A dCAPS molecular marker for rice blast resistance gene Pita and its application

Abstract

The invention discloses an application of a dCAPS molecular marker for a rice blast resistance gene Pita, wherein the functional specific molecular marker for the rice blast resistance gene Pita is Pita-dCAPS; the Pita-dCAPS molecular marker is amplified from genomic DNA of a rice variety carrying the rice blast resistance gene Pita by using a primer pair SEQ ID NO.1 and SEQ ID NO.2, and can be specifically recognized by an endonuclease Ecop15Ⅰ, while the genomic DNA of a rice variety not containing the resistance gene Pita cannot be recognized by the endonuclease Ecop15Ⅰ; wherein, SEQ ID NO.1: 5'-ATCACGGGTATGGATTTTTCA-3'; SEQ ID NO.2: 5'-TCAAACAATCATCAAGTCAGGTTGAAGATGCAC-3'; the dCAPS molecular marker for the rice blast resistance gene Pita obtained by the invention can be applied to identifying the rice blast resistance gene Pita in rice varieties.

Description

Technical Field

[0001] The invention relates to the field of agricultural biotechnology, and in particular to a dCAPS molecular marker of a rice blast resistance gene Pita and an application thereof. Background Art

[0002] Rice blast can cause a significant reduction in rice yields, with a 40% to 50% reduction in severe cases, or even a total loss of all crops. However, due to the rapid variation in the pathogenicity of rice blast physiological subspecies, the resistance of a single resistant variety will gradually be lost; and traditional disease-resistant breeding strategies have the characteristics of heavy workload and long cycles. Therefore, it is urgent to change the traditional disease-resistant breeding strategy.

[0003] Resistance breeding improvement using R genes is an economical, efficient and environmentally friendly way to control diseases in field crops. In the past, it often took 10-15 years to cultivate a new variety using conventional methods such as pedigree method, and the process relied on the identification of disease resistance phenotypes, which was easily disturbed by the surrounding environment and human factors, thus reducing the selection efficiency of resistant varieties. MAS, a major application of molecular markers in breeding, is a technology that indirectly screens target traits by genotyping molecular markers that are closely linked to or developed within the R gene. Because it is not affected by other gene effects and environmental conditions, and allows large-scale, high-intensity selection in early generations, it can greatly improve the accuracy of conventional backcrossing and breeding, shorten the breeding period, and achieve accurate accumulation of multiple genes. With the completion of rice genome sequencing and the continuous development and application of molecular markers and biotechnology, MAS has become an important means of modern molecular design breeding.

[0004] In the analysis of rice blast resistance genes, 14 genes were identified in the initial 8 resistance loci, and a set of analysis and identification system for rice blast resistance genes was established. In recent decades, with the development of molecular genetics of rice blast resistance, systematic research on rice blast resistance genes has been gradually carried out, and fine positioning or large-scale disease resistance gene cloning has been carried out. The development and application of molecular markers have greatly promoted the identification of resistance genetic background and the development of breeding. Therefore, directly analyzing the functional allele sequence and developing its function-specific molecular markers to select target genes not only has high selection reliability, but also greatly accelerates the pace of breeding.

[0005] The rice blast resistance gene Pita is resistant to many rice blast fungus races in Japan, and can also show strong resistance to the Chinese strains KJ201 and FJ2011. Therefore, in order to more accurately and effectively apply the rice blast broad-spectrum resistance gene Pita to rice resistance breeding, it is necessary to develop a dCAPS molecular marker that truly reflects the Pita gene and is convenient and easy to use. Summary of the invention

[0006] The present invention provides a dCAPS molecular marker for a rice blast resistance gene Pita and its application, develops a dCAPS molecular marker for Pita that truly reflects a broad-spectrum rice blast resistance gene Pita, is convenient and easy to use, and has high accuracy and stability, so that the broad-spectrum rice blast resistance gene Pita can be better applied to rice resistance breeding.

[0007] The objective of the present invention is achieved through the following technical solutions:

[0008] The invention provides a dCAPS molecular marker of a rice blast resistance gene Pita. The functional specific molecular marker of the rice blast resistance gene Pita is Pita-dCAPS. The Pita-dCAPS molecular marker is amplified from genomic DNA of a rice variety carrying the rice blast resistance gene Pita by using a primer pair SEQ ID NO.1 and SEQ ID NO.2.

