Compositions and methods for derepressing RE1-silencing transcription factor target genes
By developing high-affinity small molecule peptides to bind to and degrade CTDSP1, the problem of regulating REST activity was solved, neuronal differentiation and gene expression were promoted, and the treatment effect of related diseases was improved.
Patent Information
- Application Number
- CN202080089156.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-10-01
- Filing Date
- 2020-11-20
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2040-11-20
AI Technical Summary
Existing technologies make it difficult to effectively regulate the activity of the RE1-silencing transcription factor REST, which leads to the obstruction of neuronal differentiation and affects the efficacy of treating traumatic brain injury, epilepsy, dementia, Huntington's disease, chronic pain, brain cancer and other diseases.
Small molecule peptides with high affinity, such as TEDLEPPEPPLPKEN, EDLEPPEPPLPK, nekplppeppeldet, etc., have been developed to inhibit REST activity by binding to C-terminal domain small phosphatase 1 (CTDSP1), promote its degradation through intracellular transport peptides, and increase target gene expression.
It achieves effective inhibition of REST, promotes neuronal differentiation and related gene expression, and improves the therapeutic effects of diseases such as traumatic brain injury, peripheral nerve injury, and chronic pain.
Smart Images

Figure CN115023434B_ABST
Abstract
Description
[0001] Cross-references to related applications and priority claims
[0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 939,149, filed on November 22, 2019, and U.S. Provisional Patent Application No. 63 / 086,248, filed on October 1, 2020, the disclosures of which are incorporated herein by reference.
[0003] Sequence Listing
[0004] This application contains a sequence listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on January 8, 2021, is named 09097_001_PCT_SL.txt, and is 120,717 bytes in size. Technical Field
[0005] The present invention provides methods, compounds, and compositions for inhibiting RE1 silencing transcription factor (REST) target genes. Specifically, the present invention discloses a peptide having the sequences TEDLEPPEPPLPKEN (SEQ ID NO: 1) and EDLEPPEPPLPK (SEQ ID NO: 15), or a peptide having a reverse sequence (retro inverted, RI) consisting of the D-amino acids nekplppeppeldet (SEQ ID NO: 16) and kplppeppelde (SEQ ID NO: 17), for inhibiting REST activity. These peptides can be used to treat, prevent, or ameliorate conditions such as traumatic brain injury, epilepsy, dementia, Huntington's disease (HD), chronic pain, brain cancer (including glioblastoma multiforme), pancreatic cancer, diabetes, and peripheral nerve damage. Background Art
[0006] Repressor 1 (RE1) silencing transcription factor (REST) is a repressor of hundreds of neuronal genes 1Its targets represent genes required for the terminally differentiated neuronal cell phenotype, including genes encoding voltage- and ligand-dependent ion channels, their receptors, growth factors, and axon guidance proteins (Bruce AW et al., Proc Natl Acad Sci USA 101, 10458-10463 (2004); Conaco C et al., Proc Natl Acad Sci USA 103, 2422-2427 (2006); Mortazavi A et al., Genome Res 16, 1208-1221 (2006); and Otto SJ et al., J Neurosci 27, 6729-6739 (2007); all of which are incorporated herein by reference). Therefore, during neurogenesis, REST is gradually downregulated to establish a mature neuronal phenotype (Ballas et al., 2005, supra). The importance of this event is confirmed by gain-of-function studies showing that the continued presence of REST blocks terminal neuronal differentiation (Mandel G et al., Proc Natl Acad Sci USA 108, 16789-16794 (2011) and Gao Z et al., J Neurosci 31, 9772-9786 (2011); both incorporated herein by reference).
[0007] Little is known about the transcriptional or post-transcriptional regulation of REST (Ballas N et al. 2005, supra; Ballas N et al., Neuron 31, 353-365 (2001); and Kojima T et al., Brain Res Mol Brain Res 90, 174-186 (2001); all of which are incorporated herein by reference). However, two phosphorylation sites on REST (serines 861 and 864) regulate neuronal differentiation through interaction with C-terminal domain small phosphatase-1 (CTDSP1). 2 When CTDSP1 removes phosphates from serines 861 and 864, REST protein is stabilized and neuronal differentiation is inhibited. 2-4 . Summary of the Invention
[0008] Disclosed herein are methods, compounds, and compositions for developing peptides with high affinity for CTDSP1.
[0009] Disclosed herein are methods, compounds, and compositions for binding to C-terminal domain small phosphatase 1 (CTDSP1).
[0010] Disclosed herein are REST-like phosphopeptides TEDLEPPEPPLPKEN (SEQ ID NO: 1), EDLEPPEPPLPK (SEQ ID NO: 15), nekplppeppeldet (SEQ ID NO: 16), and kplppeppelde (SEQ ID NO: 17) that bind to CTDSP1 to inhibit REST activity. Lowercase letters represent D-amino acids, which are resistant to degradation, thereby increasing peptide half-life without affecting binding affinity. 5 .
[0011] Ninety-eight (98) REST-like phosphopeptide variants (RPPv) (SEQ ID NOs: 18 to 117) are disclosed herein that inhibit CTDSP1 activity on REST to varying degrees. Figure 25 ).
[0012] Disclosed herein are intracellular transport peptides, such as cell penetrating peptides (CPPs) and / or endosomal release sequences (SEQ ID NOs: 118 to 137 and 140 to 159), which can be fused at their N- or C-termini to RPPs (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) to improve intracellular transport. Also disclosed are linkers (SEQ ID NOs: 138, 139, 160, and 161) that can be inserted between RPP or RPPv and one of the peptides listed in Table 7 to further improve intracellular transport.
[0013] Disclosed herein are RPPs (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) that are N-terminally or C-terminally fused to intracellular transit peptides (SEQ ID NOs: 118 to 137 and 140 to 159) and cyclized to further improve binding affinity and stability (increase peptide half-life). Examples of cyclized fusion proteins are SEQ ID NOs: 2, 5, 12, 13, and 14.
[0014] Disclosed herein are RPPs (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 137 and 140 to 159) fused to intracellular transit peptides (SEQ ID NOs: 118 to 137 and 140 to 159) at the N-terminus or C-terminus to promote degradation of REST proteins. Examples of fusion proteins are SEQ ID NOs: 2 and 4 to 14.
[0015] Disclosed herein are REST-type phosphopeptides such as SEQ ID NOs: 1 and 15 to 17 or RPPv of SEQ ID NOs: 18 to 117, fused to intracellular transport sequences (SEQ ID NOs: 118 to 137 and 140-159) at the N-terminus or C-terminus to promote expression of REST target genes. Examples of fusion proteins are SEQ ID NOs: 2, 4 to 14.
[0016] Disclosed herein are RPPs or RPPvs (SEQ ID NOs: 18 to 117) fused to intracellular transit peptides (SEQ ID NOs: 118 to 137 and 140 to 159) as described in SEQ ID NOs: 1 and 15 to 17, N- or C-terminally, for use in treating an animal suffering from a disease or condition associated with REST or CTDSP1 by administering to the animal a therapeutically effective amount of the compound to increase expression of a REST target gene or increase expression of BDNF. Examples of fusion proteins are SEQ ID NOs: 2 and 4 to 14.
[0017] Disclosed herein are RPPs SEQ ID NOs: 1 and 15 to 17 or RPPv (SEQ ID NOs: 18 to 117) fused to intracellular transit peptides (SEQ ID NOs: 118 to 137 and 140 to 159) for use in treating traumatic brain injury, chronic pain, peripheral nerve damage, epilepsy, diabetes, Alzheimer's disease, Huntington's disease, brain tumors (including glioblastoma multiforme), or pancreatic cancer in animals. Examples of fusion proteins are SEQ ID NOs: 2 and 4 to 14. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The accompanying drawings are incorporated in and constitute a part of this specification. Together with the general description given above and the detailed description of exemplary embodiments and methods given below, they serve to explain the principles of the invention. In these drawings:
[0019] Figure 1 (A) Full-length REST protein showing the location of the CTDSP1 binding site. SEQ ID NO: 347 is disclosed. (B) Circular form of the reverse-inverted (RI) REST-like phosphopeptide integrated with a cell-penetrating peptide. SEQ ID NO: 348 is disclosed.
[0020] Figure 2The binding affinity of the rest of the phosphopeptide (RPP) for CTDSP1 was determined using Monolith (NanoTemper). The affinity of RPP (Table 4; SEQ ID NO: 165) for CTDSP1 (Table 2; SEQ ID NO: 163) was approximately 130 pM. The His tag on CTDSP1 (40 nM) was fluorescently labeled with RED-tris NTA dye (20 nM), and the change in fluorescence upon binding of RPP (up to 0.5 μM) was measured to assess binding.
[0021] Figure 3 The binding affinity of RPP for CTDSP1 was determined using Biacore (GE Healthcare Life Sciences). CTDSP1 (Table 2; SEQ ID NO: 163) was immobilized on a CM5 sensor chip (GE Healthcare Life Sciences), and the binding affinity of (a) a GST control or (B) RPP (Table 4; SEQ ID NO: 165) was determined.
[0022] Figure 4 RPP is cell permeable and accumulates in the nucleus. (AD) 100 nM FLAG-RPP-CPP (CAQKDYKDDDDK TEDLEPPEPPLPKEN GRKKRRQRRRG (SEQ ID NO: 4) was added to mesenchymal progenitor cells (MPCs) and cultured for 4 hours. After 6 days of culture, RPP was concentrated in the nucleus. (E, F) Translocation of the peptide from the cytoplasm to the nucleus over a 6-day period (SD, n = 3). (A) Cytoskeleton (phalloidin); (B) Nucleus (Hoechst dye); (C) RPP (FLAG antibody); (D) Composite image.
[0023] Figure 5 RPP accumulates in the spinal sciatic nerve nuclei. Coronal spinal cord sections of 0.7 cm from the L3 and L4 regions of male Sprague-Dawley (SD) rats show the nuclei surrounding the sciatic nerve. These sections were collected 48 hours after injection of 1 mg (1 mg / mL) of the peptide into the mid-thigh sciatic nerve defect. A. Hoechst staining reveals the nuclei. B. FLAG-RPP-CPP (SEQ ID NO: 4) localization is shown by the FLAG antibody.
[0024] Figure 6RPP reduces REST protein levels. (Left) Western blot showing exogenously expressed REST protein levels in HEK293 cells after treatment with solvent or 100 nM FLAG-RPP-CPP (SEQ ID NO: 4) for 4 hours. Blots were probed with anti-REST (Millipore Sigma, 07-579) and anti-GAPDH. (Right) Bar graph showing that 100 nM FLAG-RPP-CPP reduced REST protein levels by 58%. Band intensities were calculated by measuring gel peak areas using ImageJ.
[0025] Figure 7 .RPP increases BDNF expression. After 24 hours of culture, cells were incubated with FLAG-RPP-CPP (SEQ ID NO: 4, 100 nM) or solvent (PBS) for 4 hours, and the mRNA levels in HEK 293 cells were measured by qPCR. BDNF (2 -DDCT The mean fold change of expression was 2.401 ± 0.885 (SD, n = 3). Mean fold change 1 = no change. Calculated according to the description of Livak et al., 2001 -DDCT .
[0026] Figure 8 Kv4.3 mRNA levels in NBFL cells 48 hours after CTDSP1 inhibition. Cells were transfected with a plasmid expressing RPP (SEQ ID NO: 1) with GFP (+) or a control peptide with GFP (-). 24 hours after transfection, cells were sorted based on fluorescence intensity. Error bars represent standard deviation, n = 2.
[0027] Figure 9 Comparison of linear and cyclic RPP. NBFL cells were treated with RPP (linear, SEQ ID NO: 4; cyclic, SEQ ID NO: 2, Table 8) or a control peptide (SEQ ID NO: 3, Table 9) (1 μM) for 24 or 48 hours. Efficacy was assessed by measuring changes in (A) BDNF, (B) NGF, and (C) Kv4.3 transcript levels. N = 1.
[0028] Figure 10 BDNF and NGF mRNA expression (normalized to actin) in mesenchymal progenitor cells (MPCs) from two patients after 48 h incubation with water (control) or 3 μM RPP (SEQ ID NO: 9). mRNA levels are shown relative to the control group (standard deviation, n=2).
[0029] Figure 11iPSCs (neural stem cells (NSC)-NL5) were treated with a 3 μM RPP sequence (shown below) or a water control. After 7 days of culture, the cells were assessed for neuronal differentiation using the microtubule-associated protein 2 (MAP2) neuronal marker (normalized to DAPI). The medium and variants were replaced on day 3. In the bar graph, MAP2 levels are relative to the control (standard deviation, n = 4).
[0030]
[0031] Figure 12 iPSCs (neural stem cells (NSC)-NL5) were treated with 1 μM RPP (SEQ ID NO: 9) or water as a control. After 7 days of culture, neuronal differentiation was assessed using the neuronal markers TUJ1 (class III β-tubulin) and MAP2 (both normalized to DAPI). The culture medium and RPP were replaced on day 3. (Standard deviation, n = 6).
[0032] Figure 13 iPSCs (neural stem cells (NSC)-NL5) were treated with 1 μM RPP (SEQ ID NO: 13) or water as a control. After 7 days of culture, neuronal differentiation was assessed using the neuronal markers TUJ1 and MAP2 (both normalized to DAPI). The culture medium and RPP were replaced on day 3. (Standard deviation, n = 6).
