ID NO:46;

[0284] (iii) HC CDR1 of SEQ ID NO:44, HC CDR2 of SEQ ID NO:45, and HCCDR3 of SEQ ID NO:68; or

[0285] (iv) HC CDR1 of SEQ ID NO:44, HC CDR2 of SEQ ID NO:45 and HCCDR3 of SEQ ID NO:76.

[0286] In some embodiments, the CAR molecule described herein or the anti-BCMA binding domain described herein includes:

[0287] (1) One, two, or three light chain (LC) CDRs selected from one of the following:

[0288] (i) LC CDR1 of SEQ ID NO:95, LC CDR2 of SEQ ID NO:131 and LC CDR3 of SEQ ID NO:132;

[0289] (ii) LC CDR1 of SEQ ID NO:95, LC CDR2 of SEQ ID NO:96 and LC CDR3 of SEQ ID NO:97;

[0290] (iii) LC CDR1 of SEQ ID NO:95, LC CDR2 of SEQ ID NO:114, and LCCDR3 of SEQ ID NO:115; or

[0291] (iv) LC CDR1 of SEQ ID NO:95, LC CDR2 of SEQ ID NO:114, and LCCDR3 of SEQ ID NO:97; and / or

[0292] (2) One, two, or three heavy chain (HC) CDRs selected from one of the following:

[0293] (i) HC CDR1 of SEQ ID NO:86, HC CDR2 of SEQ ID NO:130 and HCCDR3 of SEQ ID NO:88;

[0294] (ii) HC CDR1 of SEQ ID NO:86, HC CDR2 of SEQ ID NO:87, and HCCDR3 of SEQ ID NO:88; or

[0295] (iii) HC CDR1 of SEQ ID NO:86, HC CDR2 of SEQ ID NO:109 and HCCDR3 of SEQ ID NO:88.

[0296] In some embodiments, the CAR molecule described herein or the anti-BCMA binding domain described herein includes:

[0297] (1) One, two, or three light chain (LC) CDRs selected from one of the following:

[0298] (i) LC CDR1 of SEQ ID NO:147, LC CDR2 of SEQ ID NO:182 and LC CDR3 of SEQ ID NO:183;

[0299] (ii) LC CDR1 of SEQ ID NO:147, LC CDR2 of SEQ ID NO:148, and LCCDR3 of SEQ ID NO:149; or

[0300] (iii) LC CDR1 of SEQ ID NO:147, LC CDR2 of SEQ ID NO:170, and LCCDR3 of SEQ ID NO:171; and / or

[0301] (2) One, two, or three heavy chain (HC) CDRs selected from one of the following:

[0302] (i) HC CDR1 of SEQ ID NO:179, HC CDR2 of SEQ ID NO:180 and HCCDR3 of SEQ ID NO:181;

[0303] (ii) HC CDR1 of SEQ ID NO:137, HC CDR2 of SEQ ID NO:138, and HCCDR3 of SEQ ID NO:139; or

[0304] (iii) HC CDR1 of SEQ ID NO:160, HC CDR2 of SEQ ID NO:161 and HCCDR3 of SEQ ID NO:162.

[0305] In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively comprise the amino acid sequences of SEQ ID NO: 44, 45, 84, 54, 55, and 56. In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively comprise the amino acid sequences of SEQ ID NO: 44, 45, 46, 54, 55, and 56. In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively comprise the amino acid sequences of SEQ ID NO: 44, 45, 68, 54, 55, and 56. In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively comprise the amino acid sequences of SEQ ID NO: 44, 45, 76, 54, 55, and 56.

[0306] In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively contain the amino acid sequences of SEQ ID NO: 47, 48, 84, 57, 58, and 59. In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively contain the amino acid sequences of SEQ ID NO: 47, 48, 46, 57, 58, and 59. In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively contain the amino acid sequences of SEQ ID NO: 47, 48, 68, 57, 58, and 59. In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively contain the amino acid sequences of SEQ ID NO: 47, 48, 76, 57, 58, and 59.

[0307] In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively comprise the amino acid sequences of SEQ ID NO: 49, 50, 85, 60, 58, and 56. In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively comprise the amino acid sequences of SEQ ID NO: 49, 50, 51, 60, 58, and 56. In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively comprise the amino acid sequences of SEQ ID NO: 49, 50, 69, 60, 58, and 56. In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 respectively comprise the amino acid sequences of SEQ ID NO: 49, 50, 77, 60, 58, and 56.

[0308] In some embodiments, the human anti-BCMA binding domain comprises an scFv, which includes a VH (e.g., the VH described herein) and a VL (e.g., the VL described herein). In some embodiments, the VH is attached to the VL via a connector (e.g., a connector described herein, such as the connectors described in Table 1). In some embodiments, the human anti-BCMA binding domain comprises a (Gly4-Ser)n connector, where n is 1, 2, 3, 4, 5, or 6, preferably 3 or 4 (SEQ ID NO: 26). The light chain variable region and the heavy chain variable region of the scFv can be, for example, in any of the following orientations: light chain variable region-connector-heavy chain variable region or heavy chain variable region-connector-light chain variable region.

[0309] In one aspect, the anti-BCMA binding domain is a fragment, such as a single-chain variable fragment (scFv). In another aspect, the anti-BCMA binding domain is an Fv, Fab, (Fab')2, or a bifunctional (e.g., bispecific) hybrid antibody (e.g., Lanzavecchia et al., Eur. J. Immunol. [European Journal of Immunology] 17, 105 (1987)). In one aspect, the antibodies and fragments thereof of the present invention bind to the BCMA protein with wild-type or enhanced affinity.

[0310] In some cases, scFvs can be prepared according to methods known in the art (see, for example, Bird et al., (1988) Science 242:423-426 and Huston et al., (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). ScFv molecules can be generated by linking the VH and VL regions together using flexible peptide linkers. ScFv molecules contain linkers with optimized length and / or amino acid composition (e.g., Ser-Gly linkers). Linker length can significantly influence how the variable regions of scFv fold and interact. In fact, if short peptide linkers are used (e.g., between 5 and 10 amino acids), intrachain folding can be prevented. Interchain folding is also required to combine the two variable regions together to form a functional epitope binding site. For examples of joint orientation and size, see, for example, Hollinger et al., 1993 Proc Natl Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 90:6444-6448, U.S. Patent Application Publications Nos. 2005 / 0100543, 2005 / 0175606, 2007 / 0014794, and PCT Publications Nos. WO 2006 / 020258 and WO 2007 / 024715, which are incorporated herein by reference.

[0311] The scFv may contain a linker having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, or more amino acid residues between its VL and VH regions. The linker sequence may contain any naturally occurring amino acid. In some embodiments, the linker sequence contains the amino acids glycine and serine. In another embodiment, the linker sequence contains a set of glycine and serine repeat sequences, such as (Gly4Ser)n, where n is a positive integer equal to or greater than 1 (SEQ ID NO: 25). In some embodiments, the linker may be (Gly4Ser)4 (SEQ ID NO: 27) or (Gly4Ser)3 (SEQ ID NO: 28). Variations in linker length can preserve or enhance activity, resulting in superior efficacy in activity studies.

[0312] Transmembrane domain

[0313] Regarding the transmembrane domain, in various embodiments, the CAR may be designed to include a transmembrane domain comprising an extracellular domain attached to the CAR. The transmembrane domain may include one or more additional amino acids adjacent to the transmembrane region, such as one or more amino acids (e.g., amino acids 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 to 15 of the extracellular region) associated with the extracellular region of a transmembrane protein-derived protein and / or one or more additional amino acids (e.g., amino acids 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 to 15 of the intracellular region) associated with the intracellular region of a transmembrane protein-derived protein. In one aspect, the transmembrane domain is a transmembrane domain associated with one of the other domains of the CAR used. In some cases, the transmembrane domain may be selectively modified, or modified by amino acid substitution, to prevent such domains from binding to transmembrane domains of the same or different surface membrane proteins, for example, to minimize interactions with other members of the receptor complex. In one aspect, the transmembrane domain is capable of homodimerization with another CAR on the surface of a cell expressing the CAR (e.g., CART cells). In another respect, the amino acid sequence of the transmembrane domain can be modified or replaced to minimize the interaction with the binding domain of the natural binding partner present in the same CAR-expressing cell (e.g., CART).

[0314] The transmembrane domain can be derived from a natural or recombinant source. In the case of a natural source, the domain can originate from any membrane-binding or transmembrane protein. In one aspect, whenever a CAR binds to a target, the transmembrane domain is capable of transducing a signal to one or more intracellular domains. The transmembrane domain particularly used in this invention may include at least one or more of the following transmembrane regions: for example, the α, β, or ζ chain of a T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8 (e.g., CD8α, CD8β), CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. In some embodiments, the transmembrane domain may include at least one or more transmembrane regions of a co-stimulatory molecule, such as MHC. Class I molecules, TNF receptor protein, immunoglobulin-like protein, cytokine receptor, integrin, signal transduction lymphocyte activating molecule (SLAM protein), activating NK cell receptor, BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (C D278), GITR, BAFFR, LIGHT, HVEM(LIGHTR), KIRDS2, SLAMF7, NKp80(KLRF1), NKp44, NKp30, NKp46, CD19, CD4 , CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1 1d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB 7. NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM 1. CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and ligands that specifically bind to CD83.

[0315] In some cases, the transmembrane domain may be attached to an extracellular region of the CAR (e.g., an antigen-binding domain of the CAR) via a hinge (e.g., a hinge derived from a human protein). For example, in some embodiments, the hinge may be a human Ig (immunoglobulin) hinge (e.g., an IgG4 hinge) or a CD8a hinge. In some embodiments, the hinge or spacer region comprises the amino acid sequence of SEQ ID NO:2 (e.g., constitutes thereof). In one aspect, the transmembrane domain comprises the transmembrane domain of SEQ ID NO:6 (e.g., constitutes thereof).

[0316] In one aspect, the hinge or spacer region comprises an IgG4 hinge. For example, in some embodiments, the hinge or spacer region comprises the hinge of SEQ ID NO:3. In some embodiments, the hinge or spacer region comprises a hinge encoded by the nucleotide sequence of SEQ ID NO:14.

[0317] In one aspect, the hinge or spacer region comprises an IgD hinge. For example, in some embodiments, the hinge or spacer region comprises a hinge of the amino acid sequence of SEQ ID NO:4. In some embodiments, the hinge or spacer region comprises a hinge encoded by a nucleotide sequence of SEQ ID NO:15.

[0318] In one respect, the transmembrane domain can be recombined, in which case it will primarily contain hydrophobic residues such as leucine and valine. In another respect, a triplet of phenylalanine, tryptophan, and valine can be found at each end of the recombinant transmembrane domain.

[0319] Optionally, short oligopeptide or polypeptide linkers with a length between 2 and 10 amino acids can form a link between the transmembrane domain and the cytoplasmic region of the CAR. Glycine-serine duplexes provide particularly suitable linkers. For example, in one aspect, the linker comprises the amino acid sequence of SEQ ID NO:5. In some embodiments, the linker is encoded by the nucleotide sequence of SEQ ID NO:16.

[0320] In one aspect, the hinge or spacer contains the KIR2DS2 hinge.

[0321] Cytoplasmic domain

[0322] The cytoplasmic domains or regions of the CAR of the present invention include intracellular signal transduction domains. Intracellular signal transduction domains are typically responsible for activating at least one normal effector function of immune cells to which the CAR has been introduced.

[0323] Examples of intracellular signal transduction domains used in the CAR of this invention include cytoplasmic sequences of T-cell receptors (TCRs) and co-receptors (which work together to initiate signal transduction upon antigen-receptor binding) as well as any derivatives or variants of these sequences and any recombinant sequences having the same functional capabilities.

[0324] It is known that signals generated by the TCR alone are insufficient to fully activate T cells, and secondary and / or co-stimulatory signals are also required. Therefore, T cell activation can be considered to be mediated by two different classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation via the TCR (primary intracellular signaling domains) and those that function in an antigen-independent manner to provide secondary or co-stimulatory signals (secondary cytoplasmic domains, such as co-stimulatory domains).

[0325] Primary signaling domains regulate primary activation of the TCR complex in a stimulatory or inhibitory manner. Primary intracellular signaling domains that function in a stimulatory manner may contain signaling motifs known as immune receptor tyrosine-based activation motifs or ITAMs.

[0326] Examples of primary cytoplasmic signaling sequences containing ITAM that are particularly useful in this invention include TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS"), FcεRI, DAP10, DAP12, and CD66d. In some embodiments, the CAR of this invention comprises an intracellular signaling domain, such as the primary signaling domain of CD3ζ.

[0327] In some embodiments, the primary signaling domain includes a modified ITAM domain, such as a mutant ITAM domain having altered (e.g., increased or decreased) activity compared to the native ITAM domain. In some embodiments, the primary signaling domain includes a primary intracellular signaling domain containing modified ITAM, such as a primary intracellular signaling domain containing optimized and / or truncated ITAM. In one embodiment, the primary signaling domain includes one, two, three, four, or more ITAM motifs.

[0328] Further examples of molecules containing primary intracellular signal transduction domains that are particularly useful in this invention include those of DAP10, DAP12, and CD32.

[0329] The intracellular signaling domain of a CAR may comprise a primary signaling domain (e.g., a CD3-ζ signaling domain) alone, or it may be combined with any other desired intracellular signaling domain or combination thereof useful in the context of the CAR of this invention. For example, the intracellular signaling domain of a CAR may comprise a primary signaling domain (e.g., a portion of the CD3ζ chain) and a co-stimulatory signaling domain. A co-stimulatory signaling domain refers to a portion of the intracellular domain of the CAR that contains a co-stimulatory molecule. Co-stimulatory molecules are cell surface molecules, other than antigen receptors or their ligands, that are essential for an effective lymphocyte response to antigens. Examples of such molecules include MHC. Class I molecules, TNF receptor protein, immunoglobulin-like protein, cytokine receptor, integrin, signal transduction lymphocyte activating molecule (SLAM protein), activating NK cell receptor, BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD 278), GITR, BAFFR, LIGHT, HVEM(LIGHTR), KIRDS2, SLAMF7, NKp80(KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11 d. ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7 , NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1 CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and ligands that specifically bind to CD83, etc.For example, CD27 co-stimulation has been shown to enhance the expansion, effector function, and survival of human CAR-T cells in vitro, and to increase the persistence and antitumor activity of human T cells in vivo (Song et al. Blood. 2012; 119(3):696-706). The intracellular signaling sequences within the cytoplasmic portion of the CAR of the present invention can be linked together in a random or specified order. Optionally, short oligopeptides or polypeptide linkers, for example, those between 2 and 10 amino acids in length (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids), can form links between intracellular signaling sequences. In some embodiments, glycine-serine duplexes can be used as suitable linkers. In some embodiments, single amino acids (e.g., alanine, glycine) can be used as suitable linkers.

[0330] In one aspect, the intracellular signal transduction domain is designed to include two or more (e.g., 2, 3, 4, 5, or more) co-stimulatory signal transduction domains. In one embodiment, the two or more (e.g., 2, 3, 4, 5, or more) co-stimulatory signal transduction domains are separated by a linker molecule (e.g., the linker molecule described herein). In some embodiments, the intracellular signal transduction domain includes two co-stimulatory signal transduction domains. In some embodiments, the linker molecule is a glycine residue. In some embodiments, the linker is an alanine residue.

[0331] In one aspect, the intracellular signal transduction domain is designed to include a CD3-ζ signal transduction domain and a CD28 signal transduction domain. In another aspect, the intracellular signal transduction domain is designed to include a CD3-ζ signal transduction domain and a 4-1BB signal transduction domain. In another aspect, the 4-1BB signal transduction domain is the signal transduction domain of SEQ ID NO:7. In another aspect, the CD3-ζ signal transduction domain is the signal transduction domain of SEQ ID NO:9 (mutant CD3ζ) or SEQ ID NO:10 (wild-type human CD3ζ).

[0332] In one aspect, the intracellular signal transduction domain is designed to include a CD3-ζ signal transduction domain and a CD27 signal transduction domain. In another aspect, the CD27 signal transduction domain comprises the amino acid sequence of SEQ ID NO:8. In yet another aspect, the CD27 signal transduction domain is encoded by the nucleic acid sequence of SEQ ID NO:19.

[0333] In one aspect, the intracellular domain is designed to include a CD3-ζ signaling domain and a CD28 signaling domain. In one aspect, the CD28 signaling domain comprises the amino acid sequence of SEQ ID NO:36. In one aspect, the CD28 signaling domain is encoded by the nucleic acid sequence of SEQ ID NO:37.

[0334] In one aspect, the intracellular domain is designed to include a CD3-ζ signaling domain and an ICOS signaling domain. In one aspect, the ICOS signaling domain comprises the amino acid sequence of SEQ ID NO:38. In another aspect, the ICOS signaling domain is encoded by the nucleic acid sequence of SEQ ID NO:39.

[0335] CAR configuration

[0336] Multispecific CAR

[0337] In one embodiment, the CAR of the present invention is a multispecific CAR. In some embodiments, the multispecific CAR is a bispecific CAR. In some embodiments, the bispecific CAR includes an antigen-binding domain, which is a bispecific antibody molecule. The bispecific antibody is specific to no more than two antigens. The bispecific antibody molecule is characterized by having a first immunoglobulin variable domain sequence having binding specificity to a first epitope and a second immunoglobulin variable domain sequence having binding specificity to a second epitope. In one embodiment, the first epitope and the second epitope are on the same antigen, such as the same protein (or a subunit of a multimeric protein). In one embodiment, the first epitope and the second epitope overlap. In one embodiment, the first epitope and the second epitope do not overlap. In one embodiment, the first epitope and the second epitope are on different antigens (e.g., different proteins (or different subunits of a multimeric protein)). In one embodiment, the bispecific antibody molecule includes a heavy chain variable domain sequence and a light chain variable domain sequence having binding specificity to the first epitope and a heavy chain variable domain sequence and a light chain variable domain sequence having binding specificity to the second epitope. In one embodiment, the bispecific antibody molecule comprises a hapten with binding specificity to a first epitope and a hapten with binding specificity to a second epitope. In another embodiment, the bispecific antibody molecule comprises a hapten or a fragment thereof with binding specificity to a first epitope and a hapten or a fragment thereof with binding specificity to a second epitope. In yet another embodiment, the bispecific antibody molecule comprises an scFv or a fragment thereof with binding specificity to a first epitope and an scFv or a fragment thereof with binding specificity to a second epitope.

