Diagnosis based on type iii crisper / cas

By utilizing cOA formation and inorganic pyrophosphatase in the type III CRISPR/Cas system, combined with cOA-dependent nonspecific nucleases, the targeting problem of the type III CRISPR/Cas system in RNA detection has been solved, enabling rapid and stable nucleic acid detection and biosensor applications at high temperatures.

CN114207145BActive Publication Date: 2026-03-20SCOOP BIOSCIENCES LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-06-19
Publication Date
2026-03-20

AI Technical Summary

Technical Problem

Existing CRISPR/Cas systems primarily target DNA, while type III CRISPR/Cas systems target RNA but lack cleavage activity, making them difficult to apply to nucleic acid detection, especially RNA detection.

Method used

Using a type III CRISPR/Cas system, the Cas10 protein catalyzes the formation of cyclic oligoadenylates (cOA), and combines inorganic pyrophosphatase and cOA-dependent nonspecific nucleases. The cOA level is determined indirectly or directly by detecting pyrophosphate/ester or inorganic phosphate levels, thereby detecting target nucleic acid molecules.

Benefits of technology

It enables rapid and stable RNA detection at high temperatures, and can identify and quantify target nucleic acid molecules in samples, making it suitable for isothermal detection and biosensor applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003496212510000131
    Figure BDA0003496212510000131
  • Figure BDA0003496212510000141
    Figure BDA0003496212510000141
  • Figure BDA0003496212510000151
    Figure BDA0003496212510000151
Patent Text Reader

Abstract

The present invention relates to a clustered regularly interspaced short palindromic repeats (CRISPR) based ribonucleic acid detection system. The present invention further relates to a method for determining the presence or absence of a target nucleic acid molecule in a sample by means of the system, and to a device comprising a ribonucleic acid detection system according to the present invention.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present invention relates to CRISPR / Cas related nucleic acid detection systems and their broad use in diagnostic applications. BACKGROUND

[0002] In the past decade, several breakthrough discoveries in the field of molecular biology have had an impact far beyond their own field. Without a doubt, CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR / associated genes) can be considered one of these discoveries. The CRISPR / Cas system was identified as a prokaryotic adaptive immune system, providing sequence-specific defense against foreign genetic elements such as phages and plasmids. However, the CRISPR / Cas system allows for genetic interference in most, if not all, organisms, which will have a tremendous impact on all technical fields.

[0003] The CRISPR defense can be described as a process consisting of three stages: adaptation, expression and interference (Rath et al., 2015. Biochimie 117: 119-128; Makarova et al., 2011. Nat Rev Microbiol 9: 467-477). In the adaptation stage, genetic fragments are acquired from foreign invading entities and stored in the CRISPR reservoir (Jackson et al., 2017. Science 356: eaa15056). This reservoir contains foreign DNA sequences called spacers, which are separated by repeated DNA sequences (repeaters). Expression of the CRISPR locus (stage II) leads to the transcription of long RNA molecules, which are subsequently processed into multiple CRISPR RNAs (crRNAs) (Brouns et al., 2008. Science 321 : 960-964). In addition, the cell expresses Cas proteins, which are effectors of the CRISPR / Cas system, by binding to crRNAs to form ribonucleoprotein (RNP) complexes. Once a foreign genetic element is detected due to sequence complementarity with a crRNA, the associated Cas protein will degrade the invading entity using its nuclease activity, which is often described as the interference stage of the CRISPR defense process.

[0004] Due to the extensive research on CRISPR / Cas over the past decade, a large number of systems have been discovered in the bacterial and archaeal kingdoms (Fenner et al., 2007. J Biomol Screen 20: 1027-1039; van der Oost et al., 2009. Trends Biochem Sciences 34: 401-407). The CRISPR / Cas systems have been classified. Class I systems utilize a multi-subunit Cas complex, whereas class II systems use only a single Cas protein to mediate its activity. Different types are generally characterized based on the presence of signature genes (Wright et al., 2016. Cell 164: 29-44).

[0005] In contrast to the differences that can distinguish many CRISPR / Cas systems, the vast majority of systems share functional similarities. Almost all CRISPR / Cas types function as DNA-targeting RNPs, which can be related to the large number of DNA-based invasive entities. In contrast, RNA-based invasive elements are not common in the prokaryotic world. Thus, type III CRISPR / Cas systems have evolved to target RNA sequences, which is somewhat surprising (Wright et al., 2016. Cell 164: 29-44; Hale et al., 2009. Cell 139: 945-956). Studies attribute this unusual activity to the degradation of the transcriptional products of invading phages, thus preventing them from lysing the cell (Jiang et al., 2016. Cell 164: 710-721; Goldberg et al., 2014. Nature 514: 633-637). Type III systems belong to class I, meaning that the RNPs are composed of multiple subunits.

[0006] With three different types of nuclease activity, type III systems can be considered unique. In addition, the production of the messenger molecule cyclic oligoadenylate (cOA) is not attributed to any other CRISPR / Cas system. Utilizing these features can yield new methods of visualizing target recognition, which makes type III systems suitable for application in novel diagnostic tools. SUMMARY

[0007] The present invention provides a detection system for clustered regularly interspaced short palindromic repeats (CRISPR) based ribonucleic acids comprising a) an effector complex comprising a type III CRISPR-associated effector protein (Cas) and at least one CRISPR RNA (crRNA) binding to a target nucleic acid molecule and b) means for directly or indirectly determining the level of cyclic oligoadenylate (cOA). The type III Cas in the detection system is preferably a type IIIB Cas, preferably a type IIIB Cmr. The type III Cas is preferably from a thermophylic organism such as Thermus thermophilus.

[0008] The type III Cas is preferably cleavage-dead (e.g. by D26N mutation of the Cmr4 subunit or an equivalent mutation of another subunit). Further preferred cleavage-dead mutations include Cmr4 D26A, E227A and E228 double mutation of Cmr4, and Cmr4 D86A (Ramia et al., 2014. Cell Reports 9: 1610-1617; Zhu and Ye, 2015. Nucleic Acids Res 43: 1257-1267). Furthermore, Csm3 D32A is a good candidate for a cleavage-dead type IIIA Csm mutation (Samai et al., 2015. Cell 161: 1164-1174).

[0009] In a preferred detection system according to the present invention, the means for directly or indirectly determining the level of cOA comprises means for determining the level of pyrophosphate (PPi). A preferred detection system according to the present invention can further comprise an inorganic pyrophosphatase. The inorganic pyrophosphatase is preferably from a thermophylic organism such as Thermus thermophilus, making it compatible with the preferred type III CRISPR / Cas system and allowing for isothermal detection.

[0010] A preferred detection system according to the present invention further comprises a cOA-dependent non-specific effector endoribonuclease such as Csxl.

[0011] A preferred detection system according to the present invention further comprises a cOA-dependent non-specific effector endoribonuclease such as Csxl and a detectable substrate for said endoribonuclease.

[0012] The present application further provides a method for determining the presence or absence of a target nucleic acid molecule in a sample, said method comprising: providing the sample with a ribonucleic acid detection system according to the present application; incubating the sample under conditions allowing the binding of the crRNA to its target nucleic acid molecule; and determining the level of cyclic oligoadenosine (cOA) directly or indirectly, whereby an increase in the determined level of cOA compared to a control indicates the presence of the target molecule in the sample.

[0013] The level of cOA is determined by determining the level of pyrophosphate or, in case of the presence of an inorganic pyrophosphatase in the detection system, the level of inorganic phosphate. The level of pyrophosphate or inorganic phosphate is determined by a colorimetric, fluorometric, fluorescent or bioluminescent assay.

[0014] The level of cOA is determined indirectly by detecting a detectable substrate for the effector ribonuclease enzyme, such as Csx1.

[0015] A preferred method according to the present application comprises incubating the sample with the ribonucleic acid detection system at a temperature between 37°C and 85°C, preferably at about 65°C.

[0016] The present application further provides a device comprising a ribonucleic acid detection system according to the present application. The device preferably comprises a plurality of arranged ribonucleic acid detection systems according to the present application. The plurality of arranged ribonucleic acid detection systems preferably have different target nucleic acid molecules.

[0017] The present application further provides a kit of parts comprising a) an effector complex comprising a type III CRISPR-associated effector protein (Cas) and at least one CRISPR RNA (crRNA) that binds to a target nucleic acid molecule, and b) means for determining the level of cyclic oligoadenosine (cOA) directly or indirectly. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Codons of Cmr Cas proteins optimized using the IDT Codon Optimization Tool (available at eu.idtdna.com / codonopt).

[0019] Figure 2 Alignment of Cmr and Csm sequences.

[0020] Figure 3 In vitro RNase activity assay with endogenous and reconstituted TtCmr complex. (A) Denaturing polyacrylamide gel electrophoresis (PAGE) analysis of activity assay using 5'-phospho-32 labeled target RNA complementary to crRNA incubated with endogenous TtCmr complex. Single stranded RNA marker ("M") was used as size standard as indicated on the left. (B) Similar to A activity assay but using reconstituted complex.

[0021] Figure 4 (A) RNase activity of TtCmr is not affected by target mismatches at the first guide nucleotide of crRNA. (B) cOA production is significantly affected by mismatches at 1, 2, and 5 nucleotide positions.

[0022] Figure 5 cOA production assays using A) TtCmr40 and B) TtCmr46 incubated with target RNA (Table 4) with mismatches at the indicated nucleotide positions.

[0023] Figure 6 Flexible seed region at the 3' end of crRNA. Target RNA degradation and cOA production assays using (A) endogenous TtCmr ("TtCmr") or reconstituted TtCmr complex with (B) 46 nucleotide (nt) crRNA ("TtCmr-46") or (C) 40 nt crRNA ("TtCmr-40") incubated with target RNA (Table 4) with mismatches in the indicated fragments.

[0024] Figure 7 Base pairing of target RNA to crRNA of TtCmr starts at the 3' end of crRNA. (A) Electrophoretic mobility shift assay (EMSA) analysis of endogenous TtCmr complex incubated with different target RNAs (Table 4) each containing a stretch of 5 nt mismatched to the crRNA of TtCmr. (B) EMSA analysis of endogenous TtCmr complex incubated with 11 nt short target RNAs (Table 4) complementary to the indicated nucleotides of the crRNA of TtCmr.

[0025] Figure 8: A) Absorbance of the colorimetric output of the Pi detection by Cmr as determined by the range of target RNA concentrations added as indicated. Reaction time was set to 1 hour and color development time was set to 30 minutes (direct detection of cOA using Malachite Green assay). B) Absorbance of the colorimetric output of the target RNA detection by determining the fold increase of Pi levels over time (direct detection of cOA using Malachite Green assay). C) Detection of cOA mediated RNase activity of Csx1 using ssRNA and ssDNA quencher fluorophore sequences (indirect cOA detection).

[0026] Figure 9 : Sensitivity range of the Thermus thermophilus type IIIB Cmr system for the natural target RNA 4.5. Target recognition was monitored using the indirect cOA visualization method. Random RNA of similar length was used as negative off-target control.

[0027] Figure 10 : Sensitivity range of the Thermus thermophilus type IIIB Cmr system containing the Cmr4 D26N mutation for the natural target RNA 4.5. Target recognition was monitored using the indirect cOA visualization method. Random RNA of similar length was used as negative off-target control.

[0028] Figure 11 : Comparison of the norovirus target RNA limit of detection for the wild type Cmr complex and the dCmr complex. Target recognition was monitored using the indirect cOA visualization method. The raw signal output of the assay is shown. Random RNA of similar length was used as negative off-target control.

[0029] Figure 12 : cOA produced by type IIIA CRISPR / Cas complex upon addition of complementary target RNA.

[0030] Figure 13 : Results from one-pot SARS-CoV-19 N gene detection assay. This graph shows data from the "signal production incubation" at 65°C.

[0031] Figure 14 : Results from one-pot SARS-CoV-19 N gene detection assay from a mink sample. This graph shows data from the "signal production incubation" at 65°C. DETAILED DESCRIPTION

[0032] 4.1, Definitions

[0033] As used herein, the term "Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)" refers to one or more specific DNA regions in the genomes of prokaryotic microorganisms. These regions are characterized by the presence of nucleotide repeats interspersed with spacer sequences, typically ~25-~38 bp direct DNA repeats separated by unique spacer sequences of similar length (Grissa et al., 2007) that are derived from previous encounters with invading elements. They serve as a memory to quickly attack these invaders the next time around. The genomic region includes one or more CRISPR-associated effector protein (Cas) encoding genes located near the CRISPR locus.