[0033] Figure 14 RPP (SEQ ID NO: 12) increases the expression of Kv4.3, Kv7.2, Nav1.8, and OPRM1. qRT-PCR analysis of mRNA expression was performed in adult Sprague-Dawley (SD) rat L5 DRG after incubation with various concentrations of RPP for 48 hours relative to water controls. * = p < 0.05, *** = p < 0.01, *** = p < 0.001, one-way ANOVA followed by Dunnett's test. Error bars = standard error of the mean.
[0034] Figure 15 3 μM RPP (SEQ ID NOs: 13 and 14) for 48 hours increases NaV1.8 expression. qRT-PCR analysis of mRNA expression relative to water controls (normalized to β-actin) was performed after incubation of RPP with L5 DRG of adult Sprague-Dawley (SD) rats. Error bars = standard error of the mean.
[0035] Figure 16RPP (SEQ ID NO: 12) increases BDNF and NGF expression. qRT-PCR analysis was performed on L5 DRG neurons from adult Sprague-Dawley (SD) rats after incubation with various concentrations of RPP for 48 hours, relative to a water control group. mRNA expression (normalized to b-actin) was compared. * = p < 0.05, one-way ANOVA and Dunnett's test, error bars = SEM.
[0036] Figure 17 RPP (SEQ ID NO: 12) does not cause DRG neuronal necrosis. LDH toxicity was assessed in SD rats cultured with water, RPP (1, 3, or 10 μM), or triton for 48 hours. *** = p < 0.001, one-way ANOVA and Dunnett's test, error bars = SD.
[0037] Figure 18 RNA levels of chronic pain genes after SNI. RNA fold changes relative to β-actin on day 0 (sham group, n = 3), day 7 (n = 5), or day 28 (n = 2) after SNI (mean ± SD, **p < 0.01, ***p < 0.001, one-way ANOVA with Dunnett's multiple comparison test). RNA was isolated from the sciatic nerve DRG (L5).
[0038] Figure 19 REST mRNA levels are elevated after TBI. (A) Normal levels of REST mRNA expression in the ipsilateral cortex of uninjured mice. (B) REST levels are significantly increased in the ipsilateral cortex of mice 7 days after controlled cortical impact injury. 6 mRNA was shown by RNAscope counter-staining with DAPI.
[0039] Figure 20(a) Schematic diagram of the AAVS1 Nanoluc-Halotag knock-in (KI) construct for engineering NCRM-1 iPSCs. The CMV-driven construct was inserted into the safe harbor AAVS1 site on chromosome 19q. By transcription activator-like effector nucleases (TALENS). The AAVS1 KI was confirmed by sequencing and ligation PCR (not shown). (b) Schematic diagram of the MAP2 Nanoluc-Halotag knock-in (KI) construct for engineering NCRM-1 iPSCs. The nanoluciferase-halotag was knocked into the MAP2 transcription start site (TSS) (chromosome 2) using zinc finger nucleases (ZFNs) and MAP2 in the framework KI, as confirmed by sequencing and ligation PCR (not shown). CMV-NLHT and MAP2-NLHT iPSCs express the pluripotency markers OCT4 / NANOG / TRA1-81 / TRA 1-60 (not shown). (c) Luciferase assay of CMV-NLHT iPSCs and MAP2-NLHT neural stem progenitor cells (NSPCs) and neurons. Note that luciferase activity increased with neuronal differentiation of MAP2-NLHT cells, consistent with increased MAP2 expression with differentiation.
[0040] Figure 21 Rat sciatic nerve injury model: (Left) Sciatic nerve section surgical procedure. (Right) Immunohistochemical and immunofluorescent staining of sciatic nerve sections. Tissue was stained for βIII tubulin, laminin I, and DAPI. Scale bar = 100 μm.
[0041] Figure 22 Rat sciatic nerve harvest: (Left) Whole-mount section of the rat spine and associated peripheral nerves. (Right) Image of the sciatic nerve injury site and associated lumbar nerve roots.
[0042] Figure 23 A. SNI induced sensitization of mechanical pain threshold (MT) 4 days after injury (n = 16) compared with baseline (basal); paired t-test, *p < 0.05. No significant difference in mechanical threshold was observed in the sham group 4 days after surgery. B. Analgesic effect of a single subcutaneous injection of morphine on MT after trauma (SNI + MOR, n = 4). Mean ± SEM; one-way ANOVA, F = 4.62, *p < 0.05 before and after treatment; mean difference and 95% confidence interval, -7.3 and -14.5 to -0.135, respectively, p < 0.05, using Bonferroni's multiple comparison test. 20 mg / kg MOR (n = 4; F = 19.03, **p < 0.001, one-way ANOVA).
[0043] Figure 24Conditioned place preference (CPP) was induced in SNI mice after conditioning with saline (control group) and four doses of morphine (MOR). MOR-induced CPP was dose-dependent (one-way ANOVA, F=4.167, p<0.05); 10 mg versus control (p<0.001) and 20 mg versus control (p<0.05) by Tukey's multiple comparison test.
[0044] Figure 25 In vitro CTDSP1 phosphatase activity of the REST peptide (TEDpSPPpSPPLPKEN (SEQ ID NO: 329)) as a substrate (relative to a GST control) after exposure to 1 μM RPP (SEQ ID NO: 1) or one of its variants (Table 3).
[0045] Figure 26 In vitro targeted (CTDSP1) and non-targeted phosphatase activities (1 = PPA1, 2 = PPM1H, 3 = PPM1A, 4 = PP3CA, 5 = PPP1CA, 6 = PP5CA) of the phosphorylated REST peptide (TEDpSPPpSPPLPKEN (SEQ ID NO: 329)) as a substrate relative to a water control after exposure to RPP (SEQ ID NO: 12). N = 5, error bars are standard deviation.
[0046] Figure 27 Construction of the RPP library. A) Experimental scheme; B) Nucleotide sequence of the REST construct (before mutation) (SEQ ID NO:349); C) Protein sequence of the REST construct (before mutation) (SEQ ID NO:350). The RPP, CPP, and His tags are underlined.
[0047] Figure 28 .RPP (SEQ ID NO: 13) structure. Along the bottom of the structure is the CPP, which contains a polyarginine sequence and two 2-aminotetradecanoic acids that are bound to the remaining RI-type phosphates (starting from the lysine at the bottom right of the structure). DETAILED DESCRIPTION
[0048] In one embodiment, the present invention provides a method for developing peptides with high affinity for CTDSP1 (as described in Examples 1 to 3). Importantly, the method uses peptide evolution technology to generate peptides with high affinity for CTDSP1.
[0049] In one embodiment, the present invention provides peptides of SEQ ID NOs: 1 and 15 to 17, or peptides having at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, or more preferably at least 95% similarity to SEQ ID NOs: 1 and 15 to 17. These peptides or their analogs are referred to herein as REST-type phosphopeptides (RPPs). However, it is important to maintain the glutamic acid in the RPPs, particularly at positions 5 and 8 of SEQ ID NO: 1, positions 4 and 7 of SEQ ID NO: 15, positions 8 and 11 of SEQ ID NO: 16, and positions 6 and 9 of SEQ ID NO: 17.
[0050] In one embodiment, the present invention provides RPPv (SEQ ID NOs: 18 to 117) or peptides having at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95% similarity to RPPv (SEQ ID NOs: 18 to 117). The peptides or their analogous peptides are referred to herein as REST-type phosphopeptide variants (RPPv) (SEQ ID NOs: 18 to 117). However, it is important to maintain the glutamic acid in SEQ ID NOs: 18 to 67, especially the glutamic acid at positions 5 and 8 in SEQ ID NO: 1. For the reverse inversion sequence (RPPv RI )(SEQ ID NO: 68 to 117), positions 8 and 11 of SEQ ID NO: 16 must be maintained.
[0051] In one embodiment, the present invention is a fusion protein of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) and an intracellular transport peptide (SEQ ID NOs: 118 to 137 and 140 to 159) (or a peptide having at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90% or more preferably at least 95% similarity thereto).
[0052] The identity / similarity between two or more nucleotide sequences or two or more amino acid sequences is expressed as the identity or similarity between the sequences. Sequence identity can be measured as a percentage of identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured as a percentage of similarity (taking into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are.
[0053] Methods of sequence alignment for comparison are well known in the art. Various programs and alignment algorithms are described, for example, in Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al., Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Biol. 24: 307-31, 1994. Altschul et al., J. Mol. Biol. 215: 403-10, 1990 introduce sequence alignment methods and homology calculations in detail.
[0054] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from multiple sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894) and the Internet for sequence analysis programs BLASTP, BLASTN, BLASTX, TBLASTN, and TBLASTX. For more information, visit the NCBI website (www.NCBI.nlm.nih.gov).
[0055] BLASTN is used to compare nucleotide sequences, and BLASTP is used to compare amino acid sequences. If the two compared sequences share homology, the specified output file will display these homologous regions as aligned sequences. If the two compared sequences do not share homology, the specified output file will not display aligned sequences.
[0056] During alignment, the number of matches is determined by calculating the number of positions at which the same nucleotides or amino acid residues are present in the two sequences. The percentage of sequence identity is determined by dividing the number of matches by the length of the sequence in the identified sequence, or by the length of the segment (e.g., 100 consecutive nucleotides or amino acid residues of the sequence in the identified sequence), and then multiplying the resulting value by 100. For example, when aligned with a test sequence having 1154 nucleotides, a nucleotide sequence with 1166 matches is 75.0% identical to the test sequence (1166 / 1554*100=75.0). Percent sequence identification values are rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded to 75.2. Length values will always be integers. In another example, a target sequence comprising a 15 nucleotide region that aligns with 20 consecutive nucleotides in the following recognition sequence comprises a region having 75% sequence homology with the recognition sequence (ie, 15 / 20 x 100 = 75).
[0057] For comparisons of amino acid sequences greater than about 30 amino acids, the default BLOSUM62 matrix set to default parameters was used using the Blast 2 sequence function (gap cost of 11, gap cost per residue of 5 / 1). Homologs are typically characterized by having at least 70% sequence identity using NCBI Basic Blast 2.0 with gap blastp against databases such as the nr or swissprot databases in full-length alignments of amino acid sequences. Queries searched with the blastn program were filtered using DUST (Hancock and Armstrong, 1994, Comput. Appl. Biosci, 10:67-70). Other programs use SEG. Manual alignments can also be performed. When evaluated using this method, proteins with greater similarity will show increasing percentage identities, for example, at least 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the protein. When aligning short peptides (less than about 30 amino acids), the alignment is performed using the Blast 2 sequence function, using the PAM30 matrix set to default parameters (9 for leading gaps and 1 for extending gaps). When evaluated in this way, proteins that are more similar to a reference sequence will show increasing identity, for example, at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to the protein. When the sequence identity being compared is less than the entire sequence, homologs typically have at least 75% sequence identity within a short window of 10-20 amino acids, and can have at least 85%, 90%, 95% or 98% sequence identity, depending on their identity to the reference sequence. Methods for determining sequence identity in such short windows are described on the NCBI website.
[0058] One indicator that two nucleic acid molecules are closely related is that, as described above, the two molecules hybridize to each other under stringent conditions. Nevertheless, due to the degeneracy of the genetic code, nucleotide sequences that do not show a high degree of identity may encode identical or similar (conserved) amino acid sequences. This degeneracy can be exploited to alter the nucleotide sequence to produce multiple nucleic acid molecules that all encode essentially identical proteins. Another (not necessarily cumulative) indicator that two nucleotide sequences are essentially identical is that the polypeptide encoded by the first nucleic acid cross-reacts immunologically with the polypeptide encoded by the second nucleic acid.
[0059] In certain embodiments, RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) can be fused to another peptide, for example to allow cell penetration. Preferably, RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) is fused to a peptide sequence that allows cell penetration and escape from endosomes. More preferably, the cell penetrating and escape peptide sequence is one of SEQ ID NOs: 118 to 137 and 140 to 159. RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) and cell penetrating peptides (CPPs) (SEQ ID NOs: 118 to 137 and 140 to 159) can be fused directly or contain a linker sequence (e.g., SEQ ID NOs: 138, 139, 160, or 161) linking them. It has been shown that when cells or tissues are fused with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides and CPP (SEQ ID NOs: 118 to 137 and 140 to 159), they localize to the nucleus ( Figure 3 , SEQ ID NO: 4 and Figure 4 _SEQ ID NO: 4), leading to degradation of REST ( Figure 5 , SEQ ID NO: 4), increasing the expression of REST target genes ( Figure 7 、SEQ ID NO:4、 Figure 8 、SEQ ID NO:1、 Figure 9 , linear_SEQ ID NO: 4 and cyclized_SEQ ID NO: 2, Figure 10 、SEQ ID NO:9、 Figure 14 、SEQ ID NO:12、 Figure 15 , SEQ ID NOs: 13 and 14, and Figure 16 , SEQ ID NO: 12), and leads to neural differentiation ( Figure 11 , SEQ ID NO: 5 to 11, Figure 12 , SEQ ID NO: 9 and Figure 13 , SEQ ID NO: 13).
[0060] The present inventors discovered that RPP (SEQ ID NOs: 1 and 15 to 17) binds to CTDSP1 to inhibit REST activity. Figure 2 and 3 The binding curves shown show that RPP has a low pM affinity for CTDSP1. In cells and animals, RPP binds to CTDSP1, thereby preventing CTDSP1 from binding to REST.