[0338] In some embodiments, the CAR of the present invention includes an antigen-binding domain, which is a multispecific (e.g., bispecific or trispecific) antibody molecule. Schemes for generating bispecific or heterodimeric antibody molecules are known in the art; these schemes include, but are not limited to: the "knob in a hole" approach, as described, for example, in US 5731168; electrostatically guided Fc pairing, as described, for example, in WO 09 / 089004, WO 06 / 106905, and WO 2010 / 129304; chain exchange engineered domain (SEED) heterodimer formation, as described, for example, in WO 07 / 110205; Fab arm exchange, as described, for example, in WO 08 / 119353, WO 2011 / 131746, and WO 2013 / 060867; and biantibody conjugates, for example, using heterobifunctional reagents having amine reactive groups and thiol reactive groups, through antibody crosslinking to generate bispecific structures, as described, for example, in US 5731168. As described in 4433059; bispecific antibody determinants generated by recombining hemiantibodies (heavy-light chain pairs or Fab) from different antibodies through a cycle of reduction and oxidation of disulfide bonds between two heavy chains, as described, for example, in US 4444878; trifunctional antibodies, such as three Fab' fragments cross-linked by thiol reactive groups, as described, for example, in US 5273743; biosynthetic binding proteins, such as scFv pairs cross-linked by C-terminal tails, preferably by disulfide bonds or amine reactive chemical cross-linking, as described, for example, in US 5534254; bifunctional antibodies, such as Fab fragments with different binding specificities, dimerized by leucine zippers (e.g., c-fos and c-jun) that have replaced constant domains, as described, for example, in US 5273743. As described in US 5582996; bispecific and oligospecific monovalent and oligovalent receptors, such as the VH-CH1 regions of two antibodies (two Fab fragments) linked by a polypeptide spacer between the CH1 region of one antibody and the VH region of the other antibody (typically having an associated light chain), as described, for example, in US 5591828; bispecific DNA-antibody conjugates, such as antibodies or Fab fragments cross-linked by a double-stranded DNA segment, as described, for example, in US 5635602; bispecific fusion proteins, such as expression constructs containing two scFvs (with a hydrophilic helical peptide linker between them) and a completely constant region, as described, for example, in US 5637481; multivalent and multispecific binding proteins, such as polypeptide dimers having a first domain of an Ig heavy chain variable region binding region and a second domain of an Ig light chain variable region binding region, commonly referred to as bispecific antibodies (also encompassing higher-order structures that produce bispecific, trispecific, or tetraspecific molecules), as described, for example, in US 5582996.As described in US 5837242; microantibody constructs having linked VL and VH chains (which are further linked to antibody hinge regions and CH3 regions by peptide spacer regions) that can dimerize to form bispecific / multivalent molecules, as described, for example, in US 5837821; VH and VL domains linked by short peptide linkers (e.g., 5 or 10 amino acids) or completely unlinked in either orientation, which can dimerize to form bispecific antibodies; trimers and tetramers, as described, for example, in US 5844094; strings of VH domains (or VL domains in family members) linked by peptide bonds to C-terminal crosslinkable groups that are further associated with VL domains to form a series of FVs (or scFvs), as described, for example, in US 5837242. As described in 5864019; single-chain binding polypeptides having both VH and VL domains linked by peptide linkers are combined into multivalent structures by non-covalent or chemical crosslinking, to form, for example, iso-divalent, iso-divalent, trivalent, and tetravalent structures using scFV or bimeric antibody types, as described, for example, in US 5869620. Other exemplary multispecific and bispecific molecules and their preparation methods can be found in, for example, US 5910573, US 5932448, US 5959083, US 5989830, US 6005079, US 6239259, US 6294353, US 6333396, US 6476198, US 6511663, US 6670453, US 6743896, US 6809185, US 6833441, US 7129330, US 7183076, US 7521056, US 7527787, US 7534866, US 7612181, US 2002004587 A1, and US 2002076406. A1, US2002103345 A1, US 2003207346 A1, US 2003211078 A1, US 2004219643 A1, US2004220388 A1, US 2004242847 A1, US 2005003403 A1, US 2005004352 A1, US2005069552 A1, US 2005079170 A1, US 2005100543 A1, US 2005136049 A1, US2005136051 A1, US 2005163782 A1, US 2005266425 A1, US 2006083747 A1, US2006120960 A1, US 2006204493 A1, US 2006263367 A1, US 2007004909A1, US2007087381 A1, US 2007128150 A1, US 2007141049 A1, US 2007154901 A1, US2007274985 A1, US 2008050370 A1, US 2008069820 A1, US 2008152645 A1, US2008171855 A1, US 2008241884 A1, US 2008254512 A1, US 2008260738 A1, US2009130106 A1, US 2009148905 A1, US 2009155275 A1, US 2009162359 A1, US2009162360 A1, US 2009175851 A1, US 2009175867 A1, US 2009232811 A1, US2009234105 A1, US 2009263392 A1, US 2009274649 A1, EP 346087 A2, WO 0006605 A2, WO02072635 A2, WO 04081051 A1, WO 06020258 A2, WO 2007044887 A2, WO 2007095338 A2, WO 2007137760 A2, WO 2008119353 A1, WO 2009021754 A2、WO The contents of the above applications are incorporated herein by reference in their entirety by means of 2009068630 A1, WO9103493 A1, WO 9323537 A1, WO 9409131 A1, WO 9412625 A2, WO 9509917 A1, WO 9637621A2, and WO 9964460 A1.

[0339] Within each antibody or antibody fragment (e.g., scFv) of a bispecific antibody molecule, the VH can be upstream or downstream of the VL. In some embodiments, the upstream antibody or antibody fragment (e.g., scFv) has its VH (VH1) disposed upstream of its VL (VL1), and the downstream antibody or antibody fragment (e.g., scFv) has its VL (VL2) disposed upstream of its VH (VH2), such that the entire bispecific antibody molecule has a VH1-VL1-VL2-VH2 arrangement. In other embodiments, the upstream antibody or antibody fragment (e.g., scFv) has its VL (VL1) disposed upstream of its VH (VH1), and the downstream antibody or antibody fragment (e.g., scFv) has its VH (VH2) disposed upstream of its VL (VL2), such that the entire bispecific antibody molecule has a VL1-VH1-VH2-VL2 arrangement. Optionally, if the construct is arranged as VH1-VL1-VL2-VH2, the linker is positioned between two antibodies or antibody fragments (e.g., scFvs), such as between VL1 and VL2; if the construct is arranged as VL1-VH1-VH2-VL2, the linker is positioned between VH1 and VH2. The linker can be as described herein, such as the (Gly4-Ser)n linker, where n is 1, 2, 3, 4, 5, or 6, preferably 4 (SEQ ID NO: 26). Generally, the linker between the two scFvs should be long enough to avoid mismatches between the domains of the two scFvs. Optionally, the linker is positioned between VL and VH of the first scFv. Optionally, the linker is positioned between VL and VH of the second scFv. In constructs with multiple linkers, any two or more linkers can be the same or different. Thus, in some embodiments, the bispecific CAR includes VL, VH, and optionally one or more linkers in an arrangement as described herein.

[0340] In one aspect, a bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence (e.g., an scFv that has binding specificity to BCMA, such as comprising scFv as described herein, for example, as described in Tables 2, 6, and 10, or comprising light chain CDRs and / or heavy chain CDRs from BCMA scFvs described herein) and a second immunoglobulin variable domain sequence (which has binding specificity to a second epitope on a different antigen). In some aspects, the second immunoglobulin variable domain sequence has binding specificity to antigens expressed on AML cells (e.g., antigens other than BCMA). For example, the second immunoglobulin variable domain sequence has binding specificity to CD123. As another example, the second immunoglobulin variable domain sequence has binding specificity to CLL-1. As another example, the second immunoglobulin variable domain sequence has binding specificity to CD34. As another example, the second immunoglobulin variable domain sequence has binding specificity to FLT3. For example, the second immunoglobulin variable domain sequence has binding specificity to folate receptor β. In some respects, the variable domain sequence of the second immunoglobulin has binding specificity for antigens expressed on B cells (such as CD10, CD19, CD20, CD22, CD34, CD123, FLT-3, ROR1, CD79b, CD179b, or CD79a).

[0341] Chimeric TCR

[0342] In one aspect, the anti-BCMA antibodies and antibody fragments of the present invention (e.g., those disclosed in Tables 2, 6, and 10) can be grafted to one or more constant domains of a T-cell receptor (“TCR”) chain (e.g., a TCRα or TCRβ chain) to generate a chimeric TCR that specifically binds to BCMA. Without being bound by theory, it is believed that the chimeric TCR will signal via the TCR complex upon antigen binding. For example, BCMA scFv as disclosed herein can be grafted to constant domains (e.g., at least a portion of the extracellular constant domain), transmembrane domains, and cytoplasmic domains of a TCR chain (e.g., a TCRα chain and / or a TCRβ chain). As another example, a BCMA antibody fragment (e.g., the VL domain described herein) can be grafted onto a constant domain of the TCRα chain, and a BCMA antibody fragment (e.g., the VH domain described herein) can be grafted onto a constant domain of the TCRβ chain (or, the VL domain can be grafted onto a constant domain of the TCRβ chain, and the VH domain can be grafted onto the TCRα chain). As another example, a CDR of an anti-BCMA antibody or antibody fragment, such as the CDRs of anti-BCMA antibodies or antibody fragments described in Tables 2-13, can be grafted onto the TCRα and / or β chains to produce a chimeric TCR that specifically binds to BCMA. For example, the LCDR disclosed herein can be grafted onto a variable domain of the TCRα chain, and the HCDR disclosed herein can be grafted onto a variable domain of the TCRβ chain, or vice versa. Such chimeric TCRs can be generated by methods known in the art (e.g., Willemsen RA et al., Gene Therapy, 2000; 7:1369-1377; Zhang T et al., Cancer Gene Therapy, 2004; 11:487-496; Aggen et al., Gene Therapy, April 2012; 19(4):365-74).

[0343] Other embodiments

[0344] In one aspect, the CAR-expressing cells described herein may also include a second CAR, for example, a second CAR containing a different antigen-binding domain, which targets the same target (BCMA) or different targets (e.g., CD19, CD20, or CS-1, or other multiple myeloma targets, such as the κ light chain, CD138, Lewis Y antigen, or CD38 (Garfall et al., Discovery Medicine, 2014, 17(91):37-46)). In some embodiments, the CAR-expressing cells comprise a first CAR that targets a first antigen and contains an intracellular signaling domain having a co-stimulatory signaling domain but not a primary signaling domain, and a second CAR that targets a second, different antigen and contains an intracellular signaling domain having a primary signaling domain but not a co-stimulatory signaling domain. While not wishing to be bound by theory, placing a co-stimulatory signaling domain (e.g., 4-1BB, CD28, CD27, ICOS, or OX-40) on a first CAR and a primary signaling domain (e.g., CD3ζ) on a second CAR can restrict CAR activity to cells expressing both targets. In some embodiments, the CAR-expressing cells comprise a first BCMA CAR (which includes a BCMA-binding domain, a transmembrane domain, and a co-stimulatory domain) and a second CAR (which targets an antigen other than BCMA (e.g., antigens expressed on leukemia or lymphoma cells, such as CD19, CD20, CS-1, κ light chain, CD139, Lewis Y antigen, or CD38) and includes an antigen-binding domain, a transmembrane domain, and a primary signaling domain). In another embodiment, the CAR-expressing cell comprises a first BCMA CAR (which includes a BCMA-binding domain, a transmembrane domain, and a primary signaling domain) and a second CAR (which targets an antigen other than BCMA (e.g., an antigen expressed on leukemia or lymphoma cells, such as CD19, CD20, CS-1, κ light chain, CD139, Lewis Y antigen, or CD38) and includes an antigen-binding domain, a transmembrane domain, and a co-stimulatory signaling domain targeting the antigen). In some embodiments, the CAR-expressing cell comprises the BCMA CAR described herein and a CD19-targeting CAR (CD19 CAR).

[0345] In some embodiments, cells expressing CARs include the BCMA CAR and repressive CARs described herein. In some embodiments, the repressive CAR includes an antigen-binding domain that binds to antigens present on normal cells rather than cancer cells. In some embodiments, the repressive CAR includes an antigen-binding domain, a transmembrane domain, and an intracellular domain of the repressive molecule. For example, the intracellular domain of the repressive CAR may be the intracellular domain of PD1, PD-L1, PD-L2, CTLA4, TIM3, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFRβ.

[0346] In some embodiments, when the cells expressing a CAR contain two or more different CARs, the antigen-binding domains of the different CARs can prevent the antigen-binding domains from interacting. For example, cells expressing a first CAR and a second CAR can have an antigen-binding domain of the first CAR (e.g., as a fragment, such as scFv) that does not associate with the antigen-binding domain of the second CAR, for example, the antigen-binding domain of the second CAR is VHH.

[0347] In some embodiments, the antigen-binding domain comprises a single-domain antigen-binding (SDAB) molecule, including molecules whose complementarity-determining regions are part of a single-domain polypeptide. Examples include, but are not limited to, heavy-chain variable domains, naturally occurring binding molecules lacking light chains, single-domain molecules derived from conventional 4-chain antibodies, engineered domains, and single-domain scaffolds other than those derived from antibodies. SDAB molecules can be any prior art or any future single-domain molecule. SDAB molecules can be derived from any species, including but not limited to mice, humans, camels, llamas, lampreys, fish, sharks, goats, rabbits, and cattle. The term also includes naturally occurring single-domain antibody molecules from species other than camelids and sharks.

[0348] In one respect, SDAB molecules can be derived from variable regions of immunoglobulins found in fish, such as those derived from the variable region of an immunoglobulin isotype called the novel antigen receptor (NAR) found in shark serum. Methods for generating single-domain molecules (“IgNAR”) derived from NAR variable regions are described in WO 03 / 014161 and Streltsov (2005) Protein Sci. 14:2901-2909.

[0349] According to another aspect, SDAB molecules are naturally occurring single-domain antigen-binding molecules, referred to as heavy chains lacking light chains. Such single-domain molecules are disclosed, for example, in WO 9404678 and Hamers-Casterman, C. et al. (1993) Nature 363:446-448. For clear reasons, this variable domain derived from naturally occurring heavy chain molecules lacking light chains is referred to herein as a VHH or nanobody to distinguish it from the conventional VH of four-stranded immunoglobulins. Such VHH molecules can be derived from camel species, such as camels, llamas, dromedary camels, alpacas, and guanacos. Other species besides camels can produce naturally occurring heavy chain molecules lacking light chains; such VHHs are within the scope of this invention.

[0350] SDAB molecules can be recombinant, CDR-transplanted, humanized, camelified, deimmunized, and / or in vitro generated (e.g., selected via phage display).

[0351] It has also been found that cells having multiple chimeric membrane-embedded receptors (which contain antigen-binding domains that interact with each other) may be undesirable, for example, because it inhibits the ability of one or more antigen-binding domains to bind their homologous antigens. Therefore, this paper discloses cells having a first non-naturally occurring chimeric membrane-embedded receptor and a second non-naturally occurring chimeric membrane-embedded receptor containing an antigen-binding domain that minimizes such interactions. This paper also discloses nucleic acids encoding the first and second non-naturally occurring chimeric membrane-embedded receptors containing an antigen-binding domain that minimizes such interactions, and methods for preparing and using such cells and nucleic acids. In one embodiment, the antigen-binding domain of one of the first non-naturally occurring chimeric membrane-embedded receptors and the second non-naturally occurring chimeric membrane-embedded receptor includes scFv, while the other includes a single VH domain, such as a single VH domain from camels, sharks, or lampreys, or a single VH domain derived from a human or mouse sequence.

[0352] In some embodiments, the claimed invention includes a first CAR and a second CAR, wherein the antigen-binding domain of one of the first CAR and the second CAR does not contain a variable light domain and a variable heavy domain. In some embodiments, the antigen-binding domain of one of the first CAR and the second CAR is an scFv, while the other is not an scFv. In some embodiments, the antigen-binding domain of one of the first CAR and the second CAR contains a single VH domain, such as a single VH domain from camels, sharks, or lampreys, or a single VH domain derived from a human or mouse sequence. In some embodiments, the antigen-binding domain of one of the first CAR and the second CAR contains a nanobody. In some embodiments, the antigen-binding domain of one of the first CAR and the second CAR contains a camel VHH domain.

[0353] In some embodiments, one of the first CAR and the second CAR has an antigen-binding domain comprising an scFv, and the other comprises a single VH domain, such as a camel, shark, or lamprey single VH domain, or a single VH domain derived from a human or mouse sequence. In some embodiments, one of the first CAR and the second CAR has an antigen-binding domain comprising an scFv, while the other comprises a nanobody. In some embodiments, one of the first CAR and the second CAR has an antigen-binding domain comprising an scFv, while the other comprises a camel VHH domain.

[0354] In some embodiments, when present on the cell surface, the binding of the antigen-binding domain of the first CAR to its homologous antigen is substantially not reduced by the presence of the second CAR. In some embodiments, in the presence of the second CAR, the binding of the antigen-binding domain of the first CAR to its homologous antigen is 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the binding of the antigen-binding domain of the first CAR to its homologous antigen in the absence of the second CAR.

[0355] In some embodiments, when present on the cell surface, the association between the antigen-binding domains of the first CAR and the second CAR is less than the association when both are scFv antigen-binding domains. In some embodiments, the association between the antigen-binding domains of the first CAR and the second CAR is 85%, 90%, 95%, 96%, 97%, 98%, or 99% less than the association when both are scFv antigen-binding domains.

