Chimeric DNA polymerase and method for preparing the same

By combining DNA polymerase domains from different sources, a chimeric DNA polymerase was constructed, which solved the problems of fidelity and amplification speed of existing DNA polymerases in the PCR process, and improved the efficiency and effectiveness of PCR.

CN113755465BActive Publication Date: 2026-07-10WUHAN AIBO TAIKE BIOTECH CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202111114932.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-23
Publication Date
2026-07-10
Estimated Expiration
2041-09-23

AI Technical Summary

Technical Problem

Existing DNA polymerases have problems in PCR, such as low fidelity, slow amplification speed, poor tolerance to inhibitors, and limited ability to amplify long fragments.

Method used

A chimeric DNA polymerase was designed by combining the domains or segments of DNA polymerases from different sources, such as Pfu polymerase, KOD polymerase, 9°N polymerase, T4 polymerase, and phi29 polymerase, to construct a chimeric DNA polymerase with superior properties, including improved elongation properties, DNA binding properties, correction activity, and inhibitor tolerance.

Benefits of technology

It achieves higher fidelity, faster amplification speed, better inhibitor tolerance, and stronger long-fragment amplification capability, thus improving the efficiency and effectiveness of the PCR process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN113755465B_ABST
    Figure CN113755465B_ABST
Patent Text Reader

Abstract

The present application relates to chimeric DNA polymerases and methods of making the same. The chimeric DNA polymerases comprise 2-8, e.g., 3, domains or segments derived from different polymerases. The chimeric DNA polymerases of the present application have improved properties, e.g., superior extension properties, superior DNA binding properties, superior proofreading activity, superior fidelity, faster amplification speed, superior tolerance to inhibitors, superior long fragment amplification ability, etc.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of enzyme engineering, and more specifically, to chimeric polymerases, their preparation methods, and uses. Background Technology

[0002] Polymerases, also known as polymerases, are a collective term for a class of enzymes that specifically catalyze the synthesis of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) in biological processes. In 1957, American scientist Arthur Kornberg first discovered DNA polymerase in Escherichia coli; this enzyme was named DNA polymerase I. In 1970, German scientist Rolf Knippers discovered DNA polymerase II. Subsequently, DNA polymerase III was discovered.

[0003] DNA polymerase, as one of the essential components of polymerase chain reaction (PCR), plays a crucial role in the PCR process. In a sense, PCR technology is essentially the technology of thermostable DNA polymerase. Currently discovered thermostable DNA polymerases all belong to either family A or family B. Those belonging to family A are derived from eubacteria, such as Taq, Tth, Tca (T. caldophilus), Tfl, and TfI from the genus *Thermophyton*, and Bst from the genus *Bacillus*. Thermostable DNA polymerases belonging to family B are derived from archaea, such as Tli from the genus *Thermococcus*, and Pfu and KOD from the genus *Pyrophyton*.

[0004] Since the advent of PCR technology, researchers have been continuously searching for DNA polymerases with good enzymatic properties and high fidelity for PCR. Following Taq DNA polymerase, heat-resistant DNA polymerases with correction functions, such as DeepVent, Pfu, Tgo, and KOD, have been discovered.

[0005] Polymerase chain reaction (PCR) is a technique for rapidly amplifying specific DNA fragments in vitro. It involves the amplification of a DNA fragment defined by a pair of oligonucleotide primers in a reaction mixture consisting of a DNA template, primers, dNTPs, and appropriate buffer. DNA polymerase plays a crucial role in this process, and the development and utilization of enzymes is an important aspect of modern biotechnology. Modifying and designing enzyme genes using this technology is a key method in bioenzyme engineering. Summary of the Invention

[0006] This application provides a high-fidelity chimeric DNA polymerase. The chimeric DNA polymerase of this application may also possess improved properties, such as superior elongation properties, superior DNA binding properties, superior correction activity, superior fidelity, faster amplification speed, superior resistance to inhibitors, and superior long-fragment amplification capability.

[0007] DNA polymerase

[0008] The chimeric DNA polymerase of this application may contain 2-8, for example, 3, domains or segments derived from different polymerases. These domains or segments include, but are not limited to, exonuclease domains (typically the N-terminal region), thumb domains, palmar domains, and finger domains. These domains or segments may originate from different DNA polymerases, including but not limited to: Pfu polymerase, KOD polymerase, 9°N polymerase, T4 polymerase, and phi29 polymerase. These polymerases may also originate from various thermophilic bacteria, including but not limited to *Thermotoga sp.*, *Thermococcus profundus*, *Thermococcus gammatolerans*, *Thermococcus radiotolerans*, *Pyrococuus sp. NA2*, *Thermococcus celericrescens*, *Pyrococcus glycovorans*, and *Pyrococcus furiosus*. The chimeric DNA polymerases of this application exhibit an identity of over 80%.

[0009] In some embodiments, a chimeric DNA polymerase with DNA replication activity is provided, comprising:

[0010] A first domain, wherein the first domain is encoded by a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO: 576-583 or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity with one of the nucleotide sequences shown in SEQ ID NO: 576-583;

[0011] A second domain, wherein the second domain is encoded by a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO: 584-591 or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity with one of the nucleotide sequences shown in SEQ ID NO: 584-591; and

[0012] The third domain is encoded by a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO: 592-599 or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity with one of the nucleotide sequences shown in SEQ ID NO: 592-599.

[0013] More specifically, SEQ ID NO: 576-599 are derived from eight species: Thermococcus profundus, Thermococcus gammatolerans, Thermococcus radiotolerans, Pyrococcus sp.NA2, Thermococcus celericrescens, Pyrococcus glycovorans, and Pyrococcus furiosus. The first domain, encoded by the nucleotide sequences shown in SEQ ID NO: 576-583, is the N-terminal domain, which mainly participates in 3'-5' exonuclease activity correction or exonucleation function. The second domain, encoded by the nucleotide sequences shown in SEQ ID NO: 584-591, is the finger and palm domain. The finger or palm domain is mainly responsible for dNTP binding and incorporation and is the active site of the enzyme. The third domain, encoded by the nucleotide sequences shown in SEQ ID NO: 592-599, is the thumb domain, which is mainly related to the continuous DNA synthesis capacity. There is no absolute cleavage among the three regions; conserved cleavage and combination are performed based on structural and sequence characteristics to construct the diversity of the enzyme library.

[0014] In some more specific embodiments, the combined polymerase with the first domain being SEQ ID NO: 583 or 581, the second domain being SEQ ID NO: 586 or 591, and the third domain being SEQ ID NO: 596 or 598 has better elongation ability; the combined polymerase with the first domain being SEQ ID NO: 578 or 582, the second domain being SEQ ID NO: 586 or 590, and the third domain being SEQ ID NO: 592, 593, or 594 has a faster elongation rate.

[0015] In some embodiments, the chimeric DNA polymerase of this application comprises a first domain encoded by a nucleotide sequence selected from SEQ ID NO: 576-583, a second domain encoded by a nucleotide sequence selected from SEQ ID NO: 584-591, and a third domain encoded by a nucleotide sequence selected from SEQ ID NO: 592-599, or is composed of the first, second, and third domains described above.

[0016] In other embodiments, the chimeric DNA polymerase comprising the first, second, and third domains described above further includes or has one or more amino acid substitutions. For example,The amino acid substitution may be one or more amino acid substitutions selected from the following positions: 5, 6, 11, 15, 16, 18, 22, 24, 25, 28, 30, 33, 35, 36, 38, 43, 47, 49, 50, 51, 52, 54, 56, 57, 61, 62, 64, 65, 66, 67, 68, 72, 73, 80, 81, 84, 88, 89, 90, 94, 96, 99, 100, 102, 104, 107, 110, 126, 127, 132, 136, 137, 138, 139, 140, 153, 154, 158, 165, 166, 167, 169, 176, 180 182, 183, 185, 186, 188, 189, 193, 194, 195, 196, 197, 198, 199, 206, 210, 213, 216, 217, 220, 223, 226, 228, 230, 231, 232, 233, 236, 238, 241, 244, 247 248, 251, 252, 261, 262, 265, 268, 282, 285, 286, 292, 293, 296, 297, 301, 302, 303, 304, 310, 318, 320, 324, 327, 331, 334, 337, 340, 341, 356, 367, 373 374, 375, 377, 378, 379, 383, 384, 386, 395, 399, 400, 401, 403, 406, 407, 408, 409, 410, 424, 426, 430, 434, 437, 439, 441, 446, 447, 455, 456, 459, 463 466, 467, 470, 471, 472, 475, 477, 478, 479, 485, 494, 499, 502, 508, 520, 524, 525, 526, 527, 529, 532, 533, 540, 545, 546, 552, 553, 554, 556, 557, 559 560, 562, 565, 566, 570, 575, 585, 588, 597, 604, 605, 626, 631, 633, 634, 636, 642, 646, 652, 653, 656, 658, 662, 664, 670, 672, 673, 677, 683, 690, 692 694, 695, 698, 701, 703, 706, 708, 710, 712, 713, 717, 718, 719, 721, 723, 724, 727, 743, 747, 752, 753, 755, 758, 762, 764, 767, 768, 771, 772, 774, 775,The location is defined with reference to SEQ ID NO:575.

