Application of TL1A as a biomarker in the diagnosis of cirrhosis
By detecting the methylation level of the TL1A gene promoter using real-time quantitative methylation-specific PCR, the problem of early diagnosis of cirrhosis has been solved, providing a convenient and accurate diagnostic method suitable for the early identification and treatment guidance of hepatitis B-related cirrhosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANDONG UNIV QILU HOSPITAL
- Filing Date
- 2022-05-17
- Publication Date
- 2026-07-03
AI Technical Summary
Existing technologies are insufficient to effectively identify early biomarkers of cirrhosis, leading to difficulties in early diagnosis. This necessitates invasive liver biopsies and imaging examinations, which are easily affected by patient positioning and equipment.
A real-time quantitative methylation-specific PCR detection method is used to detect the methylation level of the TL1A gene promoter. The TL1A gene promoter is in a hypomethylated state in patients with hepatitis B-related cirrhosis. A detection kit and diagnostic system are provided, including TL1A-specific primers and Taqman fluorescent probes, for detection in peripheral blood samples.
It enables early, sensitive, and stable diagnosis of hepatitis B-related cirrhosis, with convenient sample collection, simple operation, and accurate test results. It is suitable for large-scale application to assist in clinical diagnosis and treatment.
Smart Images

Figure CN114891877B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of TL1A as a biomarker in the diagnosis of cirrhosis. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Liver corrhosis (LC) is a common chronic progressive liver disease caused by long-term or repeated exposure to one or more etiologies. Histopathological examination reveals extensive hepatocyte necrosis, nodular regeneration of residual hepatocytes, connective tissue hyperplasia, and fibrous septa formation, leading to destruction of liver lobule structure and the formation of pseudolobules. In my country, chronic hepatitis B virus infection is the most important risk factor for the development of cirrhosis and liver failure. Late-stage cirrhosis is characterized by impaired liver function and portal hypertension, affecting multiple systems and often leading to complications such as upper gastrointestinal bleeding, hepatic encephalopathy, secondary infections, hypersplenism, ascites, and cancer. However, in the early stages, due to the liver's strong compensatory function, no obvious symptoms are detected, and diagnosis relies heavily on imaging examinations. When necessary, liver biopsy or laparoscopy can be used for diagnosis. Therefore, early diagnosis of LC urgently requires effective biomarkers, and timely and effective diagnosis to delay disease progression remains a medical challenge. Therefore, elucidating the mechanisms of hepatitis B-related cirrhosis, establishing effective comprehensive assessment and diagnostic criteria, and developing effective prevention and treatment strategies are of great significance.
[0004] Studies have shown that epigenetics, referring to changes in gene expression levels based on non-gene sequence alterations such as DNA methylation and chromatin conformation changes, plays a crucial role in the progression of cirrhosis and has gradually become a research hotspot in the medical field. Among these, DNA methylation is a key regulatory mechanism in epigenetics. DNA methylation refers to the covalent bonding of a methyl group, 5-methylcytosine, to the cytosine 5-carbon position of a CpG dinucleotide in the genome under the action of DNA methyltransferase (DNMT). Methylated cytosine is mainly located in the long chain of DNA, containing high-density CpG clusters called CpG islands. Methylation primarily occurs on the cytosine of these CpG islands. Methylation of gene promoter regions can inhibit transcription, thereby affecting the expression of cell / tissue-specific genes. Studies have shown that hosts infected with HBV exhibit upregulated DNMT expression. Therefore, HBV can inhibit viral replication by enhancing DNMT activity, promoting viral DNA promoter methylation, and inhibiting viral DNA transcription.