[0356] In another aspect, the CAR-expressing cells described herein may further express another agent, such as an agent that enhances the activity of CAR-expressing cells. For example, in some embodiments, the agent may be an agent that inhibits an inhibitory molecule, such as the agent described herein. In some embodiments, an inhibitory molecule (e.g., PD1) may reduce the ability of CAR-expressing cells to produce an immune effector response. Examples of inhibitory molecules include PD1, PD-L1, PD-L2, CTLA4, TIM3, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFRβ. In some embodiments, the agent that inhibits the inhibitory molecule comprises a first polypeptide (e.g., an inhibitory molecule) that associates with a second polypeptide that provides a positive signal to the cell, such as an intracellular signal transduction domain as described herein. In some embodiments, the agent comprises a first polypeptide and a second polypeptide, such as an inhibitory molecule like PD1, PD-L1, PD-L2, CTLA4, TIM3, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC The second polypeptide comprises a fragment of class II, GAL9, adenosine, and TGFRβ, or any of these (e.g., at least a portion of the extracellular domain of any of these), wherein the second polypeptide is an intracellular signaling domain as described herein (e.g., including a co-stimulatory domain (e.g., 41BB, CD27, ICOS, or CD28, as described herein) and / or a primary signaling domain (e.g., the CD3ζ signaling domain as described herein)). In some embodiments, the agent comprises a first polypeptide of PD1 or a fragment thereof (e.g., at least a portion of the extracellular domain of PD1) and a second polypeptide comprising an intracellular signaling domain as described herein (e.g., the CD28 signaling domain as described herein and / or the CD3ζ signaling domain as described herein). In embodiments, the CAR-expressing cells described herein comprise a switch-co-stimulatory receptor, for example, as described in WO 2013 / 019615 (which is incorporated herein by reference in its entirety).PD-1 is an inhibitory member of the CD28 family of receptors, which also includes CD28, CTLA-4, ICOS, and BTLA. PD-1 is expressed on activated B cells, T cells, and myeloid cells (Agata et al. 1996 Int. Immunol [International Journal of Immunology] 8:765-75). It has been shown that the two ligands of PD-1, PD-L1 and PD-L2, downregulate T cell activation upon binding to PD-1 (Freeman et al. 2000 J Exp Med [Journal of Experimental Medicine] 192:1027-34; Latchman et al. 2001 Nat Immunol [Natural Immunology] 2:261-8; Carter et al. 2002 Eur J Immunol [European Journal of Immunology] 32:634-43). PD-L1 is abundant in human cancers (Dong et al. 2003 J Mol Med [Journal of Molecular Medicine] 81:281-7; Blank et al. 2005 Cancer Immunol. Immunother [Cancer Immunology and Immunotherapy] 54:307-314; Konishi et al. 2004 Clin Cancer Res [Clinical Cancer Research] 10:5094). Immunosuppression can be reversed by inhibiting the local interaction between PD1 and PD-L1.

[0357] In some embodiments, the agent comprises the extracellular domain (ECD) of an inhibitory molecule (e.g., programmed death 1 (PD1)) that may be fused with transmembrane domains and intracellular signaling domains (such as 41BB and CD3ζ) (also referred to herein as a PD1 CAR). In some embodiments, the PD1 CAR, when used in combination with the BCMA CAR described herein, improves the persistence of CAR-expressing cells (e.g., T cells or NK cells). In some embodiments, the CAR is a PD1 CAR that comprises the extracellular domain of PD1, as indicated by the underline in SEQ ID NO:24. In some embodiments, the PD1 CAR comprises the amino acid sequence of SEQ ID NO:24.

[0358] In some embodiments, the PD1 CAR comprises the amino acid sequence (SEQ ID NO:22) provided below.

[0359] In some embodiments, the agent comprises a nucleic acid sequence encoding a PD1 CAR (e.g., the PD1 CAR described herein). In some embodiments, the nucleic acid sequence of the PD1 CAR is as provided in SEQ ID NO:23, with PD1 ECD underlined.

[0360] In another aspect, the present invention provides a cell population expressing a CAR, such as CAR-T cells or CAR-expressing NK cells. In some embodiments, the cell population expressing a CAR comprises a mixture of cells expressing different CARs. For example, in some embodiments, the cell population expressing a CAR (e.g., CAR-T cells or CAR-expressing NK cells) may include a first cell expressing a CAR having an anti-BCMA binding domain as described herein, and a second cell expressing a CAR having a different anti-BCMA binding domain (e.g., an anti-BCMA binding domain as described herein that is different from the anti-BCMA binding domain in the CAR expressed by the first cell). As another example, the cell population expressing a CAR may include a first cell expressing a CAR containing, for example, an anti-BCMA binding domain as described herein, and a second cell expressing a CAR containing an antigen-binding domain targeting a target other than BCMA (e.g., CD19, CD20, CS-1, κ light chain, CD139, Lewis Y antigen, or CD38). In some embodiments, a CAR-expressing cell population includes first cells expressing a CAR containing, for example, an anti-BCMA binding domain as described herein, and second cells expressing a CAR containing an antigen-binding domain targeting CD19 (CD19 CAR). In some embodiments, a CAR-expressing cell population includes, for example, first cells expressing a CAR containing a primary intracellular signaling domain, and second cells expressing a CAR containing a secondary signaling domain.

[0361] In another aspect, the present invention provides a cell population in which at least one cell expresses a CAR having the anti-BCMA domain as described herein, and a second cell expresses another agent, such as an agent that enhances the activity of CAR-expressing cells. For example, in some embodiments, the agent may be an agent that inhibits an inhibitory molecule. In some embodiments, the inhibitory molecule may, for example, reduce the ability of CAR-expressing cells to produce an immune effector response. Examples of inhibitory molecules include PD1, PD-L1, PD-L2, CTLA4, TIM3, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFRβ. In some embodiments, the agent that inhibits the inhibitory molecule comprises a first polypeptide (e.g., an inhibitory molecule) that associates with a second polypeptide that provides a positive signal to the cell, such as an intracellular signal transduction domain as described herein. In some embodiments, the agent comprises a first polypeptide and a second polypeptide, such as an inhibitory molecule like PD1, PD-L1, PD-L2, CTLA4, TIM3, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC The second polypeptide comprises a fragment of class II, GAL9, adenosine, and TGFRβ, or any of these (e.g., at least a portion of the extracellular domain of any of these), and is an intracellular signaling domain as described herein (e.g., including co-stimulatory domains (e.g., 41BB, CD27, ICOS, or CD28, as described herein) and / or a primary signaling domain (e.g., the CD3ζ signaling domain as described herein)). In some embodiments, the agent comprises a first polypeptide of PD1 or a fragment thereof (e.g., at least a portion of the extracellular domain of PD1) and a second polypeptide of an intracellular signaling domain as described herein (e.g., the CD28 signaling domain and / or the CD3ζ signaling domain as described herein).

[0362] In one aspect, the present invention provides a method comprising administering a population of cells expressing a CAR (e.g., CAR-T cells or NK cells expressing a CAR), such as a mixture of cells expressing a different CAR and another agent (e.g., a kinase inhibitor, as described herein). In another aspect, the present invention provides a method comprising administering a population of cells in combination with another agent (e.g., a kinase inhibitor, as described herein), wherein at least one cell in the population expresses a CAR having an anticancer-associated antigen-binding domain as described herein, and a second cell expresses another agent (e.g., an agent that enhances the activity of cells expressing the CAR).

[0363] Natural killer cell receptor (NKR)

[0364] In one embodiment, the CAR molecule described herein comprises one or more components of a natural killer cell receptor (NKR), thereby forming an NKR-CAR. The NKR component may be a transmembrane domain, hinge domain, or cytoplasmic domain derived from any of the following natural killer cell receptors: killer cell immunoglobulin-like receptors (KIRs), such as KIR2DL1, KIR2DL2 / L3, KIR2DL4, KIR2DL5A, KIR2DL5B, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, DIR2DS5, KIR3DL1 / S1, KIR3DL2, and KIR3DL3. KIR2DP1 and KIR3DP1; natural cytotoxic receptors (NCRs), such as NKp30, NKp44, and NKp46; the signaling lymphocyte activation molecules (SLAM) family of immune cell receptors, such as CD48, CD229, 2B4, CD84, NTB-A, CRACC, BLAME, and CD2F-10; Fc receptors (FcRs), such as CD16 and CD64; and Ly49 receptors, such as LY49A and LY49C. The NKR-CAR molecules described herein can interact with adaptor molecules or intracellular signal transduction domains (e.g., DAP12). Exemplary configurations and sequences of CAR molecules containing NKR components are described in International Publication No. WO2014 / 145252, the contents of which are hereby incorporated by reference.

[0365] Strategies for modulating chimeric antigen receptors

[0366] CAR activity can be modulated in a variety of ways. In some embodiments, it is desirable to have a moduloable CAR (RCAR) with controllable CAR activity to optimize the safety and efficacy of CAR therapy. For example, the use of caspase fused with a dimerizing domain to induce apoptosis (see, for example, Di et al., N Engl. J. Med. [New England Journal of Medicine] 2011 Nov 3; 365(18):1673-1683) can be used as a safety switch in the CAR therapy of the present invention. In another instance, CAR-expressing cells may also express the inducible caspase-9 molecule, which, upon administration of a dimerizing drug such as rimiducid (also known as AP1903 (Bellicum Pharmaceuticals) or AP20187 (Ariad)), leads to activation of caspase-9 and apoptosis in the cells. The inducible caspase-9 molecule contains a dimerization chemical inducer (CID) binding domain, which mediates dimerization in the presence of CID. This results in depletion of the inducibility and selectivity of CAR-expressing cells. In some cases, the inducible caspase-9 molecule is encoded by a nucleic acid molecule separate from one or more CAR-encoding vectors. In other cases, the inducible caspase-9 molecule is encoded by the same nucleic acid molecule as the CAR-encoding vector. Inducible caspase-9 can provide a safety switch to avoid any toxicity to CAR-expressing cells. See, for example, Song et al., Cancer Gene. Ther. [Cancer Gene Therapy] 2008; 15(10):667-75; Clinical Trial Identifier NCT02107963; and Di Stasi et al. N. Engl. J. Med. [The New England Journal of Medicine] 2011; 365:1673-83.

[0367] Alternative strategies for modulating the CAR therapy of the present invention include utilizing small molecules or antibodies that inactivate or shut down CAR activity, for example by deleting CAR-expressing cells, for example by inducing antibody-dependent cell-mediated cytotoxicity (ADCC). For example, CAR-expressing cells described herein may also express antigens recognized by molecules capable of inducing cell death (e.g., ADCC or complement-induced cell death). For example, CAR-expressing cells described herein may also express receptors that can be targeted by antibodies or antibody fragments. Examples of such receptors include EpCAM, VEGFR, integrins (e.g., integrin αvβ3, α4, αI3 / 4β3, α4β7, α5β1, ανβ3, αν), members of the TNF receptor superfamily (e.g., TRAIL-R1, TRAIL-R2), PDGF receptor, interferon receptor, folate receptor, GPNMB, ICAM-1, HLA-DR, CEA, CA-125, MUC1, TAG-72, IL-6 receptor, 5T4, GD2, GD3, CD2, CD3, CD4, CD5, CD11, CD11 a / LFA-1, CD15, CD18 / ITGB2, CD19, CD20, CD22, CD23 / IgE receptor, CD25, CD28, CD30, CD33, CD38, CD40, CD41, CD44, CD51, CD52, CD62L, CD74, CD80, CD125, CD147 / basal immunoglobulin, CD152 / CTLA-4, CD154 / CD40L, CD195 / CCR5, CD319 / SLAMF7, and EGFR and their truncated forms (e.g., forms that retain one or more extracellular epidermal domains but lack one or more regions within the cytoplasmic domain). For example, cells expressing CARs as described herein may also express truncated epidermal growth factor receptor (EGFR) that lacks signal transduction capabilities but retains molecules capable of inducing ADCC (e.g., cetuximab). The epitopes identified by rituximab are used to induce ADCC and subsequently deplete CAR-expressing cells upon administration of cetuximab (see, for example, WO 2011 / 056894, and Jonnalagadda et al., Gene Ther. 2013; 20(8):853-860). Another strategy involves expressing a highly compact marker / suicide gene that combines target epitopes of CD32 and CD20 antigens from CAR-expressing cells described herein, which binds to rituximab, leading to selective depletion of CAR-expressing cells, for example, by ADCC (see, for example, Philip et al., Blood. 2014; 124(8):1277-1287). Other methods for depleting CAR-expressing cells described herein include administration of cetuximab. (A monoclonal anti-CD52 antibody that selectively binds to and targets mature lymphocytes (e.g., cells expressing CAR) to cause destruction, for example, by inducing ADCC. In other embodiments, a CAR ligand (e.g., an anti-idiotype antibody) may be used to selectively target cells expressing CAR. In some embodiments, the anti-idiotype antibody may induce effector cell activity (e.g., ADCC or ADC activity), thereby reducing the number of cells expressing CAR. In other embodiments, the CAR ligand, such as the anti-idiotype antibody, may be conjugated to an agent that induces cell killing (e.g., a toxin), thereby reducing the number of cells expressing CAR. Alternatively, the CAR molecule itself may be configured such that its activity can be modulated, e.g., turned on and off, as described below.

[0368] In some embodiments, the RCAR comprises a set of peptides, typically two in the simplest embodiment, wherein components of the standard CAR described herein, such as an antigen-binding domain and an intracellular signaling domain, are assigned to separate peptides or members. In some embodiments, the set of peptides includes a dimerization switch that can couple the peptides to each other in the presence of dimerizing molecules, for example, coupling the antigen-binding domain to the intracellular signaling domain. Further description and exemplary constructions of such tunable CARs are provided herein and in International Publication No. WO 2015 / 090229, which is incorporated herein by reference in its entirety.

[0369] In one embodiment, the RCAR comprises two polypeptides or members: 1) an intracellular signaling member comprising an intracellular signaling domain (e.g., a primary intracellular signaling domain as described herein) and a first switch domain; and 2) an antigen-binding member comprising, for example, an antigen-binding domain targeting a tumor antigen as described herein and a second switch domain. Optionally, the RCAR comprises a transmembrane domain as described herein. In one embodiment, the transmembrane domain may be disposed on the intracellular signaling member, the antigen-binding member, or both. Unless otherwise stated, the order of members or elements of the RCAR may be as provided, but other orders are also included when the members or elements of the RCAR are described herein. In other words, in one embodiment, the order is as described herein, but in other embodiments, the order may be different. For example, the order of elements on one side of the transmembrane region may differ from the example; for example, the placement of the switch domain relative to the intracellular signaling domain may be different, for example, opposite.

[0370] In one embodiment, the first switching domain and the second switching domain can form an intracellular or extracellular dimerization switch. In one embodiment, the dimerization switch can be a homodimerization switch, for example, where the first switching domain and the second switching domain are the same, or a heterodimerization switch, for example, where the first switching domain and the second switching domain are different from each other.

[0371] In embodiments, the RCAR may include "multiple switches". Multiple switches may include heterodimerization switch domains or homodimerization switch domains. The multiple switches independently include multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) switch domains on a first member (e.g., an antigen-binding member) and a second member (e.g., an intracellular signaling member). In one embodiment, the first member may include multiple first switch domains (e.g., FKBP-based switch domains), and the second member may include multiple second switch domains (e.g., FRB-based switch domains). In another embodiment, the first member may include both first and second switch domains (e.g., FKBP-based and FRB-based switch domains), and the second member may include both first and second switch domains (e.g., FKBP-based and FRB-based switch domains).

[0372] In one embodiment, an intracellular signaling member includes one or more intracellular signaling domains (e.g., primary intracellular signaling domains) and one or more co-stimulatory signaling domains.

[0373] In one embodiment, the antigen-binding member may comprise one or more intracellular signaling domains, such as one or more co-stimulatory signaling domains. In one embodiment, the antigen-binding member comprises multiple (e.g., two or three) co-stimulatory signaling domains as described herein, such as those selected from 4-1BB, CD28, CD27, ICOS, and OX40, and in this embodiment, no primary intracellular signaling domain is present. In one embodiment, the antigen-binding member comprises the following co-stimulatory signaling domains from extracellular to intracellular direction: 4-1BB-CD27; 4-1BB-CD27; CD27-4-1BB; 4-1BB-CD28; CD28-4-1BB; OX40-CD28; CD28-OX40; CD28-4-1BB; or 4-1BB-CD28. In such embodiments, the intracellular binding member comprises a CD3ζ domain. In one such embodiment, the RCAR includes (1) an antigen-binding member comprising an antigen-binding domain, a transmembrane domain, two co-stimulatory domains, and a first switch domain; and (2) an intracellular signaling domain comprising a transmembrane domain or a meso-membrane chain domain and at least one primary intracellular signaling domain and a second switch domain.

[0374] One embodiment provides an RCAR in which the antigen-binding member is not tethered to the cell surface of the CAR. This allows cells with intracellular signaling members to readily pair with one or more antigen-binding domains without needing to transform the cell using a sequence encoding the antigen-binding member. In such embodiments, the RCAR comprises: 1) an intracellular signaling member comprising: a first switch domain, a transmembrane domain, an intracellular signaling domain (e.g., a primary intracellular signaling domain), and a first switch domain; and 2) an antigen-binding member comprising: an antigen-binding domain and a second switch domain, wherein the antigen-binding member does not contain a transmembrane domain or a membrane chain domain, and optionally, does not contain an intracellular signaling domain. In some embodiments, the RCAR may further comprise 3) a second antigen-binding member comprising: a second antigen-binding domain, such as a second antigen-binding domain that binds to a different antigen rather than being bound by an antigen-binding domain; and a second switch domain.