[0061] Increased REST and associated neurogenic repression underlie the pathology of the following diseases or disorders:
[0062] Traumatic brain injury (TBI) causes neuronal death, leading to cognitive loss. To improve cognitive recovery after TBI, two issues need to be addressed: 1) reducing the neuronal death that persists after injury; and 2) regenerating lost neurons.
[0063] After TBI, REST levels in the brain increased significantly ( Figure 19 Several studies have consistently shown that acute ischemia-induced brain damage induces REST expression in neurons, leading to neuronal death. 7-9 These studies show that neuronal survival is enhanced when REST is eliminated. 7-9 The clinical implications are profound. For example, increased REST levels are associated with increased frequency of epileptic seizures, which often occur after brain injury. 10-12 In animal models of brain injury, when REST was inhibited, seizure rates were significantly reduced. 13-14 Furthermore, long-term elevated REST levels after brain trauma may play a role in neurodegenerative diseases caused by a history of brain injury. 15-17 Both in vitro and in vivo studies have shown that eliminating REST can improve neuronal survival 7-9 ,Function 14,18 and regeneration 2,19-24 Therefore, targeting REST after TBI should mitigate the effects of brain injury and offset the risk of developing related age-related neurodegenerative disorders such as Alzheimer's disease. 17,25 .
[0064] The improvement in cognitive function in patients with TBI stems from research linking increased neurogenesis to improvements in learning, memory, and other cognitive functions. 26-30 , and contrary studies showing that inhibition of neurogenesis by antimitotic agents, radiation, or genetic manipulation impairs hippocampal-dependent memory 29-33 Defects in neurogenesis have also been implicated in many disorders of cognitive etiology, including developmental disorders such as microcephaly. 34 , megalencephaly 35 , autism 35 ) and neurodegenerative diseases (such as dementia and Alzheimer's disease) 36 Experimental treatments (including blood transfusions, growth and neurotrophic factors, and stem cell transplants) 10,37-49 ) focused on regenerating neurons. These attempts have failed to stimulate the neurogenesis needed to restore cognitive function, at least in part because they are unable to terminally differentiate neural progenitor cells in the setting of TBI. 26 ,28 ,50-57Silencing of the transcription factor REST by RE1 blocks terminal differentiation of neural progenitor cells into neurons at a single checkpoint.
[0065] Peripheral nerve injury - Neuronal regeneration in patients with peripheral nerve injury (PNI) is inhibited in at least two ways. First, there is a decrease in neurotrophic factors (NTFs) that support the growth, survival, and differentiation of developing and mature neurons. 58 Second, there is a reduction in the expression of genes required for synaptic plasticity, including axonal growth, vesicle transport, and ion conduction. 59 These two phenomena are consistent with injury-induced REST expression. 60 Therefore, eliminating REST can accelerate the recovery of PNI by reversing the impairment of nerve regeneration. Inhibition of CTDSP1 by RPP can promote the degradation of REST ( Figure 6 ), increase neuronal differentiation ( Figure 11 、 12 and 13), and increased NTF expression ( Figure 7 、 9 , 10 and 16), which suggests the potential of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) to stimulate nerve regeneration.
[0066] Chronic pain - Many genes that are suppressed in the central and peripheral circulation during chronic pain are direct or indirect targets of the repressive element-1 (RE1)-silencing transcription factor (REST), a repressor of neuronal gene expression in stem cells, neural progenitor cells, and non-neuronal cells. 61-63 REST levels are typically maintained at low levels in normal neurons, with chromatin actively degrading to keep this powerful neuronal gene repressor away from the chromatin. 64-69 Prior to the transition to neuropathic pain, REST levels increased significantly in peripheral nerve neurons of mice and rats after peripheral nerve injury, followed by a spike in neurons in the central nervous system that process and sense pain stimuli. 60,70,71 Activation of REST after nerve injury leads to the expression of several genes required for normal excitability of sensory neurons, including the potassium channels KV4.3 (Kcnd3) and KV7.2 (Kcnq2), the sodium channel Nav1.8 (Scn10a), and the μ-opioid receptor Oprm1 ( Figure 18 ) expression is reduced 60,72-74 The basis for blocking REST to alleviate chronic pain is published in studies using mouse and rat models of peripheral nerve injury (PNI). 60,72-74 In mice, genetic knockout of REST in sensory neurons after PNI restores μ opioid receptor 60,72,73 、Nav1.860,72,73 、KV4.3 72,73,75 、KV7.2 72,73 Gene expression in dorsal root ganglia restores normal K+ M-type current in C nerve fibers 60 , reducing hyperalgesia and allodynia 72-74 Disruption of the REST repressive complex using an optimized REST mimetic targeting the mSin3 binding site (an adaptor protein) facilitated transcriptional repression of many genes, including REST targets, restored C-fiber function, reduced hyperalgesia and allodynia, and restored morphine analgesia in a mouse model of chronic pain (Table 12). 74 In rats, knockdown of REST mitigated the transition from acute to chronic pain, as evidenced by a reduction in hyperalgesia and allodynia, and restored muscarinic analgesia (Table 12). 72,73 .
[0067]
[0068]
[0069]
[0070] We recognize that the studies shown in Table 12 demonstrate discrepancies in reducing hypersensitivity between mouse conditional knockout (cKO) studies (complete knockout) and rat siRNA knockdown studies, which showed no hypersensitivity after injury and no downregulation of REST target genes (Table 12), and only partially reduced allodynia (up to 45%) and hyperalgesia (up to 65%) after injury. We believe that the knockdown effect is more effective than siRNA knockdown because the bioavailability of siRNA is limited by its size (>13,000 kD) and poor cellular trafficking due to endosomal entrapment.
[0071] We recognize that the studies in Table 12 lack rigor, as power analyses were not performed to determine the number of animals per group, and the low animal numbers make statistical analysis problematic. Some studies used the less predictive partial sciatic nerve ligation (pSNL) model, rather than the preferred spare nerve injury (SNI) chronic pain model. Most of these studies evaluated only males. However, despite these shortcomings, the findings are consistent and, therefore, support the in vivo efficacy assessment of our proposed drugs for the treatment of chronic pain. Furthermore, because REST activity is highly conserved across mammals, we believe these studies provide strong proof-of-concept support for testing REST modulation in humans.
[0072] We found that REST is degraded by phosphorylation at serines 861 and 864. REST is stabilized by dephosphorylation of these sites by C-terminal domain small phosphatase 1 (CTDSP1). 2-4 Like REST, CTDSP1 is expressed in non-neural tissues and promotes neural gene silencing through its interaction with REST. We conclude that inhibition of CTDSP1 is sufficient to promote REST degradation and stimulate gene expression. In support of this conclusion, we have shown that knockdown of CTDSP1 in mesenchymal progenitor cells (MPCs) and neurons leads to expression of REST target genes and axonal regeneration. 76 We leveraged our mechanistic understanding of the REST-CTDSP1 interaction to develop a cyclic phosphopeptide encompassing the REST-associated regulatory region. 77 The remaining phosphopeptide-like peptide (RPP) has several pharmacological properties. Due to its cyclized structure and D-amino acid composition (e.g., SEQ ID NO: 9, 12, 13, 14, 16, 17, and 68-117), it is very stable. It has a lower pM binding affinity than most antibodies ( Figure 2 and Figure 3 ), indicating a low risk of off-target effects. Its small size (<3.5kD) suggests that its bioavailability should be close to that of small molecule drugs. Our preliminary data show that our mimetic inhibits the activity of CTDSP1, reduces REST protein levels, and leads to the expression of neural genes required for proper neuronal activity. 77 .
[0073] Most importantly, our approach is expected to be safe and effective for the following reasons: 1) Our drugs are selective for targets that are central to the regenerative response, such as after neural injury. The basic organization of chromatin does not allow epigenetic "writing" of a new set of instructions; however, neural injury triggers a concerted, extensive, and transient nucleosome reorganization, known as a genomic transient intermediate state (GTIS): a temporary nucleosome structure that favors epigenetic reprogramming for the necessary response. 78-81 2) Our drugs have high binding affinity (low pM) and therefore will not produce off-target effects ( Figure 2 and Figure 3 3) We recommend a short treatment period of less than 1 month. The basis for our shortened treatment cycle is that REST is the gatekeeper of neuronal terminal differentiation 64,82 (The process of irreversibly committing cells to that lineage 83 Neural progenitor cells that share epigenetic similarities with neurons in chronic pain states 63Because they are also in GTIs, they undergo terminal differentiation after a few days of induction. Consistently, we demonstrated that RPP can induce neuronal differentiation within 7 days (as determined by MAP2-positive cells, a marker of neuronal differentiation) ( Figure 11 、 12 and 13). Once this process has begun and the cells have been committed, no further treatment is required. Therefore, we expect that the pain relief achieved through this early treatment period will be long-lasting. 4) In an in vitro toxicity assay for isolated DRG neurons measuring necrosis, we have demonstrated that our drug is not toxic to neurons ( Figure 17 5) REST and CTDSP1 are primarily involved in neural development; therefore, we predict that inhibition of their activity in damaged adult cells will be well tolerated. 6) The safety profile of peptide drugs makes them an attractive therapeutic strategy. Currently, there are more than 68 peptide drugs on the market, with global sales exceeding $14.7 billion, and 140 are in clinical development. 84,85 .
[0074] Innovation
[0075] First-in-class drug candidate. We have developed the first drug targeting the neuronal gene transcription inhibitor REST. Published literature suggests that REST expression contributes to chronic pain (Table 12). After PNI, the peripheral nervous system ( Figure 18 ) and the central nervous system, leading to increased expression of REST and CTDSP1, which 7-9 Several published studies in rodents have shown that blocking REST can relieve chronic pain. 60,72-74 .
[0076] Innovative drug design. We have developed a cyclic phospho-cell penetrating peptide that destabilizes REST by inhibiting CTDSP1, a phosphatase that protects REST from degradation. 3 , thereby allowing the expression of neural-specific genes. Like REST, CTDSP1 expression is restricted to non-neuronal cell types, except after neuronal injury. Our inhibitor is novel because it directly targets a transcriptional checkpoint that immediately regulates genes required for inducing regeneration. It overcomes the difficulties of targeting transcription factors and creating anti-serine phosphatase therapies. Regarding the latter, other approaches focus on phosphoprotein phosphatases (PPPs) and metal-dependent protein phosphatases (PPPs). 86 However, CTDSP1 is a haloacid dehalogenase (HAD) that uses two catalytic aspartates rather than relying solely on metal ions for activity. 87 This catalytic site can be specifically inhibited, as demonstrated by the successful development of therapeutic drugs targeting similar enzymes such as HIV-1 protease.88-91 Finally, CTDSP1 has a proline-dependent substrate preference not found in other serine phosphatases, which we exploited to improve drug binding and stability.
[0077] Preliminary data. REST represses gene expression by binding to chromatin at the repressor element-1 (RE-1) site near regulatory regions of neuronal genes, including ion channels, growth factors, and axon guidance proteins. 1 Therefore, before stem cells such as neural progenitor cells (NPCs) can terminally differentiate, they must first be targeted for degradation by REST in order to express desired neuronal genes. 64 CTDSP1 protects REST from degradation and is necessary and sufficient to block neuronal gene expression 2 Dominant negative CTDSP1 can bind to phosphorylated targets but cannot catalyze dephosphorylation, inducing terminal differentiation of P19 stem cells 92 .
[0078] We have previously shown that the interaction between CTDSP1 and REST depends on phosphorylation of REST serines 861 and 864 by the MAP kinase ERK2 and that mutation of these serines to alanine increases REST stability. 2-4 We hypothesized that a non-hydrolyzable phosphorylation of the REST regulatory region could slow CTDSP1 activity and promote REST degradation. To test our hypothesis, we developed a REST-like phosphopeptide or RPP. 77 To evaluate the dose-dependent effects of REST and its targets. RPP contains amino acids 858 to 870 of REST with serine 861 and 864 mutated to glutamic acid, which can mimic the shape and overall charge of phosphoserine. At the C-terminus, we fused an arginine-rich cell-penetrating peptide and an endosomal exit sequence (exit sequence) from HIV-Tat and HA2, respectively, to deliver peptides and proteins into cultured mammalian cells and living organisms and promote blood-brain barrier (BBB) crossing. 93-96 .
[0079] We investigated whether RPP could reduce the expression of REST protein ( Figure 6 In the left panel, Western blotting (WB) showed that RPP reduced the REST (exogenous + endogenous) level in HEK cells. In the right panel, quantification of the total REST protein (exogenous + endogenous) level by WB analysis showed that the total REST protein level in HEK cells administered with RPP decreased by 58.3% ( Figure 6 ).
[0080] In in vitro binding assays, RPP has a low pM affinity for CTDSP1 and decreases slowly ( Figure 2 and Figure 3 In an in vitro phosphatase inhibition assay, RPP inhibited its target CTDSP1 at low nM concentrations but did not inhibit the activity of non-target PP5, PP1, PPM1H, PPM1A, or PP3CA at 10 μM ( Figure 26 In the cell permeability and stability analysis of MPCs, RPP translocated to the nucleus ( Figure 4 and Figure 5 ), which is consistent with the localization patterns of REST and CTDSP1 92,97 After 6 days of culture, the RPP level remained stable.