[0005] Patients with cirrhosis exhibit varying degrees of fibrosis in their livers. Fibrosis and inflammatory damage play crucial roles in the development and progression of cirrhosis. Tumor necrosis factor ligand-associated molecule 1A (TL1A), a member of the TNF superfamily (TNFSF) encoded by TNFSF15, is a major transmembrane protein in endothelial cells and plays a key role in various chronic inflammatory processes. In the liver, it is primarily located in macrophages, promoting the secretion of a series of pro-inflammatory and pro-fibrotic factors. These factors can act on hematopoietic stem cells to induce a pro-fibrotic phenotype. Specifically, it can produce and activate the typical pro-fibrotic cytokine TGF-β1, which can increase the production of myofibroblast ECM and TIMP-1. In addition, hepatic macrophages can also produce PDGF-BB (myofibroblast proliferation stimulant), IL-1β, and TNF-α to maintain pro-inflammatory and pro-fibrotic stimulation. TL1A plays an important role in liver fibrosis, and studies have shown a significant negative correlation between the degree of TL1A gene methylation and its expression level. Hypomethylation of the GSTM3 gene promoter can increase TL1A expression, leading to further development of fibrosis and impaired normal liver function. Quantitative methylation assay (QMA) is currently the most widely used method for detecting DNA methylation, possessing high specificity, sensitivity, and ease of operation.
[0006] Currently, liver biopsy is the gold standard for diagnosing cirrhosis. However, due to its invasive nature, clinical diagnosis often relies on symptoms of decompensated cirrhosis, such as portal hypertension and ascites, combined with imaging examinations such as transient elastography (TE). Early diagnosis of cirrhosis remains challenging. The TE test for liver stiffness measurement (LSM), as one of the diagnostic indicators for cirrhosis, is limited by the influence of patient positioning and equipment. Therefore, there is an urgent need for a biomarker that can identify early-stage cirrhosis, enabling early, sensitive, and stable diagnosis of cirrhotic lesions for timely and effective treatment. Summary of the Invention
[0007] To address the problems existing in the prior art, the present invention aims to provide the application of TL1A as a biomarker in the diagnosis of cirrhosis. This invention, through its research, has for the first time discovered that the TL1A gene promoter exhibits a hypomethylated state in patients with hepatitis B-related cirrhosis, suggesting that the degree of methylation of the TL1A gene promoter is closely related to the diagnosis of hepatitis B-related cirrhosis. Therefore, quantitative detection of TL1A gene promoter methylation can indicate the occurrence and progression of hepatitis B-related cirrhosis, thereby assisting in clinical diagnosis. Based on the above research results, this invention has been completed.
[0008] To achieve the above-mentioned technical objectives, the technical solution of the present invention is as follows:
[0009] In a first aspect, the invention provides the use of a substance for detecting the degree of methylation of the tumor necrosis factor ligand-associated molecule 1A (TL1A) gene in the preparation of diagnostic or auxiliary diagnostic products for liver cirrhosis.
[0010] The tumor necrosis factor ligand-associated molecule 1A (TL1A) gene was selected from the subject's blood.
[0011] The substance mentioned can be the substance used to detect the methylation level of the TL1A gene using a real-time quantitative methylation-specific PCR detection method. Compared with the methylation-specific polymerase chain reaction (MSP-PCR) qualitative detection method, the real-time quantitative methylation-specific PCR detection method can eliminate non-specific amplification, better avoid the influence of DNA contamination on the results, and ensure the specificity of the detection results.
[0012] The cirrhosis mentioned can be hepatitis B-related cirrhosis. This invention, through extensive and in-depth research, analyzed the methylation status of DNA gene promoters in peripheral blood mononuclear cells from multiple patients with hepatitis B-related cirrhosis (LC), chronic hepatitis B (CHB), and healthy individuals. Correlation analysis with the patients' disease prognostic indicators (MELD score) revealed a close relationship between the methylation status of the TL1A gene promoter and the progression of hepatitis B-related cirrhosis. The TL1A gene promoter is hypomethylated in cirrhosis patients. Analysis of the TL1A promoter methylation status in peripheral blood mononuclear cell DNA from patients with hepatitis B-related cirrhosis and chronic hepatitis B helps clinicians identify patients with chronic hepatitis B who may progress to hepatitis B-related cirrhosis, thus playing a diagnostic and treatment-guiding role. Therefore, the cirrhosis diagnostic or auxiliary diagnostic product can specifically be a product for monitoring or predicting the progression of chronic hepatitis B patients to hepatitis B-related cirrhosis.