[0017] For example, the amino acid substitution may be selected from one or more of the following:

[0018] V5T / A、D6N、E11N / D、V15I、I16V、I18V / L、E22N、G24K / E、K25R / E、I28V、H30Y、T33Y / E / N、R35E、P36E / H / M、I38F、R43K、K47Q / K / A、E49D、E50S、I51V、K52R、I54V、G56S / A、E57K / G、K61T / R、I62V、R64K / T、I65V、V66T / I / K、D67K / R、V68A、E72Q / K、K73R、I80V、T81E、K84R、E88T、H89R、P90F、P94E / Q、I96M、K99E / R、V100I、E102S / R / A、P104S、V107I、F110Y、L126I、I127V、E132N / D、K136T、I137F / L / M、L138M、A139S、F140V、G153A、K154E / T、I158L、E165G、N166S / G / E、E167G、K169R、I176V、Y180F、E182D、V183A、S185A、S186N / T、R188K、E189D、R193A、F194L、L195I、R196K、I197V、I198V、R199K、I206L、N210D、S213N / D、F216L、P217A、A220L / V / K、A223C、L226F / I、I228M / V、L230F、T231P / I、I232L、G233R、G236N、E238K、I241M、I244L / M、M247S / R、T248L / F、E251D、V252I、Y261F、H262P、T265L / R、I268V、I282V、K285T / R、P286Q、A292P、D293H / E、A296T、K297Q / T / E、S301T、G302N、E303K、N304G、K310R、A318V、Y320F、K324R、F327L、I331A、S334A、V337I、P340S、L341F、F356Y、V367L、S373D、E374G / K、E375K / R、Y377L、Q378V / A / E / D、R379E、E383G / N、S384G、T386A / E、KR395R、E399D、N400G、I401L、Y403S、F406Y、R407K / M / H、A408S / D / F / G / P / R / T、L409S / D / F / G / P / R / T / A、Y410S / D / F / G / P / R / T / A、L424F、L426K / R、K430G / M / R、I434E / T / V、Q437E, G439K, K441R, I446V / F, P447Q, G455K, H456N / A / S / R / D, E459D, K463E, T466R / K, K467R, E470A, T471S, Q472I / V / K, I475L / V, K477R, I478R / K, L479M, K485R, F494Y, G499A, K502R, K508R, K520D / Q / E, L524M / T / F, V52 5T / S, W526R / I, K527H / R, L529I, K532R, F533Y / R, I540A, L545V / F / I, Y546V / I / A / T, G552E / A, E553K / D, S554N / P / D, E556T, I557V, K559R, K560R, L562K / M, V565L, K566N / E / D, S570A, L575A, K585V / R / T, F588L, V597L, I604 V / T, I605V / T, R626K, I631L, K633R, H634D, D636N, R642K / S, E646D, A652G / S, N653K, I656V, P658V, A662V, Y6 64H, P670E / D, H672N / K / R, E673D, I677T, V683I, K690R, V692I, I694V, R695K, M698T, G701S, I703V, R706K, D70 8S, P710R, S712G, N713K / D, L717A / P, A718I / F, E719D, Y721F, P723G / L, K724T / A / R, K727R, L743E, E747R / K, R752K, K753R / A, D755E, Y758W, R762K, V764T, G767T, S768V / A, N771Q / K, I772L / V / P, K774G, S775K, the positions of which are defined with reference to SEQ ID NO:575.

[0019] SEQ ID NO: 575 is derived from Pyrococcus furiosus, and the sequences of its three structural domains are as follows:

[0020] Domain 1:

[0021]

[0022] Domain 2:

[0023] gtagctccaaacaagccaagtgaagaggagtatcaaagaaggctcagggagagctacacaggtggattcgttaaagagccagaaaaggggttgtgggaaaacatagtatacctagattttagagccctatatccctcgattataattacccacaatgtttctcccgatactctaaatcttgagggatgcaagaactatgatatcgctcctcaagtaggccacaagttctgcaaggacatccctggttttataccaagtctcttgggacatttgttagaggaaagacaaaagattaagacaaaaatgaaggaaactcaagatcctatagaaaaaatactccttgactatagacaaaaagcgataaaactcttagcaaattctttctacggatattatggctatgcaaaagcaagatggtactgtaaggagtgtgctgagagcgttactgcctggggaagaaagtacatcgagttagtatggaaggagctcgaagaaaagtttggatttaaagtcctctacattgacactgatggtctctatgcaactatcccaggaggagaaagtgaggaaataaagaaaaaggctctagaatttgtaaaatacataaattcaaagctccctggactgctagagcttgaatatgaagggttttataagaggggattcttcgttacgaagaagaggtatgcagtaatagatgaagaaggaaaagtcattactcgtggtttagagatagttaggagagattggagtgaaattgcaaaagaaactcaa

[0024] Domain 3:

[0025] gctagagttttggagacaatactaaaacacggagatgttgaagaagctgtgagaatagtaaaagaagtaatacaaaagcttgccaattatgaaattccaccagagaagctcgca atatatgagcagataacaagaccattacatgagtataaggcgataggtcctcacgtagctgttgcaaagaaactagctgctaaaggagttaaaataaagccaggaatggtaatt ggatacatagtacttagaggcgatggtccaattagcaatagggcaattctagctgaggaatacgatcccaaaaagcacaagtatgacgcagaatattacattgagaaccaggtt cttccagcggtacttaggatattggagggatttggatacagaaaggaagacctcagataccaaaagacaagacaagtcggcctaacttcctggcttaacattaaaaaatcctag

[0026] In some embodiments, the chimeric DNA polymerase of this application has improved properties, such as superior Mg... 2+ Better tolerance, better SDS tolerance, better TE tolerance, better long fragment amplification capability, etc.

[0027] In some embodiments, the amino acid substitution may be one or more amino acid substitutions selected from the following positions: 210, 213, 377, 378, 407, 408, 409, 410, 474, 501. The inventors of this application have discovered that amino acids at positions 408, 409, and / or 410 are related to dNTP binding capacity and are also active sites, directly affecting polymerase amplification efficiency and yield; amino acids at positions 210 and / or 213 are related to inhibitor tolerance; for example, when amino acids at positions 210 and 213 are D, the range of inhibitor tolerance is significantly increased; amino acids at positions 210 and / or 213 are directly related to exonuclease activity, because mutations at these sites are directly related to fidelity and polymerase correction activity; amino acids at positions 501, 474, and / or 377 are related to polymerase amplification efficiency, therefore mutations at these sites can increase the yield of the target fragment; amino acid at position 378 is directly related to SDS tolerance; and amino acid at position 407 is directly related to Mg and TE tolerance.

[0028] This application also provides a DNA polymerase mutant with DNA replication activity, comprising an amino acid sequence that, when compared with the reference polypeptide shown in SEQ ID NO:575,The amino acid sequence comprises one or more amino acid substitutions corresponding to the following positions: 5, 6, 11, 15, 16, 18, 22, 24, 25, 28, 30, 33, 35, 36, 38, 43, 47, 49, 50, 51, 52, 54, 56, 57, 61, 62, 64, 65, 66, 67, 68, 72, 73, 80, 81, 84, 88, 89, 90, 94, 96, 99, 100, 102, 104, 107, 110, 126, 127, 132, 136, 137, 138, 139, 140, 153, 154, 158, 165, 166, 167, 169, 176, 180, 1 82, 183, 185, 186, 188, 189, 193, 194, 195, 196, 197, 198, 199, 206, 210, 213, 216, 217, 220, 223, 226, 228, 230, 231, 232, 233, 236, 238, 241, 244, 247, 2 48, 251, 252, 261, 262, 265, 268, 282, 285, 286, 292, 293, 296, 297, 301, 302, 303, 304, 310, 318, 320, 324, 327, 331, 334, 337, 340, 341, 356, 367, 373, 3 74, 375, 377, 378, 379, 383, 384, 386, 395, 399, 400, 401, 403, 406, 407, 408, 409, 410, 424, 426, 430, 434, 437, 439, 441, 446, 447, 455, 456, 459, 463 466, 467, 470, 471, 472, 475, 477, 478, 479, 485, 494, 499, 502, 508, 520, 524, 525, 526, 527, 529, 532, 533, 540, 545, 546, 552, 553, 554, 556, 557, 559 560, 562, 565, 566, 570, 575, 585, 588, 597, 604, 605, 626, 631, 633, 634, 636, 642, 646, 652, 653, 656, 658, 662, 664, 670, 672, 673, 677, 683, 690, 692 694, 695, 698, 701, 703, 706, 708, 710, 712, 713, 717, 718, 719, 721, 723, 724, 727, 743, 747, 752, 753, 755, 758, 762, 764, 767, 768, 771, 772, 774, 775,The position is defined with reference to SEQ ID NO:575. In some embodiments, the amino acid substitution is selected from one or more of the following:

[0029] V5T / A、D6N、E11N / D、V15I、I16V、I18V / L、E22N、G24K / E、K25R / E、I28V、H30Y、T33Y / E / N、R35E、P36E / H / M、I38F、R43K、K47Q / K / A、E49D、E50S、I51V、K52R、I54V、G56S / A、E57K / G、K61T / R、I62V、R64K / T、I65V、V66T / I / K、D67K / R、V68A、E72Q / K、K73R、I80V、T81E、K84R、E88T、H89R、P90F、P94E / Q、I96M、K99E / R、V100I、E102S / R / A、P104S、V107I、F110Y、L126I、I127V、E132N / D、K136T、I137F / L / M、L138M、A139S、F140V、G153A、K154E / T、I158L、E165G、N166S / G / E、E167G、K169R、I176V、Y180F、E182D、V183A、S185A、S186N / T、R188K、E189D、R193A、F194L、L195I、R196K、I197V、I198V、R199K、I206L、N210D、S213N / D、F216L、P217A、A220L / V / K、A223C、L226F / I、I228M / V、L230F、T231P / I、I232L、G233R、G236N、E238K、I241M、I244L / M、M247S / R、T248L / F、E251D、V252I、Y261F、H262P、T265L / R、I268V、I282V、K285T / R、P286Q、A292P、D293H / E、A296T、K297Q / T / E、S301T、G302N、E303K、N304G、K310R、A318V、Y320F、K324R、F327L、I331A、S334A、V337I、P340S、L341F、F356Y、V367L、S373D、E374G / K、E375K / R、Y377L、Q378V / A / E / D、R379E、E383G / N、S384G、T386A / E、KR395R、E399D、N400G、I401L、Y403S、F406Y、R407K / M / H、A408S / D / F / G / P / R / T、L409S / D / F / G / P / R / T / A、Y410S / D / F / G / P / R / T / A、L424F、L426K / R、K430G / M / R、I434E / T / V、Q437E, G439K, K441R, I446V / F, P447Q, G455K, H456N / A / S / R / D, E459D, K463E, T466R / K, K467R, E470A, T471S , Q472I / V / K, I475L / V, K477R, I478R / K, L479M, K485R, F494Y, G499A, K502R, K508R, K520D / Q / E, L524M / T / F, V525T / S, W526R / I, K527H / R, L529I, K532R, F533Y / R, I540A, L545V / F / I, Y546V / I / A / T, G552E / A, E553K / D, S 554N / P / D, E556T, I557V, K559R, K560R, L562K / M, V565L, K566N / E / D, S570A, L575A, K585V / R / T, F588L, V597L , I604V / T, I605V / T, R626K, I631L, K633R, H634D, D636N, R642K / S, E646D, A652G / S, N653K, I656V, P658V, A6 62V, Y664H, P670E / D, H672N / K / R, E673D, I677T, V683I, K690R, V692I, I694V, R695K, M698T, G701S, I703V, R 706K, D708S, P710R, S712G, N713K / D, L717A / P, A718I / F, E719D, Y721F, P723G / L, K724T / A / R, K727R, L743E, E747R / K, R752K, K753R / A, D755E, Y758W, R762K, V764T, G767T, S768V / A, N771Q / K, I772L / V / P, K774G, S775K. ,

[0030] In some embodiments, the DNA polymerase mutant has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO:575.

[0031] In some embodiments, the DNA polymerase mutant has improved properties, such as superior Mg2+. 2+ Better tolerance, better SDS tolerance, better TE tolerance, better long fragment amplification capability, etc.

[0032] In some embodiments, the amino acid sequence of the DNA polymerase mutant includes one or more amino acid substitutions corresponding to the following positions: 210, 213, 377, 378, 407, 408, 409, 410, 474, 501.

[0033] In some embodiments, the DNA polymerase of this application comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in any one of SEQ ID NO: 1-574. Examples are as follows:

[0034] SEQ ID NO:564 is composed of the first structural domain SEQ ID NO:583, the second structural domain SEQ ID NO:586, and the third structural domain SEQ ID NO:596, which contains V5A, D6N, E11D, V15I, L18I, K25E, I28V, H30Y, T33N, R43K, K47Q, E49D, G56A, E72K, K78R, T81E, L86F, T95A, E98D, V100I, E132D, I137L, G153A, E167G, and N175. K, I176V, R196K, I197V, I205V, V207I, F216L, A220V, T231P, I232L, I244L, V252I, T2 65R, D293H, K297E, S301T, E303K, N304G, A318V, K324R, L327F, I331A, F356Y and V367I.

[0035] SEQ ID NO:561 is composed of the first structural domain SEQ ID NO:583, the second structural domain SEQ ID NO:586, and the third structural domain SEQ ID NO:598, which contains V5A, D6N, E11D, V15I, L18I, K25E, I28V, H30Y, T33N, R43K, K47Q, E49D, G56A, E72K, K78R, T81E, L86F, T95A, E98D, V100I, E132D, G153A, E167G, N175K, I 176V, R196K, I197V, I205V, V207I, F216L, A220V, T231P, I232L, I244L, V252I, T265R, D293H, K297E, S301T, E303K, N304G, A318V, K324R, L327F, I331A, F356Y and V367I.

[0036] SEQ ID NO:287 is composed of the first structural domain SEQ ID NO:519, the second structural domain SEQ ID NO:584, and the third structural domain SEQ ID NO:595, which includes V5A, E11D, V15I, K25R, I28V, H30Y, T33N, R43K, K47A, E49D, E50D, K52R, G56S, E57K, I62V, I65V, V66I, E72K, K78R, T81E, L86F, T95A, I96M, E98D, V100I, V107I, E132N, K136T, F140V, E167G, N175K, S185A, S186N, F194L, L195I, R196K, I197V, I205V, V207I, S213N, P217A, A220L, I228M, T231P, I232L, G236N, I244L, M247S, T248L, V252I, Y261F, H262P, T265R, P286Q, A292P, D293H, K297E, S301T, E303K, N304G, A318V, L327F, I331A, S334A, F356Y, and V367L.

[0037] SEQ ID NO:503 is composed of the first structural domain SEQ ID NO:581, the second structural domain SEQ ID NO:590, and the third structural domain SEQ ID NO:594, which contains E10D, V14I, L18I, I28V, H30Y, T33N, R43K, K47Q, K52R, G56A, V66I, K78R, K83R, L86F, T95A, E98D, P104S, V107I, E132D, N175K, R196K, I205V, V207I, F216L, A220V, I244L, V252I, K297E, K324R, and V367L.

[0038] SEQ ID NO:532 is composed of the first structural domain SEQ ID NO:583, the second structural domain SEQ ID NO:588, and the third structural domain SEQ ID NO:596, which contains V5A, D6N, E11D, V15I, L18I, K25E, I28V, H30Y, T33N, R43K, K47Q, E49D, G56A, E72K, K78R, T81E, L86F, T95A, E98D, V100I, E132D, G153A, E167G, N175K, I 176V, R196K, I197V, I205V, V207I, F216L, A220V, T231P, I232L, I244L, V252I, T265R, D293H, K297E, S301T, E303K, N304G, A318V, K324R, L327F, I331A, F356Y and V367L.

[0039] SEQ ID NO:78 is composed of the first structural domain SEQ ID NO:578, the second structural domain SEQ ID NO:586, and the third structural domain SEQ ID NO:598, which includes V5T, E11N, L18V, K24E, H30Y, R35E, I38F, R43K, K47A, E50D, I54V, G56A, K61T, I65V, V66K, D67R, V68A, E72Q, K73R, K78R, T81E, L86F, E87T, T95A, E98D, V100I, E102A, V107I, F110Y, E132D, K136T, K154T, I158L, E165G, E166S. K169R, N175K, E182D, S186T, R188K, I198V, R199K, I205V, I206L, V207I, S213N, A220K, A223C, L230F, I232L, M301I, I244M, M247R, T248F, H262P, T265R, I282V, D293E, K297Q, N304G, K310R, A318V, K324R, L327F, I331A, V337I, P340S, and V367I.

[0040] SEQ ID NO:406 is composed of the first structural domain SEQ ID NO:580, the second structural domain SEQ ID NO:591, and the third structural domain SEQ ID NO:596, which contains E11D, I15V, I16V, L18I, K25E, H30Y, T33N, R35E, R43K, K47A, G56A, I62V, I65V, V66K, D67R, V68A, E72K, K78R, T81E, L86F, T95A, E98D, V100I, F110Y, E132D, I158L, K169R, N175K, S186T, and I197. V, R199K, I205V, I206L, V207I, S213N, P217A, A220K, A223C, L230F, I232L, M241I, I244M, M247R, T248F , E251D, H262P, T265R, D293E, K297E, S301T, N304G, K310R, A318V, K324R, L327F, I331A, V337I and V367L.

[0041] SEQ ID NO:403 is composed of the first structural domain SEQ ID NO:580, the second structural domain SEQ ID NO:591, and the third structural domain SEQ ID NO:598, which contains E11D, I15V, I16V, L18I, K25E, H30Y, T33N, R35E, R43K, K47A, G56A, I62V, I65V, V66K, D67R, V68A, E72K, K78R, T81E, L86F, T95A, E98D, V100I, F110Y, E132D, I158L, K169R, N175K, S186T, and I197. V, R199K, I205V, I206L, V207I, S213N, P217A, A220K, A223C, L230F, I232L, M241I, I244M, M247R, T248F , E251D, H262P, T265R, D293E, K297E, S301T, N304G, K310R, A318V, K324R, L327F, I331A, V337I and V367L.

[0042] This application also relates to bioactive fragments of the DNA polymerase of this application, such fragments being considered to be included in the terms "DNA polymerase of this application," "chimeric DNA polymerase of this application," and "DNA polymerase mutant of this application." The bioactive fragments of the DNA polymerase of this application comprise fewer amino acids than the full-length protein but exhibit at least one biological activity of the corresponding full-length protein. Typically, the bioactive fragment contains at least one domain, motif, or segment of the DNA polymerase protein of this application. Bioactive fragments lacking partial regions of the protein can be prepared using recombinant techniques, and said fragments can be evaluated for one or more biological activities possessed by the full-length form of the DNA polymerase of this application.

[0043] As used in this application, the term "DNA polymerase" refers to an enzyme used to replicate DNA, which uses DNA as a template to replicate DNA from the 5' end to the 3' end. DNA polymerase has the activity of catalyzing DNA synthesis in the presence of a template, primers, dNTPs, etc., as well as optional auxiliary activities.

[0044] As used in this application, the term "amino acid" refers to compounds in which the hydrogen atom on the carbon atom of a carboxylic acid is replaced by an amino group. Amino acid molecules contain both amino and carboxyl functional groups. Similar to hydroxy acids, amino acids can be classified into α-, β-, γ-...w-amino acids according to the position of the amino group on the carbon chain. However, the amino acids obtained after protein hydrolysis are all α-amino acids, and there are only about twenty of them. They are the basic building blocks of proteins.