[0081] It has been demonstrated that blocking REST in rodent chronic pain models prevents the downregulation of NaV1.8, Kv4.3, Kv7.2, and Oprm1, which are thought to be responsible for hyperalgesia and allodynia (Table 12). Based on these studies, we tested whether blocking CTDSP1 could stimulate the expression of REST target genes associated with chronic pain. We also showed that Kv4.3 mRNA was increased (2-fold and 4-fold, respectively) in NBFL cells transfected with RPP (without HIVTAT-HA2) or administered with linear or circular RPP ( Figure 8 and 9 c).
[0082] We found that 3 μM RPP (SEQ ID NO: 5-11) increased the differentiation of human neural progenitor cells (iPSCs) by 2 to 2.7 fold compared to controls, as measured by MAP2 (mature neuronal marker) expression normalized to DAPI (nuclei) ( Figure 11 ), 1 μM RPP (SEQ ID NO: 9 and 13) increased the differentiation of human neural progenitor cells (iPSCs) ( Figure 12 and 13 ), as measured by expression of TUJ1 (up to 36% and 3-fold, respectively) and MAP2 (up to 33% and 2-fold, respectively) (neuronal markers) normalized to DAPI (nuclei). There was no increase in cell death compared to the control group (data not shown). This screen was used based on the fact that elimination of REST in neural progenitor cells has been shown to induce neuronal differentiation. 22 , which is an indicator of global derepression of neuronal genes.
[0083] In preliminary evaluations of efficacy and toxicity, RPP was evaluated at 0, 1, 3, or 10 μM for 48 h in whole-body DRG neuron cultures to determine its ability to induce Kv4.3 ( Figure 14 )、KV7.2( Figure 14 )、Nav1.8( Figure 14 and 15 ) and OPRM1( Figure 14 ) expression potential and induce neurotoxicity ( Figure 17 At 3 μM, SEQ ID NO: 12 induced Kv4.3, KV7.2, Nav1.8 and OPRM1 by approximately 0, 6, 3 and 3 times that of the control group, respectively ( Figure 14 At 3 μM, SEQ ID NOs: 13 and 14 induced NaV1.8 by approximately 6 and 13 times, respectively ( Figure 15 At 10 μM, SEQ ID NO: 12 induced Kv4.3, KV7.2, Nav1.8 and OPRM1 by approximately 2, 7, 5 and 4 times, respectively ( Figure 14 In the lactate dehydrogenase LDH cytotoxicity assay, RPP SEQ ID NO: 12 showed no toxicity at 0, 1, 3 or 10 μM ( Figure 16 As expected, the positive control (triton, n=6) was toxic ( Figure 17 ).
[0084] Epilepsy - Epilepsy is uncontrolled electrical activity in the brain that causes confusion, loss of consciousness, and uncontrolled movements 98 It results from dysregulation of ion channels and receptors including SCN1A (Nav1.1), SCN2A (Nav1.2), SCN1B (Navβ subunit 1), KCNQ2 (Kv7.2), and KCNQ3 (Kv7.3), which are targets of REST inhibition. 14,99 The underlying cause of epilepsy is increased REST levels in neuronal nuclei 100 .
[0085] Diabetes-Pancreatic β cells and neurons share similar transcriptional pathways during differentiation, involving ablation of REST 101 Overexpression of REST in β cells reduces insulin secretion by downregulating REST target genes. 102,103 .
[0086] Alzheimer's Disease - In Alzheimer's disease, acetylcholine and choline acetyltransferase (ChAT), a transferase necessary for the synthesis of acetylcholine, are present at very low levels. Reduced concentrations of this enzyme contribute to the memory and cognitive deficits associated with Alzheimer's disease. Increased levels of REST in the brain inhibit ChAT. 16 .
[0087] Huntington's disease - In Huntington's disease, translocation of the REST region from the cytoplasm to the nucleus of neurons is thought to be responsible for the neuronal degeneration associated with the disease 104-106 .
[0088] Brain cancer, including glioblastoma multiforme - Brain cancer, including glioblastoma multiforme (GBM), originates from brain tumor-initiating cells (BTICs), which are cancer stem cells with a strong self-renewal capacity to become cancerous tumors. These cells are resistant to radiation and chemotherapy and become proliferative months after treatment. 107-109 RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) have the potential to prevent tumor formation by terminally differentiating BTICs. Once cells are terminally differentiated, they can no longer proliferate and give rise to new tumors. 110 It is important to note that terminal differentiation is distinct from differentiation achieved by other approaches, such as targeting chromatin remodeling with histone deacetylase inhibitors (HDACs). Inhibition of these enzymes randomly alters gene expression and fails to achieve the permanent terminal differentiation required to prevent recurrent GBM. Terminal differentiation of BTICs into neurons was blocked at a single checkpoint by REST. The importance of this inhibitory factor in maintaining oncogenicity was emphasized by the observation that increased REST levels correlated with GBM recurrence. 111-113 , and shorter disease-free survival 112-114 BTIC's dependence on REST to maintain its oncogenicity creates an opportunity for therapeutic intervention. REST is degraded by phosphorylation at serines 861 and 864, and these serines are maintained in a dephosphorylated state by the C-terminal domain small phosphatase CTDSP1. 2 Therefore, inhibition of CTDSP1 with RPPs (SEQ ID NOs: 1 and 15-17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPPs (SEQ ID NOs: 118 to 137 and 140 to 159) should release the REST-brake on terminal differentiation and prevent recurrence of GBM and other brain tumors.
[0089] Pancreatic cancer - Advanced, metastasis-positive pancreatic cancer cells have higher REST levels 115 Pancreatic cancer patients with higher REST levels in their tumors have lower survival rates 115 In vitro functional experiments showed that REST gene knockout inhibited the proliferation, migration, invasion and epithelial-mesenchymal transition of pancreatic cancer cells (AsPC-1 and PANC-1). 115 In vivo experiments (subcutaneous BALB / c nude mouse model and superior mesenteric vein injection BALB / c nude mouse model) showed that knockout of REST inhibited the growth and metastasis of xenograft tumors 115. Therefore, inhibiting REST can improve the prognosis of patients with these diseases. Therefore, the present invention also relates to a method of inhibiting REST in a cell. Generally, the method comprises contacting a cell with an RPP (SEQ ID NO: 1 and 15 to 17) or RPPv (SEQ ID NO: 18 to 117) peptide fused to a CPP (SEQ ID NO: 118 to 137 and 140 to 159). For example, it can expose the cell for a long enough time to allow the RPP (SEQ ID NO: 1 and 15 to 17) or RPPv (SEQ ID NO: 18 to 117) fused to the CPP (SEQ ID NO: 118 to 137 and 140 to 159) to enter the cell and have an effect on REST activity. The method can be implemented in vitro or in vivo. When performed in vitro, this method can be used to study the activity of REST, to test the ability of other compounds to complement or antagonize the effects of RPPs (SEQ ID NOs: 1 and 15 to 17) or RPPvs (SEQ ID NOs: 18 to 117) fused to CPPs (SEQ ID NOs: 118 to 137 and 140 to 159) on REST, or for any other reason of importance to the researcher. When performed in vivo, this method can be used as a method for treating one or more REST-related diseases or conditions in a subject. According to this aspect of the invention, REST activity is preferably reduced. The step of contacting cells can be any procedure that physically brings the agent into contact with one or more target cells. Thus, this can be achieved by adding the agent directly to an in vitro culture of the cells to be contacted and allowing sufficient time for the agent to diffuse through the culture medium and contact at least one cell. Similarly, this can be achieved by adding the agent to cells in an aqueous environment. Alternatively, the agent can be administered to the subject via any acceptable route of administration and allowed to be distributed to the target cells by the subject's body through natural processes. Thus, in vivo methods can be methods for locally or systemically delivering the agent to cells in animals, including, inter alia, all mammals and humans. According to this aspect, RPPs (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPPs (SEQ ID NOs: 118 to 137 and 140 to 159) can be used to treat a subject therapeutically or prophylactically and to prepare compositions for treatment.
[0090] In another embodiment, the present invention provides a method for treating a subject having or at risk of having a disease or condition involving REST. Generally, the method comprises administering an amount of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) sufficient to affect the amount or activity of REST in the subject. In certain aspects, binding of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) to CTDSP1 results in inhibition of REST activity in the cell. Generally, the method comprises administering an amount of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) sufficient for a sufficient period of time to inhibit REST activity. Typically, the dosage and duration of administration are sufficient to see a change in one or more clinical symptoms of the disease or lesion, or to prevent the disease or lesion from progressing to a stage where one or more clinical symptoms appear. According to this aspect, the agent can be used to treat or prophylactically treat a subject, and to prepare a composition for treatment.
[0091] In one embodiment, the present invention provides a method for treating, alleviating or improving a subject's traumatic brain injury, chronic pain, peripheral nerve injury, epilepsy, diabetes, Alzheimer's disease, Huntington's disease, brain tumor (including glioblastoma multiforme) or pancreatic cancer. As used herein, the terms "treat" or "alleviate" or "improve" and similar terms include prevention and complete or partial treatment. These terms can also include alleviating symptoms, improving symptoms, reducing the severity of symptoms, reducing the incidence of the disease, or any other change in the patient's condition that improves the outcome of treatment. These methods involve administering RPPs (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPPs (SEQ ID NOs: 118 to 137 and 140 to 159) to animal subjects suffering from, or in need of treatment for, traumatic brain injury, chronic pain, peripheral nerve injury, epilepsy, diabetes, Alzheimer's disease, Huntington's disease, brain tumors (including glioblastoma multiforme), or pancreatic cancer.
[0092] RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) can be administered to a subject by any known and acceptable route. These routes include, but are not necessarily limited to, oral, mucosal (e.g., nasal, inhaled, rectal, uterine or vaginal, sublingual), intravenous (e.g., intravenous bolus, intravenous infusion), intraperitoneal, and subcutaneous. Likewise, administration can be by direct injection into a site (e.g., an organ, a tissue) containing target cells (i.e., cells to be treated). Furthermore, administration can follow any number of regimens. Thus, it can include a single dose or administration of the drug, or multiple doses or administrations over a period of time. Thus, treatment can involve one or more repetitions of the administration step until the desired result is achieved. In embodiments, treatment can continue for longer periods of time, such as weeks, months, or years. One skilled in the art is well able to readily develop a suitable dosing regimen for an individual based on parameters known in the art. Thus, these methods also contemplate controlling, but not necessarily eliminating, the disease or pathology. Preferred routes of administration according to the invention are oral and transmucosal.
[0093] The amount to be administered will vary depending on the subject, the stage of the disease, the age of the subject, the general health of the subject, and various other parameters known and commonly considered by those skilled in the medical field. As a general matter, a sufficient amount of the agent will be administered to produce a detectable change in the subject's symptoms. Suitable amounts are disclosed herein, and other suitable amounts can be determined by those skilled in the art without undue or excessive experimentation.
[0094] The RPPs (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPPs (SEQ ID NOs: 118 to 137 and 140 to 159) are administered in a form that is acceptable, tolerable, and effective to the subject. A variety of pharmaceutical forms and dosage forms for bioactive agents are known in the art, and the present invention contemplates all such forms and dosage forms. Thus, for example, the formulation can be formulated as an oral solution, caplet, capsule, injection, insolvent, suppository, lozenge, tablet, cream or ointment, inhalant, and the like.
[0095] One of ordinary skill in the art will readily optimize effective dosages and administration regimens based on good medical practice and the clinical condition of the individual subject.
[0096] The frequency of administration depends on the pharmacokinetic parameters of the compound and the route of administration. The optimal pharmaceutical formulation will be determined by those skilled in the art based on the route of administration and the desired dosage. Such formulations may affect the physical state, stability, in vivo release rate, and in vivo clearance rate of the formulation. Depending on the route of administration, the appropriate dosage is calculated based on body weight, body surface area, or organ size. The availability of animal models is particularly helpful in determining the appropriate dosage of a given therapeutic drug. Those of ordinary skill in the art will typically further refine the calculations required to determine the appropriate therapeutic dosage without unnecessary experimentation, especially based on the dosage information and analysis disclosed herein and the pharmacokinetic data observed in animal or human clinical testing.
[0097] In some embodiments, the dosage of the present invention is as follows: the dosage of the drug of claim 1 or 2 is as follows: 1) the dosage of the drug of claim 1 or 2 is as follows: 2) the dosage of the drug of claim 1 or 2 is as follows: 3) the dosage of the drug of claim 1 or 2 is as follows: 4) the dosage of the drug of claim 1 or 2 is as follows: 5) the dosage of the drug of claim 1 or 2 is as follows: 6) the dosage of the drug of claim 1 or 2 is as follows: 7) the dosage of the drug of claim 1 or 2 is as follows: 8) the dosage of the drug of claim 1 or 2 is as follows: 9) the dosage of the drug of claim 1 or 2 is as follows: 10) the dosage of the drug of claim 1 or 2 is as follows: 11) the dosage of the drug of claim 1 or 2 is as follows: 12) the dosage of the drug of claim 1 or 2 is as follows: 13) the dosage of the drug of claim 1 or 2 is as follows: 14) the dosage of the drug of claim 1 or 2 is as follows: 15) the dosage of the drug of claim 1 or 2 is as follows: 16) the dosage of the drug of claim 1 or 2 is as follows: 17) the dosage of the drug of claim 1 or 2 is as follows: 18) the dosage of the drug of claim 1 or 2 is as follows: 19) the dosage of the drug of claim 1 or 2 is as follows: 20) the dosage of the drug of claim 1 or 2 is as follows: 21) the dosage of the drug of claim 1 or 2 is as follows: 22) the dosage of the drug of claim 1 or 2 is as follows: 23) the dosage of the drug of claim 1 or 2 is as follows: 24) the dosage of the drug of claim 1 or 2 is as follows: 25) the dosage of the drug of
[0098] It will be appreciated that the peptides, compositions and treatment methods of the present invention are useful in the fields of human medicine and veterinary medicine. Thus, the subject to be treated is a mammal, such as a human or other mammal. For veterinary purposes, subjects include, for example, farm animals, including cattle, sheep, pigs, horses and goats, companion animals, such as dogs and cats, exotic animals and / or zoo animals, and laboratory animals, including mice, rats, rabbits, guinea pigs and hamsters.