[0034] As used herein, the term "CRISPR crRNA" refers to a CRISPR-derived RNA molecule comprising a spacer sequence and 5 and 3 repeat-derived ends. The CRISPR crRNA is preferably at least 30 nucleotides in length, more preferably at least 34 nucleotides in length, more preferably at least 40 nucleotides in length, more preferably at least 46 nucleotides in length. The CRISPR crRNA is preferably less than 1000 nucleotides in length, preferably less than 200 nucleotides in length, preferably less than 100 nucleotides in length. The RNA molecule can include ribonucleic acid nucleotide analogs (e.g., inosine, uridine, xanthine, hypoxanthine, 2,6-diaminopurine, and 6,8-diaminopurine-based ribonucleotides and deoxyribonucleotides).

[0035] As used herein, the term "CRISPR-associated effector protein (Cas)" refers to a protein that associates with a CRISPR crRNA. The CRISPR / Cas system is currently divided into two classes. Class I systems use a multi-subunit Cas complex, whereas class II systems use a single Cas protein to mediate its activity. Type III CRISPR-Cas systems of class I have evolved to target RNA sequences in particular. The unique proteins in these systems are Cas3 in class I systems, Cas9 in class II systems, and CaslO in class I type III systems.

[0036] As used herein, the term "effector complex" refers to a CRISPR-Cas ribonucleoprotein complex that has nuclease activity and can cleave and inactivate an invading nucleic acid sequence comprising a sequence complementary to the spacer sequence in the CRISPR crRNA.

[0037] As used herein, the term“cyclic oligoadenylate (cOA)” refers to a cyclic structure containing 3-6 molecules of Adenosine Mono Phosphate (AMP). Formation of cOA is catalyzed by the cyclase domain of CaslO, which is part of the Type III effector system.

[0038] As used herein, the term“Type III Cas” refers to an RNA-targeting, multi-subunit CRISPR-associated complex comprising at least a CaslO protein.

[0039] As used herein, the term“Type III A Cas” refers to an RNA-targeting Type 3 CRISPR / Cas complex that has non-specific DNase activity when bound to a target RNA molecule. Type III A Cas includes Type III A Csm complexes such as from Staphylococcus thermophilus, Thermus thermophilus, and Staphylococcus epidermis.

[0040] As used herein, the term“Type III B Cas” refers to an RNA-targeting Type 3 CRISPR-Cas complex that lacks non-specific DNase activity. The Type III B Cas complex consists of 6-7 proteins. Type III B Cas includes Type III B Cmr complexes such as from Pyrococcus furiosus, Thermus thermophilus, and Sulfolobus solfataricus.

[0041] As used herein, the term“PPi” or phosphonato phosphate refers to a salt or ester of pyrophosphate. Alternative names are pyrophosphate, diphosphate, and dimeric phosphate.

[0042] As used herein, the term“inorganic pyrophosphatase” or inorganic diphosphatase refers to an enzyme that catalyzes the conversion of one ion of pyrophosphate to two phosphate ions. This enzyme belongs to the class of EC 3.6.1.1 enzymes.

[0043] As used herein, the term "cOA-dependent non-specific effector endoribonuclease" refers to a ribonuclease that non-specifically degrades RNA using a HEPN (Higher Eukaryotes and Prokaryotes, Nucleotide binding) active site. These nucleases are activated by binding to messenger cOA using their CRISPR-associated Rossmann fold (CARF) domain. Examples of such non-specific effector ribonucleic endonucleases are the Cas helper proteins Csx1 and Csm6.

[0044] As used herein, the term "biosensor" or "biological sensor" refers to a sensing device containing a CRISPR-based ribonucleic acid system according to the present application. The signal (e.g. colorimetric, fluorometric, fluorescent or bioluminescent signal) generated upon interaction of the CRISPR-based ribonucleic acid system with the RNA molecule complementary to the crRNA can be coupled to a transducer, allowing quantification of the signal. The signal is preferably converted into a measurable electrical parameter (e.g. current or voltage) by a suitable transducer.

[0045] 4.2. CRISPR / Cas-based ribonucleic acid detection system

[0046] In one aspect, the present application provides a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based ribonucleic acid (RNA) detection system. The system comprises an effector complex comprising a Type III CRISPR-associated effector protein and at least one CRISPR RNA (crRNA) that binds to a target nucleic acid molecule, and means and methods for determining the level of cyclic oligoadenylate (cOA) directly or indirectly.

[0047] The CRISPR / Cas-based ribonucleic acid detection system is preferably derived from a thermophilic organism (e.g. Pyrococcus furiosus, Sulfolobus solfataricus or Thermus thermophilus). An advantage of a CRISPR / Cas-based ribonucleic acid detection system from a thermophilic organism is that the detection can be performed at high temperatures (e.g. between 40°C and 80°C, preferably between 50°C and 70°C, such as between 55°C and 65°C, preferably about 65°C). Incubation at such temperatures can accelerate the cOA synthesis reaction compared to incubation at lower temperatures. Furthermore, the high temperature can inactivate nucleases (e.g. DNase, RNase) or proteases present in the sample.

[0048] In addition, the advantages of the CRISPR / Cas-based ribonucleic acid detection system from thermophilic organisms can provide the system with improved stability (e.g., the system can be stored for a longer time when compared to a CRISPR / Cas-based ribonucleic acid detection system from mesophilic organisms).

[0049] The ribonucleic acid detection system is based on the prokaryotic CRISPR / Cas system that constitutes an acquired immune system to protect prokaryotic cells from invading viruses and plasmids, which is analogous to the eukaryotic RNA interference (RNAi) system (Makarova et al., 2006. Biol Direct 1: 1-7). The CRISPR-Cas immune response consists of three distinct stages: 1) adaptation, through which a portion of the target DNA of the invader is excised and inserted into the CRISPR array; 2) expression and maturation of CRISPR (cr) RNA and binding of the CRISPR / Cas complex; and 3) interference when the crRNA is used as a guide to recognize a sequence complementary to the mature CRISPR sequence in the invading genome of the virus or plasmid, followed by cleavage and inactivation of the foreign nucleic acid by the Cas nuclease.

[0050] The general structure of the type III CRISPR / Cas complex includes multiple subunits of Cas7 and Cas11 (Staals et al., 2013. mol. Cell 52: 135-145; Staals et al., 2014. mol. Cell 56: 518-530), which are capped off on one side by Cas5 and Cas10. Among them, Cas7 provides RNase activity when recognizing the target RNA by the pre-loaded RNA guide.

[0051] Target recognition has been shown to promote the production of cyclic oligoadenylate (cOA) by the Palm domain of CaslO (Kazlauskiene et al., 2017. Science 357:605-609; Niewoehner et al., 2017. Nature 548:543-548). While cOA species are known signal molecules in eukaryotes, this activity has not been reported in prokaryotic hosts. However, the studies indicate that the presence of cOA greatly increases the RNase activity of Csm6 or Csx1 family members. These proteins are usually encoded on type III loci but are not directly associated with the ribonucleoprotein complex. Instead, recognition of the invader RNA transcript can result in targeted RNA degradation by Cas7, non-specific DNA degradation by CaslO of type IIIA, and production of cOA that activates Csm6 or Csx1, thereby causing collateral cleavage of nearby other single-stranded RNA molecules.

[0052] The method for directly determining the level of cOA preferably comprises a method for determining the level of pyrophosphate or PPi. The formation of pyrophosphate is associated with the formation of cOA from ATP by CRISPR / Cas related proteins, such as CaslO. The formation of cOA consisting of 3-6 AMP units results in the simultaneous formation of 3-6 PPi molecules.

[0053] Alternatively, the detection system according to the application can comprise an inorganic pyrophosphatase, such that the PPi molecules are broken down and two inorganic phosphate molecules are formed per PPi molecule. Thus, by determining the level of inorganic phosphate, the number of molecules can be detected to expand from 1 molecule of cOA to 6-12 Pi molecules.

[0054] A preferred inorganic pyrophosphatase is an enzyme that is active at the same or similar temperature as the type III CRISPR / Cas based RNA detection system. Furthermore, it is preferred that the inorganic pyrophosphatase is active under the same or similar conditions as the type III CRISPR / Cas based RNA detection system, including under the same or similar pH and the same or similar salt concentration. For example, in case the type III CRISPR / Cas based RNA detection system has an optimal activity at 50°C, it is preferred that the inorganic pyrophosphatase is active at this temperature. Preferably, the activity of the inorganic pyrophosphatase at 50°C is such that substantially all PPi molecules are broken down into inorganic phosphate molecules. Said breakdown is preferably instantaneous. Likewise, the activity of the inorganic pyrophosphatase at the chosen pH and salt concentration is such that substantially all PPi molecules are broken down into inorganic phosphate molecules. Said breakdown is preferably instantaneous.

[0055] Preferred inorganic pyrophosphatases are derived from thermophilic organisms (e.g., Pyrococcus furiosus, sulfur-bearing fungi, and thermophilic bacteria), which allow for simultaneous isothermal detection. This allows for the direct determination of cOA levels by identifying Pi levels.

[0056] PPi and Pi can be detected using methods known in the art, including colorimetric, fluorescence-based, fluorescence-based, or bioluminescent assays.

[0057] Suitable methods for determining PPi levels include fluorescence assays and / or colorimetric pyrophosphate / ester (PPi) test kits (Biovision Inc., Milpitas, CA); fluorescence... Pyrophosphate / ester assay kit (Thermfisher Sciential; Waltham, MA); fluorescence-based pyrophosphate / ester assay kit (Sigma-Aldrich, Saint Louis, MO); and luminescent PPiLight. TM Experiment (Lonza Group aG, Bazel, Switcher).

[0058] Suitable methods for determining inorganic phosphate / ester or Pi levels include colorimetric methods such as PiColorLock. TM Experiments (Epedeon, Cambridge, UK); colorimetric Malachite Green phosphate / ester assay kit (Sigma-Aldrich, Saint Louis, MO); fluorescent phosphate / ester sensor (Thermfisher Sciential; Waltham, MA); luminescent ADP-ATP conversion reader (US Patent Application US20140273036A); fluorescent chemiluminescent sensor (Meng et al., 2015. RSC Advances 5: 53189-53197); and photoluminescent graphene quantum dots bound to europium ions (Bai et al., 2013. Chemistry 19: 3822-3826).

[0059] These methods and components for directly determining cyclic oligoadenylate (cOA) levels preferably include at least one substrate, and if desired, an enzyme that allows for at least one of the indicated detection methods for PPi or Pi.

[0060] The preferred method is colorimetric assay (e.g., Malachite Green phosphate / ester assay kit), which serves as a direct determination of CoA levels and allows for rapid determination of PPi or Pi levels.

[0061] The method for indirectly determining the level of cOA preferably comprises a method for determining the activity of a cOA-dependent non-specific effector nuclease, such as CRISPR-assisted nuclease 1 (Can1) or Can2, and preferably a method for determining the activity of a cOA-dependent non-specific effector endoribonuclease, such as Csx1. To this end, the detection system according to any of the present application preferably comprises a cOA-dependent non-specific effector endoribonuclease, such as Csx1.

[0062] The cOA-dependent non-specific effector nuclease, preferably endoribonuclease, is preferably an enzyme that is active at the same or similar temperature as the type III CRISPR / Cas-based RNA detection system. Further, preferably, the cOA-dependent non-specific effector endoribonuclease is active under the same or similar conditions, including the same or similar pH and the same or similar salt concentration, as the type III CRISPR / Cas-based RNA detection system. For example, in case the type III CRISPR / Cas-based RNA detection system has optimal activity at 65 °C, preferably the cOA-dependent non-specific effector endoribonuclease is active at this temperature. Preferably, the activity of the cOA-dependent non-specific effector endoribonuclease at 65 °C is such that the cOA-induced activity of the cOA-dependent non-specific effector endoribonuclease results in a detectable amount of reaction product of the substrate of the cOA-dependent non-specific effector endoribonuclease. Similarly, at the selected pH and salt concentration, the activity of the cOA-dependent non-specific effector endoribonuclease is such that the cOA-induced activity of the cOA-dependent non-specific effector endoribonuclease results in a detectable amount of reaction product of the substrate of the cOA-dependent non-specific effector endoribonuclease.