[0045] As used in this application, "PCR" or "polymerase chain reaction" is a molecular biology technique used to amplify specific DNA fragments. It can be viewed as a special form of DNA replication outside of a living organism. It utilizes the denaturation of DNA into single strands at 95°C, followed by primer binding to the single strands at a lower temperature (often around 60°C) based on complementary base pairing. The temperature is then adjusted to the optimal reaction temperature for DNA polymerase (around 72°C), where the polymerase synthesizes complementary strands along the phosphate-to-pentose (5'-3') direction. A PCR instrument based on polymerase is essentially a temperature control device, capable of effectively controlling the denaturation, annealing, and extension temperatures.

[0046] There are five main substances involved in the PCR reaction: primers, enzymes, dNTPs, template, and Mg. 2+ These can be called reaction elements. Primers are crucial for the specificity of PCR reactions; the specificity of PCR products depends on the degree of complementarity between the primers and the template DNA. Mg 2+ It has a significant impact on the specificity and yield of PCR amplification. In a typical PCR reaction, when the concentration of various dNTPs is 200 μmol / L, Mg... 2+ A concentration of 1.5-2.0 mmol / L is preferred. Mg 2+ If the concentration is too high, the reaction specificity will decrease, resulting in nonspecific amplification; if the concentration is too low, the activity of DNA polymerase will decrease, leading to a reduction in reaction products.

[0047] As used in this application, the term "domain" refers to any structural fragment of a polymerase or a region with specific activity, such as a DNA-binding region, a nucleotide-polymerizing region, a dNTP-binding region, a strand substitution-binding region, a proofreading-active region, etc.

[0048] As used in this application, the term "inhibitor tolerance" refers to the ability of DNA polymerase to substantially maintain its enzymatic activity in the presence of substances that are detrimental to PCR, including but not limited to Mg. 2+ Tolerance, SDS tolerance, TE tolerance, etc. Tolerance to the inhibitor can be measured by the maximum inhibitor concentration at which the DNA polymerase remains substantially active. In this application, "Mg" 2+ "Tolerance" can refer to tolerance to Mg at concentrations above 2mM, 4mM, 6mM, 8mM, or 10mM. 2+The ability to substantially maintain DNA polymerase activity in the presence of SDS. In this application, "SDS tolerance" can refer to the ability to substantially maintain DNA polymerase activity in the presence of SDS concentrations greater than 0.00125%, 0.0025%, 0.005%, 0.01%, or 0.02%. In this application, "TE tolerance" can refer to the ability to substantially maintain DNA polymerase activity in the presence of SDS concentrations greater than 0.03125X TE, 0.0625X TE, 0.125X TE, 0.25X TE, 0.5X TE, or 1X TE. The term "substantially" as used herein means that the DNA polymerase retains more than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of its DNA polymerase activity in any or a specific target assay, either in vivo or in vitro. The target assay can be a semi-quantitative or quantitative PCR amplification experiment. Alternatively, the target assay may be, for example, DNA binding assay, nucleotide polymerization assay, primer extension assay, strand displacement assay, reverse transcriptase assay, calibration assay, accuracy assay, thermal stability assay, ion stability assay, etc.

[0049] As used in this application, the term "long fragment amplification capability" refers to the ability of DNA polymerase to generate long fragments through a PCR reaction. In this application, "long fragment amplification capability" may refer to the ability to amplify continuous DNA fragments greater than 1kb, 2kb, 3kb, 4kb, 5kb, 6kb, 7kb, 8kb, 9kb, or 10kb.

[0050] As used herein, the term "substitution" or "amino acid substitution" refers to the replacement of at least one amino acid residue in a specific amino acid sequence with another different amino acid residue. Substitution representations are well-known in the art; for example, T5V / A means replacing the 5th T with V or A, and D6N means replacing the 6th D with N. In some embodiments, amino acid substitutions are conservative substitutions. A "conservative substitution" means that one amino acid is replaced by another amino acid with a shared property. A method for functionally defining shared properties between individual amino acids is to analyze the normalized frequencies of amino acid variations between corresponding proteins in homologous organisms (Schulz (1979) Principles of Protein Structure, Springer-Verlag). Based on such analysis, groups of amino acids can be identified, where amino acids within a group preferentially substitute for each other, thus having the most similar effects on the overall protein structure (Schulz (1979) ibid.). Examples of groups of amino acids defined in this way include: “charged / polar groups,” including Glu, Asp, Asn, Gln, Lys, Arg, and His; “aromatic or cyclic groups,” including Pro, Phe, Tyr, and Trp; and “aliphatic groups,” including Gly, Ala, Val, Leu, Ile, Met, Ser, Thr, and Cys. Within each group, subgroups can also be identified. For example, groups of charged / polar amino acids can be further subdivided into subgroups, including: “positively charged subgroups,” including Lys, Arg, and His; “negatively charged subgroups,” including Glu and Asp; and “polar subgroups,” including Asn and Gln. In another example, aromatic or cyclic groups can be further subdivided into subgroups, including: “nitrogen-cyclic subgroups,” including Pro, His, and Trp; and “phenyl subgroups,” including Phe and Tyr. In another example, aliphatic peptides can be further divided into subfamilies, including: "large aliphatic nonpolar subfamilies," including Val, Leu, and Ile; "aliphatic micropolar subfamilies," including Met, Ser, Thr, and Cys; and "small residue subfamilies," including Gly and Ala. Examples of conserved mutations include amino acid substitutions within the aforementioned subfamilies, such as, but not limited to: Lys replacing Arg or vice versa to maintain a positive charge; Glu replacing Asp or vice versa to maintain a negative charge; Ser replacing Thr or vice versa to maintain free -OH; and Gln replacing Asn or vice versa to maintain free -NH2. A "conserved variant" is a polypeptide that contains one or more amino acids that have been substituted by amino acids with common properties (e.g., belonging to the same amino acid family or subfamily as described above) to replace one or more amino acids of a reference polypeptide (e.g., whose sequence is publicly available in a literature or sequence database, or whose sequence has been determined by nucleic acid sequencing).

[0051] "Natural" or "wild-type" refers to a form found in nature. For example, natural or wild-type polypeptide or polynucleotide sequences are sequences that exist in organisms, such as DNA polymerase sequences that have not been intentionally modified by human intervention.

[0052] The term "percentage identity" or "homology" for nucleic acid or polypeptide sequences is defined as the percentage of nucleotide or amino acid residues in a candidate sequence that are identical to a known polypeptide after aligning sequences for the purpose of maximizing percentage identity and introducing vacancies where necessary to achieve maximizing percentage homology. N-terminal or C-terminal insertions or deletions should not be interpreted as affecting homology. Nucleotide or amino acid sequence-level homology or identity can be determined by BLAST (Basic Local Alignment Search Tool) analysis using algorithms executed through the procedures blastp, blastn, blastx, tblastn, and tblastx (Altschul (1997), Nucleic Acids Res. 25, 3389-3402, and Karlin (1990), Proc. Natl. Acad. Sci. USA 87, 2264-2268), which is tailored for sequence similarity searches. The BLAST procedure first considers similar regions between the query sequence and the database sequence, both with and without gaps. Then, it evaluates the statistical significance of all identified matches and finally summarizes only those matches that meet a pre-selected significance threshold. For a discussion of the fundamental problems of sequence database similarity searching, see Altschul (1994), Nature Genetics 6, pp. 119-129. Search parameters such as bar charts, descriptions, alignments, expected values ​​(i.e., the statistical significance threshold used to report matches for database sequences), truncation values, matrices, and filtering (low complexity) can be set to default. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff (1992), Proc. Natl. Acad. Sci. USA 89, 10915-10919), recommended for query sequences longer than 85 units (nucleotide bases or amino acids).

[0053] This application is intended to cover functional equivalents or functional variants of the DNA polymerase of this application. The terms “functional equivalent” and “functional variant” are used interchangeably herein. “Functional equivalent” and “functional variant” can be obtained, for example, by substitution, insertion, or deletion (e.g., conserved substitution) of one or more amino acids in the DNA polymerase of this application.

[0054] Nucleic acids, nucleic acid constructs and host cells

[0055] This application also provides isolated nucleic acids containing a sequence encoding the DNA polymerase described in this application. This application also relates to isolated polynucleotides encoding at least one functional domain of the DNA polymerase of this application. Typically, such functional domains comprise one or more substitutions as described herein.

[0056] The nucleic acid molecules of this application can be produced using standard molecular biology techniques known to those skilled in the art, combined with the sequence information provided herein. For example, the required nucleic acid can be generated or synthesized de novo using standard synthesis techniques such as PCR.

[0057] As used herein, the terms “nucleic acid,” “polynucleotide,” and “nucleic acid molecule” are used interchangeably to include DNA molecules and RNA molecules (e.g., mRNA), as well as analogs of DNA or RNA produced using nucleotide analogs. Nucleic acid molecules can be single-stranded or double-stranded, but double-stranded DNA is preferred. “Isolated nucleic acid” or “isolated polynucleotide” is used interchangeably herein and refers to DNA or RNA whose two directly adjacent coding sequences (one at the 5' end and one at the 3' end) in the natural genome of the organism from which the DNA or RNA is derived are not directly adjacent. Therefore, the term covers, for example, recombinant DNA integrated into a vector, recombinant DNA integrated into an autonomously replicating plasmid or virus, or recombinant DNA integrated into the genomic DNA of a prokaryote or eukaryote, or recombinant DNA existing as a separate molecule independent of other sequences (e.g., cDNA or genomic DNA fragments produced by PCR or restriction endonuclease treatment). The term also includes recombinant DNA as part of a heterozygous gene encoding an additional polypeptide.

[0058] This application also relates to nucleic acid constructs comprising the said nucleic acid, said nucleic acid being operatively linked to a control sequence that allows said nucleic acid to replicate or be expressed in a host cell, said control sequence including, but not limited to, promoters, enhancers, terminators, origins of replication, etc. The term "nucleic acid construct" herein refers to a segment modified to contain nucleic acids combined and juxtaposed in a manner not found in nature. Nucleic acid constructs may refer to expression cassettes, expression vectors, or replication vectors.