[0099] RPPs (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPPs (SEQ ID NOs: 118 to 137 and 140 to 159) can be administered to a subject animal, preferably a mammal, such as a human, in need thereof as a pharmaceutical or veterinary composition (e.g., tablet, capsule, solution, or emulsion). RPPs (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) fused to CPPs (SEQ ID NOs: 118 to 137 and 140 to 159) can be present in a composition containing other ingredients. Non-limiting examples of compositions suitable for use in the present invention are pharmaceutical compositions, such as tablets, pills, capsules, caplets, multiparticulates (including granules, beads, pellets, and microencapsulated particles); powders, elixirs, syrups, suspensions, and solutions. Pharmaceutical compositions typically contain a pharmaceutically acceptable diluent or solvent. Pharmaceutical compositions are preferably suitable for parenteral administration (e.g., oral administration). Orally administrable compositions can be in solid or liquid form, and can be in the form of tablets, powders, suspensions, syrups, etc. Optionally, the composition comprises one or more flavoring agents and / or coloring agents. In general, therapeutic and nutritional compositions can comprise any substance that does not significantly interfere with the effect of the medicament on the subject.
[0100] Pharmaceutically acceptable excipients or solvents suitable for use in such compositions are well known in the pharmaceutical art. The compositions of the present invention may contain 0.01-99% (by weight) of the pharmaceutical agent. The compositions of the present invention are typically prepared in unit dosage form. Excipients used to prepare these compositions are well known in the art.
[0101] Other examples of product forms of the composition are food supplements, such as soft gel or hard capsules, which contain an encapsulating material selected from gelatin, starch, modified starch, starch derivatives (such as glucose, sucrose, lactose, and fructose). The encapsulating material may optionally contain a crosslinking agent or polymerizing agent, a stabilizer, an antioxidant, a light absorber for protecting photosensitive fillers, a preservative, and the like.
[0102] Generally speaking, the term solvent is used in this application to refer to a composition that can be mixed with a formulation, whether it is a pharmaceutical solvent, a food, a nutritional supplement, or a dietary aid. For the purposes of the present invention, the above materials can be considered solvents for the formulation. In certain embodiments of the present invention, the solvent has little or no biological activity, particularly against REST.
[0103] Without further description, it is believed that one of ordinary skill in the art can use the foregoing description and the following illustrative examples to prepare and utilize the compounds of the present invention, as well as to practice the claimed methods. The following examples are given to illustrate the present invention. It should be understood that the present invention is not limited to the specific conditions or details described in the examples.
[0104] Example 1 - His-CTDSP1 plasmid construction
[0105] The codon-optimized (using the IDT codon optimization tool) CTDSP1 gene was cloned into the pBAD HisA plasmid (Thermo Fisher Scientific). First, the pBAD-HisA plasmid was amplified using primers P33 and P34 (Table 1) that introduced HindIII and XhoI restriction sites. The PCR reaction (20 μL) was initially heated at 95°C for 2.5 minutes, followed by denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, 30 cycles, and extension at 72°C for 6 minutes. After amplification, the PCR fragment was gel-purified using the QIAGEN gel band purification kit and digested with HindIII and XhoI restriction endonucleases. All digested fragments were purified using the QIAGEN kit according to the manufacturer's recommendations and ligated in appropriate combinations using T4 DNA ligase (NEB).
[0106] Table 1: Primers used for plasmid construction
[0107]
[0108]
[0109] According to the manufacturer's protocol, the ligation fragments were transformed into 10G chemically competent cells (Lucigen). The transformed cells were inoculated on LB plates containing 50 μg / mL ampicillin and cultured overnight at 37°C. The presence of inserts in the colonies was detected by colony PCR. Colonies were collected and resuspended in 20 μl sterile 0.9% sodium chloride solution. 1 μl of this solution was transferred to a PCR tube and amplified with Taq polymerase (New England Biolabs, cat#M0482S) and 30 pM flanking primers. Initially, each PCR reaction (20 μL) was heated to 95°C for 2.5 minutes, followed by denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, 30 cycles, and extension at 72°C for 1 minute. Agarose electrophoresis showed the amplified products. Clones with the correct inserts were inoculated into culture tubes containing 5 mL LB and appropriate antibiotics and cultured overnight at 37°C. The construct was then purified using the Monar Plasmid miniprep kit (NEB).
[0110] Example 2 - Expression and purification of His-CTDSP1
[0111] His-CTDSP1 (Table 2; SEQ ID NO: 162): Escherichia coli (10G strain Lucigen) harboring the pBAD-CTDSP1 construct were shaken vigorously overnight at 37°C. Then, 4 mL of the overnight culture was added to 500 mL of LB medium containing 50 μg / mL ampicillin in a 1-L flask and incubated at 37°C with shaking. When the culture reached an OD600 of 0.4, arabinose was added to a final concentration of 0.02% and incubated at 30°C with shaking for 16 hours. The following morning, cells were spun down at maximum speed (Eppendorf centrifuge 5810R) and frozen at -80°C. When necessary, cell pellets were removed from the freezer, incubated at room temperature, lysed with 4 mL of BPER protein lysis reagent (Thermofisher), and protein purified using the HisPurCobalt purification kit (Thermofisher, Cat# 90091) as described by the manufacturer.
[0112] Table 2 - CTDSP1 nucleotide and protein sequences
[0113]
[0114]
[0115] Example 3 - Development of peptides with high affinity for CTDSP1
[0116] Candidate peptides were generated using RNA display and protein evolution methods.
[0117] Construction of RNA display libraries: We have constructed three different RPP variant libraries. In all libraries, serine 861 and 864 were replaced by glutamate. Library 1 was constructed using primers P11 to P14 (Table 1). In library 1, each position of the remaining peptides was mutated. It is estimated that 1×10 9 In library 2 (primers P14 to P18, Table 1), the degenerate oligomers were not modified with glutamate (touched). This library is expected to have 65×10 6 In library 3, only one glutamate and every second codon were mutated. This library is expected to generate only 65,000 variants.
[0118] In all three libraries, the RPP sequence (SEQ ID NO: 1) was diversified by synthesizing degenerate oligonucleotides. Only one degenerate base was introduced per codon: the first or second position, with the choice of 4 amino acids. The remaining cassettes were amplified from the pBAD construct as two fragments: the left fragment and the right fragment, which were recombined by ligation ( Figure 27The left fragment was amplified using the flanking forward primer P23 (Table 1) and a reverse primer (11R slot 22R, Table 1).
[0119] The right fragment was amplified using a forward primer (11F to 22F, Table 1) and a reverse primer P24 (Table 1). The PCR reaction (20 μL) was initially heated at 95°C for 2.5 minutes, then denatured at 94°C for 15 seconds, annealed at 55°C for 15 seconds, 30 cycles, and extended at 72°C for 40 seconds. After amplification, the PCR fragment was gel-purified using a QIAGEN gel band purification kit and mixed and ligated with T4 DNA ligase. The ligation reaction contained 20 μl 10x ligation buffer, 100 ng fragment mixture, 0.5 μl 100 mM ATP, 1 μl T4 DNA ligase (NEB cat# M0202S), and 1 μl T4 polynucleotide kinase. The reaction mixture was incubated at room temperature and used as a template for PCR with flanking primers P17 and P20 (Table 1) using the above-mentioned procedure. The PCR fragment was gel-purified by a QIAGEN gel band purification kit and used as a template for mRNA display experiments.
[0120] For quality control purposes, we cloned and sequenced a portion of this library. A small portion of the library was digested with HindIII and XhoI restriction endonucleases, purified using a QIAGEN kit, and the CTDSP1 gene was cloned into the pBAD vector as described above. Individual clones were sequenced using GeneWiz to confirm successful mutation of the REST cassette and that most clones did not exhibit frameshift mutations.
[0121] In vitro transcription: RNA was translated from the amplified library using the RiboMAX Large-Scale RNA Production System T7 (Promega, Cat# P1300) according to the manufacturer's protocol and purified by the RNeasy Mini Kit (Qiagen, Cat# 74104).
[0122] mRNA was linked to a DNA linker using puromycin: XL-PSO oligonucleotides were synthesized using the IDT method. The oligonucleotide sequence was: 5'-PsoC6-(uagccggug) 2’-OMc-AAAAAAAAAAAAAAA-Spacer9-Spaser9-ACC-Puro-3' (SEQID NO: 330). To connect this oligonucleotide to mRNA, we mixed the following reagents in a PCR tube: 29.5μl RNase-free water. 1μl 1M HEPES-KOH, pH 7.6, 5μl 1M KCl, 2μl 25mM spermidine, 0.5μl 125mM EDTA, 8μl mRNA from the previous step, and 4μl 100mM XL-PSO oligonucleotide. The PCR tube was placed in a PCR machine, heated to 70°C for 5 minutes, and cooled to 25°C at a rate of 0.1°C / s. We then transferred the mixture to a 96-well plate on ice, placed a 365nm handheld UV lamp on top, and irradiated the plate for 20 minutes. Afterwards, the cross-linked RNA was purified by RNeasy Mini kit (Qiagen, Cat#74104).
[0123] In vitro translation: Translation was performed using the PUREexpress In Vitro Protein Synthesis Kit (NEB, Cat# E6800S). The following reagents were mixed in a 1.5 ml tube: 20 μl of Solution A, 15 μl of Solution B, 0.5 μl of RNAsin Plus, 4.5 μl of water, and 10 μl of cross-linked RNA (1 μg / l). The mixture was incubated at 37°C for 2 hours.
[0124] Purification of peptides with His tags: We used Ni-NTA magnetic beads (Qiagen, Cat#36111) to purify RNA-peptide complexes. 100 μl of beads were washed with 300 μl of wash buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 0.005% Tween 20), separated on a magnetic stand, and suspended in 300 μl of wash buffer. 25 μl of RNA-peptide complexes from the previous step were added to the washed beads and incubated for 30 minutes at room temperature on an end-over-end shaker. The beads were washed three times with wash buffer, then separated on a magnetic stand and eluted with 50 μl of elution buffer (50 mM NaH2PO4, 300 mM NaCl, 500 mM imidazole, 0.005% Tween 20).
[0125] Use of Oligo-d(T) 25Purification using magnetic beads (SEQ ID NO: 331): Oligo-d(T)25 magnetic beads were purchased from New England Biolabs (Cat# S1419S). 100 μl of the bead suspension was washed with 500 μl of wash buffer I (20 mM Tris-HCl, pH 7.5, 500 mM NaCl, 1 mM EDTA), placed in the buffer and separated on a magnetic stand, then suspended in 50 μl of wash buffer I. 50 μl of the RNA-peptide complex from the previous step was mixed with 50 μl of binding buffer (100 mM Tris-HCl, pH 7.5, 1 M NaCl, 2 mM EDTA), heated at 65°C for 2 minutes, placed on ice for 1 minute, and mixed with the washed beads. The mixture was incubated at room temperature for 5 minutes, then washed twice with 500 μl of wash buffer I (20 mM Tris-HCl, pH 7.8, 500 mM NaCl, 1 mM EDTA) and once with 500 μl of wash buffer II (20 mM Tris-HCl, pH 7.8, 200 mM NaCl, 1 mM EDTA).
[0126] Peptide cyclization: Oligo-d(T) 25 The magnetic bead-bound RNA peptide complex (SEQ ID NO: 331) was incubated for 30 minutes with regular shaking. After incubation, the beads were washed with wash buffer III (20mM Tris-HCl, pH 7.8, 0.3mM NaCl, 5mM 2-mercaptoethanol), then washed with wash buffer IV (20mM Tris-HCl, pH 7.8, 0.3mM NaCl, 0.5mM TCEP), and then washed with wash buffer I (20mM Tris-HCl, pH 7.8, 500mM NaCl, 1mM EDTA) and wash buffer II (20mM Tris-HCl, pH 7.8, 200mM NaCl, 1mM EDTA). The purified product was eluted from the magnetic beads by adding 30ul elution buffer (20mM Tris-HCl, pH 7.8) and incubating at 65°C for 2 minutes.
[0127] Affinity screening: Affinity screening was performed in NUNC Maxisorp plates (Thermo Fischer Scientific). His-CTDSP1 (Table 2; SEQ ID NO: 163) was dissolved in 100 μl PBS, transferred to the Maxisorp plate wells, and incubated for 2 hours at room temperature on an orbital shaker. The wells were washed twice with PBS and blocked with casein (PBSC buffer or PBS containing 1% casein) for 1 hour at room temperature, shaken, and then washed three times with PBS. Negative screening wells were coated with casein only by incubating with 300 μl PBSC solution and washing three times with PBS. Purified RNA-peptide complexes were first added to these negative screening wells containing 100 μl PBS and incubated at room temperature for 20 minutes with shaking. This solution was transferred to the positive screening wells (covered with His-CTDSP1) containing 125 μl PBSC and incubated at room temperature for 1 hour with shaking. Off-target screening was performed by adding 25 μl of purified His-CTDSP1 to each well and incubating for 3 minutes. The incubated wells were then washed three times with PBS and used for cDNA synthesis.