[0063] The substrate for the cOA-dependent non-specific effector endoribonuclease is preferably an RNA molecule, the cleavage of which can be detected. The detection can be performed by any method known in the art. For example, the detection can be performed directly by mass spectrometry, such as ultra-high performance liquid chromatography (UHPLC) coupled to tandem mass spectrometry (LC-MS / MS) in positive electrospray ionization mode. LC-MS / MS analysis can be performed by, for example, using a high-end UHPLC chromatography system coupled to a triple quadrupole mass spectrometer.

[0064] The detection can further be performed by liquid-liquid phase separation (LLPS; Spoelstra et al., 2018. BioRxiv, CSHL (doi.org / 10.1101 / 471482)).

[0065] A preferred substrate for cOA-dependent non-specific effector endoribonucleases is an RNA molecule labeled at one end with a fluorescent reporter and at the other end with a quencher. The reporter is in close proximity to the quencher to prevent detection of its fluorescence. Cleavage of the substrate by the activity of the cOA-dependent non-specific effector endoribonuclease disrupts the proximity of the reporter-quencher, thus allowing the emission of unquenched fluorescence, which can be detected upon laser excitation. Therefore, an increase in the activity of the cOA-dependent non-specific effector endoribonuclease results in a proportional increase in fluorescence due to cleavage of the substrate and removal of the quencher from the fluorescent reporter.

[0066] In addition to, or independently from, the activation of non-specific effector ribonucleases, the level of target recognition can also be determined by determining the activation of non-specific effector DNase activity present in the Type IIIA CRISPR / Cas effector complex using a suitable substrate for said nuclease. The suitable substrate is preferably a DNA molecule labeled at one end with a fluorescent reporter and at the other end with a quencher. The reporter is in close proximity to the quencher to prevent detection of its fluorescence. Cleavage of the substrate by the activity of the cOA-dependent non-specific effector DNase disrupts the proximity of the reporter-quencher, thus allowing the emission of unquenched fluorescence, which can be detected upon laser excitation. Therefore, an increase in the activity of the cOA-dependent non-specific effector DNase results in a proportional increase in fluorescence due to cleavage of the substrate and removal of the quencher from the fluorescent reporter. Both the activation of non-specific effector ribonucleases and the activation of non-specific effector DNases allow the determination of the presence or absence of two independent target RNA molecules in a single assay, provided that two independent riboprotein complexes are used, one of which specifically activates the non-specific effector DNase and the other allows the indirect or direct determination of the level of cOA. The skilled person will understand that, for this, the fluorescent tags present on the substrates by the activation of cOA-dependent non-specific effector endoribonucleases and non-specific effector DNases must be sufficiently differentiated to allow the determination of the level of each activity as a measurement method for the determination of the level of cOA.

[0067] Preferred fluorescent labels can be selected from Atto 425 (ATTO-TEC GmbH, Siegen, Germany), Atto 647N (ATTO-TEC GmbH, Siegen, Germany), Yakima Yellow (Epoch Biosciences Inc, Bothell, WA, USA), Cal610 (BioSearch Technologies, Petaluma, CA, USA), Cal635 (BioSearch Technologies, Petaluma, CA, USA), FAM (Thermo Fisher Scientific Inc., Waltham, MA USA), TET (Thermo Fisher Scientific Inc., Waltham, MA USA), HEX (Thermo Fisher Scientific Inc., Waltham, MA USA), cyanine dyes (e.g. Cy5, Cy5.5, Cy3, Cy3.5, Cy7 (Thermo Fisher Scientific Inc., Waltham, MA USA)), Alexa dyes (Thermo Fisher Scientific Inc., Waltham, MA USA), Tamra (Thermo Fisher Scientific Inc., Waltham, MA USA), ROX (Thermo Fisher Scientific Inc., Waltham, MA USA), JOE (Thermo Fisher Scientific Inc., Waltham, MA USA), fluorescein isothiocyanate (FITC, Thermo Fisher Scientific Inc., Waltham, MA USA), Yakima Yellow (Epoch Biosciences, Bothell, Washington) and tetramethylrhodamine (TRITC, Thermo Fisher Scientific Inc., Waltham, MA USA). The substrate is preferably labeled with a detectable label, preferably a fluorescent label, at the 5' end.

[0068] ​Quenchers (e.g. tetramethylrhodamine TAMRA, Dihydroxycarbopyronoid tripeptide minor groove binder) are known in the art. Preferred quenchers include Black Hole (BHQ1) and BHQ2 (Biosearch Technologies, Petaluma, CA, USA). BHQ1 dark quenchers have strong absorption in the range of 480 nm to 580 nm, which quenches fluorophores (e.g. FAM, TET, CAL Gold 540, JOE, HEX, CAL Fluor Orange 560 and 570 dyes). BHQ2 dark quenchers have strong absorption in the range of 599 nm to 670 nm, which quenches fluorophores (e.g. HEX, Cy3, Cy3.5, Cy5, 6-FAM, 6-JOE, 6-TET, 6-TAMRA, CAL 570, TAMRA, CAL Red 590, CAL Fluor Red 610, ROX, CAL Fluor Red 635, 650, Quasar 670 and Quasar 705 dyes). BHQ1 and BHQ2 can quench fluorescence by FRET and static quenching mechanisms.

[0069] A suitable commercially available substrate is provided by the Lab Test Kit v2 (ThermoFisher Scientific; Waltham, MA).

[0070] Preferred cOA-dependent non-specific effector endoribonucleases are from thermophilic organisms (e.g. Pyrococcus furiosus, Sulfolobus solfataricus and Thermus thermophilus) allowing simultaneous isothermal detection of cOA-dependent non-specific effector endoribonuclease activity.

[0071] Methods and means for indirect determination of cyclic oligoadenylate (cOA) levels preferably comprise a cOA-dependent non-specific effector endoribonuclease and a substrate for said cOA-dependent non-specific effector endoribonuclease.

[0072] 4.3, Protein production

[0073] The ribonucleic acid detection system according to the present application is based on the in vitro assembly of a ribonucleoprotein complex (preferably a type IIIB complex). The required Cas protein is preferably from a thermophilic organism such as Thermus thermophilus. The protein is preferably expressed and purified from a suitable expression system.

[0074] Commonly used expression systems for the production of heterologous proteins include E. coli, Bacillus, baculovirus, yeast, fungi, most preferably filamentous fungi or yeast (e.g. Saccharomyces cerevisiae and Pichia pastoris), eukaryotic cells (e.g. Chinese hamster ovary cells (CHO), human embryonic kidney (HEK) cells and Expression of recombinant proteins in heterologous systems is dependent on many factors, including transcriptional and translational levels.

[0075] Preferably, the Cas protein is produced using prokaryotic cells, preferably E. coli E. coli The Cas protein is preferably produced by expressing the protein in the prokaryotic cell of interest, preferably E. coli. The expression construct, preferably DNA, is preferably produced by recombinant techniques, including the use of polymerases, restriction enzymes and ligases well known to the skilled person. Alternatively, the expression construct is provided by artificial gene synthesis, e.g. by synthetic parts or fully overlapping oligonucleotides as known to the skilled person, or by a combination of organic chemistry and recombinant techniques.

[0076] Alternatively or in addition, the Cas protein can be isolated from a thermophilic organism by expressing the tagged Cas protein in the thermophilic organism and isolating the ribonucleoprotein complex comprising the Cas protein based on the tag. The isolated ribonucleoprotein complex can be isolated using the tagged Cas protein.

[0077] The expression construct is preferably codon-optimized to enhance expression of the Cas protein in the prokaryotic cell of interest, preferably E. coli. Further optimization preferably includes removal of cryptic splice sites, removal of cryptic polyA tails and / or removal of sequences that cause mRNA to fold unfavorably. In addition, the expression construct preferably encodes a protein export signal for secretion of the Cas protein out of the cell into the prokaryotic periplasm, allowing for efficient purification of the Cas protein.

[0078] Methods for purifying Cas proteins are known in the art and are typically based on chromatography (e.g. affinity chromatography and ion exchange chromatography) to remove contaminants. In addition to contaminants, it can also be necessary to remove undesired derivatives of the product itself (e.g. degradation products and aggregates). Suitable purification process steps are provided in Berthold and Walter, 1994 (Berthold and Walter, 1994. Biologicals 22: 135-150).

[0079] Alternatively or in addition, the recombinant Cas protein can be tagged with one or more specific tags by genetic engineering to allow the protein to attach to a column specific for the tag and thus separate it from impurities. The purified protein is then exchanged from the affinity column with a decoupling reagent. This method has been increasingly applied to the purification of recombinant proteins. A common tag for proteins (e.g. a histidine tag) is used with an affinity column that specifically captures the tag (e.g. a Ni-IDA column for a histidine tag) to separate the protein from other impurities. The protein is then exchanged from the affinity column with a decoupling reagent according to the specific tag. This method is more specific compared to traditional purification methods.

[0080] As demonstrated by Chatterjee, 2006 (Chatterjee, 2006. Cur Opin Biotech 17, 353-358), suitable further tags include the c-myc domain (EQKLISEEDL), the hemagglutinin tag (YPYDVPDYA), maltose binding protein, glutathione-S-transferase, the FLAG tag peptide, the biotin acceptor peptide, the streptavidin binding peptide and the calmodulin binding peptide. Methods for using these tags are known in the art and can be used for purification of Cas proteins.

[0081] Methods for expressing proteins in E. coli are known in the art and can be used for expression and purification of Cas proteins.

[0082] In a preferred method, Cas proteins are expressed in E. coli from codon-optimized expression constructs. The constructs are placed in a bi-cistronic expression plasmid containing a Strep tag at the N-terminus and the amino acid sequence Glu-Asn-Leu-Tyr-Phe-Gln-(Gly / Ser), which is recognized by the Tobacco Etch Virus (TEV) protease. The expression plasmid is transformed into E. coli (e.g., strain B121(DE3)). The desired culture volume is grown at 37°C until the OD600 is ~0.6, the culture is placed on ice for 1 hour, and then isopropyl β-D-l-thiogalactopyranoside is added to a final concentration of 0.1 mM. The culture is then incubated at 18°C for ~16 hours (overnight). The cells are harvested, lysed by sonication in buffer A (100 mM Tris-HCl, 150 mM NaCl), and then centrifuged at 30000 g for 45 minutes. The clarified lysate is filtered and run over a pre-equilibrated StrepTrap FPLC column (GE Healthcare, Chicago, IL). After the column is washed with buffer A until no more protein is present in the flow through, the protein of interest is eluted with buffer B (100 mM Tris-HCl, 150 mM NaCl, and 2.5 mM D-desthiobiotin). The protein is cleaved from the affinity tag by the addition of TEV protease and incubation at 4°C overnight. The protein of interest is separated from the mixture by HisTrap and StrepTrap affinity chromatography steps, and the flow through from this step is collected. If necessary, additional size exclusion chromatography is added to achieve higher purity.

[0083] Preferred Cas proteins include Csm or Cmr proteins, at least Cmr1 and Cmr4, preferably Cmr1-6, or at least Csm2 and Cas10 (Csm1), preferably Csm2-5 and Cas10, more preferably Csm1-6.

[0084] Preferred proteins include proteins having at least 80% sequence identity to the amino acid sequences shown in Table 2, preferably at least 90% sequence identity, preferably the amino acid sequences shown in Table 2. However, mutants of the proteins, including insertion mutants, deletion mutants, chimeric proteins, and amino acid substitution proteins, are also useful in CRISPR-based ribonucleic acid systems according to the present application.