[0375] This document also provides RCARs, in which the antigen-binding member incorporates bispecific activation and targeting capabilities. In this embodiment, the antigen-binding member may comprise multiple (e.g., 2, 3, 4, or 5) antigen-binding domains, such as scFv, wherein each antigen-binding domain binds to a target antigen, such as a different antigen or the same antigen, for example, the same or different epitopes on the same antigen. In one embodiment, multiple antigen-binding domains are tandem, and optionally, a connector or hinge region is arranged between each antigen-binding domain. Suitable connectors and hinge regions are described herein.

[0376] One embodiment provides an RCAR having a configuration that allows switch proliferation. In this embodiment, the RCAR comprises: 1) an intracellular signaling member comprising: optionally, a transmembrane domain or a mesosynaptic chain domain; one or more co-stimulatory signaling domains, for example, selected from 4-1BB, CD28, CD27, ICOS, and OX40, and a switch domain; and 2) an antigen-binding member comprising: an antigen-binding domain, a transmembrane domain, and a primary intracellular signaling domain (e.g., a CD3ζ domain), wherein the antigen-binding member does not contain a switch domain, or does not contain a switch domain dimerized with a switch domain on the intracellular signaling domain. In one embodiment, the antigen-binding member does not contain a co-stimulatory signaling domain. In one embodiment, the intracellular signaling member comprises a switch domain from a homodimerization switch. In one embodiment, the intracellular signaling member comprises a first switch domain of a heterodimerization switch, and the RCAR comprises a second intracellular signaling member comprising a second switch domain of a heterodimerization switch. In such embodiments, the second intracellular signaling member includes the same intracellular signaling domain as the intracellular signaling member. In one embodiment, the dimerization switch is intracellular. In one embodiment, the dimerization switch is extracellular.

[0377] In any RCAR configuration described herein, the first and second switch domains contain switches based on FKBP-FRB as described herein.

[0378] This document also provides cells comprising the RCAR described herein. Any cell engineered to express RCAR can be used as an RCARX cell. In one embodiment, the RCARX cell is a T cell and is referred to as an RCART cell. In one embodiment, the RCARX cell is an NK cell and is referred to as an RCARN cell.

[0379] This document also provides nucleic acids and vectors containing RCAR-coding sequences. Sequences encoding various elements of the RCAR can be arranged on the same nucleic acid molecule, such as the same plasmid or vector, for example, a viral vector, such as a lentiviral vector. In one embodiment, (i) a sequence encoding an antigen-binding member and (ii) a sequence encoding an intracellular signaling member can be present on the same nucleic acid, such as a vector. The respective proteins can be produced, for example, by using separate promoters or by using bicistronic transcripts (which can produce two protein products by cleaving a single translation product or by translating two separate protein products). In one embodiment, a sequence encoding a cleavable peptide (e.g., a P2A or F2A sequence) is arranged between (i) and (ii). In one embodiment, a sequence encoding an IRES (e.g., EMCV or EV71 IRES) is arranged between (i) and (ii). In these embodiments, (i) and (ii) are transcribed into a single RNA. In one embodiment, a first promoter is operatively linked to (i) and a second promoter is operatively linked to (ii), such that (i) and (ii) are transcribed into separate mRNAs.

[0380] Alternatively, sequences encoding various elements of RCAR can be arranged on different nucleic acid molecules, such as different plasmids or vectors, such as viral vectors, such as lentiviral vectors. For example, (i) sequences encoding antigen-binding members can be present on a first nucleic acid (e.g., a first vector), and (ii) sequences encoding intracellular signaling members can be present on a second nucleic acid (e.g., a second vector).

[0381] Dimerization switch

[0382] Dimerization switches can be non-covalent or covalent. In non-covalent dimerization switches, dimerizing molecules promote non-covalent interactions between the switching domains. In covalent dimerization switches, dimerizing molecules promote covalent interactions between the switching domains.

[0383] In one embodiment, the RCAR includes an FKBP / FRAP-based or FKBP / FRB-based dimerization switch. FKBP12 (an FKBP or FK506-binding protein) is an abundant cytoplasmic protein that acts as the initial intracellular target for the natural product immunosuppressive drug (rapamycin). Rapamycin binds to both FKBP and the large PI3K homolog FRAP (RAFT, mTOR). FRB is the 93-amino acid motif of FRAP, which is sufficient to bind the FKBP-rapamycin complex (Chen, J., Zheng, XF, Brown, EJ, and Schreiber, SL (1995) Identification of an 11-kDa FKBP12-rapamycin-binding domain within the 289-kDa FKBP12-rapamycin-associated protein and characterization of a critical serine residue. Proc Natl Acad Sci USA 92:4947-51).

[0384] In embodiments, the FKBP / FRAP-based switch (e.g., FKBP / FRB) can use dimerized molecules, such as rapamycin or rapamycin analogues.

[0385] An example amino acid sequence of FKBP is as follows:

[0386] DVPDYASLGGPSSPKKKRKVS RGVQVETISPGDG RT FPKRGQTCVVHYTGMLEDGKK FDSSRDRNKPFKFMLG KQ EVIRGWEEGVAQMSVGQRAKL TISPDYAYGATGHPGI IP PHATLVFDVELLKLETSY(SEQ ID NO:275)

[0387] In embodiments, the FKBP switching domain may contain a fragment of FKBP that has the ability to bind to FRB or a fragment or analog of FRB in the presence of rapamycin or a rapamycin analogue. In some embodiments, the FKBP switching domain comprises the following amino acid sequence:

[0388] VQVETISPGDGRTFPKRGQTC VVHYTGMLEDGKK FD SSRDRNKPFKFMLGKQEVIRG WEEGVAQMSVGQRAKL TI SPDYAYGATGHPGIIPPHATL VFDVELLKLETS(SEQ IDNO:276)

[0389] The amino acid sequence of FRB is as follows:

[0390] ILWHEMWHEG LEEASRLYFG ERNVKGMFEV LEPLHAMMER GPQTLKETSF NQAYGRRDLMEAQEWCRKYMK SGNVKDLTQA WDLYYHVFRR ISK(SEQ ID NO:277)

[0391] As used herein, the term "FKBP / FRAP-based (e.g., FKBP / FRB) switch" refers to a dimerizing switch comprising: a first switching domain containing an FKBP fragment or analogue thereof, the FKBP fragment or analogue thereof having the ability to bind to FRB or a fragment or analogue thereof in the presence of rapamycin or a rapamycin analogue (e.g., RAD001), and associated with SEQ ID The FKBP sequence of NO:275 or 276 has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity, or differs by no more than 30, 25, 20, 15, 10, 5, 4, 3, 2, or 1 amino acid residues; and a second switch domain comprising an FRB fragment or analogue thereof, the FRB fragment or analogue thereof having the ability to bind to an FRB or fragment or analogue thereof in the presence of rapamycin or a rapamycin analogue, and is consistent with SEQ ID. The FRB sequence of NO:277 has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity, or differs by no more than 30, 25, 20, 15, 10, 5, 4, 3, 2, or 1 amino acid residues. In one embodiment, the RCAR described herein comprises a switch domain containing the amino acid residues disclosed in SEQ ID NO:275 (or SEQ ID NO:276) and a switch domain containing the amino acid residues disclosed in SEQ ID NO:277.

[0392] In an embodiment, the FKBP / FRB dimerization switch comprises a modified FRB switching domain that exhibits altered (e.g., enhanced) complex formation between an FRB-based switching domain (e.g., a modified FRB switching domain, an FKBP-based switching domain) and a dimerizing molecule (e.g., rapamycin or a rapamycin analog (e.g., RAD001)). In one embodiment, the modified FRB switching domain comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) mutations selected from one or more amino acid positions L2031, E2032, S2035, R2036, F2039, G2040, T2098, W2101, D2102, Y2105, and F2108, wherein the wild-type amino acid is mutated to any other naturally occurring amino acid. In one embodiment, the mutant FRB comprises a mutation at E2032, wherein E2032 is mutated to phenylalanine (E2032F), methionine (E2032M), arginine (E2032R), valine (E2032V), tyrosine (E2032Y), isoleucine (E2032I), such as SEQ ID NO:278, or leucine (E2032L), such as SEQ ID NO:279. In one embodiment, the mutant FRB comprises a mutation at T2098, wherein T2098 is mutated to phenylalanine (T2098F) or leucine (T2098L), such as SEQ ID NO:280. In one embodiment, the mutant FRB comprises mutations at both E2032 and T2098, wherein E2032 is mutated to any amino acid, and wherein T2098 is mutated to any amino acid, such as SEQ ID NO:281. In one embodiment, the mutant FRB comprises E2032I and T2098L mutations, such as SEQ ID NO:282. In another embodiment, the mutant FRB comprises E2032L and T2098L mutations, such as SEQ ID NO:283.

[0393] Table 14. The exemplary mutant FRB has an increased affinity for dimerized molecules.

[0394]

[0395] Other suitable dimerization switches include GyrB-GyrB-based dimerization switches, gibberellin-based dimerization switches, label / adhesive dimerization switches, and halogen label / fast label dimerization switches. Such switches and related dimerization molecules will be readily apparent to those skilled in the art following the guidance provided herein.

[0396] dimer molecules

[0397] The association between switch domains is facilitated by dimerizing molecules. In the presence of dimerizing molecules, the interaction or binding between switch domains allows signal transduction between peptides associated (e.g., fused) with a first switch domain and peptides associated (e.g., fused) with a second switch domain. In the presence of dimerizing molecules at unrestricted levels, for example, in the system described herein, signal transduction is increased by 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 5, 10, 50, and 100-fold.

[0398] Rapamycin and rapamycin analogs (sometimes referred to as rapalogues, such as RAD001) may be used as dimerizing molecules in the FKBP / FRB-based dimerizing switches described herein. In one embodiment, the dimerizing molecule may be selected from rapamycin (sirolimus), RAD001 (everolimus), zotamolimus, tesimolimus, AP-23573 (desfolimus), bayolimus (biolimus), and AP21967. Other rapamycin analogs suitable for use with FKBP / FRB-based dimerizing switches are further described in the section entitled “Combination Therapy” or in the subsection entitled “Combination with Low (Immune-Enhancing) Dose of mTOR Inhibitors”.

[0399] Separate CAR

[0400] In some embodiments, the cells expressing the CAR use isolated CARs. Isolated CAR methods are described in more detail in publications WO 2014 / 055442 and WO 2014 / 055657, which are incorporated herein by reference. Briefly, an isolated CAR system comprises cells expressing a first CAR having a first antigen-binding domain and a co-stimulatory domain (e.g., 41BB), and the cells also expressing a second CAR having a second antigen-binding domain and an intracellular signaling domain (e.g., CD3ζ). When the cell encounters the first antigen, the co-stimulatory domain is activated, and the cell proliferates. When the cell encounters the second antigen, the intracellular signaling domain is activated, and cytotoxic activity begins. Thus, the CAR-expressing cells are fully activated only in the presence of both antigens. In embodiments, the first antigen-binding domain recognizes BCMA, such as those containing the antigen-binding domain described herein, and the second antigen-binding domain recognizes antigens expressed on acute myeloid leukemia cells, such as CD123, CLL-1, CD34, FLT3, or folate receptor β. In the embodiments, the first antigen-binding domain recognizes BCMA, such as including the antigen-binding domains described herein, and the second antigen-binding domain recognizes antigens expressed on B cells, such as CD10, CD19, CD20, CD22, CD34, CD123, FLT-3, ROR1, CD79b, CD179b, or CD79a.

[0401] Stability and mutation

[0402] The stability of the anti-BCMA binding domain (e.g., scFv molecules (e.g., soluble scFv)) can be assessed by referring to the biophysical properties (e.g., thermal stability) of conventional control scFv molecules or full-length antibodies.

[0403] The improved thermal stability of the anti-BCMA binding domain (e.g., scFv) is then imparted to the entire CART-BCMA construct, thereby improving the therapeutic properties of the CART-BCMA construct. The thermal stability of the anti-BCMA binding domain (e.g., scFv) can be improved by at least about 2°C or 3°C compared to conventional antibodies. In some embodiments, the thermal stability of the anti-BCMA binding domain (e.g., scFv) is improved by 1°C compared to conventional antibodies. In another embodiment, the thermal stability of the anti-BCMA binding domain (e.g., scFv) is improved by 2°C compared to conventional antibodies. In yet another embodiment, the scFv exhibits improved thermal stability at 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, and 15°C compared to conventional antibodies. Comparisons can be made, for example, between the scFv molecules disclosed herein and scFv molecules or Fab fragments of antibodies derived from scFv VH and VL. Thermal stability can be measured using methods known in the art. For example, in some embodiments, Tm can be measured. Methods for measuring Tm and other methods for determining protein stability are described in more detail below.

[0404] Mutations in scFv (generated through humanization of soluble scFv or direct mutagenesis) alter the stability of scFv and improve the overall stability of scFv and CART33 constructs. The stability of human scFv can be compared with that of mouse scFv using measurements such as Tm, temperature denaturation, and temperature aggregation.

[0405] The binding affinity of the mutant scFv can be determined using the assay described in the examples.

[0406] In some embodiments, the anti-BCMA binding domain (e.g., scFv) includes at least one mutation arising from the humanization process, such that the mutated scFv confers improved stability to the CART-BCMA construct. In another embodiment, the anti-BCMA binding domain (e.g., scFv) includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations arising from the humanization process, such that the mutated scFv confers improved stability to the CART-BCMA construct.

[0407] Methods for evaluating protein stability

[0408] The stability of antigen-binding domains can be assessed using methods such as those described below. Such methods allow for the determination of the overall stability threshold of multiple thermally folding transitions, where the least unstable domain unfolds first or restricts co-folding of multi-domain units (e.g., multi-domain proteins exhibiting a single unfolding transition). The least unstable domain can be identified in many other ways. Mutagenesis can be performed to detect which domain restricts overall stability. Additionally, protease resistance of multi-domain proteins can be determined by DSC or other spectroscopic methods under conditions where the least unstable domain is known to have inherently unfolded (Fontana et al., (1997) Fold. Des. [Folding Design], 2: R17-26; Dimasi et al., (2009) J. Mol. Biol. [Journal of Molecular Biology] 393: 672-692). Once the least unstable domain is identified, the sequence encoding that domain (or a portion thereof) can be used as the test sequence in the method.

[0409] a) Thermal stability

[0410] The thermal stability of a composition can be analyzed using many non-limiting biophysical or biochemical techniques known in the art. In some embodiments, thermal stability is evaluated by analytical spectroscopy.

[0411] An exemplary analytical spectroscopic method is differential scanning calorimetry (DSC). DSC employs a calorimeter that is sensitive to the thermal absorption accompanying the unfolding of most proteins or protein domains (see, for example, Sanchez-Ruiz et al., Biochemistry, 27:1648-52, 1988). To determine the thermal stability of a protein, a protein sample is inserted into the calorimeter and the temperature is increased until Fab or scFv unfolds. The temperature at which the protein unfolds indicates the overall protein stability.

[0412] Another exemplary analytical spectroscopic method is circular dichroism (CD) spectroscopy. CD spectroscopy measures the change in the optical activity of a composition with increasing temperature. Circular dichroism (CD) spectroscopy measures the difference in absorption between left-handed and right-handed polarized light due to structural asymmetry. Disordered or unfolded structures result in CD spectra that are very different from those of ordered or folded structures. CD spectra reflect the sensitivity of proteins to denaturation with increasing temperature and thus indicate the thermal stability of proteins (see van Mierlo and Steemsma, J. Biotechnol. [Journal of Biotechnology], 79(3):281-98, 2000).

[0413] Another exemplary analytical spectroscopic method for measuring thermal stability is fluorescence emission spectroscopy (see van Mierlo and Steemsma, ibid.). Yet another exemplary analytical spectroscopic method for measuring thermal stability is nuclear magnetic resonance (NMR) spectroscopy (see, for example, van Mierlo and Steemsma, ibid.).

[0414] The thermal stability of a composition can be measured biochemically. An exemplary biochemical method for assessing thermal stability is a thermal excitation assay. In a thermal excitation assay, the composition is subjected to a series of increasing temperatures for a predetermined period of time. For example, in some embodiments, the test scFv molecule or a molecule containing scFv is subjected to a series of increasing temperatures, for example, for 1–1.5 hours. The activity of the protein is then determined by an associated biochemical assay. For example, if the protein is a binding protein (e.g., scFv or a polypeptide containing scFv), the binding activity of the binding protein can be determined by a functional or quantitative ELISA.

[0415] This assay can be performed in high-throughput mode, and examples disclose those using *E. coli* and high-throughput screening. Libraries of anti-BCMA binding domains (e.g., scFv variants) can be generated using methods known in the art. Expression of anti-BCMA binding domains (e.g., scFv) can be induced, and anti-BCMA binding domains (e.g., scFv) can be subjected to thermal excitation. Binding to the excited test sample can be measured, and those stable anti-BCMA binding domains (e.g., scFv) can be scaled up and further characterized.

[0416] Thermal stability was evaluated by measuring the melting temperature (Tm) of the composition using any of the techniques described above (e.g., analytical spectroscopic techniques). The melting temperature is the temperature at the midpoint of the thermal transition curve, where 50% of the molecules of the composition are in a folded state (see, for example, Dimasi et al. (2009) J. Mol Biol. [Journal of Molecular Biology] 393:672-692). In some embodiments, the Tm values ​​for the anti-BCMA binding domain (e.g., scFv) are approximately 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, and 66°C. ℃, 67℃, 68℃, 69℃, 70℃, 71℃, 72℃, 73℃, 74℃, 75℃, 76℃, 77℃, 78℃, 79℃, 80℃, 81℃, 82℃, 83℃, 84℃, 85℃, 86℃, 87℃, 88℃, 89℃, 90℃, 91℃, 92℃, 93℃, 94℃, 95℃, 96℃, 97℃, 98℃, 99℃, 100℃. In some embodiments, the Tm value of IgG is approximately 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C. ℃, 69℃, 70℃, 71℃, 72℃, 73℃, 74℃, 75℃, 76℃, 77℃, 78℃, 79℃, 80℃, 81℃, 82℃, 83℃, 84℃, 85℃, 86℃, 87℃, 88℃, 89℃, 90℃, 91℃, 92℃, 93℃, 94℃, 95℃, 96℃, 97℃, 98℃, 99℃, 100℃. In some embodiments, the Tm value of the multivalent antibody is approximately 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 6... 8℃, 69℃, 70℃, 71℃, 72℃, 73℃, 74℃, 75℃, 76℃, 77℃, 78℃, 79℃, 80℃, 81℃, 82℃, 83℃, 84℃, 85℃, 86℃, 87℃, 88℃, 89℃, 90℃, 91℃, 92℃, 93℃, 94℃, 95℃, 96℃, 97℃, 98℃, 99℃, 100℃.

