An immune cell expressing a CD3 antibody receptor complex and its uses
By developing immune cells modified with CD3 antibody receptor complexes that do not depend on TCR expression, the problems of long preparation cycle, high cost and safety of CAR-T cell therapy have been solved, achieving safe and efficient tumor killing effect.
Patent Information
- Application Number
- CN202080003009.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-07-06
- Filing Date
- 2020-07-03
- Publication Date
- 2026-03-06
- Estimated Expiration
- 2040-07-03
AI Technical Summary
Existing CAR-T cell therapies suffer from long preparation cycles, high costs, safety issues, and the inability to prepare autologous CAR-T cells when immune function is poor. Furthermore, long-term use may lead to the loss of normal B cells and immunoglobulins.
Develop a modified immune cell containing a CD3 antibody receptor complex that can be activated independently of TCR expression and upon stimulation by CD3 antibody, secreting cytokines and killing tumor cells in conjunction with anti-CD3 and anti-CD19 bispecific antibodies.
This provides a safer and more controllable cell therapy that can effectively kill tumor cells, avoids the limitations of autologous CAR-T cells, reduces preparation costs, and improves treatment efficiency.
Smart Images

Figure HDA0002801289630000011 
Figure HDA0002801289630000021 
Figure HDA0002801289630000031
Abstract
Description
Technical Field
[0001] This application relates to the field of biomedicine, specifically to an immune cell expressing a CD3 antibody receptor complex, wherein the CD3 antibody receptor complex may be expressed independently of the TCR. Background Technology
[0002] In recent years, due to its significant clinical efficacy in cancer treatment, chimeric antigen receptor T-cell (CAR-T) therapy has gradually become a research hotspot worldwide. Currently, the source of CAR-T cells prepared clinically is generally the patient themselves, thus all are autologous CAR-T cells. However, autologous CAR-T has many problems in clinical application, such as long preparation cycles and high costs. CAR-T cells cannot be successfully prepared when the patient's immune function is poor.
[0003] There are also methods that use gene editing tools such as CRISPR / Cas9 nucleases to specifically knock out certain immune-related genes to prepare universal CAR-T cells. However, long-term presence of CAR-T cells may lead to the loss of normal B cells and immunoglobulins, and CAR-T cells targeting solid tumors may exhibit cytotoxicity and other safety issues, such as targeting but not eliminating tumor cells.
[0004] Therefore, there is still a need to develop a safer and more tunable cell therapy. Summary of the Invention
[0005] This application provides a modified immune cell comprising a CD3 antibody receptor complex and which does not express a T cell receptor (TCR). The CD3 antibody receptor complex described in this application can be expressed in a TCR-independent manner and can be recognized by common CD3 antibodies. Upon stimulation by CD3 antibodies, the modified immune cell described in this application can be activated and secrete cytokines. The modified immune cell described in this application can also combine with anti-CD3 and anti-CD19 bispecific antibodies to kill tumor cells.
[0006] On one hand, this application provides a modified immune cell comprising a CD3 antibody receptor complex comprising a first CD3 recombinant protein and a second CD3 recombinant protein, wherein the first CD3 recombinant protein comprises: (1) a first extracellular domain comprising an extracellular domain derived from the CD3 epsilon domain, (2) a first transmembrane domain, and (3) a first intracellular domain; the second CD3 recombinant protein comprises: (1) a second extracellular domain comprising an extracellular domain derived from either the CD3 gamma domain or the CD3 delta domain, (2) a second transmembrane domain, and (3) a second intracellular domain, and wherein it does not express a T cell receptor (TCR).
[0007] In some embodiments, the modified immune cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes, and / or peripheral blood mononuclear cells.
[0008] In some embodiments, the extracellular domain of the CD3 epsilon domain comprises an amino acid sequence as shown in SEQ ID NO:1.
[0009] In some implementations, the second extracellular domain comprises an extracellular domain derived from the CD3 gamma domain.
[0010] In some embodiments, the extracellular domain of the CD3 gamma domain comprises an amino acid sequence as shown in SEQ ID NO:2.
[0011] In some implementations, the second extracellular domain comprises an extracellular domain derived from the CD3 delta domain.
[0012] In some embodiments, the extracellular domain of the CD3 delta domain comprises an amino acid sequence as shown in SEQ ID NO:4.
[0013] In some implementations, the first transmembrane domain and the second transmembrane domain may be the same or different.
[0014] In some embodiments, the transmembrane domain does not include a transmembrane domain derived from CD3.
[0015] In some embodiments, the transmembrane domain comprises a transmembrane domain derived from any of the following proteins: CD8α, CD28, 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3ε, CD5, ICOS, OX40, NKG2D, 2B4, CD244, FcεRIγ, BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L, TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, CD134, CD137, CD154, and SLAM.
[0016] In some embodiments, the transmembrane domain comprises the amino acid sequence shown in SEQ ID NO:7.
[0017] In some implementations, the first intracellular domain and the second intracellular domain may be the same or different.
[0018] In some embodiments, at least one of the first intracellular domain and the second intracellular domain includes a co-stimulatory domain and / or a signal transduction domain.
[0019] In some implementations, the co-stimulatory domains contained in the first intracellular domain and the co-stimulatory domains contained in the second intracellular domain may be the same or different.
[0020] In some embodiments, the costimulatory domain comprises a costimulatory domain derived from any one or more proteins selected from the group consisting of: CD28, CD137, CD27, CD2, CD7, CD8, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, FcεRIγ, BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, a ligand of CD83, CD40, and MyD88.
[0021] In some embodiments, the co-stimulatory domain comprises an amino acid sequence as shown in SEQ ID NO:8.
[0022] In some embodiments, the signal transduction domains contained in the first intracellular domain and the signal transduction domains contained in the second intracellular domain may be the same or different.
[0023] In some embodiments, the signal transduction domain includes at least one immune receptor tyrosine activation motif (ITAM).
[0024] In some embodiments, the signal transduction domain comprises a signal transduction domain derived from any one or more proteins selected from the group consisting of: CD3zeta, CD3delta, CD3gamma, CD3ε, CD79a, CD79b, FceRIγ, FceRIβ, FcγRIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, Kaposi's sarcoma herpesvirus (HSKV), DAP10, and DAP-12.
[0025] In some embodiments, the signal transduction domain comprises an amino acid sequence as shown in SEQ ID NO:9.
[0026] In some embodiments, a hinge region is further included between the extracellular domain and the transmembrane domain.
[0027] In some embodiments, the hinge region comprises a hinge region derived from any one or more proteins selected from the group consisting of CD8α, CD28, 4-1BB, CD4, CD27, CD7, and PD-1.
[0028] In some embodiments, the hinge region comprises an amino acid sequence shown in any of SEQ ID NO:6.
[0029] In some embodiments, one of the first intracellular domain and the second intracellular domain comprises a peptide containing at least two amino acids.
[0030] In some embodiments, the first CD3 recombinant protein includes an extracellular domain derived from the CD3 epsilon domain, a transmembrane region derived from CD28, an intracellular domain derived from CD28, and an intracellular domain derived from CD3 zeta. In some embodiments, the first CD3 recombinant protein includes the amino acid sequence shown in SEQ ID NO:10.
[0031] In some embodiments, the second CD3 recombinant protein includes an extracellular domain derived from the CD3 gamma domain, a transmembrane region derived from CD28, and an intracellular domain derived from CD3 gamma.
[0032] In some embodiments, the second CD3 recombinant protein comprises the amino acid sequence shown in SEQ ID NO:11.
[0033] In some embodiments, the second CD3 recombinant protein includes an extracellular domain derived from the CD3 gamma domain, a transmembrane region derived from CD28, and the peptide.
[0034] In some embodiments, the second CD3 recombinant protein comprises the amino acid sequence shown in SEQ ID NO:12.
[0035] In some embodiments, the modified immune cells further comprise a third recombinant CD3 protein comprising: (1) a third extracellular domain comprising an extracellular domain derived from either the CD3 gamma domain or the CD3 delta domain; (2) a third transmembrane domain; and (3) a third intracellular domain.
[0036] In some implementations, the third extracellular domain may be the same as or different from the second extracellular domain.
[0037] In some embodiments, the third transmembrane domain may be the same as or different from the first transmembrane domain and / or the second transmembrane domain.
[0038] In some embodiments, the third intracellular domain may be the same as or different from the first intracellular domain and / or the second intracellular domain.
[0039] In some embodiments, the expression and / or activity of the major histocompatibility complex (MHC) of the modified immune cells are downregulated.
[0040] In some embodiments, the MHC complex includes B2M.
[0041] In some embodiments, the modified immune cells comprise chimeric antigen receptors (CARs) and / or chimeric autoantibody receptors (CAARs).
[0042] On the other hand, this application provides a pharmaceutical composition comprising the modified immune cells and a pharmaceutically acceptable adjuvant.
[0043] In some embodiments, the pharmaceutical composition includes an antibody.
[0044] In some embodiments, the antibody is capable of recognizing and / or binding to the CD3 antibody receptor complex.
[0045] In some embodiments, the antibody includes a bispecific antibody.
[0046] In some embodiments, the bispecific antibody is derived from the immune cells.
[0047] In some embodiments, the bispecific antibody is capable of recognizing and / or binding to receptors on the surface of target cells.
[0048] In some embodiments, the target cells are tumor cells.
[0049] In some embodiments, the receptors on the surface of the target cells are selected from one of the following groups: CD19, CD2, CD3, CD4, CD5, CD7, CD8, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD38, CD40, CD44V6, CD47, CD52, CD56, CD57, CD58, CD79b, CD80, CD86, CD81, CD123, CD133. CD137, CD151, CD171, CD276, CLL1, B7H4, BCMA, VEGFR-2, EGFR, GPC3, PMSA, CEACAM6, c-Met, EGFRvIII, ErbB2 / HER2, ErbB3, HER-2, HER3, ErbB4 / HER-4, EphA2, IGF1R, GD2, O-acetyl GD2, O-acetyl GD3, GHRHR, GH R, Flt1, KDR, Flt4, Flt3, CEA, CA125, CTLA-4, GITR, BTLA, TGFBR1, TGFBR2, TGFBR1, IL6R, gp130, Lewis, TNFR1, TNFR2, PD1, PD-L1, PD-L2, PSCA, HVEM, MAGE-A, MSLN, NY-ESO-1, PSMA, RANK, ROR1, TNFRSF4, TWEAK-R, LTPR, LIFRP, LRP5, MUC1, MUC16, TCRα, TCRβ, TLR7, TLR9, PTCH1, WT-1, Robol, Frizzled receptor, OX40, Notch-1-4, APRIL, CS1, MAGE3, Claudin18.2, folate receptor α, folate receptor β, GPC2, CD70, BAFF-R, and TROP-2.
[0050] On the other hand, this application provides a nucleic acid molecule that encodes the CD3 antibody receptor complex in the modified immune cells described above.
[0051] On the other hand, this application provides a vector containing the aforementioned nucleic acid molecules.
[0052] In some embodiments, the vector is a viral vector.
[0053] In some embodiments, the vector is a lentiviral vector.
[0054] On the other hand, this application provides cells that contain the said nucleic acid molecules and / or the said vectors.
[0055] On the other hand, this application provides the use of the modified immune cells and / or the pharmaceutical composition described herein in the preparation of a medicament for treating tumors.
[0056] In some implementations, the tumor includes solid tumors and non-solid tumors.
[0057] In some embodiments, the tumor is selected from the group consisting of lymphoma, leukemia, and multiple myeloma.
[0058] On the other hand, this application provides a method for treating tumors, the method comprising administering the modified immune cells and the pharmaceutical composition to a subject in need.
[0059] In some implementations, the tumor includes solid tumors and non-solid tumors.
[0060] In some embodiments, the tumor is selected from the group consisting of lymphoma, leukemia, and multiple myeloma.
[0061] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description
[0062] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and accompanying drawings described in detail below. A brief description of the drawings is as follows:
[0063] Figure 1 The diagram shown is a schematic of the modified immune cells combined with bispecific antibodies used in this application to kill target cells.
[0064] Figure 2 The image shows the modified immune cell expressing the CD3 antibody receptor complex described in this application.
[0065] Figure 3 The results show that the CD3 antibody receptor complex can be recognized by the CD3 antibody UCHT1 in TCR KO human primary T cells.
[0066] Figure 4 The results show that the CD3 antibody receptor complex can be recognized by the CD3 antibody HIT3a in human primary T cells with TCR KO.
[0067] Figure 5 The result shows that the CD3 antibody receptor complex cannot be recognized by CD3 antibody SP34-2 in human primary T cells with TCR KO.
[0068] Figure 6 The results show that the CD3 antibody receptor complex can be recognized by the CD3 antibody OKT3 in TCR KO human primary T cells.
[0069] Figure 7 The image shows the modified immune cells described in this application being activated by a CD3 antibody to express the cell activation tag CD137.
[0070] Figure 8 The illustration shows the activation of tumor cells mediated by anti-CD3 and anti-CD19 bispecific antibodies by the modified immune cells described in this application.
[0071] Figure 9 The illustration shows that the modified immune cells described in this application kill tumor cells mediated by anti-CD3 and anti-CD19 bispecific antibodies. Detailed Implementation
[0072] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.
[0073] Terminology Definition
[0074] In this application, the term "CD3 antibody" generally refers to an antibody that can specifically recognize CD3 subunits (e.g., CD3epsilon, CD3 gamma, CD3 delta, or complexes thereof). The antibody may be a monoclonal antibody that can only recognize CD3, or a multi-target antibody that can recognize CD3 and other targets simultaneously.