[0085] To improve the sensitivity of the type III CRISPR / Cas detection method, it is preferred to create catalytically dead mutant Cmr and / or Csm complexes and use them in the detection system of the present application. The term “catalytically dead” refers to the target RNA digestion activity of the CRISPR-based ribonucleic acid system according to the present application. These mutants are referred to as dCmr and dCsm. These mutations are introduced into the Cmr4 and Csm3 subunits responsible for target binding and cleavage and are selected to maintain target binding while abolishing target cleavage. A number of mutations in the Cmr4 protein have been described (H15A, D26A, E277A), with the strongest catalytic impairment observed in the Cmr4 D26A and D26N mutations (Benda et al., 2014. Molecular Cell 56:43-54; Ramia et al., 2014. Cell Reports 9:1610-1617). Experiments demonstrated that this inactivating mutation is useful in Pyrococcus furiosis, and alignment of Cmr4 homologous sequences showed that this amino acid is highly conserved (data not shown). Furthermore, crystallography data showed that this particular amino acid is located in a groove of the complex where the target RNA is expected to bind (data not shown). Altogether, these results indicate that the D26 amino acid residue is important for the catalytic activity of Cmr4. Changing this residue will create a dCmr4 mutant in Thermus thermophilus. In addition to this, alignment of the Pf Cmr4 amino acid sequence with homologous sequences of Csm3 also showed that D26 is one of the few amino acids conserved between the two type III systems, and thus can also be used to create a dCsm3 mutant. Further cleavage dead mutations include the E227A and E228 double mutant of Cmr4 and Cmr4 D86A (Ramia et al., 2014. Cell Reports 9:1610-1617; Zhu and Ye, 2015. Nucleic Acids Res 43:1257-1267). In addition, Csm3 D32A is a good candidate for a cleavage dead type III A Csm mutant (Samai et al., 2015. Cell 161:1164-1174).

[0086] In addition, Jia et al. and Park et al. describe a dCsm3 mutant created by a D36A substitution (Jia et al., 2019. Mol Cell 73:264-277; Park et al., 2017. EMBO reports 18:826-840). A double mutant of K56A and R60A is also mentioned, but does not completely abolish target cleavage of Csm3.

[0087] Another type of variation is based on impairment control through the natural CRISPR / Cas defense system. After the CRISPR-associated Rossmann fold (CARF) domain of Csx1 / Csm6 binds to cOA, its Higher Eukaryotes and Prokaryotes Nucleotide-binding (HEPN) domain is activated and the protein will arbitrarily start cutting RNA (Kazlauskiene et al., 2017. Science 357:605-609). In a normal biological environment, cOA is degraded by Csx1 / Cms6 itself to avoid continuous activation, and thus maintain RNase activity (Athukoralage et al., 2019. J Mol Biol 431:2894-2899, Garcia-Doval et al., 2020. Nature Communications 11:1-9). Recently, the mechanism of this cOA degradation was elucidated by using mutants of the Csx1 / Cms6 protein. Studies have shown that T10A, T10A / T11A or T11A Csx1 / Csm6 mutants cannot degrade cOA and enable prolonged RNase activity (Athukoralage et al., 2019. J Mol Biol 431:2894-2899; Garcia-Doval et al., 2020. Nature Communications 11:1-9). This prolonged RNase activity through Csx1 / Csm6 (e.g. by using T10A, T10A / T11A or T11A Csx1 / Csm6 mutants or their equivalents) can be used for more sensitive and faster reading for diagnostic purposes.

[0088] 4.4. Assembly of ribonucleoprotein complexes

[0089] While there are differences between the different type III subtypes (Cmr, Csm), the general structure consists of multiple subunits of Cas7 and Casl l (Staals et al., 2013. mol. Cell 52: 135-145; Staals et al., 2014. mol. Cell 56: 518-530), flanked by Cas5 and CaslO. Among others, Cas7 provides RNase activity in the recognition of the target RNA by the pre-loaded RNA guide. In addition, this recognition also generates DNase activity by the CaslO HD domain (Kazlauskiene et al., 2016. Mol Cell 62: 295-306).

[0090] The type III CRISPR / Cas system can be further divided into various subtypes, including type III A Csm and type III B Cmr (Staals et al., 2013, 2014. Supra). The effector complex Cmr of Thermus thermophilus (ttCmr46) consists of 12 subunits (Staals et al., 2014. Supra; Taylor et al., 2015. Science 348: 581-586) with a stoichiometry of Cmr112131445361 and a 46 nt crRNA. A novel study by Staals et al. demonstrated a similar complex with a 40 nt crRNA (Table 1).

[0091] Table 1 Subunit composition of TtCmr40 and 46

[0092]

[0093]

[0094] The type III A Csm complex is assembled in a similar way as the Cmr (Csm1123354151) (Tamulaitis et al., 2017. Trends Microbiol 25: 49-61). This complex can be assembled by adding all subunits in the correct molar ratio and incubating the reaction mixture at the incubation temperature (e.g. 60°C or 65°C) for a period of time (e.g. 30 minutes).

[0095] The purified Cas proteins (e.g. Csm or Cmr proteins) are assembled onto the appropriate crRNA. In one embodiment, the crRNA and assembled ribonucleoprotein complex are present in an aqueous solution. Subsequently, if it is desired to determine the level of cOA, one of the Cas proteins (e.g. CAP Cas (e.g. Cmr6)) can be labeled (e.g. with a histidine tag and / or a streptavidin tag) and attached to a surface, preferably at a defined position on the surface. The surface can be a solid surface (e.g. glass, plastic or silicon). The surface can be present in a container such as a cup (e.g. an Eppendoff tube) or in a well of a microplate or in a device.

[0096] A recent study by Mogila et al. demonstrated the role of individual subunits of S. thermophilus Csm (StCsm) (Mogila et al., 2019. Cell Reports 26:2753-2765). Furthermore, a minimal Csm complex containing only the Csm3, Csm4 and Cas10 (Cmr1) subunits (and crRNA) was designed, which still retains all three catalytic activities (RNase, ssDNase, cOA synthase).

[0097] Abrogating several subunits while retaining all catalytic activities opens the possibility for practical applications of type III CRISPR / Cas systems. Most notably, the production of cOA was not reported to be affected (Mogila et al., 2019. Supra).

[0098] As described by Mogila et al., these minimal complexes will include Cmr1, 3 and 4 for type IIIA CRISPR / Cas and Cmr2, 3 and 4 for type IIIB CRISPR / Cas, the copy number of which can vary. To increase the specificity and sensitivity of cOA production and target detection, the number of Csm3 / Cmr4 subunits can be increased.

[0099] Furthermore, these subunits can be mutated to optimize their activity.

[0100] The Cmr proteins are preferably provided to the appropriate crRNA in stoichiometry Cmr1:Cmr3:Cmr4:crRNA = 1:1:4:1 and in stoichiometry Cmr1:2:3:4:5:6:crRNA = 1:1:4:3:1.

[0101] The ribonucleoprotein complex can be assembled on the TtCmr46 crRNA as follows:

[0102] First, 3.5 μΐ, crRNA (700 ng) is added to 3.5 μΐ, 1X Cmr buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl). Next, subunits are added to the reaction mixture in a specific order (Cmr3, Cmr2, Cmr4, Cmr5, Cmr6, Cmr1) to final concentrations of.5 μΜ, 2.5 μΜ, 10 μΜ, 7.5 μΜ, 2.5 μΜ, and 2.5 μΜ, respectively, to make a total reaction volume of 20 μΐ,. The reaction mixture can be incubated at 65 °C for 30 minutes.

[0103] A preferred method of reconstituting Class I Type 3A complex comprises adding 3.5 μΐ, crRNA (700 ng) to 3.5 μΐ, 1X Cmr buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl), and then adding subunits in the order Csm4, Csm1, Csm3, Csm2, Csm5 to final concentrations of 2.5 μΜ, 2.5 μΜ, 12.5 μΜ, 7.5 μΜ, and 2.5 μΜ, respectively, to make a total reaction volume of 20 μΐ,. The reaction mixture can be incubated at 60 °C or 65 °C for 30 minutes.

[0104] Table 2 Preferred Cmr and Csm Sequences

[0105]

[0106] Gene ID identifiers are from the Gene Identifier database of NCBI RefSeq Genomes

[0107] 4.5, Method of detecting RNA

[0108] The conventional CRISPR / Cas systems used for diagnostic purposes (e.g. Cas12 / Cas14 (UC Berkeley, CA, USA) and Cas13-based systems (Broad Institute, MA, USA)) rely on the presence of specific motifs adjacent to the target site. In the biological context, this mechanism is used to distinguish self from non-self. Without this motif, these Cas proteins cannot cleave their target and they cannot be diagnostic systems. For Cas12 and Cas13 these motifs are known as protospacer adjacent motifs (PAM) and protospacer flanking sites (PFS) respectively [Westra et al. 2013. PLoS Genet 9: E1003742; Abudayyeh et al. 2016. Science 353: aaf5573]. In the case of certain Cas12 / Cas14 proteins, this required PAM is TTTN / TTTA, which greatly limits the choice of target sequences. For Cas13, the required motif is limited to a small range, favoring H nucleotides (A, C, U) adjacent to the target sequence.

[0109] Type III (B) CRISPR systems use a different mechanism of self vs. non-self by checking the complementarity between the 5'-repeat tag of the crRNA and the corresponding 3'-protospacer flanking sequence to prevent autoimmunity [Guo et al., 2019. RNA Biol 16: 1513-1520]. The complementarity between these two regions influences the production of relative cOA to some extent, but does not require a specific PAM / PFS-like sequence for the III type to function as intended, which is a great advantage over the currently used systems [Guo et al., 2019. RNA Biol 16: 1513-1520].

[0110] In addition, the use of Cas13 target selection is also limited by the potential secondary structure formed in the target RNA [Smargon et al., 2017. Mol Cell 65: 618-630]. The diagnostic applications currently in use operate at 37°C, unlike the IIIB system for Thermus thermophilus, which operates at 65°C [Staals et al., 2013. Mol Cell, 52: 135-145]. This elevated temperature reduces the number of potential secondary RNA structures formed in the target RNA sequence [Wan et al., 2012. Mol Cell 48: 169-181].

[0111] The methods of the present application for detecting specific RNA sequences can be used in human health care, veterinary diagnostics, detection of plant pathogens, detection of water pollutants, and detection of food and feed contaminants. In addition, the methods of the present application for detecting specific RNA sequences can be used to detect beneficial organisms. In general, the methods of the present application can be used for the detection of bacteria, fungi, archaea, protest, protozoal, eukaryotic, viral, and virological pathogens. In addition, the methods of the present application can also be used to detect and diagnose genetic alterations or traits expressed in the form of RNA molecules in humans, animals, and plants.

[0112] For human health care and veterinary diagnostics, nucleic acid material, including RNA, is preferably isolated from biological fluids, preferably from cerebrospinal fluid, saliva, nasopharyngeal secretions, oropharyngeal secretions, sweat, urine, feces, or blood. The term "blood" includes plasma, which is prepared by removing (e.g., by centrifugation) red and white blood cells, and serum, which is prepared by forming a blood clot and removing (e.g., by centrifugation) the clot. The preferred biological fluid is blood. Methods and compositions for isolating nucleic acid material from biological fluids, particularly blood, preferably use aqueous solvents, without the use of organic solvents and chaotropic salts.

[0113] If necessary, nucleic acid material, including RNA, can be purified from the sample using a combination of techniques such as physical and chemical methods. Preferably, commercially available systems for nucleic acid isolation are used (e.g., QIAamp® (QIAGEN, Hilden, Germany), MagNA Pure® (Roche Diagnostics, Almere, The Netherlands), or the Nucleospin® RNA Isolation Kit (Macherey-Nagel, Dϋren, Germany). or Nucleospin® RNA Isolation Kit (Macherey-Nagel, Dϋren, Germany), QIAamp® (QIAGEN, Hilden, Germany), MagNA Pure® (Roche Diagnostics, Almere, The Netherlands), or the Nucleospin® RNA Isolation Kit (Macherey-Nagel, Dϋren, Germany).

[0114] To this end, RNA can be isolated from the sample by any technique known in the art, including but not limited to suitable commercial RNA isolation kits, including Trizol (Invitrogen; Carlsbad, California), RNeasy® (QIAGEN, Hilden, Germany), MagNA Pure® (Roche Diagnostics, Almere, The Netherlands), or the Nucleospin® RNA Isolation Kit (Macherey-Nagel, Dϋren, Germany). (Applied Biosystems / Ambion, Austin, Tx), (Qiagen, Hilden, Germany), Agilent Total RNA Isolation Lits (Agilent; Santa Clara, Califomia), (Tel-Test. Friendswood, Texas), the RNeasy mini kit (Qiagen, Venlo, The Netherlands) and Maxwell TM 16 Total RNA Purification Kit (Promega; Madison, Wisconsin). The isolated RNA, preferably mRNA, is preferably reverse transcribed into single- or double-stranded cDNA with the help of an RNA-dependent DNA polymerase.