[0009] SEQ ID NO.1: 5'-ATCACGGGTATGGATTTTTCA-3';

[0010] SEQ ID NO. 2: 5'-TCAAACAATCATCAAGTCAGGTTGAAGATGCAC-3'.

[0011] Furthermore, the Pita-dCAPS molecular marker can be specifically recognized by the endonuclease Ecop15Ⅰ.

[0012] Furthermore, the rice blast resistance gene Pita includes a gene fragment SEQID NO.3 that partially encodes NBS-LRR proteins;

[0013] SEQ ID NO.3;

[0014] ATCACGGGTATGGATTTTTCATTCTATTCCCAGGTTACAACTTACAAGGATTATTGAGCTTCTTTCTTTCTCTGCCGTGGCTTCTATCTTTACCTGCTATGCATCTTCAACCTGACTTGATGATTGTTTGA.

[0015] Furthermore, the rice variety carrying the rice blast resistance gene Pita is the disease-resistant rice variety Fuhui 2663.

[0016] The present invention also provides a method for screening dCAPS molecular markers of the rice blast resistance gene Pita, by comparing the site sequences of the rice blast resistance gene Pita, screening out specific differential sites of Pita, and designing dCAPS molecular markers at the differential sites.

[0017] Furthermore, the screening method for the dCAPS molecular marker of the rice blast resistance gene Pita specifically comprises the following steps:

[0018] S1. Analysis of Pita base substitution sites: The genome sequences of Pita and its homologs downloaded from the public database and the genome sequences of the corresponding regions of the susceptible variety Nipponbare were sequenced. Sequence alignment was performed on the Pita site to screen for Pita-specific differential sites that can be distinguished from other rice blast resistance alleles at the site;

[0019] S2. Determination of restriction sites: According to the differential sites in the coding region of the Pita gene obtained in step S1, find specific restriction sites, and the corresponding restriction enzyme is Ecop15Ⅰ;

[0020] S3. Primer design: According to the design principle of indel markers, primers are designed at the indel differential sites;

[0021] S4. Select representative rice varieties: Use the above primer pairs to perform PCR amplification with total DNA of rice blast-resistant varieties carrying the rice blast-resistant gene Pita as a template to obtain a fragment containing the dCAPS molecular marker of the resistance gene Pita;

[0022] S5. Enzyme digestion detection, the obtained product is the rice blast resistance gene Pita gene dCAPS molecular marker Pita-dCAPS.

[0023] The present invention also provides application of the dCAPS molecular marker of the rice blast resistance gene Pita, and utilizes the dCAPS molecular marker of the rice blast resistance gene Pita to identify the rice blast resistance gene of rice varieties.

[0024] Furthermore, the application of the dCAPS molecular marker of the rice blast resistance gene Pita specifically comprises the following steps:

[0025] A1, amplification: using primer F1 shown in SEQ ID NO.1 and primer R1 shown in SEQ ID NO.2 to perform PCR on the genome of the rice variety to be tested;

[0026] A2, using the specific endonuclease Ecop15Ⅰ to digest the PCR products containing Pita and those not containing Pita;

[0027] A3. Detection: Agarose electrophoresis is used to detect whether the rice variety to be tested carries the rice blast resistance gene based on the size of the detected nucleotide fragments.

[0028] Furthermore, in step A3, if a nucleotide fragment with a molecular weight of 98bp is detected, it means that the target fragment can be cut by the endonuclease Ecop15Ⅰ, and the rice variety to be tested carries the rice blast resistance gene Pita; if a nucleotide fragment with a molecular weight of 123bp is detected, it means that the target fragment cannot be cut by the endonuclease Ecop15Ⅰ, and the rice variety to be tested does not carry the rice blast resistance gene Pita.

[0029] The invention also provides a kit for identifying rice blast resistance of rice varieties, wherein the nucleic acid sequence is a primer pair shown in SEQ ID NO.1 and SEQ ID NO.2, and the primer pair includes a specific endonuclease Ecop15Ⅰ.