[0059] The expression vector can be any vector (e.g., plasmid or virus) that allows for convenient recombinant DNA procedures and induces the expression of a nucleic acid sequence encoding the DNA polymerase of this application. The choice of vector typically depends on its compatibility with the host cell to which it will be introduced. The vector can be a linear plasmid or a closed circular plasmid. The vector can be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity and whose replication is independent of chromosomal replication, such as a plasmid, extrachromosomal element, miniature chromosome, or artificial chromosome. If intended for use in fungal-derived host cells, a suitable additional nucleic acid construct can be, for example, based on the yeast 2μ or pKD1 plasmid. Alternatively, the expression vector can be a vector that integrates into the genome upon introduction into the host cell and replicates along with the chromosome into which it is already integrated.

[0060] This application also relates to host cells containing the nucleic acids or nucleic acid constructs described in this application. The nucleic acid constructs and vectors of this application can be designed to express the DNA polymerase of this application in prokaryotic or eukaryotic host cells. Suitable host cells for expressing the polymerase of this application are well known in the art, including but not limited to bacterial cells such as *Escherichia coli*, *Lactobacillus kefir*, *Lactobacillus brevis*, *Lactobacillus minor*, *Streptomyces*, and *Salmonella typhimurium* cells; fungal cells such as yeast cells (e.g., *Saccharomyces cerevisiae* or *Pichia pastoris*); insect cells such as *Drosophila S2* and *Lepidoptera Sf9* cells; animal cells such as CHO, COS, BHK, 293, and Bowes melanoma cells; and plant cells. Suitable culture media and growth conditions for the above-mentioned host cells are well known in the art.

[0061] Polynucleotides used to express polymerase peptides can be introduced into cells by various methods known in the art, including but not limited to electroporation, bioparticle bombardment, liposome-mediated transfection, calcium chloride transfection, and protoplast fusion. Those skilled in the art are familiar with various methods for introducing polynucleotides into cells.

[0062] Reagent test kit

[0063] This application also relates to a kit containing the DNA polymerase, nucleic acid, nucleic acid construct, or host cell described in this application. The kit may include various reagents and containers for polynucleotide synthesis (including synthesis in PCR). The kit according to this application may also contain one or more of the following substances: polynucleotide precursors, primers, buffers, instructions for use, and controls.

[0064] Composition

[0065] This application also relates to compositions comprising the DNA polymerase described in this application. The composition may be, for example, a PCR reaction system comprising, for example, primers, buffer, dNTPs, template, and / or Mg. 2+ .

[0066] Methods for preparing DNA polymerase

[0067] This application also relates to a method for preparing DNA polymerase.

[0068] In some embodiments, the method includes:

[0069] Provided a chimeric polypeptide comprising a first domain, a second domain and a third domain, wherein the first domain is encoded by a nucleotide sequence selected from SEQ ID NO: 576-583, the second domain is encoded by a nucleotide sequence selected from SEQ ID NO: 584-591, and the third domain is encoded by a nucleotide sequence selected from SEQ ID NO: 592-599;

[0070] And optionally, one or more amino acid substitutions selected from the following:

[0071] V5T / A、D6N、E11N / D、V15I、I16V、I18V / L、E22N、G24K / E、K25R / E、I28V、H30Y、T33Y / E / N、R35E、P36E / H / M、I38F、R43K、K47Q / K / A、E49D、E50S、I51V、K52R、I54V、G56S / A、E57K / G、K61T / R、I62V、R64K / T、I65V、V66T / I / K、D67K / R、V68A、E72Q / K、K73R、I80V、T81E、K84R、E88T、H89R、P90F、P94E / Q、I96M、K99E / R、V100I、E102S / R / A、P104S、V107I、F110Y、L126I、I127V、E132N / D、K136T、I137F / L / M、L138M、A139S、F140V、G153A、K154E / T、I158L、E165G、N166S / G / E、E167G、K169R、I176V、Y180F、E182D、V183A、S185A、S186N / T、R188K、E189D、R193A、F194L、L195I、R196K、I197V、I198V、R199K、I206L、N210D、S213N / D、F216L、P217A、A220L / V / K、A223C、L226F / I、I228M / V、L230F、T231P / I、I232L、G233R、G236N、E238K、I241M、I244L / M、M247S / R、T248L / F、E251D、V252I、Y261F、H262P、T265L / R、I268V、I282V、K285T / R、P286Q、A292P、D293H / E、A296T、K297Q / T / E、S301T、G302N、E303K、N304G、K310R、A318V、Y320F、K324R、F327L、I331A、S334A、V337I、P340S、L341F、F356Y、V367L、S373D、E374G / K、E375K / R、Y377L、Q378V / A / E / D、R379E、E383G / N、S384G、T386A / E、KR395R、E399D、N400G、I401L、Y403S、F406Y、R407K / M / H、A408S / D / F / G / P / R / T、L409S / D / F / G / P / R / T / A、Y410S / D / F / G / P / R / T / A、L424F、L426K / R、K430G / M / R、I434E / T / V、Q437E, G439K, K441R, I446V / F, P447Q, G455K, H456N / A / S / R / D, E459D, K463E, T466R / K, K467R, E470A, T471S , Q472I / V / K, I475L / V, K477R, I478R / K, L479M, K485R, F494Y, G499A, K502R, K508R, K520D / Q / E, L524M / T / F, V525T / S, W526R / I, K527H / R, L529I, K532R, F533Y / R, I540A, L545V / F / I, Y546V / I / A / T, G552E / A, E553K / D, S 554N / P / D, E556T, I557V, K559R, K560R, L562K / M, V565L, K566N / E / D, S570A, L575A, K585V / R / T, F588L, V597L , I604V / T, I605V / T, R626K, I631L, K633R, H634D, D636N, R642K / S, E646D, A652G / S, N653K, I656V, P658V, A6 62V, Y664H, P670E / D, H672N / K / R, E673D, I677T, V683I, K690R, V692I, I694V, R695K, M698T, G701S, I703V, R7 06K, D708S, P710R, S712G, N713K / D, L717A / P, A718I / F, E719D, Y721F, P723G / L, K724T / A / R, K727R, L743E, E 747R / K, R752K, K753R / A, D755E, Y758W, R762K, V764T, G767T, S768V / A, N771Q / K, I772L / V / P, K774G, S775K,,

[0072] The location is defined with reference to SEQ ID NO:575;

[0073] To obtain a DNA polymerase with DNA replication activity.

[0074] Among them, chimeric peptides containing a first, second, and third domain can be provided through seamless cloning.

[0075] In some embodiments, the method includes introducing one or more amino acid substitutions selected from the group consisting of the polypeptide represented by SEQ ID NO:575.

[0076] V5T / A、D6N、E11N / D、V15I、I16V、I18V / L、E22N、G24K / E、K25R / E、I28V、H30Y、T33Y / E / N、R35E、P36E / H / M、I38F、R43K、K47Q / K / A、E49D、E50S、I51V、K52R、I54V、G56S / A、E57K / G、K61T / R、I62V、R64K / T、I65V、V66T / I / K、D67K / R、V68A、E72Q / K、K73R、I80V、T81E、K84R、E88T、H89R、P90F、P94E / Q、I96M、K99E / R、V100I、E102S / R / A、P104S、V107I、F110Y、L126I、I127V、E132N / D、K136T、I137F / L / M、L138M、A139S、F140V、G153A、K154E / T、I158L、E165G、N166S / G / E、E167G、K169R、I176V、Y180F、E182D、V183A、S185A、S186N / T、R188K、E189D、R193A、F194L、L195I、R196K、I197V、I198V、R199K、I206L、N210D、S213N / D、F216L、P217A、A220L / V / K、A223C、L226F / I、I228M / V、L230F、T231P / I、I232L、G233R、G236N、E238K、I241M、I244L / M、M247S / R、T248L / F、E251D、V252I、Y261F、H262P、T265L / R、I268V、I282V、K285T / R、P286Q、A292P、D293H / E、A296T、K297Q / T / E、S301T、G302N、E303K、N304G、K310R、A318V、Y320F、K324R、F327L、I331A、S334A、V337I、P340S、L341F、F356Y、V367L、S373D、E374G / K、E375K / R、Y377L、Q378V / A / E / D、R379E、E383G / N、S384G、T386A / E、KR395R、E399D、N400G、I401L、Y403S、F406Y、R407K / M / H、A408S / D / F / G / P / R / T、L409S / D / F / G / P / R / T / A、Y410S / D / F / G / P / R / T / A、L424F、L426K / R、K430G / M / R、I434E / T / V、Q437E, G439K, K441R, I446V / F, P447Q, G455K, H456N / A / S / R / D, E459D, K463E, T466R / K, K467R, E470A, T471S , Q472I / V / K, I475L / V, K477R, I478R / K, L479M, K485R, F494Y, G499A, K502R, K508R, K520D / Q / E, L524M / T / F, V525T / S, W526R / I, K527H / R, L529I, K532R, F533Y / R, I540A, L545V / F / I, Y546V / I / A / T, G552E / A, E553K / D, S 554N / P / D, E556T, I557V, K559R, K560R, L562K / M, V565L, K566N / E / D, S570A, L575A, K585V / R / T, F588L, V597L , I604V / T, I605V / T, R626K, I631L, K633R, H634D, D636N, R642K / S, E646D, A652G / S, N653K, I656V, P658V, A6 62V, Y664H, P670E / D, H672N / K / R, E673D, I677T, V683I, K690R, V692I, I694V, R695K, M698T, G701S, I703V, R7 06K, D708S, P710R, S712G, N713K / D, L717A / P, A718I / F, E719D, Y721F, P723G / L, K724T / A / R, K727R, L743E, E 747R / K, R752K, K753R / A, D755E, Y758W, R762K, V764T, G767T, S768V / A, N771Q / K, I772L / V / P, K774G, S775K,,

[0077] The location is defined with reference to SEQ ID NO:575.