[0115] The type III CRISPR / Cas for diagnostic purposes according to the present application includes, but is not limited to, medical diagnostics (e.g. urinary tract infections, respiratory tract infections (in particular SARS-CoV-2 and respiratory syncytial virus (RSV)), blood infections (sepsis), markers of antibiotic resistance (e.g. expression of markers of methicillin-resistant Staphylococcus aureus and markers of broad-spectrum beta-lactamase), gastrointestinal infections, skin infections, odontogenic infections, vaginal infections (e.g. candidiasis, trichomonas vaginalis and gardnerella), infections of the male reproductive system, tropical infectious diseases (e.g. malaria, trypanosomiasis, dengue fever, Zika fever, chicken Kenya fever), detection of sexually transmitted diseases caused by chlamydia, gonorrhea, human immunodeficiency virus, herpes, syphilis and detection of genetic defects, including cancer and autoimmune diseases.

[0116] The type III CRISPR / Cas according to the present application can further be used for veterinary diagnostics, including detection of infectious diseases in cattle (e.g. mastitis, bluetongue and foot-and-mouth disease), salmonella, klebsiella, campylobacter, infectious diseases in pigs (e.g. respiratory diseases, dermatitis, diarrhea and porcine parvovirus infection); infectious diseases in sheep and goats (e.g. clostridial disease, mouth blisters in sheep, pneumonia and Rift Valley Disease Virus infection); infectious diseases in poultry (e.g. infectious bronchitis in chickens, salmonella); infectious diseases in cats (e.g. infection with feline immunodeficiency virus (FIV) and feline leukaemia virus (FeLV) and respiratory tract infections); infectious diseases in dogs (e.g. rabies and infections with Bordetella, Leptospira and Boriella).

[0117] The Type III CRISPR / Cas detection system according to the present application can be further used for the detection of plant pathogens (e.g. specific fungi (e.g. Ascomycetes species and Basidiomycetes species), specific fungal-like organisms (e.g. Oomycetes and Plasmodiophoromycetes), specific bacteria (e.g. Burkholderia, Proteus and Pseudomonas species); viruses, viroids and virus-like organisms (e.g. Tobacco mosaic virus, Cauliflower mosaic virus); nematodes (e.g. Meloidogyne chitwoodi and M. fallax) and protozoa and algae (e.g. Phytomonas and Cephaleuro).

[0118] The Type III CRISPR / Cas detection system according to the present application can be further used for the detection of water pollutants, including bacterial contamination (e.g. Vibrio cholerae, Escherichia coli, Shigella spp., Legionella spp., Salmonella spp.); viral contamination (e.g. Hepatitis A, Hepatitis E, Poliovirus); algal contamination (e.g. presence of Desmodesmus spp.) and parasitic contamination (e.g. Dracunculiasis spp.).

[0119] The Type III CRISPR / Cas detection system according to the present application can be further used for the detection of food and feed contaminants, including bacterial contamination (e.g. Clostridium botulinum, Escherichia coli, Listeria spp., Salmonella spp., Vibrio cholerae); viral contamination (e.g. presence of Enterovirus spp., Hepatitis A, Norovirus spp. and rotavirus spp.); parasitic contamination (e.g. presence of Giardia spp. and Trichinella spp.) and fungal contamination.

[0120] More specifically, the Type III CRISPR / Cas detection system according to the present application can be further used for the detection of any organism, since all organisms produce RNA during infection. Said organisms include bacteria: such as Bacillus species, Clostridium species, Enterobacter species, Escherichia species, Enterococcus species, Klebsiella species, Listeria species, Legionella species, Salmonella species, Staphylococcus species, Streptococcus species and combinations thereof); viruses including DNA viruses (e.g. Hepatitis B, Adenovirus, Human Papillomavirus); RNA viruses (e.g. Influenza virus, Hepatitis A / B / C / E, Poliovirus, Tobacco mosaic virus, Coronavirus and HIV); viroids; archaea; fungi (e.g. Aspergillus species, Ascomycetes species, Candida species); protozoa and parasites (e.g. Trypanosoma species).

[0121] The use of the type III CRISPR / Cas detection system according to the application for the detection of RNA will find obvious benefits in diagnostic settings. Two such diagnostic settings will be elucidated below. However, the skilled person will have no doubt be able to find additional diagnostic settings that would benefit from the use of the type III CRISPR / Cas detection system according to the application for the detection of RNA.

[0122] The first example is illustrated by recent global developments. Point-of-care (PoC) testing would have provided many benefits in the COVID-19 pandemic. The recent outbreak of SARS-CoV-2 has generated the COVID-19 pandemic that has spread globally within a few months after its discovery. To slow down the spread of the disease, many countries have implemented preventive measures to limit the flow and migration of their population. These restrictions are ultimately to “flatten the curve”, with the aim to keep the pressure on national healthcare systems manageable and to save as many lives as possible. However, some countries / regions have apparently been able to control the increase of infections more effectively than others. For example, Singapore, South Korea and Taiwan have limited the number of infections and subsequent deaths, which seems to reflect the success of their fast response. One of the main factors for this success is that they have early and widely deployed mass testing and subsequent self-isolation, while other countries / regions have not or could not do so. This diagnostic screening approach has helped to identify and isolate infected individuals, resulting in a much slower spread of the virus, with less infections and lower mortality. In addition, the World Health Organization has also indicated that decentralized, widespread testing is needed in order to be able to respond quickly to emerging pandemics. The most important diagnostic tool used in COVID-19 testing is based on (RT)-PCR, which detects the viral genetic material (RNA). While this test produces reliable results within 4-6 hours, only centralized laboratories are qualified to perform the test, which requires the transportation of samples and an expected turnaround time of at least 24 hours per test. Even in developed countries, the recently increased testing capacity has not been able to meet the demand. The only PoC test available is an immunoassay, which cannot distinguish between past and present infections and cannot be used for acute phase diagnosis.

[0123] CRISPR-Cas nucleic acid detection diagnostics offer a solution to set up decentralized screening platforms. CRISPR-Cas based diagnostics are considered faster than polymerase chain reaction and cheaper to perform on-site (Sheridan, 2020. Nat Biotechnol 38:382-384). We are developing an innovative, proprietary CRISPR-Cas based PoC COVID-19 diagnostic method that will help to improve the viral monitoring capacity, thereby limiting the spread of COVID-19 and other viruses.

[0124] The second example is provided by the detection of urinary tract infections (UTI). Current UTI diagnosis is not up to standard. Especially in primary health care, general practitioners must rely on unreliable test results with a positive predictive value of only 61%. This leads to a large number of treatments of disease-negative patients and unnecessary antibiotic prescriptions (Eriksen and Bing-Jonsson, 2016. Forskning 1-42; available at sykepleien.no / forskning / 2016 / 09 / kan-ikke-stole-blindt-pa-urinstiks). Timely diagnosis using a type III CRISPR / Cas detection system would provide major advantages over existing methods. Due to its ability for specific RNA detection, a type III CRISPR / Cas detection system allows for fast species identification and detection of antibiotic resistance markers.

[0125] Most (70-90%) UTI cases are caused by uropathogenic E. coli, but can also be caused by a range of other pathogens (Flores-Mireles et al., 2015. Nat Rev Microbiol 13: 269-284). Identifying the specific pathogen causing the infection would provide more information to increase the chance of correct use of antibiotics.

[0126] For example, specific pathogens can be identified based on the expression of specific 16S ribosomal RNA species. Van der Zee et al. (van der Zee et al., 2016. PLOS ONE 11: e0150755) show that 7 pathogens causing UTI can be distinguished based on 16S qPCR. Table 3 provides some examples of primers used (van der Zee et al., 2016. Supra). The target points of these primers can be adapted to type III CRISPR / Cas guide sequences. Similarly, the PCR primer regions used to detect antibiotic resistance markers can also be adapted to type III CRISPR / Cas based detection.

[0127] Another example is provided by the detection of Listeria in raw milk products. Listeria monocytogenes is a well-known food-borne pathogen that can cause the fatal disease Listeriosis. Listeria contamination has been found in foods such as vegetables, dairy products and meat products. It has been reported that 1% to 4.4% of raw cow's milk in Europe contains Listeria, and 1.1% to 65% of certain un-pasteurized cheeses (Lundén et al., 2004. J Dairy Science 87, E6-E12). The III-type CRISPR / Cas-based gene detection of Listeria can be combined with the detection of other potential pathogens such as E. coli, Salmonella typhimurium and Campylobacter jejuni.

[0128] The rapid detection of food-borne pathogens using rapid diagnostics can prevent the use and consumption of contaminated dairy products. Performing such detection on the farm would prevent contaminated milk from being transported to a dairy processing plant and prevent potential spread of contamination, reducing the chance of Listeriosis.

[0129] As in the first example, the III-type CRISPR / Cas-based RNA detection can be designed based on similar PCR target sequences. Complications can arise in the possible need for milk pre-treatment and in the possible need for low detection limits.

[0130] If desired, for example to increase the level of detection, the method of the present application for detecting a specific RNA sequence can be preceded by amplification of the target sequence. Amplification can be performed by any suitable amplification system, including for example ligase chain reaction (LCR), isothermal ribonucleic acid amplification systems (such as nucleic acid sequence-based amplification (NASBA) and cleavage-based RNA signal amplification), transcription-mediated amplification, strand displacement amplification and polymerase chain reaction (PCR). As is known to the person skilled in the art, reverse transcription of the RNA is preferred prior to or during the amplification reaction.

[0131] Preferred amplification reactions are single tube isothermal reactions (e.g. NASBA, loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), recombinase polymerase amplification (RPA) reactions and nicking enzyme amplification reactions (NEAR). The preferred single tube isothermal reaction is a RPA reaction (TwistDx Ltd., Cambridge, UK).

[0132] The single tube isothermal reaction (e.g. RPA) is preferably integrated with the CRISPR-based ribonucleic acid detection system of the application as a “one-pot” reaction system. The advantage of such a one-pot or single tube system is a reduced risk of sample contamination or cross-contamination of different samples.

[0133] For the detection of cOA by using a direct cOA detection method, the sample can contain endogenous levels of PPi and Pi. In particular, biological fluids such as plasma, serum, urine and synovial fluid can contain 0.16-3.42 mM PPi and 0.31 mM Pi (plasma); 3.5 mM PPi and 1-1.5 mM Pi (serum); 1.5 mM Pi (urine) and 0.1 mM Pi and 0.3 mM Pi (synovial fluid), respectively (Russell et al., 1970. Lancet 296:899-902; Silcox and McCarty, 1973. J Clin Invest 52:1863-1870; Bansal, 1990. Serum Inorganic Phosphorus. In: Clinical Methods: The History, Physical, and Laboratory Examinations (Butterworths); Le, 2008. First aid for the USMLE step 1 2018). These levels can vary over time and with the course of disease (Armstrong et al., 1975. Clin Chem 21:104-108).

[0134] Pre-treatment of samples with high endogenous PPi or Pi levels can be performed by removing small molecules such as Pi and PPi prior to detection of specific RNA sequences. Several methods can be taken to prevent interference of endogenous PPi or Pi levels on the readout, these include but are not limited to the methods listed below, including chemical precipitation, dialysis and use of cation exchange columns.

[0135] Removal of small molecules (e.g. Pi and PPi) can be performed (e.g. by filtering the sample through a filter with a molecular weight cut-off of less than 1000, preferably less than 500). The molecular weight cut-off is defined as the lowest molecular weight (in Daltons) for which a membrane retains greater than 90% of solutes of known molecular weight.

[0136] The effect of endogenous phosphorous species on the test result can also be eliminated by isolating the genetic material (of which the target sequence is part) from the patient sample and subsequent application in a PPi / Pi free medium. Methods for isolating nucleic acid material include but are not limited to organic extraction, chelate extraction, solid phase extraction, magnetic beads and / or anion exchange.

[0137] In addition to lowering the endogenous Pi levels, sample preparation steps are required to address interference of other factors (including but not limited to proteases, salt concentration and pH in the patient sample) on the readout.

[0138] Table 3 Specific qPCR primers for detection of pathogens causing UTI as described by van der Zee et al. (van der Zee et al., 2016. PLOS ONE 11 : e0150755).

[0139]

[0140]

[0141] Abbreviations: F = forward primer. R = reverse primer. CY5, YY and FAM are fluorescent dyes.