[0030] Beneficial effects of the present invention:

[0031] 1. In practical applications, the dCAPs molecular marker of the rice blast resistance gene Pita provided by the present invention has low requirements for instruments and equipment and technology, and the marker detection method is simple and convenient, and typing can be performed on an electrophoresis platform. The typing platform is fast, economical, and has strong operability. The molecular marker provided by the present invention only requires enzyme digestion of the PCR product and combined with agarose gel electrophoresis or non-denaturing polyacrylamide gel electrophoresis, which has low cost, high throughput, and high specificity, and is particularly suitable for production practice.

[0032] 2. The present invention is a Pita gene-specific Pita-dCAPS marker developed for the replacement of a base in the internal sequence of the rice blast resistance Pita gene. The present invention can successfully distinguish Pita from other non-Pita genes located at the site by enzyme cutting and electrophoresis detection methods, and the detection efficiency is high; the Pita-dCAPS, a Pita-specific molecular marker provided by the present invention, is a dominant marker, which exists inside the Pita gene and is in the coding region of the Pita gene. The theoretical value of the screening ability for Pita can reach 100%, and its comprehensive performance is better than the reported molecular markers and functional markers linked to Pita. The present invention is suitable for germplasm resource screening of Pita under any genetic background, transgenic breeding, gene aggregation, and resistance breeding based on MAS technology, which greatly improves the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The amplification was performed using the primer F1 shown in SEQ ID NO.1 and the primer R1 shown in SEQ ID NO.2 of the present invention, with the total DNA of four selected representative varieties as templates. DETAILED DESCRIPTION

[0034] The present invention will be further described in detail below in conjunction with the embodiments and drawings. The embodiments are only used to explain the present invention and do not constitute any limitation to the present invention.

[0035] Example 1

[0036] A dCAPS molecular marker of a rice blast resistance gene Pita, wherein the functional specific molecular marker of the rice blast resistance gene Pita is Pita-dCAPS; the Pita-dCAPS molecular marker is amplified from genomic DNA of a rice variety carrying the rice blast resistance gene Pita using a primer pair of SEQ ID NO.1 and SEQ ID NO.2, the genomic DNA of the rice variety containing the resistance gene Pita can be specifically recognized by the endonuclease Ecop15Ⅰ and cut into a smaller target fragment, while the genomic DNA of the rice variety not containing the resistance gene Pita cannot be recognized by the endonuclease Ecop15Ⅰ;

[0037] SEQ ID NO.1: 5'-ATCACGGGTATGGATTTTTCA-3';

[0038] SEQ ID NO. 2: 5'-TCAAACAATCATCAAGTCAGGTTGAAGATGCAC-3'.

[0039] Furthermore, the rice blast resistance gene Pita includes a gene fragment SEQID NO.3 that partially encodes NBS-LRR proteins;

[0040] SEQ ID NO.3;

[0041] ATCACGGGTATGGATTTTTCATTCTATTCCCAGGTTACAACTTACAAGGATTATTGAGCTTCTTTCTTTCTCTGCCGTGGCTTCTATCTTTACCTGCTATGCATCTTCAACCTGACTTGATGATTGTTTGA.

[0042] Furthermore, the rice variety carrying the rice blast resistance gene Pita is the disease-resistant rice variety Fuhui 2663.

[0043] Example 2

[0044] The method for screening dCAPS molecular markers and primers of the rice blast resistance gene Pita is to compare the site sequences of the rice blast resistance gene Pita, screen out the specific differential sites of Pita, and design dCAPS molecular markers at the differential sites, which specifically includes the following steps:

[0045] S1. Analysis of Pita base substitution sites:

[0046] Partial genome sequences of Pita rice donor varieties downloaded from public databases mainly include Pita genome sequences and homologous genome sequences and genome sequences of corresponding regions of the sequenced susceptible variety Nipponbare (GenBank: AY196754.1). Then, sequence alignment was performed on the Pita locus in the rice database to screen for Pita-specific differential loci that can be distinguished from other rice blast resistance alleles at the locus, and specific markers were designed based on the differential loci in the functional regions to screen for Pita-specific differential loci that can be distinguished from other rice blast resistance alleles at the locus.