[0128] cDNA synthesis and PCR: We used SuperScriptIII first-strand synthesis system (Invitrogen, Cat#18080-051) for cDNA synthesis. First, 16 μl of water was mixed with 2ul 50mM primer P19 (Table 1) and 1 μl dNTP solution, and the mixture was added to the wells in the Maxisorp plate. Next, the plate was incubated at 65°C for 5 minutes and then cooled at 4°C for 1 minute. We then transferred 20 μl of the mixture from the plate to a PCR tube and added a 20 μl reaction mixture containing 4 μl 10x buffer, 8 μl 25mM MgCl2, 4 μl 0.1M DTT, 2 μl RNAse and 2 μl Superscript III reverse transcriptase. The mixture was incubated at 50°C for 50 minutes. We then added 2 μl RNAse H and incubated the tube at 37°C for 20 minutes.
[0129] DNA corresponding to strong binders identified in the screen (Table 1) was amplified using primers P17 and P20. Amplification was performed using Vent DNA polymerase. PCR reactions (20 μL) were initially heated at 95°C for 2.5 minutes, followed by 25 cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds. After amplification, the PCR fragments were run on an agarose gel and purified using a QIAGEN gel band purification kit according to the manufacturer's protocol.
[0130] NGS data analysis. Each PCR reaction was subjected to next generation sequencing. We used Amplicon EZserveice GeneWiz. Unigenes were quantified and the most abundant sequences were selected for further testing (Tables 3 and 3a).
[0131] Table 3 - Protein and nucleotide sequences of RPP variants (SEQ ID NOs are identified in Table 19)
[0132]
[0133]
[0134]
[0135] Table 3b - Protein sequences of RPPRI variants* (SEQ ID NOs are indicated in Table 1)
[0136]
[0137]
[0138]
[0139] Example 4 - Construction and expression of peptide-GST fusions
[0140] As a first step, we cloned the GST protein into the pET29 vector. GST was codon-optimized, flanked by HindIII and XhoI sites, and synthesized by IDT. Amplification was performed using Phusion DNA polymerase (NEB, cat#M0530S) and primers P109 and P108 (Table 1). PCR reactions (20 μL) were initially heated at 95°C for 2.5 minutes, followed by 30 cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 1 minute. After amplification, the PCR fragment was gel purified using the QIAGEN Gel Band Purification Kit according to the manufacturer's protocol.
[0141] The pET29 plasmid was amplified using primers P12 and P14 (Table 1), which introduce HindIII and XhoI restriction sites. The PCR reaction (20 μL) was initially heated at 95°C for 2.5 minutes, followed by 30 cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 6 minutes. After amplification, the PCR fragment was gel-purified using a QIAGEN gel band purification kit and digested with HindIII and XhoI restriction endonucleases. All digested fragments were purified using a QIAGEN kit and ligated using T4 DNA ligase (NEB) in the appropriate combination according to the manufacturer's recommendations. The ligated fragments were transformed in 10G chemically competent cells and sequenced as described above. The expression construct for GST-RPP is shown in Table 4 (SEQ ID NO: 164).
[0142] Table 4 - Nucleotide and protein sequences of RPP-GST fusions
[0143]
[0144]
[0145] Using the primers shown in Table 5, the selected sequence was recreated by PCR, the gel was purified using a QIAGEN gel band purification kit, digested with HindIII and BamHI restriction enzymes, and cloned into the above-mentioned pET vector with a GST tag. According to the manufacturer's protocol, the ligated fragment was transformed into 10G chemically competent cells (Lucigen). The transformed cells were inoculated on LB plates containing 25 μg / mL kanamycin and cultured overnight at 37°C. The next morning, the colonies were tested for the presence of inserts by colony PCR. Colonies were collected and resuspended in 20 μl of sterile 0.9% sodium chloride solution. 1 μl of this solution was transferred to a PCR tube and amplified with Taq polymerase (New England Biolabs, cat#M0482S) and 30 pmol of flanking primers. Each PCR reaction (20 μl) was initially heated at 95°C for 2.5 minutes, then denatured at 94°C for 15 seconds, annealed at 55°C for 15 seconds, 30 cycles, and extended at 72°C for 1 minute. Agarose gel electrophoresis showed the amplified product. The clone with the correct insert was inoculated into a culture tube containing 25 μg / mL kanamycin and cultured overnight at 37°C. The next morning, the construct was purified by Monar Plasmid miniprep kit (NEB). As described above, the construct was transformed into BL21 (DE3) competent cells (Lucigen).
[0146] Purification of peptide GST fusions: E. coli cells (BL21 strain) containing the selected constructs were shaken vigorously overnight at 37°C. The next morning, we added 1 ml of the overnight culture to 100 ml of LB medium containing 25 μg / ml kanamycin in a 1-L flask and incubated at 37°C with shaking. When the OD600 of the culture reached 0.4, we added IPTG to a final concentration of 1 mM and incubated at 30°C with shaking for 16 h. The next morning, the cells were spun at maximum speed in an Eppendorf centrifuge 5810R and frozen at -80°C. If necessary, the cell pellet was removed from the freezer, incubated at room temperature, and lysed with 3 ml of BPER protein lysis reagent (Thermofisher). The peptide GST fusions were purified using glutathione agarose (Thermoscitific cat#16100) as described by the manufacturer.
[0147] Table 5 - Primers used for cloning RPP variants with in-frame GST
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157] Example 5 - Inhibition of CTDSP1 Phosphatase Activity by RPP and RPP Variants
[0158] result: Figure 25 - The top 51 most abundant RPP variants identified in the RNA display / protein evolution screen are listed in Table 3 in order of most abundant (V1) to least abundant (V51) peptides. Table 5 lists the primers used to prepare these peptides. Phosphatase activity screen (Table 6, Figure 25 ) was used to assess the ability of the first 51 RPPv to inhibit the CTDSP1 phosphatase activity at amino acids 861 and 864 of the endogenous phosphorylated REST peptide (TEDpSPPpSPPLPKEN (SEQ ID NO: 329)).
[0159] Phosphorylated REST peptide (TEDpSPPpSPPLPKEN (SEQ ID NO: 329)) was synthesized by GeneScript. Phosphatase reactions were performed at room temperature for 10 minutes using 10 mM Tris pH 8, 10 mM MgCl2, 100 nM CTDSP1, 0.5 μM phosphate sensor (phosphate sensor, Thermo Fischer), 50 μM REST peptide, and peptide GST fusions at varying concentrations. All assays were performed in 96-well plates (Corning P / N 3686) rinsed 10 times with water. Fluorescence measurements were performed using a BioTek Synergy HTX at 420 / 27 nm excitation and 485 / 20 nm emission using kinetic readouts.
[0160] Screening showed that RPP (V1) inhibited phosphatase activity by about 60% at 1 μM compared to the control group (GST) (Table 6, Figure 25 Some variants were more effective in inhibiting phosphatase activity than RPP (Table 6, Figure 25 The most effective inhibitor was v33, with an inhibition rate of 100%; v35, with a phosphatase activity of approximately 90% (Table 6, Figure 25 ).
[0161] Table 6 - Inhibition of CTDSP1 phosphatase activity by RPP variants
[0162]
[0163]
[0164]
[0165] Figure 26 , Table 13 - RPP, SEQ ID NO: 12, inhibits CTDSP1 activity, EC 50 The concentration is about 20nM, but it does not affect the activities of several other phosphatases.
[0166] Detection: As above Figure 26 The ability of RPP SEQ ID NO: 12 to inhibit CTDSP1 activity at amino acids 861 and 864 of an endogenous phosphorylated REST peptide (TEDpSPPpSPPLPKEN (SEQ ID NO: 329)) was evaluated as described.
[0167]
[0168]
[0169] Example 6 - Evaluation of the binding affinity of RPP using Monolith (NanoTemper) and Biacore (GE Healthcare LifeSciences).
[0170] Expression constructs of His-CTDSP1 (Table 2; SEQ ID NO: 162) and GST-RPP (Table 4; SEQ ID NO: 164) were constructed and purified as described in Example 2. The His tag on CTDSP1 (40 nM) was labeled with red tris-NTA dye (20 nM) at a dye to CTDSP1 ratio of 3:1, and unbound dye was removed by gravity flow size exclusion. The binding affinity of linear GST-RPP (Table 4; SEQ ID NO: 165) to His-CTDSP1 (Table 2; SEQ ID NO: 163) was determined using Monolith (NanoTemper) according to the manufacturer's recommendations. The results of the binding assay are shown in Figure 2. Figure 2 Shown: Binding of RPP (Table 4; SEQ ID NO: 165) to His-CTDSP1 was evaluated at several concentrations ranging from low pM to 0.5 μM. K values corresponding to linear RPP binding to CTDSP1 D Calculated at 130 pM.
[0171] The binding affinity of linear GST-RPP (Table 4; SEQ ID NO: 165) to His-CTDSP1 (Table 2; SEQ ID NO: 163) was determined using Biacore from GE Healthcare Life Sciences. 20 μL (5 g / mL) of His-tagged CTDSP1 in 10 mM sodium acetate (pH 5.0) was immobilized on a CM5 chip (GE Healthcare Life Science) using amine coupling according to the Biacore recommended protocol (cat # BR-1000-50, GE Healthcare Life Science). This purification yielded approximately 1300 RU of protein bound to the CM5 chip. The CM5 chip was then washed with HBS-EP buffer (pH 7.4), and 120 μL of analyte (GST-RPP or GST alone (negative control)) was injected at a concentration of 500 nM in HBS-EP buffer (pH 7.4) at a flow rate of 30 μL / min. The association time was 2 minutes, and the dissociation time was 3 minutes. Finally, the bound protein was washed with 10 mM glycine HCl (pH 1.5) (BR-1003-54, GE Health science) at a flow rate of 50 μL / min for 25 s. Binding of linear RPP to CTDSP1 resulted in: K D =1.7pM( Figure 3 B, negative control Figure 3 (as shown in A).
[0172] Example 7 - RPP and RPPv fused to cell penetrating peptides (CPP) and / or peptides that promote endosomal escape
[0173] Several RPPs and RPPvs were synthesized with cell-penetrating peptides (CPPs) and / or peptides that promote endosomal escape. The list of CPPs and linkers we used is shown in Table 7.
[0174] Table 7 - Additional peptides that allow cell penetration and escape from endosomes
[0175]
[0176]
[0177] Example 8 - RPP is internalized by mesenchymal progenitor cells and sciatic nerve.
[0178] Mesenchymal progenitor cells (MPCs)
[0179] Results: After incubation with RPP (SEQ ID NO: 4) for 4 hours and then cultured for 6 days, RPP remained internalized in mesenchymal progenitor cells (MPCs) ( Figure 4 , C, and D) and localized in the nucleus during the 6-day culture period ( Figure 4 , E and F).
[0180] Materials and methods
[0181] Dosing and cell culture: MPCs were cultured as previously described. 116 , 1.0×10 4 cells / cm 2 Cells were plated onto glass coverslips in 24-well plates and cultured overnight at 37°C. 100 nM RPP (SEQ ID NO: 4) was added for 4 hours, followed by a medium change. Cells were cultured for 6 days with medium changes every two days. Metaphase MPCs were harvested at 24 and 72 hours to assess intracellular RPP localization.
[0182] Immunohistochemistry: Phalloidin (Invitrogen) was used to stain the cytoskeleton, Hoechst 333429 (Calbiochem) dye was used to visualize the nucleus, and FLAG antibody (Sigma-Aldrich) was used to visualize RPP. Images were captured using a confocal laser scanning microscope.
[0183] sciatic nerve
[0184] Results: Linear RPP accumulated in the nuclei of sciatic nerve tissue ( Figure 5 , A and B).
[0185] Materials and methods
[0186] Dosage and steps: Figure 5 : Sciatic nerve (L3 and L4 regions) of Sprague-Dawley rats (Schmitz and Beer, 2001) 117 Exposure was performed and after retraction of the nerve stump, a 0.7 cm segment was removed to create a segmental defect of approximately 1 cm (Hems and Glasby, 1993) 118 1 mg of RPP (SEQ ID NO: 4) in PBS was injected into the injured area and the surgical incision was closed. After 48 hours, the animals were sacrificed and the spinal cord was sectioned coronally from the L4 to L6 region.
[0187] Reasonable dose level: maximum feasible dose.
[0188] Test product identification: RPP (SEQ ID NO: 4)
[0189] purity : ≥95%
[0190] Immunohistochemistry: Hoechst 333429 (Calbiochem) dye was used to visualize cell nuclei, and FLAG antibody (Sigma-Aldrich) was used to visualize RPP. Images were captured using a light microscope.
[0191] Example 9 - RPP induces REST protein degradation.
[0192] Results: Compared with the solvent control group, RPP (SEQ ID NO: 4) reduced the REST protein level by 58% ( Figure 6 ).
[0193] Materials and methods
[0194] Test product identification: RPP (SEQ ID NO: 4)
[0195] purity : ≥95%
[0196] Dosing and cell culture: HEK 293 cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% calf serum. 2HEK 293 cells were transfected in 80% to 90% confluent cultures in 35 mm dishes using lipofectamine 2000 (Life Technologies) according to the manufacturer's recommendations. 24 hours after transfection, cells were gavage-treated overnight with 100 nM RPP (SEQ ID NO: 4) or solvent control (PBS).