[0142] 4.6 Suitable devices

[0143] The CRISPR / Cas-based ribonucleic acid detection system according to the present application is preferably present in a device. The device preferably comprises one or more detection systems targeting one or more specific RNA sequences. The device can comprise openings (e.g. inlets and outlets) for the introduction and extraction of fluids from the device. The openings can be connected to valves, tubes, channels, chambers, syringes and / or pumps. The device can be connected to a fluid flow actuator that allows directional movement of fluids within the microfluidic device. Examples of actuators include, but are not limited to, syringe pumps, mechanically actuated recirculation pumps, electro-osmotic pumps, bulbs, bellows, diaphragms or bubbles intended to force the movement of fluids. In a particular example embodiment, the device is connected to a controller with programmable valves that work together to move fluids through the device. In addition, heating mechanisms can be used to incubate reaction mixtures at desired temperatures.

[0144] The CRISPR / Cas-based ribonucleic acid detection system is preferably present in a biosensor, preferably by using a disposable cartridge. Preferred biosensors provide methods and means for detecting the interaction of the CRISPR / Cas-based ribonucleic acid detection system with the target nucleic acid. Preferred biosensors comprise a reusable hand-held reader (which can be operated with simple push-button to automatically analyze samples) and a cost-effective disposable cartridge, preferably a disposable microfluidic sensor cartridge, which has been functionalized to provide optimal detection and / or quantification of a plurality of clinically relevant pathogens (e.g. pathogens). One possible biosensor is a lateral flow test device (e.g. based on the accumulation of quantifiable substances (e.g. magnetic particles)).

[0145] In one embodiment, the device or biosensor is a point-of-care (POC) test device, which is a transportable, portable and hand-held instrument or test kit that allows the collection of a sample and the obtaining of a result in a very short time at or near the patient's location, allowing the adjustment of the treatment plan as needed. The device preferably comprises a device that allows the rapid, low-cost and reliable determination of the presence or absence of a target nucleic acid, and preferably also includes the quantification of the target nucleic acid.

[0146] The POC comprising the CRISPR / Cas-based ribonucleic acid detection system is preferably directed to the detection of a limited number of target nucleic acid molecules, including 5 or less target nucleic acid molecules, 4 or less target nucleic acid molecules, 3 or less target nucleic acid molecules, such as 2 target nucleic acid molecules and 1 target nucleic acid molecule. To this end, the crRNA ribonucleoprotein complexes are preferably present in discrete locations of the ribonucleic acid detection system, allowing the determination of the level of cOA for each individual crRNA ribonucleoprotein complex.

[0147] The array comprises CRISPR / Cas based ribonucleic acid detection systems, preferably targeting at least 5 different target nucleic acid molecules, preferably at least 10 different target nucleic acid molecules, preferably at least 20 different target nucleic acid molecules, preferably at least 50 different target nucleic acid molecules, preferably at least 100 different target nucleic acid molecules. The array comprises CRISPR / Cas based ribonucleic acid detection systems, preferably targeting between 2 and 12000 different target nucleic acid molecules.

[0148] As will be clear to the skilled person, the different target nucleic acid molecules can all be directed to different organisms, such that each crRNA molecule originates from and is used to detect a different target organism (e.g. different bacteria, viruses, fungi, protozoa and / or parasites). The different crRNA molecules can be selected such that a subpopulation of different crRNA molecules is directed to the same organism. The subpopulation can comprise 2 different crRNA molecules, 3 different crRNA molecules, 4 different crRNA molecules, 5 different crRNA molecules. Preferably, the number of different crRNA molecules directed to the same organism is limited to a maximum of 10. It will be clear that detection of a target organism by all different crRNA molecules confirms that the identification of the target organism is correct.

[0149] Furthermore, a particular crRNA molecule can be present in multiple copies in the CRISPR / Cas based ribonucleic acid detection system according to the application (e.g. in multiple wells of a microtiter plate (e.g. a 48 well plate, a 96 well plate, a 192 well plate, a 384 well plate or a 768 well plate)). Detection of a target organism by multiple copies of a crRNA molecule confirms that the identification of the target organism is correct.

[0150] 5. Examples

[0151] Example 1

[0152] Materials and Methods

[0153] Detailed description of the purification of the Cmr complex and the expression and purification of recombinant Cmr proteins

[0154] Cas proteins and Cas complexes were purified as described in Staals et al., 2013 (Staals et al., 2013. Mol Cell 52: 135-145).

[0155] In vitro activity assays

[0156] RNA substrates (Table 4) were 5' labeled with T4 polynucleotide kinase (NEB) and 5'32P-γ-ATP and then purified from denaturing PAGE using RNA gel elution buffer (0.5 M Na acetate, 10 mM MgCl2, 1 mM EDTA and 0.1% SDS). In vitro activity assays were performed using labeled RNA substrates and 400 nM TtCmr in TtCmr activity assay buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP and 2 mM MgCl2). Reactions were incubated at 65 °C for 1 h unless otherwise stated. After boiling at 95 °C for 5 min, RNA loading dye (containing 95% formamide) was added. Samples were run on 20% denaturing polyacrylamide gels (containing 7 M urea) at 15 mA for 3-4 h or overnight at 4 mA constant. Images were visualized using phosphoimaging.

[0157] Complex reconstitution of Cmr46 and Cmr40

[0158] First, 3.5 μL crRNA (700 ng) was added to 3.5 μL 1X Cmr buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl). Subsequently, for Cmr46, subunits were added to the reaction mixture in a specific order (Cmr3, Cmr2, Cmr4, Cmr5, Cmr6, Cmr1) to final concentrations of 2.5 μΜ, 2.5 μΜ, 2.5 μΜ, 10 μΜ, 7.5 μΜ and 2.5 μΜ, respectively, to make up a total reaction volume of 20 μL. The reaction mixture was incubated at 65 °C for 30 min. Similarly, for subunits of Cmr40 (Cmr3, Cmr2, Cmr4, Cmr5, Cmr6, Cmr1) final concentrations were 2.5 μΜ, 2.5 μΜ, 1.875 μΜ, 6.66 μΜ, 7.5 μΜ and 2.5 μΜ, respectively.

[0159] Direct cOA detection assay

[0160] In vitro cOA detection was performed in TtCmr activity assay buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP, and 0.5 mM MgCl2), with the Cmr40- or CMR46- complex (62.5 nM) and RNA substrate (200 nM, listed in Table 4) added. The reaction was incubated at 65 °C for 1 h, followed by the addition of 0.05 units of pyrophosphatase (Thermfisher EF0221) and incubation at 25 °C for 30 min. The signal was visualized using the Sigma-Aldrich Malachite Green phosphate / ester assay kit (MAK307).

[0161] Electrophoretic mobility shift assay (EMSA)

[0162] EMSA was performed by incubating 400 nM endogenous TtCmr complex and labeled target RNA (Table 4) in Cmr binding buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl). All reactions were incubated at 65 °C for 1 h, followed by electrophoresis on a 5% (w / v) polyacrylamide gel (PAGE) at 15 mA for 2.5 h, or overnight at constant 4 mA. Images were visualized by phosphorus imaging.

[0163] Results

[0164] RNA cleavage activity of TtCmr complexes of different sizes.

[0165] Our previous research showed that the native Cmr complex purified from *Thermophilus HB8* was loaded with mature crRNA guides of varying lengths, with crRNA-4.5 (*Thermophilus HB8* CRISPR array 4, spacer region 5) being the most abundant (Staals et al., 2013. Mol. Cell 52: 135-145). The endogenous Cmr complex specifically cleaves complementary 5'-labeled target RNA (4.5 target RNA) at a 6-nt spacer, producing 5'-labeled degradation fragments, mostly 21, 27, 33, and 39 nucleotides. Figure 3(See A). However, the heterogeneity of crRNAs in the endogenous Cmr complex (Staals et al., 2013; Taylor et al., 2015. Science 348: 581-586) complicates the interpretation of these results. Therefore, to further explore the mechanism of target RNA cleavage, we replaced the endogenous Cmr complex with a reconstructed Cmr complex that binds to single crRNAs of different lengths (crRNA-4.5).

[0166]

[0167]

[0168]

[0169] Based on abundance in our previous RNA sequencing data, we selected crRNAs of lengths including 34 nt (TtCmr-34), 40 nt (TtCmr-40), and 46 nt (TtCmr-46) (Staals et al., 2013, ibid.). In contrast to the mixture of 5'-labeled degradation products observed with endogenous complexes, each reconstructed complex produced mostly defined degradation products of one size. Figure 3 (B) This aligns with the view that the length of the complex is determined by the length of the crRNA; larger complexes (e.g., TtCmr-46) are closer to the 5′ (tagged) end of the target RNA. Smaller complexes (i.e., TtCmr-40 and TtCmr-34) lack one or both Cas7-Cas11 (Cmr4-Cmr5) backbone segments, thus cleaving the target RNA at a more distant location (further from the 5′ tag), producing larger degradation products. These results suggest that the endogenous TtCmr complex population is a heterogeneous mixture of complexes of different sizes, cleaving their homologous target RNAs at different locations.

[0170] TtCmr seed sequence

[0171] To investigate the importance of these type III complexes with different stoichiometric ratios, we designed an activity assay to explore differences in targeting and seed requirements. In structurally similar type I effector complexes (i.e., cascade complexes), targeting is controlled by two factors: PAM (protospacer adjacent motif) and seed (Mojica et al., 2009. Microbiol 155: 733-740; Semenova et al., 2011. Proc Natl Acad Sci USA 108: 10098-10103; Wiedenheft et al., 2011. Proc Natl Acad Sci USA 108: 10092-10097). However, in the type III system, self-discrimination is conferred by so-called rPAM, which examines the complementarity between the 8nt 5′ stalk of the crRNA (referred to as nucleotide -8 to -1) and the corresponding 3′ region flanking the protospacer [Elmore et al., 2016. Genes Dev 2016. 30: 447-459; Kazlauskiene et al., 2016. Mol Cell 62: 295-306.; Marraffini and Sontheimer, 2010. Nature 463: 568-571]. In the presence of complementarity, the DNase activity of Cas10 is abolished. Because TtCmr lacks DNase activity (Staals et al., 2013. ibid.), and because the N-terminal truncated Cas10 protein lacks the HD domain (data not shown), we tested whether RNase activity was affected by target RNAs that match the 5′ stalk of the crRNA. However, activity assays showed that these substrates had no identifiable effect on RNA cleavage activity, suggesting that RNA targeting via TtCmr cannot target its own RNA (e.g., antisense transcripts from CRISPR arrays), similar to other type III systems (Tamulaitis et al., 2014. Mol Cell 56: 506-517; Samai et al., 2015. Cell 16l: 1164-1174).

[0172] Next, we tested whether TtCmr utilizes a seed similar to the type I system by setting up an activity assay with mutations in the first 8 nt of the crRNA guide portion (a non-repetitive fragment of crRNA bases paired with the original spacer region). The results showed that RNA targeting was unaffected by these mutations, although the mismatch at position 5 blocked the elimination of the adjacent cleavage site, as indicated by the deletion of 39 nt of degradation products. Figure 4 (A, B). For example Figure 4As shown in FIG. A, mutations in the first 8 nt of the crRNA guide portion did not affect target RNA degradation. However, its effect on cOA production and subsequent non-specific RNA degradation was unclear. By using a new analysis method, the effect of single nucleotide mismatches on cOA production can be further understood.

[0173] For the endogenous TtCmr complex and two reconstituted Cmr complexes (46 nt and 40 nt, Figure 5 ), the results clearly demonstrated the importance of having complementary pairs at positions 1, 2, and 5 for cOA production Figure 3 ). The effect of nt mismatches at position 4 on cOA production was less compared to 1, 2, and 5. It is noteworthy that nt mismatches at positions 3, 6, and 7 appeared to have little effect on the production of the second messenger molecule.

[0174] These results suggest that full complementarity in this region is not necessary and that the seed can be located in different regions. In fact, early studies on type IIIB Cmr complex from S. islandicus (Peng et al., 2015. Nucleic Acids Res 43:406-417) showed that strict base pairing is required at the 3' end of the crRNA.