[0047] Pita:

[0048] ATCACGGGTATGGATTTTTCATTCTATTCCCAGGTTACAACTTACAAGGATTATTGAGCTTCTTTCTTTCTCTGCCGTGGCTTCTATCTTTACCTGCTATGCATCTTCAACCTGACTTGATGATTGTTTGA;

[0049] Nipponbare:

[0050] ATCACGGGTATGGATTTTTCATTCTATTCCCAGGTTACAACTTACAAGGATTATTGAGCTTCTTTCTTTCTCTGCCGTGGCTTCTATCTTTACCTGCGATGCATCTTCAACCTGACTTGATGATTGTTTGA;

[0051] Among them, the framed T in the Pita genome sequence and the framed G in the Nipponbare genome sequence are the single-base substitution parts of the Pita gene with differences detected after alignment, which are differential sites;

[0052] S2. Determination of restriction site: Based on the differential sites in the coding region of the Pita gene obtained in step S1, find the specific restriction site CAGCAG, and the corresponding restriction enzyme is Ecop15Ⅰ;

[0053] S3. Primer design: According to the design principle of indel markers, primers were designed at the indel differential sites. The base sequences of the primer pairs are as follows:

[0054] SEQ ID NO.1: 5'-ATCACGGGTATGGATTTTTCA-3';

[0055] SEQ ID NO.2: 5'-TCAAACAATCATCAAGTCAGGTTGAAGATGCAC-3';

[0056] S4. Select representative rice varieties: Use the above primer pair SEQ ID NO.1 and SEQ ID NO.2, and use the total DNA of rice blast-resistant varieties carrying the rice blast-resistant gene Pita as a template to perform PCR amplification to obtain a fragment containing the dCAPS molecular marker of the resistance gene Pita; in this embodiment, four representative rice varieties are selected, namely: Nipponbare, Fuhui 2663, IR64 and R498;

[0057] S5, enzyme digestion detection, the PCR product is digested, and then the digestion product is detected by agarose electrophoresis, and the obtained product is the rice blast resistance gene Pita gene dCAPS molecular marker Pita-dCAPS;

[0058] Among them, the PCR amplification reaction system is as follows:

[0059] 2x Reaction Mix: 16 μL;

[0060] Primer SEQ ID NO.1 (F1) (10 μM): 1 μL;

[0061] Primer SEQ ID NO.1 (F1) (10 μM): 1 μL;

[0062] DNA template (20-50 ng / μL): 2 μL;

[0063] ddH2O: make up to 25 μL;

[0064] The PCR temperature cycle conditions were as follows: 94°C for 5 min; 94°C for 30 s; 55°C for 30 s; 72°C for 30 s; 35 cycles; 72°C for 7 min; 10°C storage;

[0065] The PCR product was digested with 1 μL of endonuclease, 2 ng of target fragment, 5 μL of 10× buffer, and ddH2O to 50 μL. The digestion reaction was terminated after incubation in a metal bath at an appropriate temperature for about 2 h.

[0066] Finally, an appropriate amount of the enzyme-digested product was subjected to electrophoresis on 3% agarose at 110 V for 40 minutes to obtain the Pita-dCAPS molecular marker.

[0067] Example 3

[0068] The present invention also provides an application of the dCAPS molecular marker of the rice blast resistance gene Pita, and uses the dCAPS molecular marker of the rice blast resistance gene Pita to identify the rice blast resistance gene of rice varieties, which specifically comprises the following steps:

[0069] A1, amplification: using primer F1 shown in SEQ ID NO.1 and primer R1 shown in SEQ ID NO.2 to perform PCR on the genome of the rice variety to be tested;

[0070] A2, using the specific endonuclease Ecop15Ⅰ to digest the PCR products containing Pita and those without Pita;

[0071] A3. Detection: Agarose electrophoresis is used to detect whether the rice variety to be tested carries the rice blast resistance gene based on the size of the detected nucleotide fragments. If a nucleotide fragment with a molecular weight of 98bp is detected, it means that the target fragment can be cut by the endonuclease Ecop15Ⅰ, and the rice variety to be tested carries the rice blast resistance gene Pita; if a nucleotide fragment with a molecular weight of 123bp is detected, it means that the target fragment cannot be cut by the endonuclease Ecop15Ⅰ, and the rice variety to be tested does not carry the rice blast resistance gene Pita.