[0075] In this application, the term "CD3 antibody receptor complex" generally refers to a receptor that can be recognized by CD3 antibodies, which may contain at least two (e.g., three) CD3 subunits (e.g., CD3 epsilon and CD3 delta, or CD3epsilon and CD3 gamma). The CD3 antibody receptor complex consists of at least two (e.g., three, four, five, six, or more) recombinant CD3 proteins, each of which may contain extracellular, transmembrane, and intracellular domains of a CD3 subunit (e.g., CD3epsilon, CD3 gamma, and / or CD3 delta). The conformation formed by the binding of the extracellular domains of CD3 epsilon and CD3 gamma or CD3 delta approximates the native conformation of the CD3 epsilon heterodimer in the TCR complex, including epitopes recognized by most CD3 antibodies such as UCHT1 and OKT3. The conformation formed by the extracellular domain of CD3 epsilon alone does not include binding epitopes of most CD3 antibody clones.
[0076] In this application, the term "first CD3 recombinant protein" generally refers to a recombinant protein comprising extracellular, transmembrane, and intracellular domains derived from CD3 (e.g., CD3epsilon). The CD3 antibody receptor complex may comprise one or more (e.g., two, three, four, or more) first CD3 recombinant proteins.
[0077] In this application, the term "first extracellular domain" generally refers to the extracellular domain portion of a first CD3 recombinant protein, which may include an extracellular domain derived from the CD3 epsilon domain.
[0078] In this application, the term "second CD3 recombinant protein" generally refers to a recombinant protein comprising extracellular, transmembrane, and intracellular domains derived from CD3 (e.g., CD3 delta and / or CD3 gamma). The CD3 antibody receptor complex may comprise one or more (e.g., two, three, four, or more) second CD3 recombinant proteins.
[0079] In this application, the term "second extracellular domain" generally refers to the extracellular domain portion of a second CD3 recombinant protein, which may include extracellular domains derived from CD3 delta and / or CD3 gamma domains.
[0080] In this application, the term "third CD3 recombinant protein" generally refers to a recombinant protein comprising extracellular, transmembrane, and intracellular domains derived from CD3 (e.g., CD3 delta and / or CD3 epsilon). The CD3 antibody receptor complex may comprise one or more (e.g., two, three, four, or more) third CD3 recombinant proteins.
[0081] In this application, the term "third extracellular domain" generally refers to the extracellular domain portion of a third CD3 recombinant protein, which may comprise an extracellular domain derived from the CD3 delta and / or CD3 epsilon domains. The third extracellular domain may originate from the same or different CD3 subunits (e.g., CD3 delta and / or CD3 gamma) as the second extracellular domain.
[0082] In this application, the term "antibody" generally refers to a polypeptide molecule capable of specifically recognizing and / or neutralizing a particular antigen. For example, an antibody may comprise an immunoglobulin consisting of at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, and includes any molecule containing its antigen-binding portion. The term "antibody" includes monoclonal antibodies, antibody fragments, or antibody derivatives, including but not limited to human antibodies, humanized antibodies, chimeric antibodies, single-domain antibodies (e.g., dAb), single-chain antibodies (e.g., scFv), and antigen-binding antibody fragments (e.g., Fab, Fab', and (Fab)2 fragments). The term "antibody" also includes all recombinant forms of antibodies, such as antibodies expressed in prokaryotic cells, unglycosylated antibodies, and any antigen-binding antibody fragments and their derivatives described in this application. Each heavy chain may consist of a heavy chain variable region (VH) and a heavy chain constant region. Each light chain may consist of a light chain variable region (VL) and a light chain constant region. The VH and VL regions can be further subdivided into hypervariable regions called complementarity-determining regions (CDRs), which are scattered within more conserved regions called framework regions (FRs). Each VH and VL region may consist of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen.
[0083] In this application, the term "transmembrane domain" generally refers to a sequence of a cell surface protein that spans the cell membrane, and may contain a hydrophobic alpha helix. The transmembrane domain can connect to intracellular signal transduction domains and play a role in signal transmission. In this application, the transmembrane domain may originate from any type I, II, or III transmembrane protein. In this application, the transmembrane domain may not contain transmembrane proteins derived from CD3 (e.g., CD3 epsilon, CD3 gamma, and / or CD3 delta).
[0084] In this application, the term "immunoreceptor tyrosine activation motif (ITAM)" generally refers to a conserved sequence of more than ten amino acids that commonly appears in the intracellular region of transmembrane proteins in certain cells of the immune system. TAMs are important signal transduction pathways for immune cells. Therefore, they are often found in the intracellular regions of important cell signaling molecules, such as the CD3 and ζ chains of the T cell receptor complex, the CD79α and β chains of the B cell receptor complex, and certain Fc receptors. When these receptor molecules interact with their ligands, the tyrosine residues on the intracellular ITAM are phosphorylated. The phosphorylated ITAM can bind to intracellular free proteins with SH2 domains, enabling the transmission of immune cell signals to downstream signaling molecules.
[0085] In this application, the term "Chimeric Antigen Receptor (CAR)" generally refers to a fusion protein comprising an extracellular domain capable of binding antigens and at least one intracellular domain. CARs are a core component of chimeric antigen receptor T cells (CAR-T cells) and may include an antigen-binding domain (e.g., tumor-specific antigens and / or tumor-associated antigens), a transmembrane domain, a co-stimulatory domain, and an intracellular signaling domain. In this application, the CAR may be combined with the T cell receptor-activating intracellular domain based on the antigen specificity of an antibody (e.g., CD70). Genetically modified T cells expressing CARs can specifically recognize and eliminate malignant cells expressing target antigens. For descriptions of CAR and CAR-T cells, see, for example, Sadelain M, Brentjens R, Rivi`ere I. The basic principles of chimeric antigen receptor design. Cancer Discov. 2013; 3(4):388-398; Turtle CJ, Hudecek M, Jensen MC, Riddell SR. Engineered T cells for anti-cancer therapy. Curr Opin Immunol. 2012; 24(5):633-639; Dotti G, Gottschalk S, Savoldo B, Brenner MK. Design and development of therapies using chimeric antigen receptor-expressing T cells. Immunol Rev. 2014; 257(1):107-126; and WO2013154760, WO2016014789.
[0086] In this application, the term "chimeric autoantibody receptor (CAAR)" generally refers to a protein containing autoantigens that can be recognized by autoantibodies. CAAR can guide genetically modified immune cells expressing CAAR to attack B cells expressing antibodies that can recognize those antigens.
[0087] In this application, the term "bispecific antibody" generally refers to an antibody that has binding sites for two different antigens within a single antibody molecule. For example, one of the antigens may be CD3.
[0088] In this application, the term "peptide" generally refers to a polypeptide consisting of at least two (e.g., four, five, six or more) amino acids. It can include any molecule that has both amino and acid functionalities and comprises naturally occurring amino acid polymers, including both natural and artificial amino acids.
[0089] In this application, the term "co-stimulatory domain" generally refers to an intracellular domain that can provide immune co-stimulatory molecules, which are cell surface molecules required for an effective lymphocyte response to an antigen.
[0090] In this application, the term "hinge region" generally refers to the connection region between the extracellular domain (e.g., the CD3 extracellular domain) and the transmembrane region.
[0091] In this application, the term "signal transduction domain" generally refers to a domain located inside the cell that can transduce signals. In this application, the intracellular signal transduction domain can transduce signals into the cell. Typically, a signal transduction domain is any continuous amino acid sequence used to guide protein target acquisition. In some cases, the signal transduction domain may be derived from CD3ζ. CD3ζ can form the T cell receptor-CD3 complex with the T cell receptor subunit and CD3-gamma,-delta, and-epsilon. CD3ζ contains three ITAM motifs, and the ITAM sequence mediates intracellular signal activation of the TCR. The ζ chain is a substrate of a receptor-activated protein tyrosine kinase; when the TCR receptor binds to the polypeptide MHC complex, the ζ chain can be rapidly phosphorylated with tyrosine, participating in the transduction of lymphocyte activation signals. Therefore, CD3ζ plays a crucial role in antigen recognition and TCR signal transduction.
[0092] In this application, the term "pharmaceuticalally acceptable adjuvant" generally refers to one or more nontoxic materials that do not interfere with the effectiveness of the bioactivity of the active ingredient. Such formulations may conventionally contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable formulations may also contain compatible solid or liquid fillers, diluents, or encapsulating substances suitable for human administration. Other contemplated carriers, excipients, and / or additives that may be used in the formulations described herein include, for example, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, lipids, protein excipients (such as serum albumin, gelatin, casein), salt-forming ions (such as sodium), etc.
[0093] In this application, the term "immune cell" generally refers to cells that participate in an immune response, such as promoting an immune effector response. Examples of immune cells include, but are not limited to, T cells, B cells, natural killer (NK) cells, mast cells, granulocytes, monocytes, lymphocytes, and macrophages. The term also includes engineered immune cells, such as immune cells that have been genetically modified by adding exogenous genetic material in the form of DNA or RNA to the total genetic material of the cell.
[0094] In this application, the term "vector" generally refers to a nucleic acid molecule capable of self-replication in a suitable host for transferring an inserted nucleic acid molecule into host cells and / or between host cells. The vector may include vectors primarily for inserting DNA or RNA into cells, vectors primarily for replicating DNA or RNA, and expression vectors primarily for transcription and / or translation of DNA or RNA. The vector also includes vectors having multiple of the aforementioned functions. The vector may be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, by culturing suitable host cells containing the vector, the vector can produce the desired expression product. The vector may encompass additional features beyond the transgene insertion sequence and backbone: promoter, genetic marker, antibiotic resistance, reporter gene, target sequence, protein purification tag. Vectors referred to as expression vectors (expression constructs) are specifically used to express transgenes in target cells and typically have control sequences. The vectors described in this application may be expression vectors, including viral vectors (lentiviral vectors and / or retroviral vectors), bacteriophage vectors, phage particles, granules, cosmids, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC) and / or plasmids.
[0095] In this application, the term “treatment” generally means: (i) preventing a patient who may be susceptible to a disease, condition and / or symptom but has not yet been diagnosed with the disease, from developing such a disease, condition or symptom; (ii) suppressing such a disease, condition or symptom, i.e., curbing its development; and (iii) alleviating such a disease, condition or symptom, i.e., achieving the relief of such a disease, condition and / or symptom and / or symptoms associated with such a disease, condition and / or symptom.
[0096] In this application, the term "major histocompatibility complex (MHC)" generally refers to a series of proteins located on the cell surface that help the immune system recognize foreign substances. MHC mainly includes class I MHC molecules and class II MHC molecules. Class I MHC molecules can span the membranes of almost all cells in an organism, while class II molecules are usually found on immune cells. Class I MHC molecules, also known as class I major histocompatibility complexes, are heterodimeric glycoproteins composed of two non-covalently linked peptide chains; one is called the heavy chain, which exhibits structural polymorphism, and the other is the light chain, also known as β2-microglobulin (B2M). Functionally, class I MHC molecules present polypeptides of intracellularly degraded non-self proteins, thereby activating the immune system. Human class I MHC molecules are divided into classical HLA molecules (HLA-A, HLA-B, HLA-C) and non-classical HLA molecules (HLA-E, HLA-G, HLA-F). In this application, the modified immune cells may not express active MHC. "Not expressing active MHC" may include expressed MHC lacking the activity to activate the immune system and / or the absence of class I MHC molecules on the cell surface (e.g., absence of HLA-A / B / C / E / F / G). In some cases, the absence of class I MHC molecules on the cell surface can be achieved by editing B2M or the corresponding heavy chain gene.
[0097] In this application, the term "B2M" generally refers to β-2 microglobulin, typically the light chain of a class I MHC molecule, and is therefore an essential component of the major histocompatibility complex (MHC). In the human genome, B2M is encoded by the b2m gene located on chromosome 15, while other MHC genes exist as gene clusters on chromosome 6. The human B2M protein has 119 amino acids (see UniProt database code P61769). In mouse models lacking β-2 microglobulin, it has been demonstrated that B2M is essential for the presentation of class I MHC molecules on the cell surface and for the stability of peptide binding grooves. Class I MHC molecules are present on the surface of all nucleated cells in the human body. MHC mismatches can cause immune rejection, leading to graft destruction. Removing class I MHC molecules from the cell surface by knocking out the B2M gene can prevent mismatches.
[0098] In this application, the term "CD3" generally refers to the CD3 protein multi-subunit complex, which is composed of six different polypeptide chains (subunits). In mammals, the CD3 polypeptide chain may contain one CD3 gamma (γ) chain, one CD3 gamma (δ) chain, two CD3 epsilon (ε) chains, and two CD3 zeta (ζ) chains.
[0099] In this application, the term "CD3" refers to any naturally occurring CD3 from any vertebrate source, including mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys), and rodents (e.g., mice and rats). The term encompasses "full-length" and unprocessed CD3 proteins, as well as any form of protein or one or more CD3 chains (peptides) derived from cell-processed proteins. The term also encompasses naturally occurring variants and isotypes of CD3, such as splice variants or allelic variants.
[0100] Similarly, the terms “CD3 epsilon”, “CD3 gamma”, “CD3 gamma” and / or “CD3zeta” in this application refer to any natural CD3 from any vertebrate source, including mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys) and rodents (e.g., mice and rats). The terms “CD3 epsilon,” “CD3 gamma,” “CD3 gamma,” and / or “CD3 zeta” respectively cover “full-length” and unprocessed CD3 epsilon, “CD3 gamma,” “CD3 gamma,” and / or “CD3 zeta” proteins, as well as any form of CD3 chain (peptide) derived from cell processing (e.g., mature polypeptide). The term also covers naturally occurring variants and equivalences of the CD3 chain, such as splice variants or allelic variants. For example, the amino acid sequence of an exemplary CD3delta can be found in UniProt database accession number P04234, the amino acid sequence of an exemplary CD3epsilon can be found in UniProt database accession number P07766, and the amino acid sequence of an exemplary CD3 gamma can be found in UniProt database accession number P09693.