[0175] To investigate this possibility, we performed activity assays with the endogenous TtCmr complex and RNA targets with different mismatched segments Figure 6 A). In agreement with previous findings, the mismatched RNA target in the first segment (nucleotides 1-5) did not interfere with target degradation, although one cleavage site downstream of the mismatched segment was skipped. However, its effect on cOA production was very significant, almost completely eliminating cOA Figure 6 ). For the second and third mismatched segments (nucleotides 7-12 and 13-17), both their upstream and downstream cleavage sites were skipped, while the other cleavage sites were not affected. The second segment mismatch completely eliminated cOA production, while a substantial amount of cOA production was still observed in the third segment mismatch. However, when mismatches were introduced in the fourth and fifth segments (nucleotides 19-23 and 25-29), RNA degradation was completely abolished, while cOA production was only affected in the fourth segment mismatch. The mismatch in the last segment (nucleotides 31-35) had no effect on RNA degradation or cOA production except for skipping the upstream cleavage site. This indicates that base pairing in the region spanning the fourth and fifth segments is crucial for target recognition and degradation, while also playing a role in the initiation of cOA production.

[0176] Since the endogenous complex is a mixture of longer and shorter complexes, we turned to reconstituted complexes of 46 nt (TtCmr-46) or 40 nt crRNA (TtCmr-40) to more precisely locate this critical region. The TtCmr-46 complex almost exactly mirrors the results obtained with the endogenous complex, showing sensitivity of the RNA degradation to mismatches in the fourth and fifth fragments, and a significant effect on cOA production in the first, second, and fourth fragments Figure 5 B). However, in the TtCmr-40 complex, this important region appears to have shifted by one fragment, with a strict base-pairing requirement in the third and fourth fragments Figure 5 A). Taken together, these results strongly suggest that the seed region in TtCmr located 3' of the guide, shifts significantly towards the 5' end of the guide (and thus the complex) with smaller crRNAs. We propose that these regions, together or independently, act as seed sequences in TtCmr.

[0177] We hypothesized that this seed sequence is responsible for initiating binding during the recognition of a complementary RNA target. To this end, we tested the binding affinity of the same mismatched RNA targets in EMSA using the endogenous TtCmr complex Figure 6 A). In agreement with the activity assay, we observed that targets with mismatches in the first three fragments (nucleotides 1-5, 7-11, and 13-17) did not interfere with binding to the TtCmr complex, and the fully complementary RNA target migrated similarly. However, mismatches in the fourth and fifth fragments (nucleotides 19-23 and 25-29) severely affected the migration of the TtCmr-target RNA ternary complex on the gel. While this migration was different from the unbound state, we expect that this can represent partial binding to another downstream (complementary) portion of the target RNA.

[0178] To further confirm that base pairing initiates at the 3' end of the crRNA, we designed a short 11 nt target RNA in EMSA. While the target complementary to the 5' portion of the crRNA could not base pair with the crRNA, the target that base pairs with the proposed 3' seed region was able to bind Figure 6 B). These results indicate that the 5' end of the guide shields to some extent base pairing interactions with its cognate target RNA. In contrast, the crRNA:target duplex appears to initiate at the 3' end of the guide and then extend towards the 5' end.

[0179] Previously, we solved the cryo-EM structure of the TtCmr complex bound to apolipoprotein and ssRNA targets of different sizes (Taylor et al., 2015. Science 348: 581-585). We observed a concerted subunit rearrangement upon target RNA binding. Most notably, the Casl l (Cmr5) fiber rotated away from the center of the complex, thereby exposing more of the 5' crRNA portion in the channel that allows further propagation of the crRNA:target RNA duplex. These observations are consistent with the seed region identified in this study. For example, the proposed seed is located in a region of higher accessibility and interacts with Cmr1, Cmr6, and a Cmr4 thumb. It is also the first segment of the crRNA that is proximal to Cmr5 from the top. This suggests that initial target point binding can begin with the "open" region of the Cmr1 head most accessible; however, key seed sequence residues are required to initiate conformational changes within the complex by intercalating between the "closed" primary (Cmr4) and secondary (Cmr5) backbones. Once the seed region binds, the channel of TtCmr can open and the rest of the substrate can base pair, propagating the concerted conformational changes.

[0180] Example 2

[0181] Materials and Methods

[0182] CMR46-complex reconfiguration

[0183] First, 3.5 μΐ^of crRNA (700 ng) was added to 3.5 μΐ^of IX Cmr buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl). Subsequently, the subunits were added to the reaction mixture in a specific order (Cmr3, Cmr2, Cmr4, Cmr5, Cmr6, Cmr1) with final concentrations of 2.5 μΜ, 2.5 μΜ, 10 μΜ, 7.5 μΜ, 2.5 μΜ, and 2.5 μΜ, respectively, to make a total reaction volume of 20 μΐ^. The reaction mixture was incubated at 65 °C for 30 min.

[0184] The target RNA sequence used in this experiment contained the following sequence:

[0185] (GAACUGCGCCUUGA) C (GUGGU) C (GUCCC) C (GGGCG) C (CUUAU) C (UACGGCCAUCG), where the underlined nucleotides are deoxynucleotides. This target RNA cannot be cleaved by the Cmr complex.

[0186] Pi detection assay

[0187] In vitro cOA detection assay was performed in TtCmr activity assay buffer (20 mM Tris-HCl pH8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP and 0.5 mM MgCl2, 2 units of thermostable inorganic pyrophosphatase (NEB #M0296S)) supplemented with Cmrt complex (62.5 nM) and RNA substrate (200 nM, unless otherwise specified). Reactions were incubated at 65°C for 1 hour, unless otherwise specified. Sigma-Aldrich Malachite Green Phosphate Assay Kit (MAK307) was used to visualize the signal.

[0188] Csx1 principle proof experiment

[0189] For Csx1 principle proof experiment, cOA detection assay was performed as described in “Pi detection assay” except that after incubation at 65°C for 1 hour, samples were heat inactivated at 95°C for 10 minutes. After heat inactivation, samples were centrifuged at 13000 g for 10 minutes and supernatant was stored at -20°C. 2 uL of previously obtained supernatant was added to a reaction mixture with TtCmr activity buffer (20 mM Tris-HCl pH8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP and 0.5 mM MgCl2, 2 units of thermostable inorganic pyrophosphatase (NEB #M0296S)) and ~1.5 ug Csx1 (TTHB144) and incubated at 65°C for 10 minutes. After incubation, RNase alert (IDT #11-04-03-03) or DNase alert (IDT #11-04-03-04) reagents were added according to instructions. After fluorescence measurement, the reaction was incubated at 37°C for 30 minutes.

[0190] Results

[0191] Sensitivity experiment

[0192] Reaction time (A) was set to 1 h and development time was 30 min to investigate the sensitivity of the system. As shown in A in Figure 8 measurable readout was obtained in the range of 500 pM - 1 nM of target RNA (~2-fold increase over non-target). The strategy of making mutant subunits lacking the ability to cleave the target RNA was used to increase the effective sensitivity of the complex. Target RNA mimic that the complex cannot cleave was used.

[0193] Time course experiment

[0194] The experiment was set up to determine the measurable signal (expressed as fold increase over the blank sample) at specific time points. The total reaction time consists of two parts: A) the Pi production reaction after the addition of the target RNA and B) the colorimetric reaction after the addition of the developer. The final output is the fold increase, which is measured in absorbance at the end of the combined reaction times. The duration of the total reaction time in the final application is set by the desired threshold of measurability (fold increase over the blank sample (negative control)). In Figure 8 In B, a data set with a set colorimetric reaction time (B) of 15 minutes and a variable Pi production reaction time (A) was chosen. This was arbitrarily chosen to give a perspective of the system.

[0195] Principle proof experiment mediated by Csx1

[0196] Implementation Figure 8 This principle proof experiment shown in C was performed to prove the activation of Csx1 by the target RNA. The partial reaction mixture incubated in the presence of the target RNA to produce cOA was added to a new reaction containing Csx1 and the ssRNA or ssDNA quencher fluorophore sequence. The results shown in the bar graph clearly show the degradation of the ssRNA after the addition of the cOA containing mixture. This indicates that Csx1 can be indirectly activated by the type III CRISPR Cas system upon recognition of the target RNA.

[0197] Example 3

[0198] Materials and Methods

[0199] Cas proteins and Cas complexes

[0200] Cmr4 D26N cleavage dead mutant was generated by targeted mutagenesis. All Cas protein coding sequences were generated as synthetic gBlocks (Integrated DNA Technologies (IDT)) after codon optimization for compatibility with the heterologous expression host Escherichia coli. All coding sequences were cloned into expression vectors using standard cloning methods known to those skilled in the art. In addition, the Cmr4 D26N cleavage dead mutant was generated by targeted mutagenesis of the Cmr4 gBlock. The expression vectors contain N- or C-terminal streptavidin tags, optional TEV cleavage sites, a bi-cistronic design element, a T7 promoter sequence, a terminator sequence, a p15A low copy origin of replication, and a kanamycin resistance marker. The expression vectors themselves were derived from a p15A cloning vector (Addgene plasmid #41187). All expression vectors were transformed into Escherichia coli BL21 (DE3) for protein expression.

[0201] Recombinant strains were grown in 2 L of Lysogeny Broth (LB) media, grown until the OD600 reached -0.6. After the culture was placed on ice for 1 hour, isopropyl β-D-l-thiogalactopyranoside was added to a final concentration of 0.2 mM. The culture was then incubated at 18°C for 16 hours (overnight). Cells were harvested (5000g, 10 minutes) and lysed by sonication in buffer A (100 mM Tris-HCl, 150 mM NaCl, pH 8.0) and then centrifuged at 30000g for 45 min. The clarified lysate was filtered and run over a pre-equilibrated StrepTrap FPLC column (GE Healthcare, Chicago, IL). After washing the column with buffer A until there was no protein in the flow-through, the protein of interest was eluted using buffer B (100 mM Tris-HCl, 150 mM NaCl, and 2.5 mM D-desthiobiotin). If needed, the protein was cleaved from the affinity tag by the addition of TEV protease (Genscript cat. No. Z03030) and incubated overnight at 4°C. The protein of interest was separated from the mixture by a HisTrap affinity chromatography step, and the flow-through from this step was collected. If needed, additional size exclusion chromatography was added to achieve higher purity.

[0202] Cmr46-complex and dCmr46-complex reconstitution

[0203] First, 3.5 μΐ^of crRNA (700 ng) was added to 3.5 μΐ^of IX Cmr buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl). Subsequently, subunits were added to the reaction mixture in a specific order (Cmr3, Cmr2, Cmr4 or Cmr4 D26N, Cmr5, Cmr6, Cmr1) to final concentrations of 2.5 μΜ, 2.5 μΜ, 10 μΜ, 7.5 μΜ, 2.5 μΜ, and 2.5 μΜ, respectively, to make a total reaction volume of 20 μΐ^. The reaction mixture was incubated at 65°C for 30 minutes.

[0204] Indirect cOA detection assay

[0205] In vitro cOA detection assays were performed in TtCmr activity assay buffer (20 mM Tris-HCl pH8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP and 0.5 mM MgCl2) with reconstituted Cmr46 complex (62.5 nM), different concentrations of RNA substrate (listed in Table 4 or Table 5), Csx1 (1 mM) and 0.5 pL of RNaseAlert QC system (Thermo Scientific, prepared according to instructions). Reactions were incubated at 65 °C in a qPCR thermocycler, with fluorescence output (495 / 520 nm excitation / emission) measured at 2 minute intervals, or by incubation at 65 °C in a Genie III (Optigene), with fluorescence output (495 / 520 nm excitation / emission) measured at 15 second intervals. Measurements at different concentrations of target RNA were used to determine the sensitivity range of the system.

[0206] Results

[0207] Confirmation of the ability of target RNA to bind dCmr46 and subsequent Cmr2 / Cas10 activation

[0208] The Cmr4 D26N mutant was generated as it was hypothesised to only affect the cleavage ability of the complex, without affecting the binding ability of the complex or subsequent activation of the Cmr2 / Cas10 subunits. To demonstrate this, the target binding ability was measured using the aforementioned indirect cOA visualisation method. Indeed, the mutated protein did not abolish the target binding ability of the full-length type IIIB complex (Cmr46) Figure 9 、 10 ).

[0209] Furthermore, the full-length catalytically dead type IIIB complex (dCmr46) was found to increase the sensitivity of target RNA when compared to the wild-type type IIIB complex Figure 9 、 10 ).

[0210] In addition, the signal output of the assay indicated that dCmr46 produced more cOA in the same time frame when compared to wild-type Cmr46 Figure 11 ). We aimed to exploit these features of Cmr4 D26N for diagnostic purposes, where we applied the mutation to in vitro culture assays for higher target sensitivity. This gives the benefit of lower concentrations of target material in the detection assay sample, or a reduction in the level of pre-amplification required to reach the detection limit.