[0013] A second aspect of the present invention provides a detection kit, the detection kit comprising at least a methylation-specific primer pair targeting the TL1A promoter of a target gene and a Taqman fluorescent probe;
[0014] The specific sequence is as follows:
[0015] TL1A-Upstream primer: 5'ATTTAGTTAGGACGTATATAGGTG 3' (SEQ ID NO.1);
[0016] TL1A downstream primer: 5'TTTACCAATTTAACAAACCCGAA 3' (SEQ ID NO.2);
[0017] TL1A-Taqman fluorescent probe: 5'CTAAAACCCAAAACAACAAACTCC 3' (SEQ ID NO.3);
[0018] The TL1A-Taqman fluorescent probe has a fluorescent group and a quenching group at its 5' end and 3' end, respectively. In one specific embodiment of the present invention, the fluorescent group can be Fam and the quenching group can be BHQ1.
[0019] A third aspect of the present invention provides a system for diagnosing or assisting in the diagnosis of cirrhosis, the system comprising at least a quantitative detection unit and an analysis unit;
[0020] The quantitative detection unit includes: performing a real-time quantitative methylation-specific polymerase chain reaction using the above-mentioned detection kit;
[0021] The analysis unit includes analyzing the results obtained from the quantitative detection unit, detecting the degree of DNA methylation of TL1A in the sample to be tested, and determining the subject's disease status.
[0022] The sample to be tested can be the subject's blood (peripheral blood).
[0023] The beneficial technical effects of one or more of the above technical solutions are as follows:
[0024] The above-described technical solution utilizes a real-time quantitative methylation-specific PCR detection method based on Taqman fluorescent probes (Methylight). Compared to the methylation-specific polymerase chain reaction (MSP-PCR) qualitative detection method, it eliminates non-specific amplification, better avoids the influence of DNA contamination on the results, and ensures the specificity of the detection results. Real-time quantitative methylation-specific PCR based on Taqman fluorescent probes uses fluorescently labeled Taqman probes to track PCR products, reflecting the methylation-specific PCR process in real time. Analysis of the methylation-specific PCR products yields the initial template amount of the sample. This detection method can detect trace amounts of DNA in human peripheral blood mononuclear cells, exhibiting high sensitivity and specificity, and is suitable for detecting samples with low DNA content and high loss rates.
[0025] In addition, the test samples of the above-mentioned technical solutions are taken from the peripheral blood of the subjects (such as patients with hepatitis B-related cirrhosis), which is convenient to collect, easy to operate and minimally invasive to patients.
[0026] The above-mentioned technical solution uses a reagent kit assembly, which, compared with other detection technologies, has advantages such as simple sample collection, rapid detection, and accurate results. It can serve as an auxiliary diagnostic basis for clinicians in patients with hepatitis B-related cirrhosis, and has profound clinical significance, making it suitable for large-scale application. A single reagent kit can complete the entire process from blood collection to quantitative detection of TL1A gene methylation levels related to the diagnosis of cirrhosis, making it convenient, fast, and applicable, with significant practical value.
[0027] Instruction manual illustrations
[0028] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the following description of the embodiments will be briefly introduced. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0029] Figure 1 This invention provides a comparison of the methylation levels of the TL1A promoter in patients with hepatitis B-related cirrhosis, patients with chronic hepatitis B, and healthy volunteers.
[0030] Figure 2 This is a schematic diagram of the specific detection results of qPCR for liver cirrhosis in an embodiment of the present invention: where the vertical axis represents the corrected fluorescence intensity value, the horizontal axis represents the cycle number of quantitative fluorescence amplification, the ct value is the number of cycles required to reach the threshold line; TL1A represents the methylation detection result of a positive liver cirrhosis sample; and ACTB amplification indicates that the sample content is normal.