[0197] Western blot analysis: Whole cell lysates were prepared according to the procedure of Ballas et al., 2001. 119 . Use Anti-REST-C 64 Western blotting was performed using standard procedures with anti-GAPDH (abcam) and anti-IgG conjugated to an infrared dye (Thermo Fisher) and analyzed on an Odyssey infrared fluorescence imager (LiCor). The bar graph shows quantification of the Western blot using ImageJ (https: / / imagej.nih.gov / ij).
[0198] Example 10 - RPP can be used to induce the expression of BDNF, NGF, Kv4.3, KV7.2, Nav1.8, and OPRM1 mRNA without neurotoxicity.
[0199] Results: RPP increased the expression of BDNF, NGF, Kv4.3, KV7.2, Nav1.8 and OPRM1 ( Figure 7 、 8 , 9, 10, 14, 15 and 16; Table 15). RPP (SEQ ID NO: 12) does not cause DRG neuron necrosis ( Figure 17 ), as shown by LDH cytotoxicity assay in DRG neurons incubated with different concentrations of RPP for 48 h. ***=p<0.001, n=4, one-way ANOVA and Dunnett's test, error bars=SD.
[0200]
[0201]
[0202]
[0203] Figure 7 :Materials and methods
[0204] Test product identification: RPP (SEQ ID NO: 4), purity: ≥95%
[0205] Drug administration and cell culture: 100 nM RPP; HEK 293 cells
[0206] mRNA extraction and quantification protocol: Cells were lysed in QIAzol (Qiagen) and total RNA was extracted using the RNeasy Midi kit (Qiagen) according to the manufacturer's instructions. Purified RNA was quantified using a NanoDrop 2000 (ThermoFIsher) and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) with 2 ng / L RNA per reaction. For qRT-PCR, 5 μL cDNA (equivalent to 10 ng RNA) was mixed with 10 μL SsoAdvanced TM Universal Supermix (BioRad) and 1 μL of each primer (final primer concentration 500 nM each). TM 7 Flex Real-Time PCR System (Applied Biosystems) was used in triplicate. The relative cycle threshold (ΔDC t Amplification data were analyzed using the PCR method and β-actin as a calibrator. The following primers were used: β-actin forward: AGAGCACGAGCTGCCTGAC-3' (SEQ ID NO: 332), β-actin reverse: 5'-GGATGCCACAGGACTCCA-3' (SEQ ID NO: 333), BDNF forward: 5'TATTAGTGAGTGGGTAACGGCG 3' (SEQ ID NO: 334), BDNF reverse: 5'GAAGTATTGCTTCAGTTGGCCTT 3' (SEQ ID NO: 335).
[0207] Figure 8 :Materials and methods
[0208] Transient transfection and cell culture: NBFL cells were grown as previously described. 120 0.5 μM NFBL cells were seeded on 35 mm culture dishes, cultured overnight at 37°C, and transfected with 2 g of REST (SEQ ID NO: 1)-IRES-GFP cDNA using lipofectamine 2000 (Life Technologies) according to the manufacturer's recommendations. 2 After 48 hours of culture, cells were sorted by fluorescence-activated cell sorting (FACS).
[0209] mRNA extraction and quantification: mRNA was extracted from GFP+ and - cells as described in Example 10; Kv4.3 mRNA levels were detected by real-time RT-PCR. 116β-actin (ACTB) was used as an internal control for normalization of gene expression. The β-actin primers used were the same as those in Example 10. Kv4.3 primers were: forward: CTCACTACCACCTGCTGCTC (SEQ ID NO: 336), reverse: TCAGTCCGTCGTCTGCTTTC (SEQ ID NO: 337).
[0210] Figure 9 :Materials and methods
[0211] Plasmid: RPP (SEQ ID NOs: 2 and 4): A segment of this construct containing a T7 promoter, CPP, and a His tag was synthesized as gBlock by IDT (Table 8) and amplified using the primers described in Table 8. PCR reactions (20 μL) were initially heated at 95°C for 2.5 minutes, followed by 30 cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds. After amplification, the PCR fragment was gel purified using a QIAGEN gel band purification kit according to the manufacturer's protocol.
[0212] The pET29 plasmid was amplified using primers introducing SbfI and XhoI restriction sites: forward: P12 and P14 (Table 1). The PCR reaction (20 μL) was initially heated at 95°C for 2.5 minutes, followed by secondary denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, 30 cycles, and extension at 72°C for 6 minutes. After amplification, the PCR fragment was gel purified using a QIAGEN gel band purification kit and digested with SbfI and XhoI restriction endonucleases. All digested fragments were purified using a QIAGEN kit according to the manufacturer's recommendations and ligated in appropriate combinations using T4 DNA ligase (NEB). The ligated fragments were transformed and sequenced in 10G chemically competent cells.
[0213] The nucleotide sequence of RPP (Table 8) was assembled and digested with HindIII and BamHI restriction enzymes. This fragment was cloned in the above-mentioned pET vector using CPP and His tags.
[0214] Control peptide : The control peptide (CP) was incorporated into the gBlock sequence shown in Table 9 and then cloned into the pET vector. The CP sequence is shown in Table 9.
[0215] In vitro expression: RPP (Table 8) or CP (Table 9) was expressed in vitro using the Pure Expression In Vitro Protein Synthesis Kit (New England Biolabs). RPP (SEQ ID NOs: 2 and 4) or CP sequences were amplified from RPP (SEQ ID NOs: 2 and 4) or CP expression constructs (Tables 8 and 9) using the primers listed in Table 8 and gel purified using the QIAGEN Gel Band Purification Kit. The PCR reaction (20 μL) was initially heated at 95°C for 2.5 minutes, followed by denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds for 30 cycles, and extension at 72°C for 30 seconds. 15 μL of the purified PCR fragment was then mixed with 10 μL of Solution A and 7.5 μL of Solution B of the Pure Expression In Vitro Protein Synthesis Kit (New England Biolabs) and incubated at 37°C for 2 hours. Next, 2 μL of DNase I was added and incubated at 37°C for 20 minutes.
[0216] Table 8 - RPP-CPP-His_pET cassette
[0217]
[0218]
[0219] purification: RPP (SEQ ID NO: 2 and 4) and CP The final solution from the in vitro expression step was diluted to 100 μL and filtered through an Amicon Ultracel 0.5 mL-100K column (Sigma) to remove ribosomes. The flow-through was added to 100 μL of washed Ni-NTA magnetic agarose beads (Qiagen) and washed with wash buffer according to the manufacturer's instructions.
[0220] Circularization: RPP (SEQ ID NO: 2) was used or the beads were circularized by mixing them with 500 μL of cyclization solution, which was prepared by mixing 2.65 mL of 1.33x PBS (66.5 mM phosphate buffer, 400 mM NaCl) with 1.32 mL of dibromo-m-xylene solution in acetonitrile (2.5 mg / mL). After incubation with the cyclization solution, the beads were washed once with wash buffer I (25 mM imidazole in PBS, 0.5 μL / mL mercaptoethanol), once with wash buffer II (25 mM imidazole in PBS, 0.5 mM TCEP), and twice with wash buffer III (25 mM imidazole in PBS). Elution was performed with 50 μL of elution buffer (500 mM imidazole in PBS). Imidazole was removed using a Bio-Rad Micro Bio-spin column.
[0221] Drug administration and cell culture: NBFL cells grown in 6-well plates ( Figure 9 ) were administered 1 μM linear (SEQ ID NO: 2) or cyclized (SEQ ID NO: 2) RPP (Table 8) or control peptide (Table 9) for 16 or 48 hours.
[0222] Mesenchymal progenitor cells (MPCs) from two patients ( Figure 10 ) were seeded in 12-well plates and cultured in general purpose medium (GM) (DMEM, 10% FBS, PSF). Lyophilized RPP (SEQ ID NO: 9) was dissolved in water at a concentration of 5 mM (1 mg / 34.8 g), diluted to 3 μM in culture medium, and incubated with cells for 48 hours. Water was used as a control.
[0223] mRNA extraction and quantification
[0224] After administration, cells were lysed and BDNF, NGF, and Kv4.3 mRNA levels were assessed ( Figure 9 ). All primers used, except NGF, are described: forward: 5'TATCCTGGCCACACTGAGGT3' (SEQ ID NO: 338) and reverse: 5'TCCTGCAGGGACATTGCTC3' (SEQ ID NO: 339).
[0225] Figure 10 :Materials and methods
[0226] MPCs were cultured as described by Gervasi et al., 2020 76 .
[0227] Figure 14 、 15 and 16: Materials and methods.
[0228] L5 DRGs were dissected from adult male rats and placed in 12-well plates pre-coated with poly-D-lysine (PDL) and laminin in a minimal volume of culture medium (250 μl Neurobasal medium supplemented with B27 (GIBCO), 50 ng / ml NGF (Sigma-Aldrich), and penicillin-streptomycin). TM -A medium (GIBCO)) to allow attachment to the culture plate. One day after plating, DRGs were incubated with RPP (SEQ ID NO: 12: 1 μM, 3 μM or 10 μM in culture medium, Figure 14 and 16 ; SEQ ID NO: 13 and 14: 3 μM, Figure 15) and incubated for 48 hours. For RNA expression analysis, DRG were dissolved in 300 μl of Qiazol using a Bullet Blender tissue homogenizer (Nextava nce) in a 1.5 ml tube containing Bullet Blender pink beads. Total RNA was extracted using the RNeasy Midi kit (Qiagen) according to the manufacturer's instructions. Purified RNA was quantified using a NanoDrop 2000 (ThermoFIsher) and reverse transcribed using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and 2 ng / ul of RNA per reaction. For qRT-PCR, 5 μl of cDNA (corresponding to 10 ng of RNA) was mixed with 10 μl of SsoAdvanced TM Universal Supermix (BioRad) was mixed with 1 μl of each primer (the final concentration of each primer was 500 nM). TM Reactions were performed in triplicate using the 7Flex Real-Time PCR System (Applied Biosystems). Amplification data were analyzed using the relative cycle threshold (ΔΔCt) method and β-actin as a calibrator. The primers are as follows: β-actin: F-AGAGCTATGAGCTGCCTGAC (SEQ ID NO: 340), R-GGATGCCACAGGACTCCA (SEQ ID NO: 333); KV4.3: F-AGCTGTGCCTCAGAACTAGGCTTT (SEQ ID NO: 341), R-TACCAGAAAGACGCAGGGATGCTT (SEQ ID NO: 342); KV7.2 F-CCGGCAGAACTCAGAAGA AG (SEQ ID NO: 343), R-TTTGAGGCCAGGGGTAAGAT (SEQ ID NO: 344); OPRM1: F-TTCCTGGTCATGTATGTGATTGTA (SEQ ID NO: 345), R-GGGCAGTGTACTGGTCGCTAA (SEQ ID NO: 346).
[0229] Figure 17 :Materials and methods
[0230] Cytotoxicity assay: using LDH-Glo TMCytotoxicity assay (Promega) was performed to evaluate the cytotoxicity of RPP (SEQ ID NO: 12) according to the manufacturer's instructions. Culture media were collected after 48 hours of treatment with RPP or incubated with 2% triton X-100 for 15 minutes (to induce necrosis). The culture media were diluted 1:50 in LDH storage buffer (200mM Tris-HCl (pH 7.3), 10% glycerol, 1% BSA). To verify the linear range of the assay, an LDH titration curve was also run along with the experimental samples. 50 ml of diluted culture media or LDH serial dilutions were incubated with 50 μl LDH detection reagent (50 μl LDH detection enzyme mix, 0.25 μl reductase substrate) for 40 minutes. Luminescence was recorded using an Infinite M200 Pro (Tecan) instrument.
[0231] Example 11 - RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) can be used to induce neural differentiation
[0232] Method 1: To determine whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) are most effective in promoting human neurogenesis and differentiation, an in vitro screening assay was performed using neural stem progenitor cells (NSPCs) from the NCRM-1 / XCL-1 iPS cell line. NCRM-1 / XCL-1 iPS cells were derived from CD34+ human umbilical cord blood cells by ex vivo plasmid reprogramming. 121 and differentiated into neural stem progenitor cells (NSPCs) via embryoid body (EB) method 122 NCRM-1 / XCL-1 neural stem cells are positional primitive neural stem cells that can rapidly differentiate into neurons. 123 , making it an ideal choice for broad-based toxicology and phenotypic screening platforms 124-126 .
[0233] We will perform high-throughput screening using two engineered NCRM-1 / XCL-1 lines in a 96-well plate assay. To determine whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) are cytotoxic, we will use a CPP-1 / XCL-1 line constitutively expressed under the control of the CMV promoter. luciferase NCRM-1 / XCL-1 line. In this line, the CMV nanoluciferase Halotag (CMV-NLHT) construct was inserted into the safe harbor AAVS1 site of chromosome 19q via transcription activator-like effector nucleases (TALENs). Figure 20 a). We will use luciferase activity as a rapid surrogate readout of CMV-NLHT cell number. Using this approach, we will collect time course data to determine the toxicity of long-term drug exposure. If RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) demonstrate toxic levels resulting in a loss of luciferase signal ≥ 10%, this will be assessed by CellTox. TM Green toxicity test to confirm.