[0211] Table 5 RNA oligos used in indirect cOA detection assays

[0212] Table 5 RNA oligos used in indirect cOA detection assays

[0212]

[0213] Example 4 Type IIIA system from Thermus thermophilus (Csm)

[0214] Materials and Methods

[0215] cOA detection assay

[0216] In vitro cOA detection assays were performed in TtCmr activity assay buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP and 0.5 mM MgCl2) supplemented with endogenous Csm complex (-2 pg; Staal et al., 2014. Mol Cell 56:518-530) and RNA substrates (200 nM, listed in Table 4). Reactions were incubated at 65 °C for 1 hour, followed by the addition of 0.05 units pyrophosphatase (Thermfisher EF0221) and incubation at 25 °C for 30 minutes. Signals were visualized using Sigma-Aldrich Malachite Green Phosphate Assay Kit (MAK307). Experiments were performed according to the design shown in Table 6.

[0217] Table 6 Reaction summary for direct detection of cOA using endogenous Type IIIA Csm RNP complex. Reactions A to D were set up according to the proposed composition.

[0218] A B C D Csm complex + + + + Target RNA - - + + Pyrophosphatase - + - +

[0219] Results

[0220] Figure 12 Results of the Type IIIa Csm cOA production assay are shown. This Type III CRISPR / Cas complex also shows cOA production upon addition of a complementary target RNA.

[0221] Example 5 One-pot SARS-CoV-2 detection

[0222] Materials and Methods

[0223] Design of Type IIIB Cmr crRNA and RPA primers

[0224] Based on reports from the World Health Organization (WHO) and the Centers for Disease Control and Prevention (CDC), the N gene was identified as a suitable target for SARS-CoV-2 detection. crRNAs were designed for a region in the N gene, which is referred to as N3 by the CDC, which is conserved in multiple SARS-CoV-2-like coronaviruses:

[0225] crRNA_N3:

[0226] 5’-AUUGCGACGCAGCATTGTTAGCAGGATTGCGGGTGCCAATGTGATC 3’

[0227] For amplification of the N3 region, DNA primers for RPA were designed according to the parameters set forth by the TwistAmp Liquid Basic kit (TwistDx Ltd, Maidenhead, UK). In addition, a T7 promoter sequence was added at the 5’ of the forward primer for in vitro transcription. By screening multiple candidate primers for successful amplification, we identified the best performing primer pair:

[0228] nCOV_N3_RPA_F1: 5’

[0229] GGCATAATACGACTCACTATAGGGTCTGATAATGGACCCCAAAATCAGCGAAAT 3’

[0230] nCOV_N3_RPA_R1: 5’ CTCCATTCTGGTTACTGCCAGTTGAATCTG 3’

[0231] The Cmr46 complex was reconstituted using crRNA_N3 as described previously.

[0232] The SARS-CoV-2 detection assay combines RPA and Type IIIB Cmr detection in a single reaction. Synthetic SARS-CoV-2 was used as target RNA. The genome was provided by Twist Biosciences (South San Francisco, CA) as 6 non-overlapping 5 kb RNA fragments, approximately 10 6 copies per microliter. The reference genome was created based on the isolated Wuhan-Hu-1 (GenBank ID: MN908947.3).

[0233] TwistAmp Liquid Basic kit (TwistDx) provides reagents for RPA amplification. To allow working at small sample volumes, each RPA reaction mix supplied by the vendor was divided into four aliquots. In addition, oligonucleotide primers, reverse transcriptase components and T7 in vitro cultured transcripts were introduced into these mixtures: 1.5 μL primer mix (10 mM; Integrated DNA Technologies), 0.5 μL M-MLV RT (100 U / μL; Invitrogen), 0.5 μL DTT (50 mM; Invitrogen), 0.25 μL RNase Inhibitor (40 U / μL; New England Biolabs (NEB)), 0.5 μL T7 polymerase (50 U / μL; NEB), 2.25 μL dNTP solution mix (10 mM; NEB) and 2.25 μL NTP solution mix (20 mM; NEB). Following the RPA mix, a SARS-CoV-2 Cmr mix was created by combining 0.125 μL RNaseAlert QC system (Thermo Scientific, dry pellets supplied by the manufacturer resuspended in 100 μL instead of 1 mL), 1 μL Csxl (10 μM), Cmr46 complex to a final reaction mix concentration of ~60 nM and ATP to a final reaction mix concentration of 1 mM. After mixing both reaction solutions, 16.5 μL RPA mix was combined with 4.25 μL SARS-CoV-2 Cmr mix and 1 μL SARS-CoV-2 synthetic genomic template. Various mixtures containing 100000 copies / L to 10 copies / L of genomic template were created. Reactions were incubated at 37 °C for 30 min and 65 °C for 45 min in a Genie III (OptiGene). The instrument performed a fluorescence read starting at 30 min at 495 / 520 nm (excitation / emission).

[0234] Results

[0235] The SARS-CoV-2 detection assay combines amplification and detection of the target genetic material in a single reaction. This one-pot reaction mixture is incubated at 37 °C for 45 min (pre-amplification) followed by an increase in temperature to 65 °C (signal generation). In Figure 13 , data from the SARS-CoV-2 synthetic genomic latency phase are depicted. The results show a significant increase in signal within minutes of incubation at 65 °C compared to the negative control (NC). It is estimated that the pre-amplification time could be further shortened, as signal generation can usually be observed after 5 min of incubation at 65 °C.

[0236] Example 6 Validation of one-pot SARS-CoV-2 detection

[0237] Materials and Methods

[0238] A small scale trial was performed in collaboration with Wageningen Bioveterinary Research (WBVR) to validate the one-pot type III detection assay for SARS-CoV-2 in mink samples. RNA extraction was performed on rectal swab samples of 4 COVID positive mink (GenBank IDs MT396266, MT457390 and Mt457399) using the Direct Zol RNA miniprep kit (Zymo Research). The samples were eluted in 100 pL RNase-free water, of which 5 pL was used as template for the detection assay. TwistAmp TMThe TwistAmp® info Kit (TwistDx) provides reagents for amplification by RPA. To allow working at small sample volumes, each RPA reaction mix supplied by the vendor was divided into four aliquots. The supplied primer-free rehydration buffer was combined with 1.05 μΐ, of primer mix (5 mM forward and reverse; Integrated DNA Technologies) per reaction and subsequently used to rehydrate the supplied RPA pellets. In addition, 4.5 μΐ, of reconstituted Cmr46 complex (to a final reaction mix concentration of ~60 nM, loaded with N3 gene crRNA), 0.125 μΐ, RnaseAlert QC system (Thermo Scientificial, dry pellets supplied by the manufacturer resuspended in 100 μΐ, instead of 1 mL), 0.25 μΐ, ATP (80 mM; Sigma Aldrich), 1 μΐ, Csx1 (10 μΜ), 0.5 μΐ, M-MLV RT (100 U / μL; Invitrogen), 0.5 μΐ, DTT (50 mM; Invitrogen), 0.25 μΐ, Mouse RNase Inhibitor (40 U / μL; New England Biolabs (NEB)), 0.5 μΐ, T7 polymerase (50 U / μL; NEB), and 2 μΐ, NTP solution mix (20 mM; NEB) were combined. For each test reaction, 8.425 μΐ, of RPA mix was combined with 5.625 μΐ, of Cmr mix, 0.625 μΐ, MgOAc (280 mM, TwistDx), and 5 μΐ, of template or RNase-free MQ to a total of 19.675 μΐ. As a positive control, 5 μΐ, of 100 copies / μL of SARS-CoV-2 synthetic genome (see Example 5) was used. The reaction mix was incubated at 37 °C for 30 min in a Genie III (OptiGene) spectrophotometer and subsequently incubated at 65 °C for 45 min. Data acquisition was done during the 65 °C incubation period, measuring fluorescence at 495 nm / 520 nm (excitation / emission) at 15-second intervals.

[0239] Results

[0240] Since the first outbreak of SARS-CoV-2 at a Dutch mink farm at the end of April 2020, WBVR has been responsible for all diagnostic testing of mink in the Netherlands. Extracted RNA samples were provided and subsequently used in a diagnostic assay that combines amplification of the target genetic material with detection in a single reaction. This one-pot reaction mix was incubated at 37 °C for 45 min (pre-amplification) after which the temperature was increased to 65 °C (signal generation). Data from incubation of mink SARS-CoV-2 samples is depicted in Figure 14In conclusion. These results clearly show that it is possible to detect SARS-CoV-2 within 30 minutes of incubation at 65°C, showing the applicability of this technology on real-world complex sample matrices.

Claims

1. A ribonucleic acid detection system based on clustered regularly spaced short palindromic repeats (CRISPR), comprising: a) an effector complex comprising a type III CRISPR-associated effector protein (Cas) and at least one CRISPR RNA (crRNA) that binds to a target nucleic acid molecule. b) Components used to directly or indirectly determine cyclic oligoadenylate (cOA) levels. in, The type III Cas is type III Cas7, which lacks cleavage activity.

2. The detection system according to claim 1, wherein, The type III Cas is type IIIB Cas.

3. The detection system according to claim 2, wherein, The type III Cas is derived from thermophilic organisms.

4. The detection system according to claim 3, wherein, The thermophilic organism is *Thermophilic bacterium* ( ). Thermus thermophilus ).

5. The detection system according to any one of claims 1-4, wherein, The components used to directly or indirectly determine cOA levels include components used to determine pyrophosphate / ester levels.

6. The detection system according to any one of claims 1-4, further comprising inorganic pyrophosphatase.

7. The detection system according to claim 6, wherein, The inorganic pyrophosphatase is derived from thermophilic organisms.

8. The detection system according to claim 7, wherein, The thermophilic organism is thermophilic bacteria.

9. The detection system according to any one of claims 1-4, further comprising a cOA-dependent nonspecific effector endoribonuclease.

10. The detection system according to claim 9, wherein, The cOA-dependent nonspecific effector endoribonuclease is Csx1.

11. The detection system of claim 9, further comprising a detectable substrate for the endonuclease.

12. The detection system of claim 10, further comprising a detectable substrate for the endonuclease.

13. A method for determining the presence or absence of a target nucleic acid molecule in a sample derived from a plant, the method comprising: Provide the sample with a ribonucleic acid detection system according to any one of claims 1-12; The sample was incubated under conditions that allowed the crRNA to bind to its target nucleic acid molecules; and The level of cyclic oligoadenylate (cOA) is determined directly or indirectly, and an increase in the determined cOA level compared with a control indicates the presence of the target molecule in the sample.

14. The method according to claim 13, wherein, The cOA level is determined by determining the level of pyrophosphate / ester or, in the case of the presence of inorganic pyrophosphatase in the detection system, the level of inorganic phosphate.

15. The method of claim 13 or 14, wherein the level of pyrophosphate / ester or inorganic phosphate is determined by colorimetric, fluorescence-based, fluorescence-based, or bioluminescent assays.

16. The method of claim 13, wherein the level of cOA activity is indirectly determined by using the detection system of any one of claims 9-12 to detect a detectable substrate for the effector ribonuclease to determine the level of a cOA-dependent nonspecific effector ribonuclease.

17. The method according to claim 16, wherein, The cOA-dependent nonspecific effector endoribonuclease is Csx1.

18. The method according to claim 13 or 14, wherein the sample is incubated with the ribonucleic acid detection system at a temperature between 37°C and 85°C.

19. The method according to claim 18, wherein, The sample was incubated with the ribonucleic acid detection system at a temperature of approximately 65°C.

20. An apparatus comprising a ribonucleic acid detection system according to any one of claims 1-12.

21. The apparatus of claim 20, comprising a plurality of ribonucleic acid detection systems arranged according to any one of claims 1-10, wherein the target nucleic acid molecules of the ribonucleic acid detection systems are different.

22. A kit for a component, comprising: a) an effector complex comprising a type III CRISPR-associated effector protein (Cas) and at least one CRISPR RNA (crRNA) that binds to a target nucleic acid molecule. b) Components used to directly or indirectly determine cyclic oligoadenylate (cOA) levels. in, The type III Cas is type III Cas7, which lacks cleavage activity.

Citation Information

Patent Citations

  • Luminescent detection of inorganic phosphate and coupled reactions

    US20140273036A1

  • Methods for cleaving DNA and RNA molecules

    WO2017120410A1