[0417] Thermal stability is also evaluated by measuring the specific heat or heat capacity (Cp) of the composition using analytical calorimetry techniques such as DSC. The specific heat of a composition is the energy required to raise the temperature of 1 mol of water by 1 °C (e.g., in kcal / mol). A large Cp is a marker of denatured or inactive protein compositions. The change in heat capacity (ΔCp) of the composition is measured by determining the specific heat of the composition before and after the thermal transition. Thermal stability can also be assessed by measuring or determining other parameters of thermodynamic stability, including the Gibbs free energy of unfolding (ΔG), the enthalpy of unfolding (ΔH), or the entropy of unfolding (ΔS)). The temperature at which 50% of the composition retains its activity (e.g., binding activity) is determined using one or more of the above biochemical assays (e.g., thermal excitation assays). C value).

[0418] Furthermore, mutations in the anti-BCMA binding domain (e.g., scFv) alter the thermal stability of the anti-BCMA binding domain (e.g., scFv) compared to the unmutated anti-BCMA binding domain (e.g., scFv). When a human or humanized anti-BCMA binding domain (e.g., scFv) is incorporated into a BCMA construct, the anti-BCMA binding domain (e.g., humanized scFv) confers thermal stability to the entire anti-BCMA CART construct. In some embodiments, the anti-BCMA binding domain (e.g., scFv) contains a single mutation that confers thermal stability to the anti-BCMA binding domain (e.g., scFv). In another embodiment, the anti-BCMA binding domain (e.g., scFv) contains multiple mutations that confer thermal stability to the anti-BCMA binding domain (e.g., scFv). In some embodiments, multiple mutations in the anti-BCMA binding domain (e.g., scFv) have an additive effect on the thermal stability of the anti-BCMA binding domain (e.g., scFv).

[0419] b) Aggregation %

[0420] The stability of a composition can be determined by measuring its tendency to aggregate. Aggregation can be measured by a number of non-limiting biochemical or biophysical techniques. For example, the aggregation of a composition can be evaluated using chromatography, such as size exclusion chromatography (SEC). SEC separates molecules based on size. A column is packed with semi-solid polymer gel beads, which allow ions and small molecules to enter but not large molecules. When a protein composition is applied to the top of the column, tightly folded proteins (i.e., non-aggregated proteins) are distributed through a larger volume of solvent than large protein aggregates. Therefore, large aggregates move through the column more quickly, and in this way, the mixture can be separated or fractionated into its components. When eluted from the gel, each fraction can be quantified individually (e.g., by light scattering). Therefore, the aggregation percentage of the composition can be determined by comparing the concentration of the fraction with the total concentration of protein applied to the gel. Stable compositions elute from the column as essentially a single fraction and appear as essentially a single peak in the elution curve or chromatogram.

[0421] c) Binding affinity

[0422] The stability of a composition can be assessed by determining its target binding affinity. Various methods for determining binding affinity are known in the art. An exemplary method for determining binding affinity employs surface plasmon resonance. Surface plasmon resonance is an optical phenomenon that allows, for example, the analysis of real-time biospecific interactions by detecting changes in protein concentration within a biosensor matrix using a BIAcore system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, NJ). For further details, see Jonsson, U. et al., (1993) Ann. Biol. Clin. 51:19-26; Jonsson, U. et al., (1991) Biotechniques 11:620-627; Johnson, B. et al., (1995) J. Mol. Recognit. 8:125-131; and Johnson, B. et al., (1991) Anal. Biochem. 198:268-277.

[0423] In one aspect, the antigen-binding domain of the CAR comprises an amino acid sequence homologous to the amino acid sequence of the antigen-binding domain described herein, and the antigen-binding domain retains the desired functional properties of the anti-BCMA antibody fragment described herein. In a specific aspect, the CAR composition of the present invention comprises an antibody fragment. In another aspect, the antibody fragment comprises scFv.

[0424] In various aspects, the antigen-binding domain of the CAR is engineered by modifying one or more amino acids within one or two variable regions (e.g., VH and / or VL), such as within one or more CDR regions and / or within one or more frame regions. In one specific aspect, the CAR composition of the present invention comprises an antibody fragment. In another aspect, the antibody fragment comprises scFv.

[0425] Those skilled in the art will understand that the antibodies or antibody fragments of the present invention can be further modified to alter their amino acid sequence (e.g., from wild type) without changing the desired activity. For example, additional nucleotide substitutions can be made to the protein, such as conserved substitutions leading to amino acid replacements, for example, conserved substitutions at “non-essential” amino acid residues. For example, a non-essential amino acid residue in the molecule can be replaced with another amino acid residue from the same side chain family. In another embodiment, a string of amino acids can be replaced by a string of structurally similar amino acids that differ in the sequence and / or composition of side chain family members, for example, resulting in a conserved substitution where the amino acid residue is replaced by an amino acid residue having a similar side chain.

[0426] Families of amino acid residues with similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0427] The percentage of identity in the context of two or more nucleic acid or polypeptide sequences refers to two or more identical sequences. When comparing and aligning over a comparison window (or a specified region measured by manual calibration and visual inspection using one of the following sequence comparison algorithms) to obtain maximum correspondence, two sequences are considered "substantially identical" if they have the same specified percentage of amino acid residues or nucleotides (e.g., 60% identity in a specified region, or, when not specified, throughout the entire sequence, optionally 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity). Optionally, the identity exists in a region of at least about 50 nucleotides (or 10 amino acids) in length, or more preferably in a region of 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.

[0428] For sequence comparisons, typically one sequence serves as the reference sequence, and the test sequence is compared to this reference sequence. When using a sequence comparison algorithm, the test and reference sequences are input into the computer, subsequence coordinates are specified if necessary, and the sequence algorithm program parameters are specified. Default program parameters can be used, or alternative parameters can be specified. The sequence comparison algorithm then calculates the percentage of sequence identity between the test sequence and the reference sequence based on the program parameters. Sequence alignment methods used for comparison are well known in the art. The optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith and Waterman (1970) Adv. Appl. Math. [Advances in Applied Mathematics] 2:482c; by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. [Journal of Molecular Biology] 48:443; by searching similarity methods of Pearson and Lipman, (1988) Proc. Nat'l. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 85:2444; by the computerization of these algorithms (Wisconsin Genetics Software at the Genetics Computer Group, 575 Science Dr., Madison, WI). GAP, BESTFIT, FASTA, and TFASTA in the Package; or by manual calibration and visual inspection (see, for example, Brent et al., (2003) Current Protocols in Molecular Biology [A Guide to Experiments in Contemporary Molecular Biology]).

[0429] Two examples of algorithms suitable for determining sequence identity percentage and sequence similarity are the BLAST and BLAST2.0 algorithms, described in Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402; and Altschul et al., (1990) J. Mol. Biol. 215:403-410. Software for performing BLAST analyses is publicly available from the National Center for Biotechnology Information.

[0430] Alternatively, the algorithm used in E. Meyers and W. Miller (1988) Comput. Appl. Biosci. [Computer Applications in Biological Sciences] 4:11-17, incorporated into the ALIGN program (version 2.0), can be used to determine the percentage of identity between two amino acid sequences using a PAM120 weighted residue table, a vacancy length penalty of 12, and a vacancy penalty of 4. Furthermore, the algorithm used in Needleman and Wunsch (1970) J. Mol. Biol. [Journal of Molecular Biology] 48:444-453, incorporated into the GCG software package (available at www.gcg.com), can be used to determine the percentage of identity between two amino acid sequences using a Blossom 62 matrix or a PAM250 matrix, with vacancy weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.

[0431] In one aspect, the present invention contemplates modifications to the amino acid sequence of the starting antibody or fragment (e.g., scFv) to produce functionally equivalent molecules. For example, the VH or VL of the anti-BCMA binding domain (e.g., scFv) contained in the CAR can be modified to retain at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity of the starting VH or VL framework region of the anti-BCMA binding domain (e.g., scFv). The present invention contemplates modifications to the entire CAR construct, for example, modifications to one or more amino acid sequences in the various domains of the CAR construct to produce functionally equivalent molecules. CAR constructs can be modified to retain at least approximately 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity with the starting CAR construct.

[0432] Nucleic acid constructs encoding CAR

[0433] The present invention also provides nucleic acid molecules encoding one or more CAR constructs described herein. In one aspect, the nucleic acid molecules are provided as messenger RNA transcripts. In another aspect, the nucleic acid molecules are provided as DNA constructs.

[0434] Therefore, in one aspect, the present invention relates to isolated nucleic acid molecules encoding chimeric antigen receptors (CARs), wherein the CAR comprises an anti-BCMA binding domain (e.g., a human anti-BCMA binding domain), a transmembrane domain, and an intracellular signaling domain comprising a stimulatory domain (e.g., a co-stimulatory signaling domain and / or a primary signaling domain, such as a ζ chain). In some embodiments, the anti-BCMA binding domain is the anti-BCMA binding domain described herein, or a sequence having 95%-99% identity with it. In some embodiments, the transmembrane domain is a transmembrane domain of a protein selected from the group consisting of: α, β, or ζ chains of T cell receptors, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154. In some embodiments, the anti-BCMA binding domain is connected to the transmembrane domain via a hinge region (e.g., a hinge described herein). In some embodiments, the isolated nucleic acid molecule further comprises a sequence encoding a primary signal transduction domain. In some embodiments, the primary signal transduction domain comprises a functional signal transduction domain derived from CD3ζ, TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278 (ICOS), FcεRI, DAP10, DAP12, or CD66d. In some embodiments, the isolated nucleic acid molecule further comprises a sequence encoding a co-stimulatory domain.In some embodiments, the co-stimulatory domain is selected from MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signal transduction lymphocyte activating molecules (SLAM proteins), activating NK cell receptors, BTLA, Toll ligand receptors, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278) ), GITR, BAFFR, LIGHT, HVEM(LIGHTR), KIRDS2, SLAMF7, NKp80(KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE , CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, N KG2C, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRTAM, Ly9 Functional signal transduction domains of proteins containing ligands that specifically bind to CD229, CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and CD83-specifically binding ligands.

[0435] In another aspect, the present invention relates to isolated nucleic acid molecules encoding CAR constructs, the CAR constructs comprising the leader sequence of SEQ ID NO:1.

[0436] In another aspect, the present invention relates to an isolated polypeptide molecule encoded by a nucleic acid molecule.

[0437] The nucleic acid sequence encoding the desired molecule can be obtained using recombination methods known in the art, such as by screening a library from a cell expressing the gene, obtaining the gene from a vector known to contain the gene, or by directly isolating the gene from cells and tissues containing the gene using standard techniques. Alternatively, the gene of interest can be synthesized rather than cloned.

[0438] The present invention also provides vectors in which the DNA of the present invention is inserted. Vectors derived from retroviruses, such as lentiviruses, are suitable tools for achieving long-term gene transfer because they allow for the long-term stable integration of transgenes and their proliferation in daughter cells. Lentiviral vectors have the additional advantage of being derived from tumor retroviruses, such as murine leukemia virus, because they can transduce non-proliferating cells, such as hepatocytes. They also have the additional advantage of low immunogenicity. Retroviral vectors can also be, for example, gamma retroviral vectors. Gamma retroviral vectors may include, for example, a promoter, a packaging signal (ψ), a primer binding site (PBS), one or more (e.g., two) long terminal repeats (LTRs), and a transgene of interest (e.g., a gene encoding a CAR). Gamma retroviral vectors may lack viral structural genes (such as gag, pol, and env). Exemplary gamma retroviral vectors include murine leukemia virus (MLV), spleen-forming lesion virus (SFFV), and myeloproliferative sarcoma virus (MPSV), and vectors derived therefrom. Other gamma retroviral vectors are described, for example, in Tobias Maetzig et al., “Gamma retroviral vectors: Biology, Technology and Application” Viruses. 2011, 3(6):677-713.

[0439] In another embodiment, the vector containing the nucleic acid encoding the desired CAR of this invention is an adenoviral vector (A5 / 35). In another embodiment, transposons (such as sleeping beauty), CRISPR, CAS9, and zinc finger nucleases can be used to complete the expression of the nucleic acid encoding the CAR. See June et al., 2009 Nature Reviews Immunology, 9.10:704-716, which is incorporated herein by reference.

[0440] In short, the expression of natural or synthetic nucleic acids encoding CARs is typically achieved by operatively linking a nucleic acid encoding a CAR polypeptide or a portion thereof to a promoter and incorporating the construct into an expression vector. Vectors are suitable for replication and integration into eukaryotes. Typical cloning vectors contain transcription and translation terminators, a start sequence, and a promoter that can be used to regulate the expression of the desired nucleic acid sequence.

[0441] Using standard gene delivery protocols, the expression constructs of the present invention can also be used for nucleic acid immunotherapy and gene therapy. Methods for gene delivery are known in the art. See, for example, U.S. Patent Nos. 5,399,346, 5,580,859, and 5,589,466, which are incorporated herein by reference in their entirety. In another embodiment, the present invention provides a gene therapy vector.

[0442] Nucleic acids can be cloned into many types of vectors. For example, nucleic acids can be cloned into vectors, including but not limited to plasmids, phage particles, phage derivatives, animal viruses, and entrapments. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

[0443] In addition, expression vectors can be delivered to cells in the form of viral vectors. Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, *Molecular Cloning: A Laboratory Manual*, Volumes 1–4, Cold Spring Harbor Press, New York, and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. Typically, suitable vectors contain a start-point for replication in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more selection markers (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326,193).

[0444] Numerous virus-based systems have been developed for transferring genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. Selected genes can be inserted into vectors and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered in vivo or in vitro to the cells of a subject. Many retroviral systems are known in the art. In some embodiments, adenoviral vectors are used. Many adenoviral vectors are known in the art. In some embodiments, lentiviral vectors are used.

[0445] Additional promoter elements (such as enhancers) regulate the frequency of transcription initiation. Typically, these are located in regions 30–110 bp upstream of the start site, but many promoters have also been shown to contain functional elements downstream of the start site. The spacing between promoter elements is often flexible, allowing promoter function to be preserved when elements are inverted or moved relative to each other. In the thymidine kinase (TK) promoter, the spacing between promoter elements can increase to 50 bp before activity begins to decline. Depending on the promoter, individual elements can act synergistically or independently to activate transcription.

[0446] An example of a promoter capable of expressing CAR transgenes in mammalian T cells is the EF1a promoter. The native EF1a promoter drives the expression of the α subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl-tRNA to the ribosome. The EF1a promoter has been widely used in mammalian expression plasmids and has been shown to efficiently drive CAR expression of transgenes cloned into lentiviral vectors. See, for example, Milone et al., Mol. Ther. [Molecular Therapy] 17(8):1453-1464 (2009). In one aspect, the EF1a promoter contains the sequence provided as SEQ ID NO:11.

[0447] Another example of a promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strongly constitutive promoter sequence capable of driving high-level expression of any polynucleotide sequence operatively linked to it. However, other constitutive promoter sequences may also be used, including but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters, such as, but not limited to, actin promoter, myosin promoter, elongation factor-1α promoter, hemoglobin promoter, and creatine kinase promoter. Furthermore, the present invention should not be limited to the use of constitutive promoters. Inducible promoters are also considered as part of the present invention. The use of inducible promoters provides a molecular switch capable of initiating expression when expression of the polynucleotide sequence operatively linked to the promoter is required, or shutting off expression when expression is not required. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0448] Another example of a promoter is the phosphoglycerate kinase (PGK) promoter. In embodiments, a truncated PGK promoter (e.g., a PGK promoter with one or more (e.g., 1, 2, 5, 10, 100, 200, 300, or 400) nucleotide deletions compared to a wild-type PGK promoter sequence) may be desirable. Nucleotide sequences of exemplary PGK promoters are provided below.