[0101] In this application, the term "T cell receptor (TCR)" generally refers to the transmembrane protein complex involved in the activation of T cells after antigen recognition. The TCR is a heterodimer formed by two distinct protein subunits. In humans, 95% of T cells express one alpha (α) chain and one beta (β) chain. The remaining 5% express gamma (γ) and delta (δ) chains. Each chain of the TCR molecule may contain two extracellular domains: a variable region and a constant region. The variable region binds to the polypeptide / major histocompatibility complex (MHC). Both the α and β chain variable regions contain three complementarity-determining regions (CDRs) responsible for antigen / MHC complex recognition. The constant region is located near the cell membrane and connects to the transmembrane domain. The extracellular constant domains of both heterodimeric TCR subunits contain short binding sequences containing cysteine residues. Disulfide bonds are formed between the cysteine residues, thus binding the two heterodimeric TCR subunits together. The TCR transmembrane domain contains positively charged amino acids responsible for binding to CD3 molecules. The intracellular region of the TCR is very short and lacks an active domain.
[0102] TCRs recognize processed polypeptide fragments that bind to MHC molecules; this recognition requires the presentation of MHC molecules and is therefore known as MHC restriction. When the donor and recipient MHC molecules differ, TCRs can recognize these differences, leading to T cell activation and expansion, potentially causing graft-versus-host disease (GvHD). Knocking out the TRAC gene removes the expression of the TCRα chain, thereby removing the TCR complex from the surface of T cells and preventing GvHD caused by TCR recognition of allogeneic antigens.
[0103] The CD3 multi-subunit complex and TCR can form a functional complex via non-covalent bonding, called the TCR-CD3 complex. During the formation of the TCR-CD3 complex, the CD3 epsilon molecule forms heterodimers with CD3 gamma and CD3 delta, respectively, while CD3 zeta forms a homodimer with itself. A TCR-CD3 complex includes one CD epsilon:delta heterodimer, one CD epsilon:gamma heterodimer, one CD zeta:zeta homodimer, and one TCR alpha:beta heterodimer. Therefore, these four dimers are in a 1:1:1:1 ratio within a TCR-CD3 complex. The transmembrane region of the CD3 molecule is negatively charged due to the presence of aspartic acid residues, allowing CD3 to bind to a pair of positively charged TCR subunits in the transmembrane region. CD3 gamma, CD3 delta, and CD3 epsilon molecules are highly related immunoglobulin superfamily membrane proteins, all containing a single extracellular immunoglobulin domain, while the extracellular region of CD3 zeta is very short. The intracellular regions of CD3 gamma, CD3 delta, and CD3 epsilon molecules all contain a single conserved immunoreceptor tyrosine-based activation motif (ITAM). The CD3 zeta chain contains three ITAM motifs. A single TCR-CD3 complex contains a total of 10 ITAM motifs, which determine the degree of TCR activation.
[0104] In this application, the terms “polypeptide,” “peptide,” “protein,” and “protein protein” are used interchangeably and generally refer to a polymer having amino acids of any length. The polymer may be linear or branched, may contain modified amino acids, and may be interrupted by non-amino acid components. These terms also cover polymers containing modified amino acids. These modifications may include: disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation (such as binding to a labeled component). The term “amino acid” includes natural and / or non-natural or synthetic amino acids, including glycine and its D and L optical isomers, as well as amino acid analogs and peptide mimics.
[0105] In this application, the terms "polynucleotide," "nucleotide," "nucleotide sequence," "nucleic acid," and "oligonucleotide" are used interchangeably and generally refer to a polymeric form of nucleotides of any length, such as deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides can have any three-dimensional structure and can perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, multiple loci (one locus) as defined by ligation analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may contain one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, the nucleotide structure may be modified before or after polymer assembly. The sequence of a nucleotide may be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, such as by conjugation with labeled components.
[0106] In addition to the specific proteins and nucleotides mentioned herein, this application may also include their functional variants, derivatives, analogs, homologs, and fragments.
[0107] The term "functional variant" refers to a polypeptide that has a substantially identical amino acid sequence or is encoded by a substantially identical nucleotide sequence to the naturally occurring sequence and is capable of possessing one or more activities of the naturally occurring sequence. In the context of this application, a variant of any given sequence refers to a sequence in which a specific sequence of residues (whether amino acid or nucleotide residues) has been modified such that the polypeptide or polynucleotide substantially retains at least one endogenous function. Variant sequences can be obtained by adding, deleting, substituting, modifying, replacing, and / or mutating at least one amino acid residue and / or nucleotide residue present in naturally occurring proteins and / or polynucleotides, as long as the original functional activity is maintained.
[0108] In this application, the term "derivative" generally refers to any substitution, variation, modification, replacement, deletion and / or addition of one (or more) amino acid residues of the self / pair sequence for the polypeptide or polynucleotide of this application, provided that the resulting polypeptide or polynucleotide substantially retains at least one of its endogenous functions.
[0109] In this application, the term "analyte" generally refers to a polypeptide or polynucleotide, including any mimic of a polypeptide or polynucleotide, i.e., a chemical compound having at least one endogenous function of the polypeptide or polynucleotide that the mimic mimic has.
[0110] Typically, amino acid substitutions can be made, such as substitutions of at least one amino acid (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 20), as long as the modified sequence substantially retains the desired activity or ability. Amino acid substitutions may include the use of non-naturally occurring analogues.
[0111] The proteins or peptides used in this application may also have deletions, insertions, or substitutions of amino acid residues, which produce silent changes and result in functionally equivalent proteins. Intentional amino acid substitutions can be made based on the similarity of the residues' polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphoteric properties, as long as the endogenous function is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids containing non-polarized head groups with similar hydrophilicity values include asparagine, glutamine, serine, threonine, and tyrosine.
[0112] In this application, the term "homologous" generally refers to an amino acid sequence or nucleotide sequence that has a certain degree of homology with a wild-type amino acid sequence and a wild-type nucleotide sequence. The term "homology" can be equivalent to sequence "identity". Homologous sequences can include amino acid sequences that are at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the subject sequence. Typically, homologous sequences will contain the same active sites as the subject amino acid sequence, etc. Homology can be considered based on similarity (i.e., amino acid residues with similar chemical properties / functions) or can be expressed in terms of sequence identity. In this application, a sequence having a percentage identity with any of the referenced amino acid sequences or nucleotide sequences in SEQ ID NO means a sequence having said percentage identity across the entire length of the referenced SEQ ID NO.
[0113] To determine sequence identity, sequence alignment can be performed, which can be done in various ways known to those skilled in the art, such as using BLAST, BLAST-2, ALIGN, NEEDLE, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for alignment, including any algorithms required to achieve optimal alignment across the full-length sequences being compared.
[0114] In this application, the term "and / or" should be understood to mean any one of the options or both of the options.
[0115] In this application, the term "comprising" generally means including the explicitly specified features, but does not exclude other elements.
[0116] In this application, the term "about" generally refers to a variation within a range of 0.5% to 10% above or below a specified value, such as a variation within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value. Invention Details
[0118] This application develops a tunable cell therapy that fully leverages the advantages of bispecific antibody therapy and cell therapy, representing a combined approach. The T cells used in this application are universal T cells expressing a CD3 antibody receptor and having undergone gene knockout. The CD3 antibody receptor is composed of two recombinant CD3 protein molecules. This T cell expresses a CD3 antibody receptor that can be recognized by bispecific antibodies. Unlike similar chimeric antibody receptor therapies, the CD3 antibody receptor in this application can be recognized by bispecific antibodies and its expression is independent of the TCR complex, allowing for independent and direct expression on the T cell surface.
[0119] This application provides the following technical solution:
[0120] 1. A modified lymphocyte that lacks a TCR molecule and expresses a CD3 antibody receptor complex comprising at least two recombinant CD3 proteins; wherein the first recombinant CD3 protein comprises:
[0121] a. Extracellular domains containing the CD3 epsilon domain;
[0122] b. Transmembrane domain;
[0123] c. Intracellular domains; and
[0124] The second type of CD3 recombinant protein includes:
[0125] d. Extracellular domains containing CD3 delta and / or CD3 gamma domains;
[0126] e. Transmembrane domain;
[0127] f. Intracellular domains;
[0128] The intracellular domain is composed of an intracellular co-stimulatory signal transduction domain and an intracellular signal transduction domain, or the intracellular domain is a peptide segment of at least two amino acids; wherein at least one intracellular domain of the first CD3 recombinant protein and the second CD3 recombinant protein is composed of an intracellular co-stimulatory signal transduction domain and an intracellular signal transduction domain.
[0129] 2. The lymphocytes described in technical solution 1, wherein the lymphocytes are T cells, B cells, NK cells or macrophages.
[0130] 3. The lymphocyte described in technical solution 2, wherein the lymphocyte is a T cell.
[0131] 4. The lymphocytes described in any of the foregoing technical solutions, wherein a. the extracellular domain comprises the extracellular domain of CD3epsilon as shown in SEQ ID No:1, or a variant thereof.
[0132] 5. The lymphocytes described in technical solution 4, wherein a. the extracellular domain is the extracellular domain of CD3 epsilon as shown in SEQ ID No:1.
[0133] 6. The lymphocyte described in any of the foregoing technical solutions, wherein d. the extracellular domain comprises the extracellular domain of the CD3 gamma domain.
[0134] 7. The lymphocyte of technical solution 6, wherein d. the extracellular domain comprises the extracellular domain of CD3 gamma as shown in SEQ ID No:2, or a variant thereof.
[0135] 8. The lymphocytes described in technical solution 7, wherein d. the extracellular domain is the extracellular domain of CD3 gamma as shown in SEQ ID No:2.
[0136] 9. The lymphocyte described in any of the foregoing technical solutions, wherein d. the extracellular domain comprises the extracellular domain of the CD3 delta domain, or a variant thereof.
[0137] 10. The lymphocyte of claim 9, wherein d. the extracellular domain comprises the extracellular domain of CD3 delta as shown in SEQ ID No:4, or a variant thereof.
[0138] 11. The lymphocyte of technical solution 10, wherein d. the extracellular domain is the extracellular domain of CD3 delta shown in SEQ ID No:4.
[0139] 12. The lymphocytes described in any of the foregoing technical solutions, wherein transmembrane domains b and e include at least one of the following: transmembrane domain of CD8α, transmembrane domain of CD28, transmembrane domain of 4-1BB, transmembrane domain of CD4, transmembrane domain of CD27, transmembrane domain of CD7, transmembrane domain of PD-1, transmembrane domain of TRAC, and transmembrane domain of TRBC.
[0140] 13. The lymphocytes of technical solution 12, wherein the transmembrane domain of CD28 comprises the transmembrane domain of CD28 shown in SEQ ID No:7, or a variant thereof.
[0141] 14. The lymphocytes described in any of the foregoing technical solutions, wherein the intracellular co-stimulatory signal transduction domains comprise at least one of the following: co-stimulatory molecules composed of co-stimulatory signal transduction regions of CD28, 4-1BB, CD40L, TIM1, CD226, DR3, SLAM, ICOS, OX40, NKG2D, 2B4, CD244, FcεRIγ, BTLA, CD27, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, and DAP12, and combinations thereof.
[0142] 15. The lymphocyte of technical solution 14, wherein the intracellular co-stimulatory signal transduction domain includes the co-stimulatory signal transduction region of CD28 as shown in SEQ ID No:8, or a variant thereof.
[0143] 16. The lymphocyte of technical solution 14, wherein the intracellular costimulatory signal transduction domain comprises a 4-1BB costimulatory signal transduction region, or a variant thereof.
[0144] 17. The lymphocyte described in any of the foregoing technical solutions, wherein the intracellular signal transduction domain comprises at least one of the following: CD3zeta activation region, CD3delta activation region, CD3gamma activation region, FceRIγ activation region, FceRI activation region, immunoglobulin alpha (Iga) activation region, Igbeta activation region, bovine leukemia virus gp30 activation region, Epstein-Barr virus (EBV) LMP2A activation region, simian immunodeficiency virus PBj14Nef activation region, HSKV activation region, DAP-12 activation region, a domain comprising at least one ITAM (tyrosine activation motif), and a domain formed by a combination of the above domains.
[0145] 18. The lymphocytes of technical solution 17, wherein the CD3 zeta activation region comprises the sequence shown in SEQ ID No:9, or a variant thereof.
[0146] 19. The lymphocytes described in any of the foregoing technical solutions, wherein the extracellular domain and transmembrane region of the CD3 recombinant protein further have a hinge region.
[0147] 20. The lymphocytes of technical solution 19, wherein the hinge region comprises at least one of the following: hinge regions of CD8α, CD28, 4-1BB, CD4, CD27, CD7 and PD-1.
[0148] 21. The lymphocyte described in any of the foregoing technical solutions, wherein the intracellular domain is a peptide segment consisting of at least two amino acids.