[0072] See attached Figure 1 The primer F1 shown in SEQ ID NO.1 and the primer R1 shown in SEQ ID NO.2 of the present invention are used to amplify and digest the total DNA of 4 selected representative varieties as templates; lane 1 is a DNA ladder, lane 2 is a rice variety Nipponbare that does not contain Pita donor variety, which cannot be digested by endonuclease Ecop15Ⅰ, and the detection fragment size is 123 bp; lane 2 is a rice variety Fuhui 2663 that has Pita donor variety, lane 3 is a rice variety IR24 that has Pita donor variety, lane 3 is a rice variety R498 that has Pita donor variety, lanes 2, 3, and 4 all contain Pita genes, can be digested by endonuclease Ecop15Ⅰ, and the detection fragment is a smaller fragment with a size of 98 bp.

[0073] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention. Sequence Listing <110> Rice Research Institute, Fujian Academy of Agricultural Sciences <120> A dCAPS molecular marker for rice blast resistance gene Pita and its application <130> PCN220168 <140> 2022102049996 <141> 2022-03-02 <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <400> 1 atcacgggta tggatttttc a 21 <210> 2 <211> 33 <212> DNA <213> Artificial Sequence <400> 2 tcaaacaatc atcaagtcag gttgaagatg cac 33 <210> 3 <211> 131 <212> DNA <213> Artificial Sequence <400> 3 atcacgggta tggatttttc attctattcc caggttacaa cttacaagga ttattgagct 60 tctttctttc tctgccgtgg cttctatctt tacctgctat gcatcttcaa cctgacttga 120 tgattgtttg a 131

Claims

1. A dCAPS molecular marker for the rice blast resistance gene Pita, characterized in that: The functional specific molecular marker of the rice blast resistance gene Pita is Pita-dCAPS; the Pita-dCAPS molecular marker is amplified from the genomic DNA of a rice variety carrying the rice blast resistance gene Pita using the primer pair SEQ ID NO.1 and SEQ ID NO.2; SEQ ID NO.1: 5'-ATCACGGGTATGGATTTTTCA-3'; SEQ ID NO.2: 5'-TCAAACAATCATCAAGTCAGGTTGAAGATGCAC-3'; The Pita-dCAPS molecular marker can be specifically recognized by the endonuclease Ecop15Ⅰ.

2. The dCAPS molecular marker of the rice blast resistance gene Pita according to claim 1, characterized in that: The rice variety carrying the rice blast resistance gene Pita is the disease-resistant rice variety Fuhui 2663.

3. Application of dCAPS molecular markers of rice blast resistance gene Pita, characterized in that: The dCAPS molecular marker of the rice blast resistance gene Pita according to claim 1 or 2 is used to identify the rice blast resistance gene of rice varieties.

4. The use of the dCAPS molecular marker of the rice blast resistance gene Pita as claimed in claim 3, characterized in that: The specific steps include: A1, amplification: using primer F1 shown in SEQ ID NO.1 and primer R1 shown in SEQ ID NO.2 to perform PCR on the genome of the rice variety to be tested; A2, using the specific endonuclease Ecop15Ⅰ to digest the PCR products containing Pita and those not containing Pita; A3. Detection: Agarose electrophoresis is used to detect whether the rice variety to be tested carries the rice blast resistance gene based on the size of the detected nucleotide fragments.

5. The use of the dCAPS molecular marker of the rice blast resistance gene Pita as claimed in claim 4, characterized in that: In step A3, if a nucleotide fragment with a molecular weight of 98 bp is detected, it means that the target fragment can be cut by the endonuclease Ecop15Ⅰ, and the rice variety to be tested carries the rice blast resistance gene Pita; if a nucleotide fragment with a molecular weight of 123 bp is detected, it means that the target fragment cannot be cut by the endonuclease Ecop15Ⅰ, and the rice variety to be tested does not carry the rice blast resistance gene Pita.

6. A kit for identifying rice blast resistance of rice varieties, characterized in that: The kit comprises a primer pair with nucleic acid sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, and also comprises a specific endonuclease Ecop15Ⅰ.

Images