[0449] WT PGK promoter

[0450] ACCCCTCCTCCAGCCACTAAGCCAGTTGCTCCCTCGGCTGACGGCTGCACGCGAGGCCTCCGAACGTCTTACGCCTTGTGGCGCGCCCGTCCTTGTCCCGGGTGTGATGGCGGGGTGTGGGGCGGAGGGC GTGGCGGGGAAGGGCCGGCGACGAGAGCCGCGCGGGACGACTCGTCGGCGATAACCGGTGTCGGGTAGCGCCAGCCGCGCGACGGTAACGAGGGACCGCGACAGGCAGACGCTCCCATGATCACTCTGCACG CCGAAGGCAAATAGTGCAGGCCGTGCGGCGCTTGGCGTTCCTTGGAAGGGCTGAATCCCCGCCTCGTCCTTCGCAGCGGCCCCCCGGGTTGTTCCCATCGCCGCTTCTAGGCCCACTGCGACGCTTGCCTGCA CTTCTTACACGCTCTGGGTCCCAGCCGCGGCGACGCAAAGGGCCTTGGTGCGGGTCTCGTCGGCGCAGGGACGCGTTTGGGTCCCGACGGAACCTTTTCCGCGTTGGGGTTGGGGCACCATAAGCT(SEQID NO:190)

[0451] Exemplary truncated PGK promoter:

[0452] PGK100:

[0453] ACCCCTCCTCCAGCCACTAAGCCAGTTGCTCCCTCGGCTGACGGCTGCACGCGAGGCCTCCGAACGTCTTACGCCTTGTGGCGCGCCCGTCCTTGTCCCGGGTGTGATGGCGGGGTG (SEQ ID NO: 198)

[0454] PGK200:

[0455] ACCCCTCTCTCCAGCCACTAAGCCAGTTGCTCCCTCGGCTGACGGCTGCACGCGAGGCCTCCGAACGTCTTACGCCTTGTGGCGCGCCCGTCCTTGTCCCGGGTGTGATGGCGGGGTGTGGGGCGGAGGGCGTGGCGGGGAAGGGCCGGCGACGAGAGCCGCGCGGGACGACTCGTCGGCGATAACCGGTGTCGGGTAGCGCCAGCCGCGCGACGGTAACG(SEQ ID NO:191)

[0456] PGK300:

[0457] ACCCCTCTCTCCAGCCACTAAGCCAGTTGCTCCCTCGGCTGACGGCTGCACGCGAGGCCTCCGAACGTCTTACGCCTTGTGGCGCGCCCGTCCTTGTCCCGGGTGTGATGGCGGGGTGTGGGGCGGAGGGCGTGGCGGGGAAGGGCCGGCGACGAGAGCCGCGCGGGACGACTCGTCGGCGATAACCGGTGTCGGGTAGCGCCAGCCGCGCGACGGTAACGAGGGACCGCGACAGGCAGACGCTCCCATGATCACTCTGCACGCCGAAGGCAAATAGTGCAGGCCGTGCGGCGCTTGGCGTTCCTTGGAAGGGCTGAATCCCCG(SEQ ID NO:192)

[0458] PGK400:

[0459] ACCCCTCCTCCAGCCACTAAGCCAGTTGCTCCCTCGGCTGACGGCTGCACGCGAGGCCTCCGAACGTCTTACGCCTTGTGGCGCGCCCGTCCTTGTCCCGGGTGTGATGGCGGGGTGTGGGGCGGAGGGCGTGGCGGGGAAGGGCCGGCGACGAGAGCCGCGCGGGACGACTCGTCGGCGATAACCGGTGTCGGGTAGCGCCAGCCGCGCGA CGGTAACGAGGGACCGCGACAGGCAGACGCTCCCATGATCACTCTGCACGCCGAAGGCAAATAGTGCAGGCCGTGCGGCGCTTGGCGTTCCTTGGAAGGGCTGAATCCCCGCCTCGTCCTTCGCAGCGGCCCCCCGGGTGTTCCCATCGCCGCTTCTAGGCCCACTGCGACGCTTGCCTGCACTTCTTACACGCTCTGGGTCCCAGCCG(SEQ ID NO:193)

[0460] The vector may also include, for example, a secretion-promoting signal sequence, a polyadenylation signal and transcription terminator (e.g., from the bovine growth hormone (BGH) gene), elements that allow free replication and duplication in prokaryotes (e.g., SV40 origin and ColE1 or other elements known in the art), and / or elements that allow selection (e.g., ampicillin resistance genes and / or zeocin markers).

[0461] To assess the expression of CAR peptides or portions thereof, the expression vector to be introduced into cells may also contain a selectable marker gene or a reporter gene, or both, to facilitate the identification and selection of expressing cells from a cell population intended for transfection or infection via a viral vector. In other respects, the selectable marker can be carried on a separate DNA fragment and used in co-transfection procedures. Both the selectable marker and the reporter gene can be side-linked with appropriate regulatory sequences to achieve expression in host cells. Useful selectable markers include, for example, antibiotic resistance genes such as neo.

[0462] Reporter genes are used to identify potentially transfected cells and to evaluate the function of regulatory sequences. Typically, a reporter gene is a gene that is not present in or expressed by a recipient organism or tissue and encodes a polypeptide whose expression is indicated by some easily detectable property (e.g., enzyme activity). Reporter gene expression is measured at an appropriate time after DNA is introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein (GFP) genes (e.g., Ui-Tei et al., 2000 FEBS Letters 479:79-82). Suitable expression systems are well known and can be prepared using known techniques or are commercially available. Typically, a construct exhibiting the highest expression level of the reporter gene with a minimal 5' flanking region is identified as a promoter. Such promoter regions can be linked to the reporter gene and used to evaluate the ability of drugs to regulate promoter-driven transcription.

[0463] In some embodiments, the vector may further comprise a nucleic acid encoding a second CAR. In some embodiments, the second CAR includes an antigen-binding domain targeting: targets expressed on acute myeloid leukemia cells, such as CD123, CD34, CLL-1, folate receptor β, or FLT3; or targets expressed on B cells, such as CD10, CD19, CD20, CD22, CD34, CD123, FLT-3, ROR1, CD79b, CD179b, or CD79a. In some embodiments, the vector comprises a nucleic acid encoding a first CAR that specifically binds to a first antigen and includes an intracellular signaling domain having a co-stimulatory signaling domain but not a primary signaling domain, and a nucleic acid encoding a second CAR that specifically binds to a second, different antigen and includes an intracellular signaling domain having a primary signaling domain but not a co-stimulatory signaling domain. In some embodiments, the vector comprises a nucleic acid encoding a first BCMA CAR, the first BCMA CAR including a BCMA binding domain, a transmembrane domain, and a co-stimulatory domain; and a nucleic acid encoding a second CAR that targets an antigen other than BCMA (e.g., an antigen expressed on AML cells, such as CD123, CD34, CLL-1, folate receptor β, or FLT3; or an antigen expressed on B cells, such as CD10, CD19, CD20, CD22, CD34, CD123, FLT-3, ROR1, CD79b, CD179b, or CD79a), and includes an antigen-binding domain, a transmembrane domain, and a primary signal transduction domain. In another embodiment, the vector comprises nucleic acid encoding a first BCMA CAR and nucleic acid encoding a second CAR, the first BCMA CAR including a BCMA binding domain, a transmembrane domain, and a primary signal transduction domain, the second CAR specifically binding to antigens other than BCMA (e.g., antigens expressed on AML cells, such as CD123, CD34, CLL-1, folate receptor β, or FLT3; or antigens expressed on B cells, such as CD10, CD19, CD20, CD22, CD34, CD123, FLT-3, ROR1, CD79b, CD179b, or CD79a), and including an antigen-binding domain, a transmembrane domain, and a co-stimulatory signal transduction domain of the antigen.

[0464] In some embodiments, the vector comprises a nucleic acid encoding the BCMA CAR described herein and a nucleic acid encoding a repressive CAR. In some embodiments, the repressive CAR comprises an antigen-binding domain that binds to antigens present on normal cells rather than cancer cells (e.g., normal cells that also express BCMA). In some embodiments, the repressive CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain of the repressive molecule. For example, the intracellular domain of the repressive CAR may be an intracellular domain of PD1, PD-L1, PD-L2, CTLA4, TIM3, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFRβ.

[0465] In embodiments, the vector may comprise two or more nucleic acid sequences encoding a CAR (e.g., the BCMA CAR described herein) and a second CAR (e.g., an inhibitory CAR or a CAR that specifically binds to antigens other than BCMA (e.g., antigens expressed on AML cells, such as CD123, CLL-1, CD34, FLT3, or folate receptor β; or antigens expressed on B cells, such as CD10, CD19, CD20, CD22, CD34, CD123, FLT-3, ROR1, CD79b, CD179b, or CD79a)). In such embodiments, the two or more nucleic acid sequences encoding the CAR are encoded by a single nucleic acid molecule within the same frame and serve as a single polypeptide chain. In this respect, the two or more CARs may be separated, for example, by one or more peptide cleavage sites (e.g., autocleavage sites or substrates of intracellular proteases). Examples of peptide cleavage sites include the following, wherein GSG residues are optional:

[0466] T2A: (GSG)EGRGSLLTCGDVEENPGP (SEQ ID NO:194)

[0467] P2A: (GSG)ATNFSLLKQAGDVEENPGP(SEQ ID NO:195)

[0468] E2A: (GSG)QCTNYALLKLAGDVESNPGP(SEQ ID NO:196)

[0469] F2A: (GSG)VKQTLNFDLLKLAGDVESNPG P(SEQ ID NO:197)

[0470] Methods for introducing genes into and expressing them in cells are known in the art. In the context of expression vectors, vectors can be readily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, by any method in the art. For example, expression vectors can be transferred into host cells by physical, chemical, or biological means.

[0471] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipid transfection, particle bombardment, microinjection, electroporation, etc. Methods for generating cells containing vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al., 2012, *Molecula Cloning: A Laboratory Manual*, Volumes 1–4, Cold Spring Harbor Press, New York. A preferred method for introducing polynucleotides into host cells is calcium phosphate transfection.

[0472] Biological methods for introducing polynucleotides of interest into host cells include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian cells, such as human cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, etc. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.

[0473] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems (including oil-in-water emulsions, micelles, mixed micelles, and liposomes). An exemplary colloidal system used as a delivery carrier in vitro and in vivo is a liposome (e.g., an artificial membrane). Other methods for targeted delivery of nucleic acids (such as delivery of polynucleotides using targeted nanoparticles or other suitable submicron-sized delivery systems) are available in the prior art.

[0474] In the use of non-viral delivery systems, an exemplary delivery vector is the liposome. Consider using lipid formulations to introduce nucleic acids into host cells (in vitro, ex vivo, or in vivo). Alternatively, nucleic acids can associate with lipids. Lipid-bound nucleic acids can be encapsulated within the aqueous interior of liposomes, dispersed within a lipid bilayer of the liposome, attached to the liposome via linker molecules associated with both the liposome and the oligonucleotide, embedded in the liposome, complexed with the liposome, dispersed in a solution containing lipids, mixed with lipids, combined with lipids, contained in lipids as a suspension, contained in micelles, or complexed with micelles, or otherwise associated with lipids. Combinations of lipids, lipid / DNA, or lipid / expression vector associations are not limited to any particular structure in solution. For example, they can exist as bilayers, micelles, or “collapsed” structures. They can also simply be dispersed in solution, possibly forming aggregates of varying sizes or shapes. Lipids are fatty substances, which can be naturally occurring or synthetic. For example, lipids include fat droplets that are naturally present in the cytoplasm, as well as compounds containing long-chain aliphatic hydrocarbons and their derivatives (such as fatty acids, alcohols, amines, amino alcohols, and aldehydes).

[0475] Suitable lipids are available from commercial sources. For example, dimyristoylphosphatidylcholine (“DMPC”) is available from Sigma, St. Louis, MO; dicetylphosphatidylcholine (“DCP”) is available from K&K Laboratories (Plainview, NY); cholesterol (“Choi”) is available from Calbiochem-Behring; dimyristoylphosphatidylglycerol (“DMPG”) and other lipids are available from Avanti Polar Lipids, Inc. (Birmingham, Alabama). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at approximately -20°C. Chloroform is used as the sole solvent because it evaporates more readily than methanol. “Liposomes” is a general term encompassing various monolayer and multilayer lipid carriers formed by creating closed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer and an internal aqueous medium. Multilayer liposomes have multiple lipid layers separated by an aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo rearrangement before forming a closed structure, trapping water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5:505-10). However, compositions exhibiting structures in solution that differ from normal vesicular structures are also included. For example, lipids can present as micellar structures or simply as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes have also been considered.

[0476] Regardless of the method used to introduce exogenous nucleic acids into host cells or otherwise expose cells to the inhibitors of the present invention, a variety of assays can be performed to confirm the presence of the recombinant DNA sequence in the host cells. Such assays include, for example, "molecular biology" assays well known to those skilled in the art, such as DNA and RNA blotting, RT-PCR, and PCR; and "biochemical" assays, such as detecting the presence or absence of a specific peptide, for example by immunological means (ELISA and Western blotting) or by assays described herein to identify agents falling within the scope of the present invention.

[0477] The present invention further provides a vector comprising a nucleic acid molecule encoding a CAR. In one aspect, the CAR vector can be directly transduced into cells, such as T cells or NK cells. In one aspect, the vector is a cloning or expression vector, for example, including but not limited to vectors such as one or more plasmids (e.g., expression plasmids, cloning vectors, microcircles, microvectors, dual microchromosomes), retroviral, and lentiviral vector constructs. In one aspect, the vector is capable of expressing the CAR construct in mammalian T cells or NK cells. In one aspect, the mammalian T cell is a human T cell. In one aspect, the mammalian NK cell is a human NK cell.

[0478] RNA transfection

[0479] This document discloses a method for generating an in vitro transcribed RNA CAR. The invention also includes an RNA construct encoding a CAR that can be directly transfected into cells. The method for generating mRNA for transfection may involve in vitro transcription (IVT) of a template using specially designed primers, followed by the addition of polyA to produce a construct (SEQ ID NO:35) typically 50-2000 bases in length containing 3' and 5' untranslated sequences (“UTR”), a 5' cap and / or an internal ribosome entry site (IRES), the nucleic acid to be expressed, and a polyA tail. The resulting RNA can be efficiently transfected into different cell types. In one aspect, the template includes the sequence of the CAR.

[0480] In one aspect, the anti-BCMA CAR is encoded by messenger RNA (mRNA). In another aspect, the mRNA encoding the anti-BCMA CAR is introduced into immune effector cells (e.g., T cells or NK cells) to generate CAR-expressing cells (e.g., CAR-T cells or CAR-expressing NK cells).

[0481] In some embodiments, the in vitro transcribed RNA CAR can be introduced into cells as a transient transfection. RNA is generated by in vitro transcription using a template produced by polymerase chain reaction (PCR). DNA of interest from any source can be directly converted into a template by PCR to synthesize mRNA in vitro using appropriate primers and RNA polymerase. The DNA source can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequences, or any other suitable DNA source. The desired template for in vitro transcription is the CAR of the present invention. For example, the template for the RNA CAR can include an extracellular region containing a single-stranded variable domain of an antitumor antibody; a hinge region; a transmembrane domain (e.g., the transmembrane domain of CD8a); and a cytoplasmic region including intracellular signal transduction domains, such as a CD3-ζ signal transduction domain and a 4-1BB signal transduction domain.

[0482] In some embodiments, the DNA to be used for PCR contains an open reading frame. The DNA may be a naturally occurring DNA sequence from the genome of an organism. In some embodiments, the nucleic acid may include some or all of the 5' and / or 3' untranslated regions (UTRs). The nucleic acid may include exons and introns. In some embodiments, the DNA for PCR is a human nucleic acid sequence. In another embodiment, the DNA for PCR is a human nucleic acid sequence including both 5' and 3' UTRs. Alternatively, the DNA may be an artificial DNA sequence that is not typically expressed in naturally occurring organisms. An exemplary artificial DNA sequence is a sequence containing gene portions linked together to form an open reading frame encoding a fusion protein. The linked DNA portions may originate from a single organism or from more than one organism.

[0483] PCR is used to generate a template for in vitro transcription of mRNA, which is then used for transfection. Methods for performing PCR are well known in the art. Primers used for PCR are designed to have regions substantially complementary to the DNA region to be used as a PCR template. As used herein, “substantially complementary” means that most or all bases in the primer sequence are complementary, or one or more bases are non-complementary or mismatched nucleotide sequences. Substantially complementary sequences are capable of annealing or hybridizing with the intended DNA target under annealing conditions used for PCR. Primers can be designed to be substantially complementary to any portion of the DNA template. For example, primers can be designed to amplify a portion (open reading frame) of a nucleic acid that is normally transcribed in cells, including the 5' and 3' UTRs. Primers can also be designed to amplify a portion of a nucleic acid encoding a specific domain of interest. In some embodiments, primers are designed to amplify the coding region of human cDNA, including all or part of the 5' and 3' UTRs. Primers that can be used for PCR can be produced by synthetic methods well known in the art. A “forward primer” is a primer containing nucleotide regions that are substantially complementary to nucleotides on the DNA template located upstream of the DNA sequence to be amplified. "Upstream" in this document refers to the 5' position of the DNA sequence to be amplified relative to the coding strand. "Reverse primer" is a primer containing a nucleotide region that is substantially complementary to the double-stranded DNA template downstream of the DNA sequence to be amplified. "Downstream" in this document refers to the 3' position of the DNA sequence to be amplified relative to the coding strand.

[0484] Any DNA polymerase that can be used for PCR can be used in the methods disclosed herein. Reagents and polymerases are commercially available from many sources.

[0485] Chemical structures that promote stability and / or translation efficiency can also be used. The RNA preferably has 5' and 3' UTRs. In some embodiments, the length of the 5' UTR is between 1 and 3000 nucleotides. The lengths of the 5' and 3' UTR sequences to be added to the coding region can be varied by various methods, including but not limited to designing PCR primers that anneal to different regions of the UTR. Using this approach, those skilled in the art can modify the desired 5' and 3' UTR lengths to achieve optimal translation efficiency after transfection of the transcribed RNA.

[0486] The 5' and 3' UTRs can be naturally occurring endogenous 5' and 3' UTRs of the nucleic acid of interest. Alternatively, these UTR sequences can be added by incorporating a UTR sequence that is not endogenous to the nucleic acid of interest into the forward and reverse primers or by any other modification of the template. Using UTR sequences that are endogenous to the nucleic acid of interest can be used to alter RNA stability and / or translation efficiency. For example, it is known that AU-rich elements in the 3' UTR sequence can reduce mRNA stability. Therefore, 3' UTRs can be selected or designed to increase the stability of transcribed RNA based on the characteristics of UTRs well known in the art.

[0487] In some embodiments, the 5'UTR may contain a Kozak sequence of an endogenous nucleic acid. Alternatively, when a shared Kozak sequence is redesigned by adding a 5'UTR sequence to which the nucleic acid of interest is not endogenous, as described above via PCR, the Kozak sequence can be improved by adding a 5'UTR sequence. Kozak sequences can improve the translation efficiency of some RNA transcripts, but do not appear to be required for efficient translation of all RNAs. The requirement for Kozak sequences for many mRNAs is known in the art. In other embodiments, the 5'UTR may be the 5'UTR of an RNA virus whose RNA genome is stable in cells. In other embodiments, various nucleotide analogs may be used in the 3' or 5'UTR to prevent exonuclease degradation of the mRNA.