[0031] Figure 3 This figure shows the correlation between the methylation rate of the TL1A gene promoter in patients with liver cirrhosis and the serum MELD score (A) and LSM detection coefficient (B) in this embodiment of the invention; in the figure, MELD Score: end-stage liver disease model score; PMR: methylation rate; LSM: liver cirrhosis assay;
[0032] Figure 4 The present invention provides subject characteristic operating curves for assessing the condition of liver cancer patients using quantitative methylation of the TL1A gene promoter, LSM, and MELD. Sensitivity and Specificity are also mentioned. Detailed Implementation
[0033] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0034] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0035] In a typical embodiment of the present invention, a substance for detecting the degree of methylation of the tumor necrosis factor ligand-associated molecule 1A (TL1A) gene is used in the preparation of diagnostic or auxiliary diagnostic products for liver cirrhosis.
[0036] The tumor necrosis factor ligand-associated molecule 1A (TL1A) gene was selected from the subject's blood.
[0037] The substance mentioned can be the substance used to detect the methylation level of the TL1A gene using a real-time quantitative methylation-specific PCR detection method. Compared with the methylation-specific polymerase chain reaction (MSP-PCR) qualitative detection method, the real-time quantitative methylation-specific PCR detection method can eliminate non-specific amplification, better avoid the influence of DNA contamination on the results, and ensure the specificity of the detection results.
[0038] The cirrhosis mentioned can be hepatitis B-related cirrhosis. This invention, through extensive and in-depth research, analyzed the methylation status of DNA gene promoters in peripheral blood mononuclear cells from multiple patients with hepatitis B-related cirrhosis (LC), chronic hepatitis B (CHB), and healthy individuals. Correlation analysis with the patients' disease prognostic indicators (MELD score) revealed a close relationship between the methylation status of the TL1A gene promoter and the progression of hepatitis B-related cirrhosis. Analysis of the TL1A promoter methylation status in peripheral blood mononuclear cell DNA from patients with hepatitis B-related cirrhosis and chronic hepatitis B helps clinicians identify patients with chronic hepatitis B who may progress to hepatitis B-related cirrhosis, thus playing a diagnostic and treatment-guiding role. Therefore, the cirrhosis diagnostic or auxiliary diagnostic product can specifically be a product for monitoring or predicting the progression of chronic hepatitis B patients to hepatitis B-related cirrhosis. The product can be a test kit.
[0039] To facilitate use by those skilled in the art, in another specific embodiment of the present invention, a detection kit is provided, the detection kit comprising at least a methylation-specific primer pair targeting the TL1A promoter of the target gene and a Taqman fluorescent probe;
[0040] The specific sequence is as follows:
[0041] TL1A-Upstream primer: 5'ATTTAGTTAGGACGTATATAGGTG 3' (SEQ ID NO.1);
[0042] TL1A downstream primer: 5'TTTACCAATTTAACAAACCCGAA3' (SEQ ID NO.2);
[0043] TL1A-Taqman fluorescent probe: 5'CTAAAACCCAAAACAACAAACTCC 3' (SEQ ID NO.3);
[0044] The TL1A-Taqman fluorescent probe has a fluorescent group and a quenching group at its 5' end and 3' end, respectively. In one specific embodiment of the present invention, the fluorescent group can be Fam and the quenching group can be BHQ1.
[0045] The detection kit may further include a specific primer pair for an internal reference gene and a Taqman fluorescent probe; the internal reference gene may be GPADH, with the following specific sequence:
[0046] GPADH upstream primer: 5'TGGTGATGGAGGAGGTTTAGTAAGT 3' (SEQ ID NO.4);
[0047] GPADH downstream primer: 5'AACCAATAAAACCTACTCCTCCCTTAAA 3' (SEQ ID NO.5);
[0048] GPADH-Taqman fluorescent probe: 5'ACCACCACCCAACACACAATAACAAACACA' (SEQ ID NO.6).
[0049] Similarly, the GPADH-Taqman fluorescent probe has a fluorescent group and a quenching group at the 5' end and the 3' end, respectively. In a specific embodiment of the present invention, the fluorescent group can be Fam and the quenching group can be BHQ1.
[0050] In another specific embodiment of the present invention, for the convenience of quality control, the test kit further includes a positive control and a negative control.
[0051] The positive control can be 100% methylated human genomic DNA modified with bisulfite; specifically, it is DNA extracted from healthy human leukocytes, methylated in vitro by CpG methyltransferase, and then modified with bisulfite.