[0078] Nucleic acid amplification application

[0079] This application also relates to a method for amplifying nucleic acids, the method comprising amplifying DNA sequences using the DNA polymerase, kit, composition (PCR reaction system) described in this application or the DNA polymerase prepared by the preparation method of this application.

[0080] In some embodiments, the method involves contacting nucleic acids with the DNA polymerase or its bioactive fragment of the present application under suitable conditions for nucleic acid amplification; and amplifying the nucleic acids using polymerase chain reaction (PCR), isothermal amplification reaction, recombinase polymerase amplification reaction, rolling circle amplification, or strand displacement amplification. Amplification includes amplifying nucleic acids in solution or on a solid support, such as nucleic acid beads, flow cells, nucleic acid arrays, or wells present on the surface of the solid support. The polymerase chain reaction (PCR) includes, but is not limited to, hot-start PCR, falling PCR, nested PCR, reverse PCR, site-directed PCR mutagenesis, RT-PCR, RACE, multiplex PCR, asymmetric PCR, in situ PCR, quantitative PCR, whole genome amplification, error-prone PCR, etc.

[0081] Methods to improve the properties of DNA polymerase

[0082] This application also relates to methods for improving the properties of DNA polymerase.

[0083] In some embodiments, the method includes replacing the corresponding domain of the DNA polymerase to be improved with one or more domains encoded by one of the nucleotide sequences shown in SEQ ID NO: 576-599.

[0084] In some embodiments, the method includes:

[0085] Introduce one or more amino acid substitutions selected from the following into the DNA polymerase to be improved:

[0086] V5T / A、D6N、E11N / D、V15I、I16V、I18V / L、E22N、G24K / E、K25R / E、I28V、H30Y、T33Y / E / N、R35E、P36E / H / M、I38F、R43K、K47Q / K / A、E49D、E50S、I51V、K52R、I54V、G56S / A、E57K / G、K61T / R、I62V、R64K / T、I65V、V66T / I / K、D67K / R、V68A、E72Q / K、K73R、I80V、T81E、K84R、E88T、H89R、P90F、P94E / Q、I96M、K99E / R、V100I、E102S / R / A、P104S、V107I、F110Y、L126I、I127V、E132N / D、K136T、I137F / L / M、L138M、A139S、F140V、G153A、K154E / T、I158L、E165G、N166S / G / E、E167G、K169R、I176V、Y180F、E182D、V183A、S185A、S186N / T、R188K、E189D、R193A、F194L、L195I、R196K、I197V、I198V、R199K、I206L、N210D、S213N / D、F216L、P217A、A220L / V / K、A223C、L226F / I、I228M / V、L230F、T231P / I、I232L、G233R、G236N、E238K、I241M、I244L / M、M247S / R、T248L / F、E251D、V252I、Y261F、H262P、T265L / R、I268V、I282V、K285T / R、P286Q、A292P、D293H / E、A296T、K297Q / T / E、S301T、G302N、E303K、N304G、K310R、A318V、Y320F、K324R、F327L、I331A、S334A、V337I、P340S、L341F、F356Y、V367L、S373D、E374G / K、E375K / R、Y377L、Q378V / A / E / D、R379E、E383G / N、S384G、T386A / E、KR395R、E399D、N400G、I401L、Y403S、F406Y、R407K / M / H、A408S / D / F / G / P / R / T、L409S / D / F / G / P / R / T / A、Y410S / D / F / G / P / R / T / A、L424F、L426K / R、K430G / M / R、I434E / T / V、Q437E, G439K, K441R, I446V / F, P447Q, G455K, H456N / A / S / R / D, E459D, K463E, T466R / K, K467R, E470A, T471S, Q472I / V / K, I475L / V, K477R, I478R / K, L479M, K485R, F494Y, G499A, K502R, K508R, K520D / Q / E, L524M / T / F, V52 5T / S, W526R / I, K527H / R, L529I, K532R, F533Y / R, I540A, L545V / F / I, Y546V / I / A / T, G552E / A, E553K / D, S554N / P / D, E556T, I557V, K559R, K560R, L562K / M, V565L, K566N / E / D, S570A, L575A, K585V / R / T, F588L, V597L, I604 V / T, I605V / T, R626K, I631L, K633R, H634D, D636N, R642K / S, E646D, A652G / S, N653K, I656V, P658V, A662V, Y6 64H, P670E / D, H672N / K / R, E673D, I677T, V683I, K690R, V692I, I694V, R695K, M698T, G701S, I703V, R706K, D70 8S, P710R, S712G, N713K / D, L717A / P, A718I / F, E719D, Y721F, P723G / L, K724T / A / R, K727R, L743E, E747R / K, R752K, K753R / A, D755E, Y758W, R762K, V764T, G767T, S768V / A, N771Q / K, I772L / V / P, K774G, S775K, the positions of which are defined with reference to SEQ ID NO:575.

[0087] The improved properties may be selected from one or more of the following: superior extension properties, superior DNA binding properties, superior correction activity, superior fidelity, faster amplification rate, superior resistance to inhibitors, and superior long-fragment amplification capability. In some embodiments, the improved properties are selected from one or more of the following: superior Mg... 2+ Better tolerance, better SDS tolerance, better TE tolerance, and better long fragment amplification capability. Attached Figure Description

[0088] The following figures are for illustrative purposes only and not for limiting purposes.

[0089] Figure 1 An illustrative polymerase sequence alignment diagram is shown. The sequence alignment results are amino acid sequence alignments of polymerases derived from thermophilic bacteria. The similarity is over 85%. * indicates identical amino acid sequences, and * indicates different amino acid sequences. The amino acid sequences of the eight template polymerases are 1-8.

[0090] Figure 2 The illustrative diagram illustrates the library construction process for a chimeric polymerase library. Block A can be derived from eight different domains, block B also originates from domains 1-8 of template, and block C also originates from domains 1-8 of template. The nucleotide sequences are: blocks A1-A8; blocks B1-B8; blocks C1-C8.

[0091] Figure 3 An exemplary Mg2+ tolerance test is shown. Lane 1: 0 mM Mg2+; Lane 2: 2 mM Mg2+; Lane 3: 4 mM Mg2+; Lane 4: 6 mM Mg2+; Lane 5: 8 mM Mg2+; Lane 6: 10 mM Mg2+. All concentrations are final reaction concentrations. Mg2+ can be obtained from MgCl2 or MgSO4. The results indicate that the chimeric polymerase can tolerate 0-10 mM Mg2+.

[0092] Figure 4 An example of an SDS tolerance test is shown. Lane 1: 0% SDS; Lane 2: 0.00125% SDS; Lane 3: 0.0025% SDS; Lane 4: 0.005% SDS; Lane 5: 0.01% SDS; Lane 6: 0.02% SDS; Lane 7: 0.04% SDS; Lane 8: 0.08% SDS. All concentrations are final reaction concentrations. The results indicate that the chimeric polymerase is tolerant to 0.02% SDS.

[0093] Figure 5 An exemplary TE tolerance test is shown. Lane 1: 0X; Lane 2: 0.03125X TE; Lane 3: 0.0625X TE; Lane 4: 0.125X TE; Lane 5: 0.25X TE; Lane 6: 0.5X TE; Lane 7: 1X TE; Lane 8: 2X TE. All concentrations are final reaction concentrations. The results indicate that the chimeric polymerase can tolerate 1X TE.

[0094] Figure 6The amplification of human gDNA at different sizes is illustrated. Lane 1: 1 kb; Lane 2: 2 kb; Lane 3: 3 kb; Lane 4: 4 kb TE; Lane 5: 5 kb; Lane 6: 6 kb; Lane 7: 7 kb; Lane 8: kb; Lane 9: 9 kb; Lane 10: 10 kb. The results indicate that chimeric polymerase can amplify long fragments. Detailed Implementation

[0095] Example

[0096] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated.

[0097] Unless otherwise specified, all materials and reagents used in the embodiments of this invention are commercially available products.

[0098] Example 1. Preparation of chimeric polymerase

[0099] 1. Cloning and building

[0100] 1.1 Primers:

[0101] The primers (numbered sequentially as SEQ ID NO: 600-647) required for the nucleotide sequences of the first domain SEQ ID NO: 576-583, the second domain SEQ ID NO: 584-591, and the third domain SEQ ID NO: 592-599 are shown in Table 1 below:

[0102] Table 1

[0103]

[0104]

[0105] 1.2 Main reagents: Plasmids were all obtained from plasmid templates stored in the laboratory; dNTPs (RK20120, ABclonal), Pfu-fast 2X PCR Master Mix (RK20652, ABclonal), 2X MultiF Seamless Assembly Mix (RK21020, ABclonal)

[0106] 1.3 Main instruments: Dongshenglong PCR instrument, ETC811; gel imaging system, Tianneng 1600; electrophoresis apparatus, EPS 300; shaker, VORTEX-5, Qilinbell; NanoDrop 1000, Thermo.

[0107] 2. Experimental Procedure

[0108] 2.1 PCR amplification

[0109] The reaction system was prepared and then rapidly transferred to a PCR instrument (Dongshenglong, ETC811) preheated to 95℃. The 50 μL reaction system is shown in Table 2 below:

[0110] Table 2

[0111] Components content <![CDATA[ddH2O]]> Add to 50μL Upstream primer (10 μM) 1μL Downstream primer (10 μM) 1μL Template DNA 10ng Pfu-fast 2X PCR Master Mix 25μL

[0112] PCR reaction procedure

[0113]

[0114] 2.2 Product Identification

[0115] Take 10 μL of the product, add 2 μL of 6X loading buffer, mix well, and then identify by 1% agarose gel electrophoresis at 150 V for 45 minutes. Check for correct bands under a gel imaging system.