[0488] To achieve RNA synthesis from a DNA template without gene cloning, a transcription promoter should be attached to the DNA template upstream of the sequence to be transcribed. When a sequence that functions as an RNA polymerase promoter is added to the 5' end of the forward primer, the RNA polymerase promoter will be incorporated into the PCR product upstream of the open reading frame to be transcribed. In a preferred embodiment, the promoter is the T7 polymerase promoter, as described elsewhere herein. Other available promoters include, but are not limited to, the T3 and SP6 RNA polymerase promoters. The common nucleotide sequences of the T7, T3, and SP6 promoters are known in the art.

[0489] In a preferred embodiment, the mRNA has a 5' cap and a 3' poly(A) tail, which determine ribosome binding, translation initiation, and mRNA stability in the cell. On a circular DNA template, such as plasmid DNA, RNA polymerase produces a long polynucleotide product unsuitable for expression in eukaryotic cells. Transcription of plasmid DNA linearized at the 3' UTR produces a normal-sized mRNA that is ineffective in eukaryotic transfection even after post-transcriptional polyadenylation.

[0490] On a linear DNA template, phage T7 RNA polymerase can extend the 3' end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003).

[0491] The conventional method for integrating polyA / T extensions into DNA templates is molecular cloning. However, polyA / T sequences integrated into plasmid DNA can lead to plasmid instability, which is why plasmid DNA templates obtained from bacterial cells are often highly contaminated with deletions and other aberrations. This makes the cloning process not only laborious and time-consuming but also often unreliable. Therefore, a method that allows the construction of DNA templates with polyA / T 3' extensions without cloning is highly desirable.

[0492] Poly(A) / T segments of transcribed DNA templates can be generated during PCR using reverse primers containing a polythymidine tail (e.g., a 100T tail) (SEQ ID NO:31) (the size can be 50-5000T (SEQ ID NO:32)), or after PCR by any other method (including but not limited to DNA ligation or in vitro recombination). The poly(A) tail also provides stability to RNA and reduces its degradation. Generally, the length of the poly(A) tail is positively correlated with the stability of the transcribed RNA. In some embodiments, the poly(A) tail is between 100 and 5000 adenosines (SEQ ID NO:33).

[0493] Following in vitro transcription using a poly(A) polymerase (such as E. coli poly(A) polymerase (E-PAP)), the poly(A) tail of RNA can be further extended. In some embodiments, increasing the length of the poly(A) tail from 100 nucleotides to 300 to 400 nucleotides (SEQ ID NO:34) results in approximately a two-fold increase in RNA translation efficiency. Additionally, the attachment of different chemical groups to the 3' end can increase mRNA stability. This attachment can contain modified / artificial nucleotides, aptamers, and other compounds. For example, ATP analogs can be incorporated into the poly(A) tail using a poly(A) polymerase. ATP analogs can also increase RNA stability.

[0494] The 5' cap also provides stability to the RNA molecule. In a preferred embodiment, the RNA produced by the methods disclosed herein includes a 5' cap. The 5' cap is obtained using techniques known in the art and described herein (Cougot et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski et al., RNA, 7:1468-95 (2001); Elango et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).

[0495] The RNA produced by the methods disclosed herein may also contain an internal ribosome entry site (IRES) sequence. The IRES sequence can be any viral, chromosomal, or artificially designed sequence that initiates cap-independent ribosome binding to mRNA and promotes translation initiation. It may include any solute suitable for cell electroporation, which may contain factors that promote cell permeability and viability, such as sugars, peptides, lipids, proteins, antioxidants, and surfactants.

[0496] RNA can be introduced into target cells using any of a number of different methods, such as commercially available methods including, but not limited to: electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Massachusetts) or Gene Pulser II (BioRad, Denver, Colorado)), Multiporator (Eppendort, Hamburg, Germany); cationic liposome-mediated transfection (using lipid transfection); polymer encapsulation; peptide-mediated transfection; or biological projectile particle delivery systems such as “gene guns” (see, for example, Nishikawa et al. Hum Gene Ther. [Human Gene Therapy], 12(8):861-70 (2001)).

[0497] Non-viral delivery methods

[0498] In some respects, non-viral methods can be used to deliver nucleic acids encoding the CAR described herein into cells or tissues or subjects.

[0499] In some embodiments, nonviral methods include the use of transposons (also known as transposition elements). In some embodiments, a transposon is a DNA strand that can insert itself into one location in the genome, for example, a DNA strand capable of self-replication and inserting a copy into the genome, or a DNA strand that can be spliced ​​from a longer nucleic acid and inserted into another location in the genome. For example, a transposon comprises a DNA sequence consisting of inverted repeat sequences flanked by genes for transposition.

[0500] Exemplary methods for nucleic acid delivery using transposons include the Sleeping Beauty transposon system (SBTS) and the piggyBac (PB) transposon system. See, for example, Aronovich et al. Hum. Mol. Genet. [Human Molecular Genetics] 20. R1 (2011): R14-20; Singh et al. Cancer Res. [Cancer Research] 15 (2008): 2961-2971; Huang et al. Mol. Ther. [Molecular Therapy] 16 (2008): 580-589; Grabundzija et al. Mol. Ther. [Molecular Therapy] 18 (2010): 1200-1209; Kebriaei et al. Blood. [Hematology]. 122. 21 (2013): 166; Williams. Molecular Therapy, 16.9 (2008): 1515-16; Bell et al., Nat. Protoc. 2.12 (2007): 3153-65; and Ding et al., Cell. 122.3 (2005): 473-83, all of which are incorporated herein by reference.

[0501] SBTS comprises two components: 1) transposons containing transgenes and 2) a source of transposases. Transposases can transfer transposons from vector plasmids (or other donor DNA) to target DNA, such as host cell chromosomes / genomes. For example, a transposase binds to a vector plasmid / donor DNA, cuts out transposons (including one or more transgenes) from the plasmid, and inserts them into the host cell's genome. See, for example, Aronovich et al., above.

[0502] Exemplary transposons include pT2-based transposons. See, for example, Grabundzija et al., Nucleic Acids Res. 41.3 (2013):1829-47; and Singh et al., Cancer Res. 68.8 (2008):2961-2971, all of which are incorporated herein by reference. Exemplary transposases include Tc1 / mariner-type transposases, such as SB10 or SB11 transposases (which may be overactive transposases expressed, for example, from cytomegalovirus promoters). See, for example, Aronovich et al.; Kebriaei et al.; and Grabundzija et al., all of which are incorporated herein by reference.

[0503] The use of SBTS allows for the efficient integration and expression of transgenes (e.g., nucleic acids encoding the CAR described herein). This article provides methods for generating cells (e.g., T cells or NK cells) that stably express the CAR described herein, for example using a transposon system (e.g., SBTS).

[0504] According to the methods described herein, in some embodiments, one or more nucleic acids (e.g., plasmids) containing SBTS components are delivered to cells (e.g., T or NK cells). For example, one or more nucleic acids are delivered using standard methods for nucleic acid (e.g., plasmid DNA) delivery, such as those described herein, such as electroporation, transfection, or lipid transfection. In some embodiments, the nucleic acid contains a transposon comprising a transgene (e.g., a nucleic acid encoding a CAR as described herein). In some embodiments, the nucleic acid contains a transposon comprising a transgene (e.g., a nucleic acid encoding a CAR as described herein) and a nucleic acid sequence encoding a transposase. In other embodiments, a system having two nucleic acids is provided, such as a dual-plasmid system, where, for example, the first plasmid contains a transposon comprising a transgene, and the second plasmid contains a nucleic acid sequence encoding a transposase. For example, the first and second nucleic acids are co-delivered to a host cell.

[0505] In some embodiments, cells expressing the CAR described herein, such as T cells or NK cells, are generated by using a combination of gene insertion (using SBTS) and gene editing (using nucleases (e.g., zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), CRISPR / Cas systems, or homing endonucleases reengineered from engineered large-scale nucleases)).

[0506] In some embodiments, the use of non-viral delivery methods allows for the reprogramming of cells, such as T cells or NK cells, and the direct infusion of these cells into the subject. Advantages of non-viral vectors include, but are not limited to, the ease and relatively low cost of producing sufficient quantities to meet the needs of the patient population, stability during storage, and lack of immunogenicity.

[0507] cell origin

[0508] Prior to amplification and genetic modification, the source of the cells (e.g., immune effector cells, such as T cells or NK cells) is obtained from the subject. The term "subject" is intended to include any living organism (e.g., a mammal) in which an immune response can be elicited. Examples of subjects include humans, dogs, cats, mice, rats, and their transgenic species. T cells can be obtained from many sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from sites of infection, ascites, pleural effusion, spleen tissue, and tumors.

[0509] In some aspects of the invention, any number of immune effector cell lines (e.g., T cells or NK cells) available in the art can be used. In some aspects of the invention, blood units collected from a subject can be used (using any number of techniques known to those skilled in the art, such as Ficoll). TM T cells are obtained by isolation. In a preferred aspect, cells from an individual's circulating blood are obtained by apheresis. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. In one aspect, cells collected by apheresis can be washed to remove the plasma fraction and placed in a suitable buffer or culture medium for subsequent processing steps. In one aspect of the invention, cells are washed with phosphate-buffered saline (PBS). Alternatively, the wash solution may be calcium-deficient and may be magnesium-deficient, or may be deficient in many (if not all) divalent cations.

[0510] An initial activation step in the absence of calcium can lead to amplified activation. As will be readily understood by those skilled in the art, the washing step can be performed by methods known to those skilled in the art, such as by using a semi-automatic "flow-through" centrifuge (e.g., Cobe 2991 cell processor, Baxter CytoMate, or Haemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, the cells can be resuspended in a variety of biocompatible buffers, such as Ca-free, Mg-free PBS, PlasmaLyte A, or other salt solutions with or without buffer. Alternatively, unwanted components in apheresis samples can be removed, and the cells can be resuspended directly in culture medium.

[0511] It should be recognized that the methods of this application may utilize culture medium conditions containing 5% or less (e.g., 2%) of human AB serum, and may use known culture medium conditions and compositions, such as those described in: Smith et al., “Ex vivoexpansion of human T cells for adoptive immunotherapy using the novel Xeno-free CTS Immune Cell Serum Replacement” Clinical & Translational Immunology (2015) 4, e31; doi:10.1038 / cti.2014.31.

[0512] In one aspect, T cells are isolated from peripheral blood lymphocytes by lysing erythrocytes and depleting monocytes (e.g., by PERCOLL™ gradient centrifugation or by convective centrifugation washing). Specific T cell subsets, such as CD3+, CD28+, CD4+, CD8+, CD45RA+, and CD45RO+ T cells, can be further isolated using positive or negative selection techniques. For example, in one aspect, T cells are isolated by conjugation with anti-CD3 / anti-CD28 (e.g., 3x28) beads (e.g., ...). Incubation with M-450 CD3 / CD28 T beads for a sufficient period of time to positively select desired T cells for T cell isolation. In one aspect, this period is approximately 30 minutes. In another aspect, this period ranges from 30 minutes to 36 hours or longer and all integer values ​​within this range. In yet another aspect, this period is at least 1, 2, 3, 4, 5, or 6 hours. In yet another preferred aspect, this period is 10 to 24 hours. In one aspect, the incubation period is 24 hours. Longer incubation times can be used to isolate T cells in any situation where fewer T cells are present, such as when isolating tumor-infiltrating lymphocytes (TILs) from tumor tissue or immunocompromised individuals, compared to other cell types. Furthermore, using longer incubation times can improve the efficiency of CD8+ T cell capture. Therefore, by simply shortening or lengthening the time for T cells to bind to CD3 / CD28 beads and / or by increasing or decreasing the bead-to-T-cell ratio (as further described herein), T cell subsets can be preferentially selected or targeted at the start of culture or at other points during the process. Additionally, by increasing or decreasing the ratio of anti-CD3 and / or anti-CD28 antibodies on beads or other surfaces, T cell subsets can be preferentially selected or targeted at the start of culture or at other desired time points. Those skilled in the art will recognize that multiple rounds of selection can also be used in the context of this invention. In some aspects, it may be desirable to perform a selection procedure and use “unselected” cells during activation and expansion. “Unselected” cells can also undergo further rounds of selection.

[0513] Enriching T cell populations by negative selection can be accomplished using a combination of antibodies targeting cell-specific surface markers specific to the negatively selected cells. One approach is cell sorting and / or selection via negative magnetic immunoadsorption or flow...

Claims

1. An isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an anti-BCMA binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the anti-BCMA binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementarity determining region 1 (HC CDR1), a heavy chain complementarity determining region 2 (HC CDR2), and a heavy chain complementarity determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3), wherein the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 are the amino acid sequences of SEQ ID NOs: 86, 87, 88, 95, 96, and 97, respectively.

2. The isolated nucleic acid molecule of claim 1, wherein the VH is the amino acid sequence of SEQ ID NO:

93.

3. The isolated nucleic acid molecule of claim 1, comprising a nucleic acid sequence encoding the VH, wherein the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 260 or 94.

4. The isolated nucleic acid molecule of claim 1, wherein the VL is the amino acid sequence of SEQ ID NO:

102.

5. The isolated nucleic acid molecule of claim 1, comprising a nucleic acid sequence encoding the VL, wherein the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 261 or 103.

6. The isolated nucleic acid molecule of claim 1, wherein the VH and VL are the amino acid sequences of SEQ ID NOs: 93 and 102, respectively.

7. The isolated nucleic acid molecule of claim 1, wherein the anti-BCMA binding domain comprises a single chain variable fragment (scFv) that is the amino acid sequence of SEQ ID NO:

105.

8. The isolated nucleic acid molecule of claim 1, wherein the anti-BCMA binding domain comprises a scFv, wherein the nucleic acid molecule comprises a nucleic acid sequence encoding the scFv, wherein the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 253 or 106.

9. The isolated nucleic acid molecule of claim 1, wherein the CAR is the amino acid sequence of SEQ ID NO:

107.

10. The isolated nucleic acid molecule of claim 1, wherein the nucleic acid molecule is the nucleic acid sequence of SEQ ID NO: 259, 258, or 108.

11. The isolated nucleic acid molecule of claim 1, wherein the VH and VL are connected by a linker.

12. The isolated nucleic acid molecule of claim 11, wherein the linker is the amino acid sequence of SEQ ID NO: 63 or 104.

13. The isolated nucleic acid molecule of claim 1, wherein: (i) the transmembrane domain comprises a transmembrane domain of a protein selected from the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154; (ii) the transmembrane domain is the amino acid sequence of SEQ ID NO: 6; or (iii) the nucleic acid molecule comprises a nucleic acid sequence encoding the transmembrane domain, wherein the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO:

17.

14. The isolated nucleic acid molecule of claim 1, wherein the anti-BCMA binding domain is linked to the transmembrane domain by a hinge region.

15. The isolated nucleic acid molecule of claim 14, wherein: (i) the hinge region is the amino acid sequence of SEQ ID NO: 2, 3, or 4; or (ii) the nucleic acid molecule comprises a nucleic acid sequence encoding the hinge region, wherein the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 13, 14, or 15.

16. The isolated nucleic acid molecule of claim 1, wherein the intracellular signaling domain comprises a primary signaling domain.

17. The isolated nucleic acid molecule of claim 16, wherein: (i) the primary signaling domain comprises a functional signaling domain derived from CD3 zeta, TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (ICOS), Fc epsilon RI, DAP10, DAP12, or CD66d; (ii) the primary signaling domain is the amino acid sequence of SEQ ID NO: 9 or 10; or (iii) the nucleic acid molecule comprises a nucleic acid sequence encoding the primary signaling domain, wherein the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 20, SEQ ID NO: 21, or SEQ ID NO:

256.

18. The isolated nucleic acid molecule of claim 1, wherein the intracellular signaling domain comprises a costimulatory signaling domain.