[0052] The negative control can be water, specifically double-distilled water under high pressure.
[0053] In another specific embodiment of the present invention, the detection kit may further include reagents for extracting genomic DNA from blood (such as peripheral blood), reagents for modifying genomic DNA with bisulfite, premixed PCR reaction system solution, etc. The above reagents can all be made using existing products, and will not be described in detail here.
[0054] In another specific embodiment of the present invention, a system for diagnosing or assisting in the diagnosis of cirrhosis is provided, the system comprising at least a quantitative detection unit and an analysis unit;
[0055] The quantitative detection unit includes: performing a real-time quantitative methylation-specific polymerase chain reaction using the above-mentioned detection kit;
[0056] The analysis unit includes analyzing the results obtained from the quantitative detection unit, detecting the degree of DNA methylation of TL1A in the sample to be tested, and determining the subject's disease status.
[0057] The sample to be tested can be the subject's blood (peripheral blood).
[0058] More specifically, the degree of TL1A methylation is calculated using the following formula:
[0059] Methylation rate = 100% × 2exp - [ΔCp(sample TL1A Cp value - sample GPADH Cp value) - ΔCp(positive control TL1A Cp value - positive control GPADH Cp value)].
[0060] A methylation rate ≤ 1.62 was defined as a positive result (methylation), and a PMR > 1.62 was defined as a negative result (non-methylation).
[0061] To enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments. Experimental methods without specific specified conditions shall follow conventional experimental conditions and methods, or the conditions recommended by the manufacturer.
[0062] Example
[0063] 1. DNA extraction:
[0064] After drawing blood from a patient with cirrhosis, the patient's DNA can be extracted using the following steps, or other methods can be used to extract DNA.
[0065] (1) Prepare reagents: TRIzol reagent, ethanol, sodium citrate, sodium hydroxide, chloroform, Tris-EDTA solution and HEPES.
[0066] (2) Collect cells by centrifugation, each cell containing (5-10) × 10⁻⁶ cells. 6 Add 1 ml of TRIzol to peripheral blood mononuclear cells and repeatedly pipette. Incubate at room temperature (15-30℃) for 5 minutes to allow complete separation of nucleic acid-protein complexes;
[0067] (3) Add 0.3 ml of chloroform to every 1 ml of TRIzol used, shake vigorously for 30 seconds, and let stand at room temperature for 2 minutes;
[0068] (4) Centrifuge at 12000×g for 15 minutes at 2-8℃. The sample consists of three layers: a bottom layer of red organic phase, an upper layer of colorless aqueous phase, and an intermediate layer.
[0069] (5) Remove the upper aqueous phase, precipitate the DNA in the intermediate and organic phases with ethanol, add 0.3 ml of anhydrous ethanol to each 1 ml of TRIzol used, mix well, let stand at room temperature for 3 minutes, and centrifuge at 14800×g for 5 minutes at 2-8℃.
[0070] (6) Remove the supernatant and wash the DNA precipitate with 0.1 mol / L sodium citrate containing 10% ethanol. Add 1 ml of 0.1 mol / L sodium citrate (containing 10% ethanol) to each 1 ml of TRIzol, shake at room temperature for 30 minutes, centrifuge at 14800×g for 5 minutes at 2-8℃, discard the supernatant, and repeat twice;
[0071] (7) Wash the DNA precipitate again with 75% ethanol. Add 1.5ml-2ml of 75% ethanol to each 1ml of TRIzol, shake at room temperature for 10-20 minutes, centrifuge at 14800×g for 5 minutes at 2-8℃, discard the supernatant, and repeat once.
[0072] (8) Wash the DNA precipitate again with anhydrous ethanol. Add 1.5ml-2ml of anhydrous ethanol to each 1ml of TRIzol, shake at room temperature for 10-20 minutes, centrifuge at 14800×g for 5 minutes at 2-8℃, and discard the supernatant.