[0149] 22. The lymphocytes described in any of the foregoing technical solutions, wherein the first CD3 recombinant protein is selected from one of the following recombinant proteins: CD3ε extracellular domain-CD8α hinge region-CD8α transmembrane region-4-1BB costimulatory signal transduction region-CD3ζ activation region, CD3ε extracellular domain-CD8α transmembrane region-4-1BB costimulatory signal transduction region-CD3ζ activation region, CD3ε extracellular domain-CD28 hinge region-CD28 transmembrane region-CD28 costimulatory signal transduction region-CD3ζ activation region, and CD3ε extracellular domain-CD28 transmembrane region-CD28 costimulatory signal transduction region-CD3ζ activation region.
[0150] 23. The lymphocytes of technical solution 22, wherein the first CD3 recombinant protein has the sequence shown in SEQ ID No:10, or a variant thereof.
[0151] 24. The lymphocytes described in any of the foregoing technical solutions, wherein the second CD3 recombinant protein is selected from one of the following recombinant proteins: CD3γ extracellular region-CD8α hinge region-CD8α transmembrane region-CD3γ co-stimulatory signal transduction region, CD3γ extracellular region-CD8α transmembrane region-CD3γ co-stimulatory signal transduction region, CD3γ extracellular region-CD28 hinge region-CD28 transmembrane region-CD3γ co-stimulatory signal transduction region, and CD3γ extracellular region-CD28 transmembrane region-CD3γ co-stimulatory signal transduction region, CD3γ extracellular region-CD28 hinge region-CD28 transmembrane region-peptide segment, wherein the peptide segment may be a peptide segment of at least 2, 4 or at least 6 amino acids.
[0152] 25. The lymphocytes of technical solution 24, wherein the second CD3 recombinant protein has the sequences shown in SEQ ID No:11 and SEQ ID No:12, or variants thereof.
[0153] 26. The lymphocytes described in any one of the aforementioned technical solutions 1-25, wherein the second CD3 recombinant protein is selected from one of the following recombinant proteins: CD3δ extracellular region-CD8α hinge region-CD8α transmembrane region-CD3δ costimulatory signal transduction region, CD3δ extracellular region-CD8α transmembrane region-CD3δ costimulatory signal transduction region, CD3δ extracellular region-CD28 hinge region-CD28 transmembrane region-CD3δ costimulatory signal transduction region, and CD3δ extracellular region-CD28 transmembrane region-CD3δ costimulatory signal transduction region.
[0154] 27. The lymphocyte described in any of the foregoing technical solutions, wherein the lymphocyte lacks MHC molecules.
[0155] 28. The lymphocyte described in any of the foregoing technical solutions, wherein the intracellular domain of the first CD3 recombinant protein is composed of an intracellular co-stimulatory signal transduction domain and an intracellular signal transduction domain.
[0156] 29. The lymphocyte described in any of the foregoing technical solutions, wherein the intracellular domain of the second CD3 recombinant protein is composed of an intracellular co-stimulatory signal transduction domain and an intracellular signal transduction domain.
[0157] 30. The lymphocytes described in any of the foregoing technical solutions, wherein the CD3 antibody receptor complex comprises three recombinant CD3 proteins, the first recombinant CD3 protein comprising:
[0158] a. Extracellular domains containing the CD3 epsilon domain;
[0159] b. Transmembrane domain;
[0160] c. Intracellular domains; and
[0161] The second type of CD3 recombinant protein includes:
[0162] d. Extracellular domains containing the CD3 delta domain;
[0163] e. Transmembrane domain;
[0164] f. Intracellular domains; and
[0165] The third type of CD3 recombinant protein includes:
[0166] g. Extracellular domains containing CD3 gamma domains;
[0167] h. Transmembrane domain;
[0168] i. Intracellular domains;
[0169] The intracellular domain is composed of an intracellular co-stimulatory signal transduction domain and an intracellular signal transduction domain, or the intracellular domain is a peptide segment of at least two amino acids; at least one of the three CD3 recombinant proteins has an intracellular domain composed of an intracellular co-stimulatory signal transduction domain and an intracellular signal transduction domain.
[0170] 31. A pharmaceutical composition comprising lymphocytes as described in any one of claims 1-30, and a bispecific antibody capable of binding to a CD3 antibody-receptor complex on the surface of lymphocytes and simultaneously binding to a receptor on the surface of target cells.
[0171] 32. The pharmaceutical composition of technical solution 31, wherein the receptor of the target cell is selected from one of the following: CD19, CD20, CD22, CD123, CD33, BCMA, IL13R alpha, PSMA, EGFR, HER2, Mesothelin and Claudin18.2.
[0172] 33. The pharmaceutical composition of technical solution 31 or 32, wherein the bispecific antibody can bind to the CD3 antibody receptor complex on the surface of lymphocytes and can simultaneously bind to the CD19 receptor on the surface of target cells.
[0173] 34. The pharmaceutical composition according to any one of technical solutions 31-33, wherein the target cells are tumor cells.
[0174] 35. The pharmaceutical composition according to any one of technical solutions 31-34, wherein the lymphocytes are T cells, B cells, NK cells or macrophages.
[0175] 36. The use of lymphocytes as described in any one of technical solutions 1-24 in the preparation of a drug for treating tumors.
[0176] 37. The application described in technical solution 30, wherein the drug further includes a bispecific antibody that can bind to the CD3 antibody receptor complex on the surface of lymphocytes and simultaneously bind to the receptor on the surface of target cells.
[0177] 38. A treatment for a disease, the method comprising injecting into a subject:
[0178] c. An effective amount of lymphocytes as described in any one of technical solutions 1-30, and
[0179] d. An effective amount of bispecific antibody that can bind to the CD3 antibody receptor complex on the surface of lymphocytes and simultaneously bind to the receptor on the surface of target cells.
[0180] 39. The method of technical solution 38, wherein the receptor of the target cell is selected from one of the following: CD19, CD20, CD22, CD123, CD33, BCMA, IL13R alpha, PSMA, EGFR, HER2, Mesothelin and Claudin18.2.
[0181] 40. The method of technical solution 39, wherein the target cell is a tumor cell.
[0182] CD3 antibody receptor complex
[0183] This application provides a modified immune cell that may contain a CD3 antibody receptor complex, the CD3 antibody receptor complex comprising a first CD3 recombinant protein and a second CD3 recombinant protein.
[0184] In this application, the first CD3 recombinant protein may include (1) a first extracellular domain, (2) a first transmembrane domain, and (3) a first intracellular domain; the second CD3 recombinant protein may include (1) a second extracellular domain, (2) a second transmembrane domain, and (3) a second intracellular domain.
[0185] In some cases, the first extracellular domain may comprise an extracellular domain derived from the CD3 epsilon domain, for example, the first extracellular domain may comprise an amino acid sequence as shown in SEQ ID NO:1. For example, the first extracellular domain may comprise an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in SEQ ID NO:1.
[0186] In some cases, the second extracellular domain may comprise an extracellular domain derived from the CD3 gamma domain, for example, the second extracellular domain may comprise an amino acid sequence as shown in SEQ ID NO:2. For example, the second extracellular domain may comprise an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in SEQ ID NO:2.
[0187] In some cases, the second extracellular domain may comprise an extracellular domain derived from the CD3 delta domain, for example, the second extracellular domain may comprise an amino acid sequence as shown in SEQ ID NO:4. For example, the second extracellular domain may comprise an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in SEQ ID NO:4.
[0188] In this application, the CD3 recombinant protein (e.g., a first CD3 recombinant protein and / or a second CD3 recombinant protein) may include a transmembrane domain (e.g., a first transmembrane domain and / or a second transmembrane domain). The transmembrane domain (e.g., the first transmembrane domain and / or the second transmembrane domain) may be derived from any type I transmembrane protein, as long as it is not a transmembrane domain of CD3. In this application, the exemplary transmembrane domains (e.g., the first transmembrane domain and / or the second transmembrane domain) may include, but are not limited to, transmembrane domains derived from the following histones: CD8, CD28, 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, the ζ chain of the T cell receptor, CD3ε, CD5, ICOS, OX40, NKG2D, 2B4, CD244, FcεRIγ, BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L, TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, CD134, CD137, CD154, SLAM, and any other transmembrane domains independent of TCR expression, or mutants of the above transmembrane domains.
[0189] For example, the transmembrane domain (e.g., the first transmembrane domain and / or the second transmembrane domain) may be a transmembrane domain derived from human CD28. For example, the first transmembrane domain may contain an amino acid sequence as shown in SEQ ID NO:7. For example, the first transmembrane domain may contain an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in SEQ ID NO:7.
[0190] In this application, the recombinant CD3 protein may include intracellular domains (e.g., a first intracellular domain and / or a second intracellular domain). In some cases, the intracellular domains (e.g., the first intracellular domain and / or the second intracellular domain) may include intracellular co-stimulatory domains and / or intracellular signal transduction domains.
[0191] In this application, the intracellular signal transduction domain may include a domain containing at least one ITAM motif. Exemplary signal transduction domains may be derived from signal transduction domains selected from the group consisting of, but not limited to, CD3zeta, CD3delta, CD3gamma, CD3ε, CD79a, CD79b, FceRIγ, FceRIβ, FcγRIIa, bovine leukemia virus gp30 activation region, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, Kaposi's sarcoma herpesvirus (HSKV), DAP10 and DAP-12, and variants thereof.
[0192] For example, the signal transduction domain may be a signal transduction domain derived from the CD3zeta intracellular domain. For example, the signal transduction domain derived from the CD3zeta intracellular domain may include the signal transduction domain shown in SEQ ID NO:9. For example, the signal transduction domain derived from the CD3zeta intracellular domain may include an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in SEQ ID NO:9.
[0193] Upon stimulation, the CD3 antibody receptor complex can transmit activation signals into the cell. Sometimes, activation of the signal transduction domain is insufficient to provide a sufficient activation signal, and a co-stimulatory domain is also required to provide a stimulatory signal. The co-stimulatory domain may include, but is not limited to, the following groups: co-stimulatory signal transduction regions of CD28, CD137, CD27, CD2, CD7, CD8, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, FcεRIγ, BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, ligands of CD83, co-stimulatory signal transduction regions of CD40 and MyD88, and combinations thereof constituting co-stimulatory molecules.
[0194] For example, the co-stimulatory domain may be a co-stimulatory domain derived from the human CD28 intracellular domain. For example, the co-stimulatory domain of the human CD28 intracellular domain may comprise the co-stimulatory domain shown in SEQ ID NO:8. For example, the co-stimulatory domain of the human CD28 intracellular domain may comprise an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in SEQ ID NO:8.
[0195] For example, the intracellular domain (e.g., the first intracellular domain and / or the second intracellular domain) may include a co-stimulatory domain from the aforementioned human CD28 intracellular domain and a signal transduction domain from the aforementioned CD3zeta intracellular domain.
[0196] For example, the intracellular domain (e.g., the first intracellular domain and / or the second intracellular domain) may comprise an intracellular domain derived from CD3 gamma. For example, the intracellular domain of CD3 gamma may comprise an amino acid sequence as shown in SEQ ID NO:3. For example, the intracellular domain of CD3 gamma may comprise an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in SEQ ID NO:3.
[0197] In some cases, the intracellular domain (e.g., a first intracellular domain and / or a second intracellular domain) may comprise a peptide of at least two (e.g., at least four, at least six, or more) amino acids. For example, the peptide may comprise an amino acid sequence as shown in SEQ ID NO:19.
[0198] In the CD3 antibody receptor complex described in this application, for the first and second recombinant CD3 proteins, other portions (e.g., transmembrane domains, intracellular domains) may be the same or different, except for the extracellular region. For example, the first transmembrane domain of the first CD3 recombinant protein and the second transmembrane domain of the second CD3 recombinant protein may be the same or different, and the first intracellular domain of the first CD3 recombinant protein and the second intracellular domain of the second CD3 recombinant protein may be the same or different. For example, the signal transduction domain of the first intracellular domain and the signal transduction domain of the second intracellular domain may be the same or different. For example, the co-stimulatory domain of the first intracellular domain and the co-stimulatory domain of the second intracellular domain may be the same or different. It is acceptable as long as at least one (e.g., at least two, three, four, or more) of the first and second intracellular domains contains a co-stimulatory domain and / or a signal transduction domain, or as long as sufficient signal transduction is provided for antibody stimulation to activate the modified immune cells.
[0199] In some cases, the intracellular domain may be an intracellular domain derived from CD3 gamma and / or CD3 delta, for example, the intracellular domain may comprise an intracellular domain as shown in any one of SEQ ID NO:3 and 5. Alternatively, the intracellular domain may comprise an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in any one of SEQ ID NO:3 and 5.
[0200] In the CD3 antibody receptor complex of this application, the first intracellular domain of the first CD3 recombinant protein may include a co-stimulatory domain and a signal transduction domain, and the first intracellular domain of the second CD3 recombinant protein may be a peptide of at least two (e.g., at least four, at least six or more) amino acids.
[0201] In the CD3 antibody receptor complex of this application, the first intracellular domain of the second CD3 recombinant protein may include a co-stimulatory domain and a signal transduction domain, and the first intracellular domain of the second CD3 recombinant protein may be a peptide of at least two (e.g., at least four, at least six or more) amino acids.
[0202] In this application, the CD3 recombinant protein (first CD3 recombinant protein and / or second CD3 recombinant protein) may further include a hinge region. The hinge region may be located between an extracellular domain and a transmembrane domain. For example, the hinge region may include a hinge region derived from any one or more proteins selected from the group consisting of: CD8α, CD28, 4-1BB, CD4, CD27, CD7, and PD-1.
[0203] For example, the hinge region may contain an amino acid sequence as shown in any of SEQ ID NO:6. Alternatively, the hinge region may contain an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in any of SEQ ID NO:6.