[0116] 2.3 Product Purification

[0117] Purification was performed using a standard DNA product purification kit (Standard DNA Product Purification Kit, DP204, Tiangen Biotech (Beijing) Co., Ltd.).

[0118] 2.3.1 Before use, please add anhydrous ethanol to the rinsing solution PW.

[0119] 2.3.2 Column equilibration procedure: Add 500 μl of equilibration solution BL to the adsorption column CB2 (place the adsorption column in the collection tube), centrifuge at 12000 rpm (~13400×g) for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.

[0120] 2.3.3 Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, and add 5 times the volume of binding buffer PB, mixing thoroughly (no need to remove paraffin oil or mineral oil). Note: If the PCR reaction system is 50 μl (excluding the volume of paraffin oil), then add 250 μl of binding buffer PB.

[0121] 2.3.4 Add the solution obtained in the previous step to an adsorption column CB2 (place the adsorption column in the collection tube), incubate at room temperature for 2 min, centrifuge at 12000 rpm (~13400×g) for 30-60 s, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube. Note: The volume of the adsorption column is 800 μl. If the sample volume is greater than 800 μl, it can be added in batches.

[0122] 2.3.5 Add 600 μl of wash buffer PW to the adsorption column CB2 (please check that anhydrous ethanol has been added before use), centrifuge at 12000 rpm (~13400×g) for 30-60 seconds, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube. Note: If the purified DNA is to be used for salt-sensitive experiments, such as blunt end ligation experiments or direct sequencing, it is recommended to let it stand for 2-5 minutes after adding PW before centrifugation.

[0123] 2.3.6 Place the adsorption column CB2 back into the collection tube and centrifuge at 12000 rpm (~13400×g) for 2 min to remove as much wash solution as possible. Allow the adsorption column CB2 to air dry completely at room temperature for several minutes to prevent residual wash solution from affecting subsequent experiments. Note: Residual ethanol in the wash solution will affect subsequent enzyme reactions (enzyme digestion, PCR, etc.).

[0124] 2.3.77. Place the adsorption column CB2 into a clean centrifuge tube, add 30 μl of elution buffer EB dropwise to the center of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 12000 rpm (~13400×g) for 2 min to collect the DNA solution.

[0125] 2.4 Quantitative

[0126] Take 1 μL of the purified PCR product and place it on a Nanodrop 1000 for concentration determination.

[0127] 2.5 Connection

[0128] The connection was performed using ABclonal MultiF Seamless Assembly Mix (RK21020), and the specific reaction system is shown in Table 3 below:

[0129] Table 3

[0130] Components Added amount Total amount of inserted DNA 1 pmol Carrier volume 0.3 pmol 2X MultiF Seamless 10uL <![CDATA[ddH2O]]> Replenish to 20uL Total volume 20uL

[0131] Reaction Procedure

[0132] Assembly Fragments 24 segments reaction temperature 50℃ reaction time 60min

[0133] 2.6 Transformation

[0134] 2.6.1 Thawing competent cells (C2566, ABclonal) for cloning on ice

[0135] 2.6.2 Add 10 μL of the assembly product to 100 μL of competent cells, gently tap the tube wall to mix (do not shake to mix), and let stand on ice for 30 min; the conversion volume of the assembly product should not exceed 1 / 6 of the volume of competent cells used;

[0136] 2.6.3 After heat shock in a 42℃ water bath for 45 seconds, immediately place it on ice to cool for 2-3 minutes;

[0137] 2.6.4 Add 900 μL of SOC or LB medium (without antibiotics) and incubate at 37°C for 1 hour (200-250 rpm).

[0138] 2.6.5 Preheat the LB plates with the corresponding resistance in a 37°C incubator;

[0139] 2.6.6 Centrifuge at 5000 rpm for 5 min, discard 900 μL of supernatant, resuspend the bacterial cells, and spread them evenly on a plate containing the corresponding antibiotic using a sterile spreader.

[0140] 2.6.7 Incubate upside down in a 37℃ incubator for 12-16 hours.

[0141] 2.7 Sequencing

[0142] After overnight culture, hundreds of single clones can form on the plate, while the number of clones on the plate transformed from the negative control should be significantly less. Several single clones are selected for first-generation sequencing to identify them. Plasmids with correct sequencing results are then preserved and expressed.

[0143] 2. High-throughput expression and purification

[0144] 2.1 Main Reagents and Materials

[0145] (1) 96-well PCR plate (Axygen, catalog number: PCR-96m2-hs-c, sterilization not required), 48-well deep well plate (Sangon, catalog number F600480-0001, autoclave and dry before use), 96-well deep well plate (NEST, catalog number 503001, sterilization not required) and matching silicone cap (sterilization required), 96-well filter plate (Sangon, catalog number B615006, sterilization not required), quartz sand, DEAE packing material (GE), DNase I (Abclonal, catalog number: RK20538), 8-tube 100μL PCR tubes (Axygen, catalog number: PCR-0108-LP-RT-C).

[0146] (2) LB liquid culture medium (prepared by ABclonal)

[0147] (3) IPTG, Amp, 50% glycerin (prepared by ABclonal)

[0148] 2.2 Main Instruments

[0149] Clean bench (Sujing Antai, SW-CJ-1FD), refrigerated centrifuge (Xiangyi, L530R), small constant temperature shaker (Jingqi, IS-RSD81), gene amplification instrument (Dongsheng, ETC811), high-throughput tissue homogenizer (Shanghai Wanbai, Wonbio-96), microplate reader (SYNERG, H1), precision constant temperature water bath (Shanghai Yiheng, BWS-12), etc.

[0150] 2.3 Experimental Procedure

[0151] 2.3.1 Transformation of Recombinant Plasmids

[0152] (1) Sort the recombinant plasmids, 47 in each box, and arrange them in order.

[0153] (2) Place the 96-well PCR plate (unopened), 200ul yellow pipette tip, and alcohol sprayed into a sterile operating table in advance and sterilize with ultraviolet light for 30 minutes.

[0154] (3) Remove the 2566 competent cells from -80℃ and place them on ice to thaw (the number is calculated based on the number of transformations).

[0155] (4) Place a metal block of a 96-well plate on ice, place the 96-well PCR plate in the metal block, and dispense competent cells, 50 μL per well. Be careful to prevent contamination of the pipette tip.

[0156] (5) Mark the 96-well PCR plate, add 0.5-1 μL of the corresponding numbered plasmid, and place on ice for 20-30 min.

[0157] (6) Incubate the PCR instrument at 42°C for 90 seconds with the lid off.

[0158] (7) Place on ice for 3 minutes.

[0159] (8) Add 100 μL of LB containing Amp resistance (concentration 100 μg / mL), incubate at 37°C for 30-45 min, then transfer to a 96-well plate (add 600 μL-1 mL of LB containing Amp) and incubate overnight at 37°C and 700 rpm.

[0160] (9) Prepare a record form for strain preservation. The form should include: strain name, corresponding well position of each strain, 96-well plate number, culture time, operator, and any abnormal situations (no growth or wrong sample added, etc.).

[0161] 2.3.2 Induced Expression of High-Throughput Proteins

[0162] Take two 48-well deep-well plates and add 4 ml of LB medium containing Amp (100 μg / mL) to each well.

[0163] Transfer 100 μL of the overnight culture to a 48-well deep-well plate, label it, and place it on a constant temperature shaker at 37°C and 700 rpm. Add an equal volume of 50% glycerol (sterilized) to the remaining culture in the 96-well plate and freeze at -20°C to preserve the culture.

[0164] After culturing for 2.5–3 hours, 300 μL of bacterial culture was randomly taken from four wells on the outermost side of a 48-well plate and the OD was measured using an ELISA reader with ultrapure water as a control. 600 In OD 600 When the concentration reaches 0.8–0.9, add 0.5 mM IPTG (2 μL of 1 M / L IPTG solution) to each well and induce overnight at room temperature.

[0165] The next day, centrifuge the overnight induced 48-well plates at 4000 rpm for 30 minutes in a horizontal centrifuge. Immediately remove the plates, discard the supernatant, and shake them vigorously to remove excess water (the bacteria will adhere very firmly to the bottom of the 48-well plates and will not be shaken off). Store at -20°C.

[0166] Prepare a record table for induction expression. The table should include: strain number, corresponding well position for each strain, plate number, culture time, operator, and any abnormalities (no growth, no induction, incorrect placement, etc.).

[0167] 2.3.3 High-throughput crushing:

[0168] ① Remove the 48-well plate containing bacteria from the freezer and thaw it. Turn on the water bath in advance and set the temperature to 80℃. Add 700μL of lysis buffer (20mM Tris-HCl, 2.5mM MgCl2, pH=7.5@25℃) to each well and repeatedly pipette to fully suspend the bacteria.

[0169] ② The suspended bacteria were transferred into a 96-well deep well plate (NEST).

[0170] ③ Freeze the 96-well plate at -80℃ for 45 minutes until completely frozen. Remove it and place it on a small shaker at 37℃ and 700 rpm for 40 minutes until completely thawed. Then place the 96-well plate in an 80℃ water bath for 10 minutes.

[0171] ④ Repeat step ③ once.

[0172] ⑤ Remove the 96-well plate from the water bath and immediately freeze it at -80℃ for 45 minutes until completely frozen. After removing it, place it on a small constant-temperature shaker and shake at 37℃ and 700 rpm for 40 minutes until completely thawed. The freeze-thaw time in the above process needs to be adjusted according to the actual situation.