[0073] (9) Allow the DNA to air dry at room temperature for 5-15 minutes, then dissolve the DNA in 8 mmol / L sodium hydroxide solution. From 10 7 DNA isolated from cells is dissolved in 300-600 μl of 8 mmol / L sodium hydroxide solution, with a DNA concentration typically between 0.2-0.3 μg / μl. After dissolving the DNA, the pH can be adjusted to approximately 7.5 using Tris-EDTA solution and HEPES to obtain DNA extracted from peripheral blood mononuclear cells.
[0074] 2. Bisulfite modification
[0075] Genomic DNA was methylated using bisulfite to convert unmethylated cytosine into uracil, which was then used as an amplification template. Specifically, the extracted genomic DNA sample was treated and transformed with bisulfite (using the EZ DNA Methylation-Gold Kit, catalog number: D5005). The steps are as follows:
[0076] (1) Preparation of conversion reagent: Add 900 μl of water, 300 μl of dilution buffer and 50 μl of dissolving buffer to the conversion reagent tube and vortex to mix.
[0077] (2) Add 130 μl of conversion agent to 20 μl of DNA sample;
[0078] (3) Place the sample in a PCR instrument and incubate at 98°C for 10 minutes, then at 72°C for 2.5 hours. It can be stored at 4°C.
[0079] (4) Add 600 μl of binding buffer to the centrifuge column and place it in a collection tube;
[0080] (5) Add the sample from step 2 into a centrifuge column containing binding buffer, tighten the cap and mix by repeatedly inverting for one minute.
[0081] (6) Centrifuge at 13400×g for 30 seconds and discard the filtrate;
[0082] (7) Add 100 μl of washing buffer to the above centrifuge column and centrifuge at 13400×g for 30 seconds;
[0083] (8) Add 200 μl of desulfonation buffer to the centrifuge column and incubate at room temperature for 15-20 minutes, then centrifuge at 13400×g for 30 seconds;
[0084] (9) Add 200 μl of wash buffer to the centrifuge column and centrifuge at 13400×g for 30 seconds. Then add another 200 μl of wash buffer and centrifuge at 13400×g for 30 seconds. Repeat once.
[0085] (10) Add the centrifuge column to a 1.5 mL EP tube, add 20 μl of elution buffer to the centrifuge column, and centrifuge at the highest speed for 30 seconds to elute the DNA;
[0086] (11) DNA concentration and purity were determined by spectrophotometry and stored at -20℃.
[0087] 3. Real-time quantitative methylation-specific polymerase chain reaction
[0088] Methylation-specific primer pairs and probes targeting the TL1A promoter of the target gene, and specific primer pairs and Taqman fluorescent probes targeting the internal reference gene were used. Real-time quantitative methylation-specific PCR was used to amplify the TL1A promoter of the target gene and the internal reference gene.
[0089] (1) Primer design:
[0090] TL1A upstream primer: 5'ATTTAGTTAGGACGTATATAGGTG 3';
[0091] TL1A downstream primer: 5'TTTACCAATTTAACAAACCCGAA3';
[0092] TL1A-probe: 5'Fam CTAAAACCCAAAACAACAAACTCC 3'BHQ1;
[0093] GPADH upstream primer: 5'TGGTGATGGAGGAGGTTTAGTAAGT 3';
[0094] GPADH downstream primer: 5'AACCAATAAAACCTACTCCTCCCTTAAA 3';
[0095] GPADH-Probe: 5'Fam ACCACCACCCAACACACAATAACAAACACA'BHQ1.
[0096] (2) Real-time quantitative methylation-specific polymerase chain reaction (PCR) detection of TL1A promoter methylation level: Methylation-specific primer pairs for the target gene TL1A promoter and the internal reference gene, along with TaqMan fluorescent probe sequences, were used to perform real-time quantitative polymerase chain reaction (PCR) on the treated DNA. The negative control was achieved by replacing the DNA template with double-distilled water, and the positive control was achieved by replacing the DNA template with 100% methylated human genomic DNA, i.e., DNA extracted from healthy human leukocytes, methylated in vitro by CpG methyltransferase, and then modified with bisulfite. The reaction system is shown in Table 1 below:
[0097] Table 1 Real-time quantitative methylation-specific PCR reaction system
[0098]
[0099]
[0100] The upstream and downstream primers refer to the specific primer pairs for the target gene TL1A and the internal reference gene, namely, the TL1A-upstream primer and TL1A-downstream primer mentioned above; and the GPADH-upstream primer and GPADH-downstream primer mentioned above. The probes refer to the fluorescent probes for the target gene TL1A and the internal reference gene, namely, the TL1A-probe and the GPADH probe mentioned above.