[0204] For example, in this application, the first CD3 recombinant protein may be derived from the extracellular domain of the CD3 epsilon domain, the transmembrane region derived from CD28, the intracellular domain derived from CD28, and the intracellular domain derived from CD3 zeta. For example, the first CD3 recombinant protein may comprise the amino acid sequence shown in SEQ ID NO:10. Alternatively, the first CD3 recombinant protein may comprise an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in SEQ ID NO:10.
[0205] For example, the second CD3 recombinant protein may comprise an extracellular domain derived from the CD3 gamma domain, a transmembrane region derived from CD28, and an intracellular domain derived from CD3 gamma. For example, the second CD3 recombinant protein may comprise the amino acid sequence shown in SEQ ID NO:11. Alternatively, the second CD3 recombinant protein may comprise an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in SEQ ID NO:11.
[0206] For example, the second CD3 recombinant protein may comprise an extracellular domain derived from the CD3 gamma domain, a transmembrane region derived from CD28, and the peptide. For example, the second CD3 recombinant protein may comprise the amino acid sequence shown in SEQ ID NO:12. Alternatively, the second CD3 recombinant protein may comprise an amino acid sequence having at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence homology to the amino acid sequence shown in SEQ ID NO:12.
[0207] In this application, the CD3 antibody receptor complex may further comprise one or more (e.g., two, three, four or more) first recombinant proteins. In this application, the CD3 antibody receptor complex may also comprise one or more (e.g., two, three, four or more) second recombinant proteins. In some cases, the CD3 antibody receptor complex may further comprise a third recombinant protein, which may comprise (1) a third extracellular domain comprising an extracellular domain derived from any one of the CD3 gamma domain or CD3 delta domain, (2) a third transmembrane domain, and (3) a third intracellular domain. The third transmembrane domain may be within the range of transmembrane domains described above and may be the same as or different from the first transmembrane domain and / or the second transmembrane domain. The third intracellular domain may be within the range of intracellular domains described above and may be the same as or different from the first intracellular domain and / or the second intracellular domain. The condition is acceptable as long as at least one (e.g., at least two, three, four or more) of the recombinant CD3 proteins in the CD3 antibody receptor complex has an intracellular domain containing a co-stimulatory domain and / or a signal transduction domain, or as long as it can provide sufficient signal transduction for antibody stimulation to activate the modified immune cells.
[0208] immune cells
[0209] On the other hand, this application provides a modified immune cell. The immune cell may include T cells, B cells, natural killer (NK) cells, macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes, and / or peripheral blood mononuclear cells.
[0210] In some cases, the immune cells may include T lymphocytes. The T lymphocytes may include thymocytes, native T lymphocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes, or activated T lymphocytes. The T cells may be helper T cells (Th), such as helper T cell 1 (Th1) or helper T cell 2 (Th2). The T lymphocytes may be CD4+ cells. + Helper T cells (HTL; CD4) + T cells, cytotoxic T cells (CTLs; CD8) + T cells), tumor-infiltrating cytotoxic T cells (TIL; CD8) + T cells), CD4 + / CD8 + T cells, CD4 - / CD8 -T cells or any other T lymphocyte subtype. In some cases, the modified T cells are human T cells. Prior to expanding and genetically modifying the cells of this application, the cell source can be obtained from a subject, such as a patient, by various non-limiting methods. T cells can be obtained from many non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from the site of infection, ascites, pleural effusion, spleen tissue, and tumors. In some cases, any number of T cell lines available and known to those skilled in the art can be used. In other cases, the cells can be derived from a healthy donor, from a patient diagnosed with cancer, or from a patient diagnosed with an infection. In still other cases, the cells are part of a mixed population of cells exhibiting different phenotypic characteristics.
[0211] In some cases, the immune cells may include B cells. In some cases, the B cells may include effector B cells (plasma cells) and memory B cells. The B cells may include B2 cells, B1 cells, marginal zone B cells, follicular B cells, and regulatory B cells. In some cases, the immune cells may include macrophages. The B cells may include type I macrophages (M1) and type II macrophages (such as M2a, M2B, and M2c).
[0212] In some cases, the immune cells may include NK cells. In some cases, the NK cells may include CD56bright and CD56dim. In some cases, the NK cells may include NK1 and NK2. In some cases, the NK cells may include A-NK and NA-NK.
[0213] In some cases, the immune cells may include leukocytes. Leukocytes generally refer to nucleated blood cells with active motility, capable of migrating from within blood vessels to outside blood vessels, or from extravascular tissues to within blood vessels. Besides the blood, leukocytes can also be found in the lymphatic system, spleen, tonsils, and other tissues of the body. In this application, the leukocytes may include granulocytes (such as neutrophils, eosinophils, and basophils) and agranulocytes (such as lymphocytes, monocytes, macrophages, phagocytes, and mast cells).
[0214] In some cases, the immune cells may include lymphocytes, which may include any monocytes, non-phagocytic leukocytes, such as B lymphocytes, T lymphocytes, and natural killer (NK) cells found in blood, lymph, and lymphoid tissue.
[0215] In some cases, the immune cells may include peripheral blood mononuclear cells, which may include any cell in peripheral blood that has a single nucleus. For example, in this application, the peripheral blood mononuclear cells may include T cells, B cells, NK cells, lymphocytes, monocytes, and dendritic cells.
[0216] In some cases, the immune cells may include macrophages. Macrophages are cells that can engulf and digest cellular debris, microorganisms, cancer cells, and any other substances that lack the surface markers expressed on the normal cell surface—a process called phagocytosis. Macrophages are present in almost all tissues and seek out potential pathogens through amoebic movement. In addition to playing an important role in nonspecific innate immune responses, they can also help initiate adaptive immunity by recruiting other immune cell types, such as lymphocytes.
[0217] The modified immune cells described in this application do not express T-cell receptors (TCRs). The lack of T-cell receptor expression (TCR) may include downregulation of T-cell receptor (TCR) expression and / or activity. Downregulation may include not expressing an active TCR, not expressing an endogenous TCR, not expressing an exogenous TCR, not containing a TCR structure, containing an inactivated TCR, and / or lacking a TCR.
[0218] In some cases, the expression and / or activity of T cell receptor α constant region protein and / or T cell receptor β constant region protein in the immune cells may be downregulated. In some cases, this downregulation may include downregulating the expression and / or activity of nucleic acid molecules encoding the T cell receptor α constant region protein and / or T cell receptor β constant region protein; and / or, may include downregulating the expression and / or activity of the T cell receptor α constant region protein and / or T cell receptor β constant region protein. In the modified immune cells described in this application, the expression of the CD3 antibody receptor complex may be independent of TCR expression.
[0219] The expression and / or activity of the MHC complex in the immune cells are downregulated. In some cases, the downregulation may include downregulating the expression and / or activity of nucleic acid molecules encoding the cellular MHC complex; and / or, may include downregulating the expression and / or activity of the cellular MHC complex protein.
[0220] In some cases, the downregulation can be achieved by gene knockout, gene knockdown, gene mutation, gene deletion, gene silencing, or any combination thereof, thereby downregulating the expression and / or activity of the TCR and / or MHC complex of the immune cells.
[0221] For example, downregulation can be achieved by administering one or more substances selected from the group consisting of: antisense RNA, siRNA, shRNA, CRISPR / Cas system, RNA editing systems such as RNA adenosine deaminase (ADAR), RNA-directed endonucleases, zinc finger nucleases (ZFN), Mega-TAL nucleases, transcription activator-like effector nucleases (TALEN), meganuclease, base editing, CRISPR interference, and transcriptional repression mediated by zinc finger protein gene repressors and / or transcription activator-like effector (TALE) gene repressors.
[0222] In some cases, the downregulation may include administering a guide RNA to the immune effector cells that targets the exon portion of the nucleic acid molecule (e.g., the nucleic acid molecule encoding the cellular MHC complex). The guide RNA targeting the nucleic acid molecule encoding the B2M may be any guide RNA available in the art. The full text of WO2019 / 011118 is incorporated herein by reference.
[0223] The modified immune cells described in this application may also include chimeric antigen receptors (CARs) and / or chimeric autoantibody receptors (CAARs).
[0224] Preparation method
[0225] This application provides a method for preparing modified lymphocytes, which may include the following steps: 1. Obtaining peripheral blood T cells from a healthy donor; 2. Activating the T cells using magnetic beads loaded with CD3 and CD28 antibodies; 3. After activation, transferring the chimeric antibody receptor gene into the T cells using lentivirus; 4. Removing the magnetic beads; 5. Knocking out the important genes TRAC and B2M that produce immune rejection using gene editing technology; 6. Continuing to culture and harvesting the cells.
[0226] By inactivating the TRAC and B2M genes in lymphocytes through gene editing, the immune rejection of lymphocytes in allogeneic cell therapy can be effectively reduced. At the same time, two recombinant CD3 surface proteins are expressed in the lymphocytes. These two co-expressed CD3 surface proteins are CD3 antibody receptors, which enable the modified lymphocytes to bind to bispecific antibodies.
[0227] Methods for preparing modified lymphocytes include: (i) preparing lymphocytes with the surface lacking class I MHC molecules and TCR molecules; and (ii) expressing two recombinant CD3 surface proteins on the surface of the lymphocytes.
[0228] On the other hand, this application provides a vector that can be used to transfer isolated nucleic acid molecules encoding the CD3 antibody receptor complex into cells. In this application, the vector may be selected from one or more of plasmids, retroviral vectors, and lentiviral vectors. The vector may also contain other genes, such as marker genes that allow selection of the vector in appropriate host cells and under appropriate conditions. Furthermore, the vector may also contain expression control elements that allow the coding region to be correctly expressed in an appropriate host. Such control elements are well known to those skilled in the art and may include, for example, promoters, ribosome binding sites, enhancers, and other control elements regulating gene transcription or mRNA translation. In some embodiments, the expression control sequence is a tunable element. The specific structure of the expression control sequence may vary depending on the species or cell type and function, but typically includes 5' non-transcriptional sequences and 5' and 3' non-translational sequences, respectively, involved in transcription and translation initiation, such as TATA boxes, capping sequences, CAAT sequences, etc. For example, the 5' non-transcriptional expression control sequence may contain a promoter region, which may contain a promoter sequence for transcriptionally controlling the functional linker nucleic acid. One or more nucleic acid molecules described in this application can be operatively linked to the expression control element.
[0229] Non-viral methods for nucleic acid delivery include lipid transfection, nuclear transfection, microinjection, gene guns, viral particles, liposomes, immunoliposomes, polycationic or lipid-nucleic acid conjugates, naked DNA, artificial virions, and reagents that enhance DNA uptake. Nucleic acids can be delivered using RNA or DNA virus-based systems, for example, by utilizing the ability of viruses to target specific cells in vivo to efficiently deliver viral payloads into the cell nucleus. Viral vectors can be administered directly to patients (in vivo) or indirectly, for example, by treating cells in vitro with viruses and then administering the treated cells to patients (ex vivo). Conventional virus-based systems can include retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, and herpes simplex virus vectors for gene transfer. In some cases, retroviral, lentiviral, and adeno-associated virus methods can be used to integrate genes into the host genome, enabling long-term expression of the inserted genes. Lentiviral vectors are retroviral vectors capable of transducing or infecting non-dividing cells and typically producing high viral titers. The lentiviral vector may contain a long terminal repeat (5'LTR) and a truncated 3'LTR, an RRE, a rev response element (cPPT), a central termination sequence (CTS), and / or a post-translational regulatory element (WPRE). The molecule can be constructed onto the lentiviral vector via BamHI and SalI digestion.
[0230] On the other hand, this application provides a pharmaceutical composition. The pharmaceutical composition may comprise the modified immune cells described in this application, and a pharmaceutically acceptable carrier. In this application, the term "pharmaceutically acceptable adjuvant" generally refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and absorption delay agents that are compatible with the immune cells and / or cell populations of this application. Unless incompatible with the immune cells and / or cell populations of this application, any conventional media or reagents may be considered for use in the pharmaceutical composition of this application.
[0231] The pharmaceutical composition described in this application may include an antibody. The antibody may be present in the same or different containers as the modified immune cells. The antibody may be administered before, during, or after administration of the modified immune cells. For example, the antibody may be a bispecific antibody. The bispecific antibody may bind to two targets simultaneously; the two targets may be the same target protein or different target proteins. A T-cell adaptor is a relatively special type of bispecific antibody. A T-cell adaptor may include two linked scFvs, one end targeting CD3 on the surface of T cells, and the other end targeting a receptor on the surface of target cells (e.g., tumor cells), thereby mediating T-cell killing of tumor cells. Receptors on the surface of target cells may include, but are not limited to, CD19, CD2, CD3, CD4, CD5, CD7, CD8, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD38, CD40, CD44V6, CD47, CD52, CD56, CD57, CD58, CD79b, CD80, CD86, CD81, CD123, CD133, CD137, CD151, CD171, CD276, CLL1, B7H4, BCMA, VEGFR-2, EGFR, GPC3, PMSA, CEACAM6, c-Met, EGFRvIII, ErbB2 / HER2, ErbB3, HER-2, HER3, ErbB4 / HER-4, EphA2, IGF1R, GD2, O-acetyl GD2, O- AcetylGD3, GHRHR, GHR, Flt1, KDR, Flt4, Flt3, CEA, CA125, CTLA-4, GITR, BTLA, TGFBR1, TGFBR2, TGFBR1, IL6R, gp130, Lewis, TNFR1, TNFR2, PD1, PD-L1, PD-L2, PSCA, HVEM, MAGE-A, MSLN, NY- ESO-1, PSMA, RANK, RORl, TNFRSF4, TWEAK-R, LTPR, LIFRP, LRP5, MUC1, MUC16, TCRα, TCRβ, TLR7, TLR9, PTCH1, WT-1, Robol, Frizzled, OX40, Notch-1-4, APRIL, CS1, MAGE3, Claudin 18.2, folate receptor α, folate receptor β, GPC2, CD70, BAFF-R and TROP-2.