[0173] ⑥ Add 100 μL of quartz sand to each well (using 100 μL 8-tube PCR tubes), cover with a silicone cap (sterilized), place in a high-throughput tissue homogenizer (Shanghai Wanbai Biotechnology), tighten the metal cap, oscillate at 60 Hz for 60 s, for a total of 5 oscillations. After each oscillation, open the cap to allow for at least 5 minutes of cooling to prevent the lysis buffer from overheating and overflowing due to continuous oscillation.

[0174] ⑦ Centrifuge at 4000 rpm for 30 min, then use a multi-channel pipette (adjust to 500 μL) to transfer the supernatant to a 96-well filter plate. Place a 96-well deep-well plate below to collect the liquid. Secure the two plates with tape. Centrifuge at 3000 rpm for 2 min to remove impurities (precipitate will be drawn up during the transfer process).

[0175] 2.3.4 High-throughput purification:

[0176] ① After adding 1.5 μL of DNase I (ABclonal) to each well, place the 96-well plate on a small shaker and shake at 700 rpm for 5 min at room temperature to mix. Then place it in a water bath and incubate at 37°C for 2 h.

[0177] ② Take out the 96-well plate and add DTT to each well to a final concentration of 2 mM (1 μL of 1 M / L stock solution). Set the water bath temperature to 80℃. After the temperature stabilizes, place the 96-well plate in the water bath for 30 min to inactivate the DTT. After removing the plate, allow it to cool completely at 4℃ and centrifuge at 4000 rpm for 2 min.

[0178] ③Preparation of DEAE packing material:

[0179] Equilibration buffer: 10mM Tris-HCl, 190mM KCl, 0.1mM EDTA

[0180] Add 150 μL of pure packing material suspension to a 96-well filter plate (pure packing material volume = suspension volume x packing material percentage). Collect the liquid with a 96-well deep well plate below. Centrifuge at 3000 rpm for 2 min, discard the packing material storage solution, add 600 μL of ultrapure water to each well of the 96-well filter plate, centrifuge at 3000 rpm for 2 min, wash once with water, wash once with equilibration buffer, replace with a new 96-well deep well plate, and prepare for sample loading.

[0181] ④ DEAE loading: Add KCl solution (final concentration 190mM, 34uL of 3M KCl solution (Vetec) to each well) to the inactivated protein sample, place in a small shaker at room temperature, and shake at 700rpm for 5min. Transfer the sample to the equilibrated DEAE packing material (96-well filter plate) using a pipette, ensuring each well is correctly positioned. Secure the 96-well filter plate and the 96-well deep-well plate below it with tape, place in a small constant-temperature shaker, and shake at 1000rpm for 2h at room temperature. Centrifuge at 3000rpm for 2min to obtain the purified protein sample, and store temporarily at 4℃.

[0182] 2.3.5 SDS-PAGE Identification

[0183] Samples were taken from a 96-well PCR plate for testing.

[0184] 1. Sample preparation: 7 μL protein + 7 μL 2X SDS loading buffer

[0185] 2. Electrophoresis conditions: Use 15-well SDS-PAGE gel (separating gel concentration 12%), and load 10 μL of sample into each well.

[0186] Electrophoresis at a constant voltage of 200V for 36 minutes, followed by Coomassie brilliant blue staining for 2 minutes, destaining, and photographing.

[0187] 3. Results processing: Mark the sample number and position on the plate (including the number of 96-well plates) on the gel image, and statistically analyze the results.

[0188] 2.3.6 Protein Concentration Determination

[0189] 1. Remove Bradford working solution from the 4°C freezer and allow it to reach room temperature before use.

[0190] 2. Take a 12-tube tube and dilute the standard according to Table 4 below.

[0191] Table 4

[0192] 1X PBS (ul) 100 95 90 80 70 60 50 40 25 10 0 2 mg / mL BSA (ul) 0 5 10 20 30 40 50 60 75 90 100 Final BSA concentration (mg / mL) 0 0.1 0.2 0.4 0.6 0.8 1 1.2 1.5 1.8 2

[0193] 3. Take a 96-well microplate and add 10 μL of standard and sample to each well. Set up one replicate for each standard and sample.

[0194] 4. Add 200 μL of Bradford working fluid to each well.

[0195] 5. Place the plate in an ELISA reader and shake for 30 seconds, let it stand for 5 minutes, and then measure A595.

[0196] 6. Plot a standard curve in Excel software with the average value of the standard group A595 as the x-axis and the corresponding protein concentration as the y-axis.

[0197] 7. Calculate the protein concentration based on the average A595 value of the sample and the Excel curve.

[0198] Example 2. Application Test of Chimeric Polymerase

[0199] The sequence tested in this embodiment is SEQ ID NO: 278. Specifically, its polymerase magnesium ion tolerance, TE buffer tolerance, SDS tolerance, and long fragment amplification ability were tested.

[0200] 1. Template and primers

[0201] The templates used in this embodiment are Escherichia coli gDNA and human gDNA. The target gene of the Escherichia coli gDNA is 16S and has a size of 400-500bp (template extracted by Tiangen reagent kit); the target fragment of the human gDNA has a size of 0.5kb-10kb (extracted by Tiangen reagent kit).

[0202] The primers used in the experiment (SEQ ID NO: 648-669, synthesized by Sangon Biotech) are shown in Table 5 below:

[0203] Table 5: Amplification Primers

[0204]

[0205] 2. PCR reaction system

[0206] Place the above template, primers, dNTPs (source), enzyme, buffer (source), and PCR tubes on ice to prepare the reaction system shown in Table 6 below.

[0207] Table 6: PCR reaction system

[0208] Components 50μL 5X Reaction Buffer 25μL Upstream primer (10 μM) 1μL Downstream primer (10 μM) 1μL dNTP (10mM) 1μL DNA template 10ng polymerase 50ng Nuclease-free Water Up to 50 μL

[0209] The 1X buffer consisted of: 20 mM Tris-HCl, pH 8.8, 10 mM (NH4)2SO4, 1.5 mM MgSO4, and 100 mM KCl. The final concentration of dNTPs was 200 μM, and the final concentration of primers was 200 nM. The amount of template added was 10 ng.

[0210] 3. Reaction Procedure

[0211] The PCR reaction procedure is shown in Table 7 below. The following procedure was performed on the PCR instrument (Dongshenglong, E811):

[0212] Table 7: PCR reaction procedure

[0213]

[0214] 4. Experimental Results

[0215] 4.1 For Mg 2+ The tolerance range was determined, with a final concentration of 0-10 mM MgCl2. The results are shown in the attached figure. Figure 3 As shown.

[0216] 4.2 The tolerance range for SDS, with a final concentration of 0-0.02% SDS, is shown in the attached figure. Figure 4 As shown.

[0217] 4.3 The tolerance range for TE buffer is 0-1X, and the results are shown in the attached figure. Figure 5 As shown.

[0218] 4.4 For amplifying human gDNA, up to 10kb can be achieved; results are shown in the attached figure. Figure 6 As shown.

[0219] The specific methods and compositions described herein represent preferred embodiments and are exemplary, and are not intended to limit the scope of the invention. Other objects, aspects, and embodiments will occur to those skilled in the art upon consideration of this specification, and are included within the spirit of the invention as defined by the claims. It will be apparent to those skilled in the art that various substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention described illustratively herein can be practiced appropriately without any elements or limitations specifically disclosed herein as necessary. Therefore, for example, in each instance herein, in embodiments or examples of the invention, any of the terms “comprising,” “including,” “containing,” etc., should be read broadly and without limitation. The steps described herein can be practiced in different sequences of steps, and they are not necessarily limited to the order indicated herein or in the claims. Unless the context clearly indicates otherwise, “a” and “the” include plural forms, and plural forms include singular forms. In no event shall any statement made by any examiner or any other officer or employee of the Patent and Trademark Office be construed as a limitation on the patent, unless such statement is explicit and unconditionally or reservedly adopted by the applicant in the respondent writing.

[0220] The invention has been described broadly and generally herein. Each narrower group of categories and subcategories falling within the general scope of disclosure also constitutes part of the invention. The terms and expressions used are used as descriptive rather than restrictive terms, and are not intended to exclude any equivalents of the features shown and described or portions thereof, but this is to be understood. Various modifications can be made within the scope of the claimed invention. Therefore, it should be understood that although the invention has been specifically disclosed by way of preferred embodiments and optional features, modifications and variations can be made to the concepts disclosed herein by those skilled in the art, and such modifications and variations can be considered as limitations on the invention. This is within the scope of the invention as defined by the appended claims.

[0221] nucleotide sequence

[0222] SEQ ID NO: 575

[0223]

Claims

1. A DNA polymerase with DNA replication activity, the encoding nucleotide sequence shown in SEQ ID NO:

278.

2. A nucleic acid encoding the DNA polymerase according to claim 1.

3. A nucleic acid construct comprising the nucleic acid according to claim 2.

4. A host cell comprising the nucleic acid according to claim 2 or the nucleic acid construct according to claim 3.

5. A kit comprising the DNA polymerase according to claim 1, the nucleic acid according to claim 2, the nucleic acid construct according to claim 3, or the host cell according to claim 4.

6. A composition comprising the DNA polymerase according to claim 1.

7. A method for amplifying nucleic acids, the method comprising amplifying a DNA sequence using the DNA polymerase according to claim 1, the kit according to claim 5, or the composition according to claim 6.

Citation Information

Patent Citations

  • Chimeric DNA polymerases

    CN102257136A

  • DNA of coded DNA polymerase separated from thermophilic bacteria

    CN103898131A

  • High fidelity DNA polymerase and preparation and application thereof

    CN104250641A

  • Chimeric DNA polymerase

    JP2012507986A

  • Synthon formation

    CN107075511A