19. The isolated nucleic acid molecule of claim 18, wherein: (i) the costimulatory signaling domain comprises a functional signaling domain derived from CD27, CD28, CD40, CD54, CD83, CD134, CD137, CD154, CD155, CD152, CD223, CD252, CD272, CD273, CD274, DAP10, DAP12, ICAM-1, ICAM-2, ICAM-3, ICAM-4, ICAM-5, ICAM-6, ICAM-7, ICAM-8, ICAM-9, ICAM-10, ICAM-11, ICAM-12, ICAM-13, ICAM-14, ICAM-15, ICAM-16, ICAM-17, ICAM-18, ICAM-19, ICAM-20, ICAM-21, ICAM-22, ICAM-23, ICAM-24, ICAM-25, ICAM-26, ICAM-27, ICAM-28, ICAM-29, ICAM-30, ICAM-31, ICAM-32, ICAM-33, ICAM-34, ICAM-35, ICAM-36, ICAM-37, ICAM-38, ICAM-39, ICAM-40, ICAM-41, ICAM-42, ICAM-43, ICAM-44, ICAM-45, ICAM-46, ICAM-47, ICAM-48, ICAM-49, ICAM-50, ICAM-51, ICAM-52, ICAM-53, ICAM-54, ICAM-55, ICAM-56, ICAM-57, ICAM-58, ICAM-59, ICAM-60, ICAM-61, ICAM-62, ICAM-63, ICAM-64, ICAM-65, ICAM-66, ICAM-67, ICAM-68, ICAM-69, ICAM-70, ICAM-71, ICAM-72, ICAM-73, ICAM-74, ICAM-75, ICAM-76, ICAM-77, ICAM-78, ICAM-79, ICAM-80, ICAM-81, ICAM-82, ICAM-83, ICAM-84, ICAM-85, ICAM-86, ICAM-87, ICAM-88, ICAM-89, ICAM-90, ICAM-91, ICAM-92, ICAM-93, ICAM-94, ICAM-95, ICAM-96, ICAM-97, ICAM-98, ICAM-99, ICAM-100, ICAM-101, ICAM-102, ICAM-103, ICAM-104, ICAM-105, ICAM-106, ICAM-107, ICAM-108, ICAM-109, ICAM-110, ICAM-111, ICAM-112, ICAM-113, ICAM-114, ICAM-115, ICAM-116, ICAM-117, ICAM-118, ICAM-119, ICAM-120, ICAM-121, ICAM-122, ICAM-123, ICAM-124, ICAM-125, ICAM-126, ICAM-127, ICAM-128, ICAM-129, ICAM-130, ICAM-131, ICAM-132, ICAM-133, ICAM-134, ICAM-135, ICAM-136, ICAM-137, ICAM-138, ICAM-139, ICAM-140, ICAM-141, ICAM-142, ICAM-143, ICAM-144, ICAM-145, ICAM-146, ICAM-147, ICAM-148, ICAM-149, ICAM-150, ICAM-151, ICAM-152, ICAM-153, ICAM-154, ICAM-155, ICAM-156, ICAM-157, ICAM-158, ICAM-159, ICAM-160, ICAM-161, ICAM-162, ICAM-163, ICAM-164, ICAM-165, ICAM-166, ICAM-167, ICAM-168, ICAM-169, ICAM-170, ICAM-171, ICAM-172, ICAM-173, ICAM-174, ICAM-175, ICAM-176, ICAM-177, ICAM-178, ICAM-179, ICAM-180, ICAM-181, ICAM-182, ICAM-183, ICAM-184, ICAM-185, ICAM-186, ICAM-187, ICAM-188, ICAM-189, ICAM-190, ICAM-191, ICAM-192, ICAM-193, ICAM-194, ICAM-195, ICAM-196, ICAM-197, ICAM-198, ICAM-199, ICAM-200, ICAM-201, ICAM-202, ICAM-203, ICAM-204, ICAM-205, ICAM-206, ICAM-207, ICAM-208, ICAM-209, ICAM-210, ICAM-211, ICAM-212, ICAM-213, ICAM-214, ICAM-215, ICAM-216, ICAM-217, ICAM-218, ICAM-219, ICAM-220, ICAM-221, ICAM-222, ICAM-223, ICAM-224, ICAM-225, ICAM-226, ICAM-227, ICAM-228, ICAM-229, ICAM-230, ICAM-231, ICAM-232, ICAM-233, ICAM-234, ICAM-235, ICAM-236, ICAM-237, ICAM-238, ICAM-239, ICAM-240, ICAM-241, ICAM-242, ICAM-243, ICAM-244, ICAM-245, ICAM-246, ICAM-247, ICAM-248, ICAM-249, ICAM-250, ICAM-251, ICAM-252, ICAM-253, ICAM-254, ICAM-255, ICAM-256, ICAM-257, ICAM-258, ICAM-259, ICAM-260, ICAM-261, ICAM-262, ICAM-263, ICAM-264, ICAM-265, ICAM-266, ICAM-267, ICAM-268, ICAM-269, ICAM-270, ICAM-271, ICAM-272, ICAM-273, ICAM-274, ICAM-275, ICAM-276, ICAM-277, ICAM-278, ICAM-279, ICAM-280, ICAM-281, ICAM-282, ICAM-283, ICAM-284, ICAM-285, ICAM-286, ICAM-287, ICAM-288, ICAM-289, ICAM-290, ICAM-291, ICAM-292, ICAM-293, ICAM (i) the costimulatory signaling domain comprises a functional signaling domain derived from a MHC class I molecule, a TNF receptor protein, an immunoglobulin-like protein, a cytokine receptor, an integrin, a signaling lymphocyte activation molecule (SLAM protein), an activating NK cell receptor, BTLA, a Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, 4-1BB (CD137), B7-H3, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM, KIRDS2, NKp80, NKp44, NKp30, NKp46, CD19, CD4, CD8a, CD8b, IL2R b, IL2R g, IL7R a, ITGA4, VLA1, CD49a, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAM1 (CD226), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAM, SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, CD19a, CD28-OX40, CD28-4-1BB, or a ligand that specifically binds with CD83; (ii) the costimulatory signaling domain is the amino acid sequence of SEQ ID NO: 7; or (iii) the nucleic acid molecule comprises a nucleic acid sequence encoding the costimulatory signaling domain, wherein the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 18 or SEQ ID NO:

255.

20. The isolated nucleic acid molecule of claim 1, wherein the intracellular signaling domain comprises a functional signaling domain derived from 4-1BB and a functional signaling domain derived from CD3 zeta.

21. The isolated nucleic acid molecule of claim 20, wherein: (i) the intracellular signaling domain consists of the amino acid sequence of SEQ ID NO: 7; and the amino acid sequence of SEQ ID NO: 9 or 10; or (ii) the intracellular signaling domain consists of the amino acid sequence of SEQ ID NO: 7 and the amino acid sequence of SEQ ID NO: 9 or 10.

22. The isolated nucleic acid molecule of claim 1, wherein the CAR further comprises a leader sequence of the amino acid sequence of SEQ ID NO:

1.

23. The isolated nucleic acid molecule of any one of claims 1-22, wherein the CAR comprises one or more of the following properties: (i) when expressed in a cell, the CAR activates NFAT signaling in the cell in the presence of a cell expressing BCMA; (ii) when expressed in a cell, the CAR induces cytotoxicity of a cell expressing BCMA; and (iii) when expressed in a cell, the CAR induces expression of a cytokine in the cell in the presence of a cell expressing BCMA.

24. An isolated CAR comprising an anti-BCMA binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the anti-BCMA binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementarity determining region 1 (HC CDR1), a heavy chain complementarity determining region 2 (HC CDR2), and a heavy chain complementarity determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3), wherein the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 are the amino acid sequences of SEQ ID NOs: 86, 87, 88, 95, 96, and 97, respectively.

25. The isolated CAR of claim 24, wherein the VH is the amino acid sequence of SEQ ID NO:

93.

26. The isolated CAR of claim 24, wherein the VL is the amino acid sequence of SEQ ID NO:

102.

27. The isolated CAR of claim 24, wherein the VH and VL are the amino acid sequences of SEQ ID NOs: 93 and 102, respectively.

28. The isolated CAR of claim 24, wherein the anti-BCMA binding domain comprises a single chain variable fragment (scFv) that is the amino acid sequence of SEQ ID NO:

105.

29. The isolated CAR of claim 24, wherein the CAR is the amino acid sequence of SEQ ID NO:

107.

30. The isolated CAR of claim 24, wherein the VH and VL are connected by a linker.

31. The isolated CAR of claim 30, wherein the linker is the amino acid sequence of SEQ ID NO: 63 or 104.

32. The isolated CAR of claim 24, wherein: (i) the transmembrane domain comprises a transmembrane domain of a protein selected from the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154; or (ii) the transmembrane domain is the amino acid sequence of SEQ ID NO:

6.

33. The isolated CAR of claim 24, wherein the anti-BCMA binding domain is linked to the transmembrane domain by a hinge region.

34. The isolated CAR of claim 33, wherein: the hinge region is the amino acid sequence of SEQ ID NO: 2, 3, or 4.

35. The isolated CAR of claim 24, wherein the intracellular signaling domain comprises a primary signaling domain.

36. The isolated CAR of claim 35, wherein: (i) the primary signaling domain comprises a functional signaling domain derived from CD3 zeta, TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (ICOS), Fc epsilon RI, DAP10, DAP12, or CD66d; or (ii) the primary signaling domain is the amino acid sequence of SEQ ID NO: 9 or 10.

37. The isolated CAR of claim 24, wherein the intracellular signaling domain comprises a costimulatory signaling domain.

38. The isolated CAR of claim 37, wherein: the costimulatory signaling domain is the amino acid sequence of SEQ ID NO: 11 or 12. (i) the costimulatory signaling domain comprises a functional signaling domain derived from a MHC class I molecule, a TNF receptor protein, an immunoglobulin-like protein, a cytokine receptor, an integrin, a signaling lymphocyte activation molecule (SLAM protein), an activating NK cell receptor, BTLA, a Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, 4-1BB (CD137), B7-H3, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM, KIRDS2, NKp80, NKp44, NKp30, NKp46, CD19, CD4, CD8a, CD8b, IL2R b, IL2R g, IL7R a, ITGA4, VLA1, CD49a, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAM1 (CD226), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAM, SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, CD19a, CD28-OX40, CD28-4-1BB, or a ligand that specifically binds with CD83; or (ii) the costimulatory signaling domain is the amino acid sequence of SEQ ID NO:

7.

39. The isolated CAR of claim 24, wherein the intracellular signaling domain comprises a functional signaling domain derived from 4-1BB and a functional signaling domain derived from CD3 zeta.

40. The isolated CAR of claim 39, wherein: (i) the intracellular signaling domain consists of the amino acid sequence of SEQ ID NO: 7; and the amino acid sequence of SEQ ID NO: 9 or 10; or (ii) the intracellular signaling domain consists of the amino acid sequence of SEQ ID NO: 7 and the amino acid sequence of SEQ ID NO: 9 or 10.

41. The isolated CAR of claim 24, wherein the CAR further comprises a leader sequence of the amino acid sequence of SEQ ID NO:

1.

42. The isolated CAR of any one of claims 24-41, wherein the CAR comprises one or more of the following properties: (i) the CAR binds to a tumor antigen selected from the group consisting of CD19, CD20, CD22, CD30, CD33, CD38, CD123, CD138, and ROR1; and (ii) the CAR is a bispecific CAR that binds to a tumor antigen selected from the group consisting of CD19, CD20, CD22, CD30, CD33, CD38, CD123, CD138, and ROR1, and a second antigen selected from the group consisting of CD123, CD33, CD38, CD138, and ROR1. (i) when expressed in a cell, the CAR activates NFAT signaling in the cell in the presence of a cell expressing BCMA; (ii) when expressed in a cell, the CAR induces cytotoxicity of a cell expressing BCMA; and (iii) when expressed in a cell, the CAR induces expression of a cytokine in the cell in the presence of a cell expressing BCMA.

43. An isolated polypeptide molecule encoded by the nucleic acid molecule of any one of claims 1-23.

44. An anti-BCMA binding domain comprising a heavy chain variable region (VH) and a light chain variable region (VL), the heavy chain variable region comprising a heavy chain complementarity determining region 1 (HC CDR1), a heavy chain complementarity determining region 2 (HC CDR2), and a heavy chain complementarity determining region 3 (HC CDR3), the light chain variable region comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3), wherein the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 are the amino acid sequences of SEQ ID NOs: 86, 87, 88, 95, 96, and 97, respectively.

45. The anti-BCMA binding domain of claim 44, wherein the VH and VL are the amino acid sequences of SEQ ID NOs: 93 and 102, respectively.

46. The isolated nucleic acid molecule of any one of claims 1-22, wherein the anti-BCMA binding domain is a human anti-BCMA binding domain.

47. The CAR of any one of claims 24-41, wherein the anti-BCMA binding domain is a human anti-BCMA binding domain.

48. The anti-BCMA binding domain of any one of claims 44 or 45, wherein the anti-BCMA binding domain is a human anti-BCMA binding domain.

49. A vector comprising the nucleic acid molecule of any one of claims 1-23 or 46, or a nucleic acid molecule encoding the CAR of any one of claims 24-42 or 47.

50. The vector of claim 49, wherein the vector is selected from a DNA vector, an RNA vector, a plasmid, a lentivirus vector, an adenovirus vector, or a retrovirus vector.

51. The vector of claim 49 or 50, further comprising an EF-1 promoter of the nucleic acid sequence of SEQ ID NO:

11.

52. A cell comprising the nucleic acid molecule of any one of claims 1-23 or 46, the CAR of any one of claims 24-42 or 47, the polypeptide molecule of claim 43, the anti-BCMA binding domain of any one of claims 44-45 or 48, or the vector of any one of claims 49-51.

53. A method of making a cell, the method comprising transducing a cell with the vector of any one of claims 49-51.

54. A method of making an RNA engineered cell, the method comprising introducing an in vitro transcribed RNA or a synthetic RNA into a cell, wherein the RNA comprises the nucleic acid molecule of any one of claims 1-23 or 46, or a nucleic acid molecule encoding the CAR of any one of claims 24-42 or 47, or a nucleic acid molecule encoding the anti-BCMA binding domain of any one of claims 44-45 or 48.

55. Use of a population of cells comprising the cells of claim 52 in the manufacture of a medicament for providing anti-tumor immunity in a subject having multiple myeloma.

56. Use of a population of cells comprising the cells of claim 52 in the manufacture of a medicament for treating a subject having multiple myeloma.

57. The use of claim 55, wherein the cells are autologous T cells.

58. The use of claim 55, wherein the cells are allogeneic T cells.

59. The use of claim 56, wherein the cells are autologous T cells.

60. The use of claim 56, wherein the cells are allogeneic T cells.

61. The use of any one of claims 55-60, wherein the medicament is formulated for administration in combination with a second therapeutic agent.

62. The use of claim 61, wherein the second therapeutic agent is selected from: (i) a PD-1 inhibitor; (ii) a PD-L1 inhibitor; (iii) a LAG-3 inhibitor; (iv) a TIM-3 inhibitor; (v) a CTLA-4 inhibitor; (vi) an interleukin-15 (IL-15) polypeptide, an interleukin-15 receptor alpha (IL-15Ra) polypeptide, or a combination of an IL-15 polypeptide and an IL-15Ra polypeptide; (vii) an interleukin-12 (IL-12) polypeptide; or (viii) an mTOR inhibitor.

63. The use of claim 62, wherein: (i) the PD-1 inhibitor is selected from the group consisting of PDR001, nivolumab, pembrolizumab, MEDI0680, REGN2810, TSR-042, PF-06801591, and AMP- 224; (ii) the PD-L1 inhibitor is selected from the group consisting of FAZ053, atezolizumab, avelumab, durvalumab, and BMS-936559; (iii) the LAG-3 inhibitor is selected from the group consisting of LAG525, BMS- 986016, TSR-033, MK-4280, and REGN3767; (iv) the TIM-3 inhibitor is selected from the group consisting of MBG453, TSR- 022, and LY3321367; (v) the CTLA-4 inhibitor is ipilimumab or tremelimumab; (vi) the combination of an IL-15 polypeptide and an IL-15Ra polypeptide is hetIL-15; or (vii) the mTOR inhibitor is rapamycin. (vii) the mTOR inhibitor is RAD001 or rapamycin.

64. The use of any one of claims 55-60, wherein the subject is a human.

65. The use of any one of claims 55-60, wherein the medicament is formulated for administration in combination with an agent that neutralizes a soluble factor.

66. The use of claim 65, wherein the agent that neutralizes a soluble factor is a corticosteroid, an IL-6 inhibitor, or a combination thereof.

67. The use of claim 66, wherein the IL-6 inhibitor is tocilizumab.

68. A chimeric antigen receptor (CAR) that binds to BCMA, comprising, from N-terminus to C-terminus: (i) a leader sequence of SEQ ID NO: 1 ; (ii) a HC CDR1 of SEQ ID NO: 86; (iii) a HC CDR2 of SEQ ID NO: 87; (iv) a HC CDR3 of SEQ ID NO: 88; (v) a LC CDR1 of SEQ ID NO: 95; (vi) a LC CDR2 of SEQ ID NO: 96; (vii) a LC CDR3 of SEQ ID NO: 97; (viii) a CD8 transmembrane domain and hinge region of SEQ ID NO: 202; (ix) a functional signaling domain of 4-1BB of SEQ ID NO: 7; and (x) a functional signaling domain of CD3 zeta of SEQ ID NO:

10.

69. The CAR of claim 67, comprising a VH region and a VL region and / or a scFv, wherein the VH region is the amino acid sequence of SEQ ID NO: 93, the VL region is the amino acid sequence of SEQ ID NO: 102, and the scFv is the amino acid sequence of SEQ ID NO:

105.

70. The CAR of claim 68 or 69, which is the amino acid sequence of SEQ ID NO: 257 or SEQ ID NO:

107.

71. An isolated nucleic acid molecule encoding the CAR of any one of claims 68-70.

72. A vector comprising a nucleic acid molecule encoding a chimeric antigen receptor (CAR) that binds to BCMA, wherein the CAR comprises, from N-terminus to C-terminus: (i) a leader sequence of SEQ ID NO: 1 ; (ii) a HC CDR1 of SEQ ID NO: 86; (iii) a HC CDR2 of SEQ ID NO: 87; (iv) a HC CDR3 of SEQ ID NO: 88; (v) a LC CDR1 of SEQ ID NO: 95; (vi) a LC CDR2 of SEQ ID NO: 96; (vii) a LC CDR3 of SEQ ID NO: 97; (viii) a CD8 transmembrane domain and hinge region of SEQ ID NO: 202; (ix) a functional signaling domain of 4-1BB of SEQ ID NO: 7; and (x) a functional signaling domain of CD3 zeta of SEQ ID NO:

10. (x) a functional signaling domain of CD3 zeta of SEQ ID NO:

10.

73. A cell comprising a chimeric antigen receptor (CAR) that binds to BCMA, wherein the CAR comprises, from N- to C-terminus: (i) a leader sequence of SEQ ID NO: 1 ; (ii) HC CDR1 of SEQ ID NO: 86; (iii) HC CDR2 of SEQ ID NO: 87; (iv) HC CDR3 of SEQ ID NO: 88; (v) LC CDR1 of SEQ ID NO: 95; (vi) LC CDR2 of SEQ ID NO: 96; (vii) LC CDR3 of SEQ ID NO: 97; (viii) a CD8 transmembrane domain and hinge region of SEQ ID NO: 202; (ix) a functional signaling domain of 4-1 BB of SEQ ID NO: 7; and (x) a functional signaling domain of CD3 zeta of SEQ ID NO:

10.

74. A cell comprising the CAR of any one of claims 68-70, the nucleic acid molecule of claim 71, or the vector of claim 72.

75. Use of the CAR of any one of claims 68-70 or the cell of claim 73 or 74 in the manufacture of a medicament for treating an individual having multiple myeloma.

76. The use of claim 75, wherein the cell is an autologous T cell or an allogeneic T cell.

77. The use of claim 75 or 76, wherein the individual is a human.

Images