[0232] The basic principle of this combination therapy is that bispecific antibodies are responsible for finding the target and guiding T cells to the target cells, while the modified immune cells are responsible for the powerful killing of the target cells. In primary T cells, the TCR is not knocked out, and the bispecific antibodies can mediate the killing of target cells by control T cells through the naturally expressed TCR-CD3 complex. Figure 1 As shown, in universal CD3 antibody receptor T cells, the CD3 antibody receptor is expressed on the surface of the modified immune cells. The bispecific antibody can simultaneously activate co-activation signals and CD3 zeta activation signals via the CD3 antibody receptor, promoting tumor cell killing and T cell proliferation. The advantage of combined use is that cell therapy can be combined with bispecific antibodies for multiple targets, and it is easy to regulate, making the therapy safer. In some cases, the bispecific antibody may be derived from the modified immune cells described in this application. For example, the bispecific antibody may include bispecific antibodies secreted by the modified immune cells themselves as described in this application.
[0233] This application can be applied not only to general T cells but also to other killer cells lacking a TCR structure, such as NK cells, or phagocytes, such as macrophages. Currently, relapse after CAR-T cell therapy includes target protein-negative relapse and target protein-positive relapse. Target protein-positive relapse is mainly caused by CAR-T cell exhaustion after infusion. This therapy allows for the continuous use of bispecific antibodies after cell regression, utilizing chimeric antibody receptor T cells and the body's own T cells to suppress tumor relapse. For patients with advanced disease and poor physical condition, flexible adjustments can be made to achieve good therapeutic effects while ensuring safety, thus expanding the applicability to these patients.
[0234] Methods and uses
[0235] On the other hand, this application also provides the use of the modified immune cells and / or the pharmaceutical composition in the preparation of a medicament for treating tumors.
[0236] On the other hand, this application also provides a method for treating tumors, the method comprising administering the modified immune cells and the pharmaceutical composition to a subject in need.
[0237] The subjects first undergo chemotherapy pretreatment, then receive modified lymphocytes and bispecific antibodies intravenously, either simultaneously or sequentially. Taking cell infusion first as an example, bispecific antibodies are then administered at different doses after the cells are infused. If adverse reactions occur, the bispecific antibody dosage is adjusted. The infusion of modified lymphocytes and bispecific antibodies can be repeated until remission or severe adverse reactions occur. The modified lymphocytes of this application, when combined with bispecific antibodies, can kill cancer cells, such as hematological malignancies and solid tumors.
[0238] In this application, the tumor may include non-solid tumors, including but not limited to leukemia, lymphoma, and / or multiple myeloma, as well as solid tumors, including but not limited to lung cancer, gastric cancer, esophageal cancer, colon cancer, breast cancer, ovarian cancer, bladder cancer, renal cell carcinoma, prostate cancer, melanoma, head and neck tumors, glioma, and soft tissue sarcoma.
[0239] For example, the tumor may include lymphoma.
[0240] The embodiments described below are not intended to be limited by any theory, but are merely for illustrating the fusion protein, preparation method and use of this application, and are not intended to limit the scope of the invention.
[0241] Example
[0242] Example 1: Design of CD3 antibody receptor complex molecule and construction of plasmid
[0243] (1) Designing molecules
[0244] Gene sequence information was obtained from the NCBI website database (https: / / www.ncbi.nlm.nih.gov / ) (Table 1). A gene encoding the CD3 antibody receptor complex, CG-UST-1 (SEQ ID NO.13), was designed. CG-UST-1 consists of two parts, representing the tandem of two CD3 recombinant protein genes. The first CD3 recombinant protein contains the CD3 epsilon extracellular domain, CD28 transmembrane domain, CD28 intracellular domain, and CD3 zeta intracellular domain (SEQ ID NO:10). The second CD3 recombinant protein contains the CD3 gamma extracellular domain, CD28 transmembrane domain, and CD3 gamma intracellular domain (SEQ ID NO:11). The two CD3 recombinant proteins are linked by the T2A gene (SEQ ID NO.16).
[0245] The CD3 gamma intracellular domain of the gene encoding the second CD3 recombinant protein in CG-UST-1 was replaced with a gene encoding a short peptide, resulting in CG-UST-2 (SEQ ID NO:14), which encodes the second CD3 recombinant protein (SEQ ID NO:12). Simultaneously, the nucleic acid molecule CG-UST-3 (SEQ ID NO:15), representing the first CD3 recombinant protein of CG-UST-1, was designed. A flag tag was added to the gene sequence for easy detection.
[0246] (2) Construction of plasmids
[0247] The CG-UST-1 gene sequence was synthesized by GenScript Biotech (Nanjing) and cloned into the pUC57 vector (Nanjing GenScript). During gene synthesis, specific restriction endonuclease sites, BamH1 and Sal1, were added to both ends of the gene. The recombinant plasmid was double-digested with restriction endonucleases BamH1 (NEB; R3136S) and Sal1 (NEB; R3138S). Gene fragments were separated by agarose gel electrophoresis and purified using gel extraction (QIAGEN; 28706). The concentration of the recovered gene fragments was determined. The synthesized gene sequence was ligated to the BamH1-Sal1 site of the lentiviral vector (Addgene; catalog number: 12252) using T4 DNA ligase (NEB; M0202S). The cloned lentiviral vector was named pL-CG-UST-1. After cloning, the lentiviral vector plasmids were sequenced for verification. The sequencing primers for the recombinant plasmids were: Lenti-For (TCAAGCCTCAGACAGTGGTTC; SEQ ID NO:17) and Lenti-Rev (CCTCATAAAGAGACAGCAACCAGG; SEQ ID NO:18). The plasmids CG-UST-2 and CG-UST-3 were constructed using the same procedure. The constructed lentiviral vector plasmids were named pL-CG-UST-2 and pL-CG-UST-3, respectively.
[0248] Example 2: Preparation of Lentiviral Virus
[0249] (1) Plasmid extraction
[0250] The constructed lentiviral vector plasmid was re-transformed into *E. coli*. Single colonies were picked from the transformed plate and transferred to 3 ml of liquid LB medium containing ampicillin, and cultured at 220 rpm for 8 h. 500 μl of the activated bacterial culture was then inoculated into 250 ml of liquid LB medium containing ampicillin, and cultured at 220 rpm for 12–16 h. Plasmid extraction was performed using the Qiagen HiSpeed Plasmid Maxi Kit (catalog number: 12662) according to the kit's instructions. After plasmid extraction, plasmid concentration was detected using Nanodrop (Thermo Fisher Scientific), and the supercoiled plasmid content was determined using DNA agarose gel electrophoresis.
[0251] (2) Culture 293T cells
[0252] After removing the cryopreserved 293T cells (ATCC) from liquid nitrogen, continuously agitate them in a 37°C water bath to promote thawing. Transfer them to a 15ml centrifuge tube containing 10ml of preheated DMEM complete medium, and gently mix. Centrifuge at 1000rpm for 3 minutes, discard the supernatant. Add 10ml of DMEM complete medium, gently mix, and seed into 10cm dishes. Incubate at 37°C in a cell culture incubator containing 5% CO2. When the cell density reaches 80%-90%, discard the medium and wash once with 10ml of PBS. Add 3ml of trypsin containing 0.25% EDTA and incubate for 1-2 minutes (during which time remove the cells and observe under a microscope to see if they become rounded). After the cells become rounded, add 1ml of DMEM complete medium to stop trypsin digestion, transfer to a 15ml centrifuge tube, centrifuge at 1000rpm for 3 minutes, and discard the supernatant. Depending on experimental needs, passage at a ratio of 1:3 or 1:5, seed into new 10cm dishes, or cryopreserve.
[0253] (3) Transfect 293T cells and harvest lentivirus.
[0254] 1) On day 1, 293 T cells were inoculated at approximately 15-16 × 10⁻⁶. 6 Seed cells at 175 bottles per T175 (35-40ml culture medium).
[0255] 2) Day 2, plasmid transfection: Before transfection, the culture medium needs to be changed to a medium with 10% FBS but without antibiotics. First, prepare the plasmid complex: Add the following plasmids to 1.5 ml of Opti-MEM (Thermo Fisher Scientific; 31985-070) and mix well. Viral vector plasmid: 18 μg, psPAX2 plasmid (Addgene; catalog number: 12260): 9 μg, pMD2.G plasmid (Addgene; catalog number: 12259): 18 μg. Next, prepare the transfection reagent complex: Add 100 μl of Lipofectamine 2000 (Invitrogen; 11668-019) to 1.5 ml of Opti-MEM, mix well, and let stand at room temperature for 5 min; then add the plasmid complex to the transfection reagent complex, mix well, and let stand for 25 min; finally, add the transfection complex to the cell culture medium and gently shake well.
[0256] 3) On day 4, harvest the virus: Collect the cell supernatant, centrifuge at 2000 rpm for 10 min; filter the supernatant using a 0.45 μm filter membrane, transfer the filtrate to a dedicated centrifuge tube, and balance; centrifuge at 20000 rpm for 2-3 h; discard the supernatant, resuspend the lentivirus in serum-free medium, aliquot the lentivirus, and store at -80℃. Prepare lentiviruses containing CG-UST-1, CG-UST-2, and CG-UST-3 according to this procedure.
[0257] Example 3: Preparation of universal T cells expressing CD3 antibody receptor complex
[0258] Peripheral blood cells (PBMCs) from healthy donors were isolated using an apheresis machine (purchased from Miaotong Biotechnology). PBMCs were diluted to 2 × 10⁶ cells. T cells were activated using CD3 / CD28 magnetic beads (Thermo Fisher Scientific) at a cell-to-bead ratio of 1:3, with the addition of IL-2 (PeproTech; 200-02). On day 3 post-activation, concentrated lentivirus was added to T cell culture flasks for transfection. On day 5 post-activation, TCR and B2M were knocked out in T cells using CRISPR / Cas9 to construct universal T cells. The gRNA sequence and procedure used were performed according to Example 3 of patent WO2019 / 011118.
[0259] Example 4: Detection of CD3 antibody receptor expression in cells
[0260] The expression of the CD3 antibody receptor complex in cells was detected by fluorescent antibody staining and flow cytometry. The basic steps were as follows: A certain volume of cultured modified T cells was collected by centrifugation, and the cells were stained with Flag antibody (BioLegend; 637309) and APC-TCR antibody (BioLegend; 306718). The cells were incubated in the dark for 30 min, washed once with PBS, and resuspended in an appropriate volume of PBS. Finally, the expression of the CD3 antibody receptor complex in T cells and in TCR-negative cells was detected by flow cytometry.
[0261] The staining results of Flag antibody and APC-TCR antibody are as follows: Figure 2As shown. In the untransfected control group, the TCR positivity rate was 95.09% when TCR was not knocked out; after TCR knockout, the TCR positivity rate was 1.95%, indicating a high knockout efficiency. In the TCR non-knockout group, the expression efficiencies of the CD3 antibody receptor complex were: CG-UST-1: 27.21%, CG-UST-2: 25.41%, and CG-UST-3: 68.88%. In the TCR knockout group, the expression efficiencies of the CD3 antibody receptor complex in TCR-negative T cells were: CG-UST-1: 30.2%, CG-UST-2: 25.0%, and CG-UST-3: 65.6%. Figure 2 In the knockout group, the expression efficiency was similar to that of the corresponding non-knockout group, therefore the CD3 antibody receptor complex could be independently expressed in human T cells in a TCR-independent manner.
[0262] T cells expressing CD3 antibody receptors were stained with different CD3 antibodies: UCHT1 (BD Biosciences; 555335), HIT3a (BD Biosciences; 561804), SP34-2 (BD Biosciences; 552127), and OKT3 (BD Biosciences; 566686), and analyzed by flow cytometry. The results are shown below. Figures 3-6 As shown in the image. The results indicate that T cells expressing CG-UST-1 and CG-UST-2 can be recognized by the common CD3 antibody clone UCHT1. Figure 3 As shown, in the TCR knockout group, 22.0% and 19.9% of TCR-negative T cells in the CG-UST-1 and CG-UST-2 groups, respectively, were recognized by UCHT1. Using the same staining and analysis methods, it was found that T cells expressing CG-UST-1 and CG-UST-2 could be recognized by the CD3 antibody HIT3a clone (see...). Figure 4 However, it cannot be recognized by clone SP34-2 (see...). Figure 5 Further simultaneous staining of cells with SP34-2 and OKT3 antibodies revealed that these cells could be recognized by the OKT3 antibody (see...). Figure 6 However, T cells expressing CG-UST-3 containing the CD3 epsilon extracellular domain alone cannot be recognized by common CD3 antibody clones (see [link]). Figures 3-6 ).
[0263] Therefore, CD3 antibody receptors can be expressed in TCR-knockout primary T cells in a TCR-independent manner. T cells co-expressing the CD3 antibody receptor complex with the extracellular domains of CD3 epsilon and CD3 gamma can be recognized by conventional CD3 antibodies, including CD3 antibodies UCHT1, HIT3a, and OKT3.
[0264] Example 5: CD3 antibody OKT3 activates universal CD3 antibody receptor T cells
[0265] (1) Coating plates. Dilute the OKT3 antibody with PBS to a concentration of 0.25 μg / ml. Add 100 μl of the diluted antibody to each well of a 96-well plate and incubate at 37°C for 3 hours. After incubation, wash the plates with 1×PBS to remove the PBS.