[0101] (3) The 5× premixed PCR reaction system is a commercially available product containing hot-start Taq polymerase, deoxyribonucleoside triphosphate, magnesium chloride, reaction buffer, PCR reaction enhancer, optimizer and stabilizer.
[0102] (4) The reaction conditions are as follows: heat to 95°C, hold for 1-15 minutes, for a total of 1 cycle; heat to 95°C, hold for 15 seconds, anneal at 58-64°C for 40-60 seconds, for 35-60 cycles.
[0103] 4. Data Calculation
[0104] Real-time quantitative analysis of the test samples was performed to detect the degree of DNA methylation. The threshold cycle value (Cp value, the number of cycles required for the fluorescence signal in each reaction tube to reach the set threshold) of the methylation reaction was obtained using the software accompanying the fluorescence PCR instrument. The degree of TL1A methylation was calculated according to the following formula.
[0105] Methylation rate = 100% × 2exp - [ΔCp(sample TL1A Cp value - sample GPADH Cp value) - ΔCp(positive control TL1A Cp value - positive control GPADH Cp value)].
[0106] A methylation rate ≤ 1.62 is defined as a positive result (methylation), and a PMR > 1.62 is defined as a negative result (non-methylation).
[0107] Comparing TL1A methylation levels in patients with cirrhosis, patients with chronic hepatitis B, and healthy volunteers.
[0108] 1. Collect medical records from liver cancer patients, chronic hepatitis B patients, and healthy volunteers.
[0109] We collected cases from 107 patients with liver cancer, 63 patients with chronic hepatitis B, and 30 healthy volunteers. Case details are as follows (see Table 2):
[0110] Table 2: Case Details
[0111]
[0112] 2. Peripheral blood samples were collected from the above patients, and genomic DNA extraction, DNA concentration determination, bisulfite conversion, real-time quantitative methylation-specific PCR reaction system, reaction conditions, and methylation degree calculation methods were all the same as in the examples.
[0113] 3. Results Analysis
[0114] The TL1A methylation index of 107 hepatocellular carcinoma patients was 0.82% (interquartile range 0.45–1.69%), significantly lower than that of patients with chronic hepatitis B (6.35%, 5.05–8.60%) and healthy volunteers (7.39%, 5.91–11.44%) (P < 0.01 for all). Figure 1 .
[0115] The correlation between TL1A gene promoter methylation rate and serum MELD score and LSM coefficient in patients with cirrhosis is shown in [reference needed]. Figure 3 . Figure 3 In Figure A, the methylation rate of the TL1A gene promoter in patients with cirrhosis is negatively correlated with the serum MELD score. In Figure B, the methylation rate of the TL1A gene promoter in patients with cirrhosis is negatively correlated with the LSM score coefficient.
[0116] like Figure 4 As shown, the area under the receiver operating characteristic (ROC) curve for TL1A methylation index in assessing liver cirrhosis was 0.947 (95% confidence interval: 0.911–0.984), with a sensitivity of 72.90% and a specificity of 87.30%. A cutoff point of 1.62% methylation rate was selected, maintaining the same sensitivity and specificity. Furthermore, compared to the LSM coefficient and serum MELD score, the area under the ROC curve was 0.897, with a sensitivity of 68.2% and a specificity of 92.10%. The area under the ROC curve for serum MELD score was 0.812, with a sensitivity of 69.20% and a specificity of 81.75%. (See [link to relevant documentation]). Figure 4 .
[0117] The TL1A gene promoter is hypomethylated in patients with cirrhosis, indicating that the degree of TL1A gene promoter methylation can be used to predict the condition of cirrhosis patients and can serve as a reference for physicians in clinical diagnosis and subsequent treatment. The kit of this invention contains reagents for quantitatively detecting the degree of TL1A gene promoter methylation, which is rapid and accurate, demonstrating significant advantages in diagnosing the condition of patients with cirrhosis and is suitable for large-scale application.