[0266] (2) Activation of T cells. The T cell density of different groups was adjusted to 1×10⁶. 6 / ml. Then seed the cells into the plate at 100μl per well and incubate at 37°C for 24 hours.
[0267] (3) Detection of T cell activation. After cell incubation, a certain volume of cells was taken and stained with CD137 fluorescent antibody (BD Biosciences; 555956) and TCR antibody (Biolegend; 306718). Flow cytometry was used to detect the expression of the activation tag CD137 protein in TCR knockout T cells. In T cells expressing CD3 antibody receptors CG-UST-1 and CG-UST-2, the percentages of TCR-negative and CD137-positive cells were 7.01% and 4.05%, respectively. (See...) Figure 7 This indicates that the coated CD3 antibody can activate universal CD3 antibody receptor T cells.
[0268] (4) Detection of cytokine secretion. The supernatant from the cells was transferred to a new 96-well plate, and the secretion of IFN-γ cytokines by T cells was detected using an ELISA kit (Thermo Fisher Scientific; catalog number 88-7316). Plate preparation and cytokine detection in the supernatant were performed according to the procedures provided in the kit.
[0269] The results showed that OKT3 antibody stimulated universal antibody receptor T cells expressing CG-UST-1 and CG-UST-2 to secrete 341.28 and 248.76 pg / ml of IFN-γ, respectively, as shown in Table 1. Therefore, coated CD3 antibody can stimulate universal T cells expressing CD3 antibody receptor complexes CG-UST-1 and CG-UST-2 to secrete the cytokine IFN-γ.
[0270] Table 1. OKT3 antibody stimulation of universal CD3 antibody receptor T cells to secrete IFN-γ cytokine (pg / ml)
[0271] control group CG-UST-1 CG-UST-2 CG-UST-3 No antibodies -64.32 -60.24 -61.68 -53.52 Add antibodies 6.48 341.28 248.76 -6.6
[0272] Example 6: Universal CD3 antibody receptor complex T cells combined with anti-CD3 and anti-CD19 bispecific antibodies kill tumor cells.
[0273] The anti-CD3 and anti-CD19 bispecific antibody was purchased from Invivogen (catalog number: bimab-hcd19cd3). This bispecific antibody can simultaneously bind to CD3 epsilon and CD19, mediating T cell killing of target cells expressing CD19. The CD3 antibody clone number used in this bispecific antibody is L2K-07.
[0274] (1) Cell co-culture.
[0275] First, co-culture of cells was performed. The steps were as follows: the concentration of T cells in different groups was adjusted to 1×10⁻⁶. 6 / ml, then seed T cells at 100μl per well into 96-well plates. The seeded T cells were temporarily incubated at 37℃; the concentration of CD19-expressing Raji cells (Chinese Academy of Sciences Cell Bank) was adjusted to 1×10⁶. 6 Raji cells were seeded at a concentration of 100 μl per well into 96-well plates containing T cells. The final T cell to tumor cell ratio was 1:1. Anti-CD3 and anti-CD19 bispecific antibodies were added to the cells. The final concentration of the antibodies was 50 ng / ml. After thorough mixing, the cells were centrifuged at 500 rpm for 3 minutes. The cells were then incubated at 37°C for 24 hours.
[0276] (2) CD137 expression detection.
[0277] A certain volume of cells was collected and stained with CD19 antibody (eBioscience, 11-0199-42), CD137 fluorescent antibody, and TCR antibody, and then detected by flow cytometry. CD19-negative cells were identified as T cells. By detecting the cell membrane activation tag CD137, it was found that Raji cells supplemented with these two antibodies could activate universal T cells expressing CD3 antibody receptors CG-UST-1 and CG-UST-2. (See...) Figure 8 In TCR-negative T cells, the CD137 positivity rates for the two groups were 7.15% and 6.47%, respectively.
[0278] (3) Detection of cytokine secretion.
[0279] After incubation, the supernatant was collected and subjected to ELISA experiments as in Example 5. The results showed that the anti-CD3 and anti-CD19 bispecific antibodies could mediate the secretion of the cytokine IFN-γ by universal CD3 antibody receptor T cells (see Table 2). In the case of TCR knockout, the bispecific antibodies combined with tumor cells stimulated universal antibody receptor T cells expressing CG-UST-1 and CG-UST-2 to secrete 287.639 and 286.512 pg / ml of IFN-γ, respectively.
[0280] Table 2. Dual antibody-mediated stimulation of universal CD3 chimeric antibody receptor T cells by tumor cells to secrete IFN-γ cytokine (pg / ml)
[0281] control group CG-UST-1 CG-UST-2 CG-UST-3 No dual resistance -32.478 -18.807 -28.117 -6.018 Add dual resistance 50.773 287.639 286.512 195.127
[0282] (4) CD107a expression detection.
[0283] 1) Take a 96-well plate and add 2 × 10⁶ T cells and 2 × 10⁶ target cells to each well. 5 After centrifugation, the precipitate was resuspended in 100 μl of RPMI-1640 complete medium, and anti-CD3 and anti-CD19 bispecific antibodies were added to the cells. The final concentration of the bispecific antibodies was 50 ng / ml. CD107a-PE antibody (BD Biosciences; 555801) was added to each well at a ratio of 1:50, and incubated for one hour. Then, BD GolgiStop (BD Biosciences; 554724) diluted 1:30,000 was added, and the cells were incubated at 37°C for 2.5 hours.
[0284] 2) Centrifuge the sample to remove the culture medium, wash the cells once with serum-free culture medium, and centrifuge at 1600 rpm for 6 minutes. Discard the supernatant, resuspend the cells in 100 μl of water. Add an appropriate amount of CD3 antibody UCHT1 to each tube and incubate at 4°C in the dark for 30 minutes.
[0285] 3) Wash each tube of cells once with PBS, then centrifuge at 1600 rpm for 5 minutes. Carefully aspirate the supernatant;
[0286] 4) Add an appropriate amount of PBS to resuspend the cells, and detect the expression level of CD107a by flow cytometry.
[0287] The results showed that universal antibody receptor T cells expressing CG-UST-1 and CG-UST-2 could be recognized by UCHT1, and that anti-CD3 and anti-CD19 bispecific antibodies could mediate the release of cytotoxic granules from universal antibody receptor T cells (see...). Figure 9After stimulation with bispecific antibodies and tumor cells, 9.49% and 10.75% of universal CD3 antibody receptor T cells expressing CG-UST-1 and CG-UST-2, respectively, expressed CD107a. Therefore, universal CD3 antibody receptor T cells can be used in combination with bispecific antibodies to kill tumor cells. sequence list <110> Suzhou Kerui Gene Biotechnology Co., Ltd. <120> An immune cell expressing a CD3 antibody receptor complex and its uses <130> 0141-PA-009CN <160> 19 <170> PatentIn version 3.5 <210> 1 <211> 104 <212> PRT <213> Homo sapiens <400> 1 Asp Gly Asn Glu Glu Met Gly Gly Ile Thr Gln Thr Pro Tyr Lys Val 1 5 10 15 Ser Ile Ser Gly Thr Thr Val Ile Leu Thr Cys Pro Gln Tyr Pro Gly 20 25 30 Ser Glu Ile Leu Trp Gln His Asn Asp Lys Asn Ile Gly Gly Asp Glu 35 40 45 Asp Asp Lys Asn Ile Gly Ser Asp Glu Asp His Leu Ser Leu Lys Glu 50 55 60 Phe Ser Glu Leu Glu Gln Ser Gly Tyr Tyr Val Cys Tyr Pro Arg Gly 65 70 75 80 Ser Lys Pro Glu Asp Ala Asn Phe Tyr Leu Tyr Leu Arg Ala Arg Val 85 90 95 Cys Glu Asn Cys Met Glu Met Asp 100 <210> 2 <211> 94 <212> PRT <213> Homo sapiens <400> 2 Gln Ser Ile Lys Gly Asn His Leu Val Lys Val Tyr Asp Tyr Gln Glu 1 5 10 15 Asp Gly Ser Val Leu Leu Thr Cys Asp Ala Glu Ala Lys Asn Ile Thr 20 25 30 Trp Phe Lys Asp Gly Lys Met Ile Gly Phe Leu Thr Glu Asp Lys Lys 35 40 45 Lys Trp Asn Leu Gly Ser Asn Ala Lys Asp Pro Arg Gly Met Tyr Gln 50 55 60 Cys Lys Gly Ser Gln Asn Lys Ser Lys Pro Leu Gln Val Tyr Tyr Arg 65 70 75 80 Met Cys Gln Asn Cys Ile Glu Leu Asn Ala Ala Thr Ile Ser 85 90 <210> 3 <211> 45 <212> PRT <213> Homo sapiens <400> 3 Gly Gln Asp Gly Val Arg Gln Ser Arg Ala Ser Asp Lys Gln Thr Leu 1 5 10 15 Leu Pro Asn Asp Gln Leu Tyr Gln Pro Leu Lys Asp Arg Glu Asp Asp 20 25 30 Gln Tyr Ser His Leu Gln Gly Asn Gln Leu Arg Arg Asn 35 40 45 <210> 4 <211> 84 <212> PRT <213> Homo sapiens <400> 4 Phe Lys Ile Pro Ile Glu Glu Leu Glu Asp Arg Val Phe Val Asn Cys 1 5 10 15 Asn Thr Ser Ile Thr Trp Val Glu Gly Thr Val Gly Thr Leu Leu Ser 20 25 30 Asp Ile Thr Arg Leu Asp Leu Gly Lys Arg Ile Leu Asp Pro Arg Gly 35 40 45 Ile Tyr Arg Cys Asn Gly Thr Asp Ile Tyr Lys Asp Lys Glu Ser Thr 50 55 60 Val Gln Val His Tyr Arg Met Cys Gln Ser Cys Val Glu Leu Asp Pro 65 70 75 80 Ala Thr Val Ala <210> 5 <211> 45 <212> PRT <213> Homo sapiens <400> 5 Gly His Glu Thr Gly Arg Leu Ser Gly Ala Ala Asp Thr Gln Ala Leu 1 5 10 15 Leu Arg Asn Asp Gln Val Tyr Gln Pro Leu Arg Asp Arg Asp Asp Ala 20 25 30 Gln Tyr Ser His Leu Gly Gly Asn Trp Ala Arg Asn Lys 35 40 45 <210> 6 <211> 42 <212> PRT <213> Homo sapiens <400> 6 Ala Ala Ala Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu 1 5 10 15 Lys Ser Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro 20 25 30 Ser Pro Leu Phe Pro Gly Pro Ser Lys Pro 35 40 <210> 7 <211> 27 <212> PRT <213> Homo sapiens <400> 7 Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu 1 5 10 15 Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val 20 25 <210> 8 <211> 41 <212> PRT <213> Homo sapiens <400> 8 Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr 1 5 10 15 Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro 20 25 30 Pro Arg Asp Phe Ala Ala Tyr Arg Ser 35 40 <210> 9 <211> 113 <212> PRT <213> Homo sapiens <400> 9 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly 1 5 10 15 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln 50 55 60 Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu 65 70 75 80 Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr 85 90 95 Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro 100 105 110 Arg <210> 10 <211> 284 <212> PRT <213> Artificial Sequence <220> <223> The first CD3 recombinant protein (CD3 epsilon extracellular domain + CD28 transmembrane domain + CD28 intracellular domain + CD3 zeta intracellular domain) <400> 10 Asp Gly Asn Glu Glu Met Gly Gly Ile Thr Gln Thr Pro Tyr Lys Val 1 5 10 15 Ser Ile Ser Gly Thr Thr Val Ile Leu Thr Cys Pro Gln Tyr Pro Gly 20 25 30 Ser Glu Ile Leu Trp Gln His Asn Asp Lys Asn Ile Gly Gly Asp Glu 35 40 45 Asp Asp Lys Asn Ile Gly Ser Asp Glu Asp His Leu Ser Leu Lys Glu 50 55 60 Phe Ser Glu Leu Glu Gln Ser Gly Tyr Tyr Val Cys Tyr Pro Arg Gly 65 70 75 80 Ser Lys Pro Glu Asp Ala Asn Phe Tyr Leu Tyr Leu Arg Ala Arg Val 85 90 95 Cys Glu Asn Cys Met Glu Met Asp Phe Trp Val Leu Val Val Val Gly 100 105 110 Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile 115 120 125 Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met 130 135 140 Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro 145 150 155 160 Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Arg Val Lys Phe 165 170 175 Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu 180 185 190 Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp 195 200 205 Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys 210 215 220 Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala 225 230 235 240 Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys 245 250 255 Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr 260 265 270 Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 275 280 <210> 11 <211> 166 <212> PRT <213> Artificial Sequence <220> <223> Second CD3 recombinant protein 1 (CD3 gamma extracellular domain + CD28 transmembrane domain + CD3 gamma intracellular domain) <400> 11 Gln Ser Ile Lys Gly Asn His Leu Val Lys Val Tyr Asp Tyr Gln Glu 1 5 10 15 Asp Gly Ser Val Leu Leu Thr Cys Asp Ala Glu Ala Lys Asn Ile Thr 20 25 30 Trp Phe Lys Asp Gly Lys Met Ile Gly Phe Leu Thr Glu Asp Lys Lys 35 40 45 Lys Trp Asn Leu Gly Ser Asn Ala Lys Asp Pro Arg Gly Met Tyr Gln 50 55 60 Cys Lys Gly Ser Gln Asn Lys Ser Lys Pro Leu Gln Val Tyr Tyr Arg 65 70 75 80 Met Cys Gln Asn Cys Ile Glu Leu Asn Ala Ala Thr Ile Ser Phe Trp 85 90 95 Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val 100 105 110 Thr Val Ala Phe Ile Ile Phe Trp Val Gly Gln Asp Gly Val Arg Gln 115 120 125 Ser Arg Ala Ser Asp Lys Gln Thr Leu Leu Pro Asn Asp Gln Leu Tyr 130 135 140 Gln Pro Leu Lys Asp Arg Glu Asp Asp Gln Tyr Ser His Leu Gln Gly 145 150 155 160 Asn Gln Leu Arg Arg Asn 165 <210> 12 <211> 129 <212> PRT <213> Artificial Sequence <220> <223> Second CD3 recombinant protein 2 (CD3 gamma extracellular domain + CD28 transmembrane region + short peptide) <400> 12 Gln Ser Ile Lys Gly Asn His Leu Val Lys Val Tyr Asp Tyr Gln Glu 1 5 10 15 Asp Gly Ser Val Leu Leu Thr Cys Asp Ala Glu Ala Lys Asn Ile Thr 20 25 30 Trp Phe Lys Asp Gly Lys Met Ile Gly Phe Leu Thr Glu Asp Lys Lys 35 40 45 Lys Trp Asn Leu Gly Ser Asn Ala Lys Asp Pro Arg Gly Met Tyr Gln 50 55 60 Cys Lys Gly Ser Gln Asn Lys Ser Lys Pro Leu Gln Val Tyr Tyr Arg 65 70 75 80 Met Cys Gln Asn Cys Ile Glu Leu Asn Ala Ala Thr Ile Ser Phe Trp 85 90 95 Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val 100 105 110 Thr Val Ala Phe Ile Ile Phe Trp Val Gly Gln Asp Gly Val Arg Gln 115 120 125 Ser <210> 13 <211> 1590 <212> DNA <213> Artificial Sequence <220> <223> CG‑UST‑1 <400> 13 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccggatggta atgaagaaat gggtggtatt acacagacac catataaagt ctccatctct 120 ggaaccacag taatattgac atgccctcag tatcctggat ctgaaatact atggcaacac 180 aatgataaaa acataggcgg tgatgaggat gataaaaaca taggcagtga tgaggatcac 240 ctgtcactga aggaattttc agaattggag caaagtggtt attatgtctg ctaccccaga 300 ggaagcaaac cagaagatgc gaacttttat ctctacctga gggcaagagt gtgtgagaac 360 tgcatggaga tggatttttg ggtgctggtg gtggttgggg gagtcctggc ttgctatagc 420 ttgctagtaa cagtggcctt tattattttc tgggtgagga gtaagaggag caggctcctg 480 cacagtgact acatgaacat gactccccgc cgccccgggc ccacccgcaa gcattaccag 540 ccctatgccc caccacgcga cttcgcagcc tatcgctcca gagtgaagtt cagcaggagc 600 gcagacgccc ccgcgtacca gcagggccag aaccagctct ataacgagct caatctagga 660 cgaagagagg agtacgatgt tttggacaag agacgtggcc gggaccctga gatgggggga 720 aagccgagaa ggaagaaccc tcaggaaggc ctgtacaatg aactgcagaa agataagatg 780 gcggaggcct acagtgagat tgggatgaaa ggcgagcgcc ggaggggcaa ggggcacgat 840 ggcctttacc agggtctcag tacagccacc aaggacacct acgacgccct tcacatgcag 900 gccctgcccc ctcgcggcag cggagagggc agaggaagtc ttctaacatg cggtgacgtg 960 gaggagaatc ccggccctag gatgcttctc ctggtgacaa gccttctgct ctgtgagtta 1020 ccacacccag cattcctcct gatcccaggc ggcagcgact acaaagacga tgacgacaag 1080 ggtggctccc agtcaatcaa aggaaaccac ttggttaagg tgtatgacta tcaagaagat 1140 ggttcggtac ttctgacttg tgatgcagaa gccaaaaata tcacatggtt taaagatggg 1200 aagatgatcg gcttcctaac tgaagataaa aaaaaatgga atctgggaag taatgccaag 1260 gaccctcgag ggatgtatca gtgtaaagga tcacagaaca agtcaaaacc actccaagtg 1320 tattacagaa tgtgtcagaa ctgcattgaa ctaaatgcag ccaccatatc tttttgggtc 1380 cttgtcgttg tcgggggcgt cttggcgtgt tatagcctcc tcgtcaccgt agcattcatt 1440 atattctggg tgggacagga tggagttcgc cagtcgagag cttcagacaa gcagactctg 1500 ttgcccaatg accagctcta ccagcccctc aaggatcgag aagatgacca gtacagccac 1560 cttcaaggaa accagttgag gaggaattga 1590 <210> 14 <211> 1479 <212> DNA <213> Artificial Sequence <220> <223> CG‑UST‑2 <400> 14 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccggatggta atgaagaaat gggtggtatt acacagacac catataaagt ctccatctct 120 ggaaccacag tatattgac atgccctcag tatcctggat ctgaaatact atggcaacac 180 aatgataaaa acataggcgg tgatgaggat gataaaaaca taggcagtga tgaggatcac 240 ctgtcactga aggaattttc agaattggag caaagtggtt attatgtctg ctaccccaga 300 ggaagcaaac cagaagatgc gaacttttat cctacctga gggcaagagt gtgtgagaac 360 tgcatggaga tggattttg ggtgctggtg gtggttgggg gagtcctggc ttgctatagc 420 ttgctagtaa cagtggcctt tattattttc tgggtgagga gtaagaggag caggctcctg 480 cacagtgact acatgaacat gactccccgc cgccccgggc ccacccgcaa gcattaccag 540 ccctatgcc caccacgcga cttcgcagcc tatcgctcca gagtgaagtt cagcaggagc 600 gcagacgccc ccgcgtacca gcagggccag aaccagctct ataacgagct caatctagga 660 cgaagagagg agtacgatgt tttggacaag agacgtggcc gggaccctga gatgggggga 720 aagccgagaa ggaagaaccc tcaggaggc ctgtacaatg aactgcagaa agatagatg 780 gcggaggcct acagtgagat tgggatgaa ggcgagcgcc ggaggggca ggggcacgat 840 ggcctttacc agggtctcag tacacccc aaggacacct acgaccccct tcacacgcag 900 gccctgcccc ctcgcggcag cggaggggc agaggaagtc ttctaacatg cggtgacgtg 960 gaggagaatc ccggccctag gatgctctc ctggtgacaa gccttctgct ctgtgagtta 1020 catcacccag cattccctcct gatcccaggc ggcagcgact ashaagacga tgacgacag 1080 ggtggctccc agtcaatca aggaaccac tggttaagg tgtatgacta tcaagagat 1140 ggttcggtac ttctgacttg tgatgcagaa gccaaaaata tcacatggtt taagatggg 1200 aagatgatcg gcttcctaac tgaagataa aaaaaatgga atctgggaag taatgccaag 1260 gaccctcgag ggatgtatca gtgtaagga tcacagaaca agtcaaacc actccaagtg 1320 tattacagaa tgtgtcagaa ctgcattgaa ctaaatgcag ccaccatatc ttttgggtc 1380 cttgtcgttg tcgggggt cttggcgtgt tatagcctcc tcgtcaccgt agcattcatt 1440 atattctggg tgggacagga tggagttcgc cagtcgtga 1479 <210> 15 <211> 960 <212> DNA <213> Artificial Sequence <220> <223> CG‐UST‐3 <400> 15 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccgggcggca gcgactacaa agacgatgac gacaagggtg gctccgatgg taatgaagaa 120 atgggtggta ttacacagac accatataaa gtctccatct ctggaaccac agtaatattg 180 acatgccctc agtatcctgg atctgaaata ctatggcaac acaatgataa aaacataggc 240 ggtgatgagg atgataaaaa cataggcagt gatgaggatc acctgtcact gaaggaattt 300 tcagaattgg agcaaagtgg ttattatgtc tgctacccca gaggaagcaa accagaagat 360 gcgaactttt atctctacct gagggcaaga gtgtgtgaga actgcatgga gatggatttt 420 tgggtgctgg tggtggttgg gggagtcctg gcttgctata gcttgctagt aacagtggcc 480 tttattattt tctgggtgag gagtaagagg agcaggctcc tgcacagtga ctacatgaac 540 atgactcccc gccgccccgg gcccacccgc aagcattacc agccctatgc cccaccacgc 600 gactcgcag cctatcgctc cagagtgaag ttcagcagga gcgcagacgc cccgcgtac 660 cagcagggcc agaaccagct ctataacgag ctcaatctag gacgaagaga ggagtacgat 720 gttttggaca agagacgtgg ccgggaccct gagatggggg gaaagccgag aaggaagaac 780 cctcaggaag gcctgtacaa tgaactgcag aaagataaga tggcggaggc ctacagtgag 840 attgggatga aaggcgagcg ccggaggggc aaggggcacg atggccttta ccagggtctc 900 agtacagcca ccaaggacac ctacgacgcc cttcacatgc aggccctgcc ccctcgctga 960 <210> 16 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> T2A <400> 16 ggcagcggag agggcagagg aagtcttcta acatgcggtg acgtggagga gaatcccggc 60 cctagg 66 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Slow‐Strong <400> 17 tcaagcctca gacagtggtt c 21 <210> 18 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Lenti-Rev <400> 18 cctcataaag agacagcaac cagg 24 <210> 19 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> short peptides <400> 19 Gly Gln Asp Gly Val Arg Gln Ser 1 5
Claims
1. An engineered immune cell comprising a CD3 antibody receptor complex, the CD3 antibody receptor complex consisting of a first CD3 recombinant protein and a second CD3 recombinant protein, wherein, The amino acid sequence of the first CD3 recombinant protein is shown as SEQ ID NO: 10, and the amino acid sequence of the second CD3 recombinant protein is shown as SEQ ID NO: 11 or 12. The engineered immune cell is a T cell, and the T cell does not express a T cell receptor and B2M.
2. The engineered immune cell of claim 1, wherein the engineered immune cell comprises a chimeric antigen receptor and / or a chimeric self-antibody receptor.
3. A pharmaceutical composition comprising the engineered immune cell of any one of claims 1-2 and a pharmaceutically acceptable adjuvant.
4. The pharmaceutical composition of claim 3, comprising an antibody.
5. The pharmaceutical composition of claim 4, wherein the antibody is capable of recognizing and / or binding the CD3 antibody receptor complex.
6. The pharmaceutical composition of claim 4, wherein the antibody comprises a bispecific antibody.
7. The pharmaceutical composition of claim 6, wherein the bispecific antibody is derived from the engineered immune cell of any one of claims 1-2.
8. The pharmaceutical composition of claim 6, wherein the bispecific antibody is capable of recognizing and / or binding CD3.
9. The pharmaceutical composition of claim 6, wherein the bispecific antibody is capable of recognizing and / or binding a receptor on the surface of a target cell.
10. The pharmaceutical composition of claim 9, wherein the target cell is a tumor cell.
11. The pharmaceutical composition of claim 9, wherein the receptor on the surface of the target cell is selected from one of the group consisting of CD2, CD3, CD4, CD5, CD7, CD8, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD38, CD40, CD44V6, CD47, CD52, CD56, CD57, CD58, CD79b, CD80, CD86, CD81, CD123, CD133, CD137, CD151, CD171, CD276, CLL1, B7H4, BCMA, VEGFR-2, EGFR, GPC3, PMSA, CEACAM6, c-Met, EGFRvIII, HER-2, HER3, HER-4, EphA2, IGF1R, GD2, O-acetylated GD2, O-acetylated GD3, GHRHR, GHR, Flt1, Flt4, Flt3, CEA, CA125, CTLA-4, GITR, BTLA, TGFBR2, TGFBR1, IL6R, gpl30, Lewis, TNFR1, TNFR2, PD1, PD-L1, PD-L2, PSCA, HVEM, MAGE-A, MSLN, NY-ESO-1, PSMA, RANK, RORl, TWEAK-R, LTPR, LIFRP, LRP5, MUC1, MUC16, TCRa, TCRp, TLR7, TLR9, PTCH1, WT-1, Robol, Frizzled receptor, OX40, Notch-1-4, APRIL, CS1, Claudin 18.2, Folate receptor a, Folate receptor b, GPC2, CD70, BAFF-R, and TROP-2.
12. A nucleic acid molecule encoding the CD3 antibody receptor complex in the engineered immune cell of any one of claims 1-2, the CD3 antibody receptor complex consisting of a first CD3 recombinant protein and a second CD3 recombinant protein, wherein, The amino acid sequence of the first CD3 recombinant protein is set forth in SEQ ID NO: 10, and the amino acid sequence of the second CD3 recombinant protein is set forth in SEQ ID NO: 11 or 12.
13. A vector comprising the nucleic acid molecule of claim 12.
14. The vector of claim 13, which is a viral vector.
15. The vector of claim 14, which is a lentiviral vector.
16. A cell comprising the nucleic acid molecule of claim 12 and / or the vector of any one of claims 13-15.
17. Use of the engineered immune cell of any one of claims 1-2 and / or the pharmaceutical composition of any one of claims 3-11 for the manufacture of a medicament for the treatment of lymphoma.
Citation Information
Patent Citations
Chimeric antigen receptors targeting b-cell maturation antigen
WO2013154760A1
BCMA chimeric antigen receptors
WO2016014789A2
Gene editing system and gene editing method
WO2019011118A1
CD3 antigen and preparation method and application thereof
CN103509122A
Binding molecules for BCMA and CD3
CN104114578A