[0118] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the given embodiments, those skilled in the art can make modifications or equivalent substitutions to the technical solutions of the present invention as needed, without departing from the spirit and scope of the technical solutions of the present invention. SEQUENCE LISTING <110> Qilu Hospital of Shandong University <120> Application of TL1A as a biomarker in the diagnosis of cirrhosis <130> <160> 6 <170> PatentIn version 3.3 <210> 1 <211> twenty four <212> DNA <213> Artificial sequence <400> 1 atttagttag gacgtatata ggtg 24 <210> 2 <211> twenty three <212> DNA <213> Artificial sequence <400> 2 tttaccaatt taacaaaccc gaa 23 <210> 3 <211> twenty four <212> DNA <213> Artificial sequence <400> 3 ctaaaaccca aaacaacaaa ctcc 24 <210> 4 <211> 25 <212> DNA <213> Artificial sequence <400> 4 tggtgatgga ggaggtttag taagt 25 <210> 5 <211> 28 <212> DNA <213> Artificial sequence <400> 5 aaccaataaa acctactcct cccttaaa 28 <210> 6 <211> 30 <212> DNA <213> Artificial sequence <400> 6 accacccaccc aacacacaat aacaaacaca 30
Claims
1. The application of a substance for detecting the degree of methylation of the TL1A gene promoter in the preparation of diagnostic or auxiliary diagnostic products for liver cirrhosis; The TL1A gene promoter was selected from the subject's blood; the TL1A gene promoter is in a hypomethylated state in patients with cirrhosis; The liver cirrhosis diagnostic or auxiliary diagnostic products are products used to monitor or predict the progression of chronic hepatitis B patients to hepatitis B-related liver cirrhosis. The substance is a detection kit, which includes at least a methylation-specific primer pair targeting the TL1A promoter of the target gene and a Taqman fluorescent probe; The specific sequence is as follows: TL1A upstream primer: 5'ATTTAGTTAGGACGTATATAGGTG 3'; TL1A downstream primer: 5'TTTACCAATTTAACAAACCCGAA 3'; TL1A-Taqman fluorescent probe: 5' CTAAAACCCAAAACAACAAACTCC 3'.
2. The application as described in claim 1, characterized in that, The substance described is used to detect the methylation level of the TL1A gene using a real-time quantitative methylation-specific PCR detection method.
3. The application as described in claim 1, characterized in that, The TL1A-Taqman fluorescent probe has a fluorescent group at the 5' end and a quenching group at the 3' end.
4. The application as described in claim 1, characterized in that, The detection kit includes specific primer pairs for the internal reference gene and a Taqman fluorescent probe.
5. The application as described in claim 4, characterized in that, The internal reference gene is GPADH; The specific sequences of the internal reference gene-specific primer pair and the Taqman fluorescent probe are as follows: GPADH upstream primer: 5'TGGTGATGGAGGAGGTTTAGTAAGT 3'; GPADH downstream primer: 5'AACCAATAAAACCTACTCCTCCCTTAAA 3'; GPADH-Taqman fluorescent probe: 5'ACCACCACCCAACACACAATAACAAACACA'.
6. The application as described in claim 5, characterized in that, The GPADH-Taqman fluorescent probe has a fluorescent group at the 5' end and a quenching group at the 3' end.
7. The application as described in claim 1, characterized in that, The test kit also includes a positive control and a negative control.
8. The application as described in claim 7, characterized in that, The positive control was 100% methylated human genomic DNA modified with bisulfite; The negative control was water.
9. The application as described in claim 8, characterized in that, The negative control was double-distilled water under high pressure.
10. The application as described in claim 1, characterized in that, The test kit also includes reagents for extracting genomic DNA from blood, reagents for modifying genomic DNA with bisulfite, and a premixed PCR reaction system.
11. The application as described in claim 10, characterized in that, The blood includes peripheral blood.