[0234] To evaluate the neuronal differentiation-promoting effects of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159), we will use a second engineered NCRM-1 / XCL-1 line. In this cell line, the Nanoluciferase Halotag (NLHT) was knocked into the MAP2 transcription start site (TSS) (chromosome 2) using zinc finger nucleases (ZFNs) ( Figure 20 b) MAP2 expression increases with neuronal differentiation in NCRM-1 / XCL-1 cultures 127 , which was replicated by increasing luciferase activity in MAP2-NHLT culture medium ( Figure 20 c). We will use luciferase activity in the culture medium as a surrogate readout of MAP2-NLHT neural differentiation and collect time course data to track the differentiation effects of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) in real time. This approach will allow us to quickly compare neural differentiation rates in cultures treated with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) or a control peptide. Cell fate marker genes will be expressed in two contemporaneous groups. 121Positive neural differentiation effects were independently verified by qRT-PCR expression screening of NSPCs and pluripotency marker genes LIN28A, RPS27L, IFITM2, IGFBP3, and ANXA1 in a cohort of patients. Luciferase activity and qRT-PCR values are reported as mean ± standard error of the mean (SEM). Statistically significant effects of drug on neuronal differentiation rates were determined using one-way analysis of variance (ANOVA) followed by Tukey's multiple comparison test.
[0235] Predicted outcomes and alternative strategies: We predict that administration of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) to human NSPCs will accelerate neuronal differentiation as measured by increased MAP2 luciferase activity, decreased expression of NSPC / pluripotent markers and increased expression of neuronal markers compared to vehicle controls.
[0236] If RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) affect the spatiotemporal expression profile of NCRM-1 / XCLs markers, data collection at alternate time points may be necessary. If the luciferase screen lacks the sensitivity to assess the pro-differentiation effects of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) , qRT-PCR data can be used to assess neural differentiation.
[0237] Materials and methods
[0238] Plasmid: CMV Nanoluciferase Halotag (CMV-NLHT) can be purchased from Promaga.
[0239] Cell lines and cell culture: NCRM-1 / XCL-1 iPS cells were derived from CD34+ human umbilical cord blood cells by exosome plasmid reprogramming as previously described. 121 and by the embryoid body (EB) method 122 Differentiation into neural stem progenitor cells (NSPCs) and neurons 123 By transcription activator-like effector nucleases (TALENs) as previously described by Papapetrou et al., 2016 128The CMV Nanoluciferase Halotag (CMV-NLHT) construct was inserted into the safe harbor AAVS1 site on chromosome 19q (NCRM-1 / XCL-1 cell line). The method of knocking in the Nanoluciferase Halotag (NLHT) into the MAP2 transcription start site (TSS) (chromosome 2) of the NCRM-1 / XCL-1 cell line using zinc finger nucleases (ZFNs) has been previously described. 127 .
[0240] Luciferase assay: The method for determining CMV-NLHT cell number and neural differentiation (MAP2-NLHT) has been previously described by Fritz et al., 2017 129 .
[0241] qRT-PCR screening: The qRT-PCR method for screening cell fate marker genes has been described by Chou et al., 2011 121 .
[0242] Method 2: Differentiation of induced pluripotent stem cells (neural stem cells (NSC)-NL5) 7 days after RPP administration ( Figure 11 (SEQ ID NO: 5-11, 3 μM); Figure 12 (SEQ ID NO: 9, 1 μM) Figure 13 (SEQ ID NO: 13( Figure 27 ), 1 μM), using the following "Neuron to Blank" protocol:
[0243] 1. A 24-well culture plate (black Visiplate) was coated with Matrigel (12 mL / well, 37°C for 30 minutes).
[0244] 2. NSCs-NLS (see culture medium below) at 0.5×10 per well 5 Carry out planking.
[0245] Components Final concentration quantity DMEM / 12 medium 1X 97mL N2(100x) 1X 1mL B27 added 2% 2mL bFGF (prepared as 100 μg / mL stock solution) 10 ng / mL 10 μL
[0246] 3. After 24 hours (cells should be >70% confluent), the culture medium was replaced with neuronal differentiation medium (below), and different concentrations of test peptides or water control ( Figure 11 、 12 and 13, Table 14). Neuronal differentiation medium containing new test peptides and controls was replaced every 2 days for 5 days.
[0247]
[0248]
[0249] 4. On day 7, cells were fixed with 4% formaldehyde in 1× PBS for 30 minutes.
[0250] 5. Immunolabel the cells with mouse anti-TUJ1 (1:1000) and rabbit anti-Map2 (1:500) overnight, followed by labeling with secondary antibodies (anti-mouse 488, anti-rabbit 568, and DAPi) for 1 hour.
[0251] 6. Collect data on a BioTek plate reader
[0252] a. Dapi: excitation 360 / 40; emission 460 / 20, gain 35;
[0253] b. Alexa 488: Excitation 485 / 20; Emission 528 / 20, Gain 50;
[0254] c. Alexa 568: excitation 560 / 20; emission 620 / 10, gain 75).
[0255] Results: In Figure 11 In the present study, 3 μM of RPP SEQ ID NOs: 5 to 11 increased (1.7 to 2.7 fold) the differentiation of NSC-NL5 after 7 days by normalizing MAP2 (mature neuronal marker) expression to DAPI (nuclei) and comparing to the control group. Figure 12 In the assay, 1 μM of RPP SEQ ID NO: 9 increased NSC-NL5 differentiation by approximately 35% after 7 days compared to the control group, as measured by TUJ1 and MAP2 neuronal markers (normalized to DAPI (nuclei)). Figure 13 In the 7-day study, 0.1 and 1 μM of RPP SEQ ID NO: 13 increased the differentiation of NSC-NL5 cells, as measured by TUJ1 (60% and 3-fold increase, respectively) and MAP2 (27% and 2-fold increase, respectively) neuronal markers (normalized to DAPI (nuclei) and relative to controls). This screen was used based on the fact that ablation of REST in neural progenitor cells has been shown to induce neuronal differentiation. 22 , is the readout of overall neuronal gene expression.
[0256] Example 12 - RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) can be used to improve motor and cognitive function after traumatic brain injury.
[0257] Methods: We will determine whether treatment with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) alters neuronal survival and the amount of neurogenesis in a rat model of TBI. We will correlate these indicators with histopathological and functional recovery outcomes to determine the effectiveness of REST peptides after TBI. We have shown that REST mRNA increases around lesions after injury ( Figure 19 We will use the well-characterized controlled cortical impact injury (CCI) rat model. 6,130-134 .
[0258] Male and female Sprague-Dawley rats (approximately 250-300 g males, 150-200 g females) will undergo unilateral CCI of the right parietal cortex (5 mm diameter, 4 m / s velocity, 2 mm depth). Sham-operated animals will undergo the same procedure without any effects. Six hours after CCI, rats will have a cannula implanted in their right ventricle, which will be connected to an osmotic minipump for intracerebroventricular catheter (ICV) delivery of control or RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) (0.17 μg / h). Six hours is a realistic initial treatment window with translational relevance for determining the efficacy of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) until sacrifice. Rats will be sacrificed at two different time points – the first at 3 days p.i. to examine the acute effects of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) on neuronal death and proliferation, and the second at 30 days p.i. to determine the effects of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) on functional and morphological recovery and neurogenesis. For each cohort, there will be 12 sets of peptide 3 (control peptide, two doses of RPP (SEQ ID NOs: 1 and 15 to 17) fused to CPP (SEQ ID NOs: 118 to 137 and 159 to 143)) or RPPv (SEQ ID NOs: 18 to 117)) × 2 (sham, CCI) × 2 (male / female) design. Male and female rats will be run on different days to determine any sex-specific differences in trauma, behavior or response to RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159). Rats will be injected intraperitoneally with BrdU (50 mg / kg) daily for the first week to determine the fate of proliferating and mature cells (first cohort - daily injections 1-3 dpi, sacrificed 2 hours after the last injection; second cohort - daily 1-7 dpi). Our previous experience has shown that we need 16 rats / group to obtain important behavioral data (second cohort) and 8 rats / group for immunohistochemistry (first cohort).
[0259] In a second cohort, to determine the functional consequences of treatment with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) compared to controls, we will examine motor and cognitive behaviors at different time points after CCI or sham injury. Rats will be trained before injury to obtain baseline readings of motor function in the beamwalk, rotorod, and open field tests. Rats will be tested for recovery of motor function in the beamwalk and rotorod tests at 1, 3, 7, and 10 days post-injury (dpi). The open field test will be performed at 4, 12, and 22 dpi. Recognition memory will be assessed using a novel object recognition test performed at 20 dpi. Data will be analyzed by repeated measures two-way ANOVA with Dunnets post hoc correction. Spatial memory and learning will be tested by the Morris water maze (MWM), starting at 25 dpi. Swimming speed and latency to find the hidden platform will be recorded for all trials. A probe test conducted on the fifth day of training will determine the time the rat spends in the quadrant that previously contained the hidden platform. Each rat will also be tested with a visible platform to ensure that differences in vision between animals are minimal. A two-way ANOVA with Tukey's multiple comparison correction will determine whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) significantly alter cognitive function in the MWM of sham-operated or injured rats compared to control peptides. 135 .
[0260] After functional assessment, eight rats per group will be sacrificed via cardiac perfusion, and brains will be harvested for processing. Lesion size at 3 and 30 dpi will be determined by cresyl violet-stained sections and measurement of 12 sections of the lesion at 500 μm intervals. Lesion volume will be expressed as a percentage of the ipsilateral hemisphere volume. Serial coronal brain sections through the frontoparietal cortex and dorsal hippocampus, including the subventricular zone (SVZ) and dentate gyrus (DG), will be examined. Stereology will be used to count the total number of BrdU-positive cells (detected with anti-BrdU) in different hippocampal regions and the SVZ to determine whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) alter the survival of newly proliferating cells after injury. Sections will be co-stained with various cell-specific markers to determine the identity of proliferating cells at 3 dpi and their maturation fate at 30 dpi. Cell-specific markers include NeuN (mature neurons), SOX2 (neural stem cells), doublecortin (DCX) (neuronal progenitor cells), GFAP or ALDH1L1 (astroglia), Iba1 (microglia), NG2 (oligodendrocyte precursor cells, OPCs), and APC or GSTpi (mature oligodendrocytes). The number of BrdU / NeuN double-positive cells in the DG and olfactory bulb at 30 dpi will be compared between treatment groups to determine whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) enhance post-injury neurogenesis. We will also determine whether there is migration of BrdU+ neuronal progenitors or mature neurons to different regions of the hippocampus—away from the DG, or from the SVZ toward the lesion area or the rostral migratory stream (RMS). In addition to the neurogenic recess, the total number of each BrdU+ cell type in the perilesional area will be examined. We will determine whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) alter post-injury pathology. Since we anticipate that RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will increase neuronal survival, we will quantify the number of degenerating neurons (Flurojade C) and the number of surviving neurons (NeuN) in the perilesional area at two time points. We will examine the corpus callosum using Luxol fast blue to reveal any differences in the number of myelin sheaths.An unbiased optical fractionator method will be used to count cells in the neurogenesis zone, perilesional zone, rostral migratory stream, and olfactory bulb to obtain accurate cell-specific and proliferating cell counts. All data will be analyzed by two-way ANOVA with Dunnett's post hoc correction. The distribution of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will be examined in sections by staining with FLAG antiserum. The remaining eight rats in each group (second cohort) will be sacrificed and their brains rapidly removed. Brain regions ipsilateral and contralateral to the lesion will be punched and snap-frozen for RNA and protein isolation. REST levels will be measured by Western blotting and BDNF expression in the perilesional or neurogenic fovea by qRT-PCR compared with control rat brains.
[0261] Predicted outcomes and alternative strategies: We anticipate that RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will reduce lesion volume 3 dpi and 30 dpi after CCI by improving neuronal survival. Degenerating and surviving neurons will be examined at two time points to directly assess the effect of treatment with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) on neuronal survival. Early neuroprotection in the perilesional area by RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) may improve motor function within the first week. Although we have previously found that the most neuronal death occurs at 3 dpi after CCI in mice 136We may need to examine different time points in rats. We also anticipate that animals treated with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will show increased neurogenesis compared to control peptides. Our data will indicate whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) lead to an increase in DCX+ precursors in different brain regions at 3 dpi, or an increase in BrdU+ / NeuN+ mature neurons in the hippocampus, olfactory bulb, or perilesional areas at 30 dpi. We will be able to correlate these data with behavioral outcomes to see whether treatment with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) improves performance on the MWM test or the novel object recognition test. 135 In this way, we will be able to determine whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) have any negative effects on inflammation or cell proliferation.
[0262] Materials and methods
[0263] Test system
[0264] species : Male and female Sprague-Dawley rats.
[0265] Age at study entry : Approximately 22 to 29 weeks.
[0266] Weight at the start of the study : Males are about 250 to 300 grams, and females are about 150 to 200 grams.
[0267] Study Design: For each concurrent group (1 and 2), there will be 12 groups of 3 (control peptide, two doses of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159)) x 2 (sham, CCI) x 2 (male / female) in a design. In concurrent group 1 (immunohistochemistry), there will be 8 rats / group and in concurrent group 2 (behavior), there will be 16 rats / group.
[0268] Reasonable dose levels: The high dose would be the maximum feasible dose (approximately 0.17 g / h), and the low dose would be the estimated effective dose based on cerebrospinal fluid (CSF) drug levels, which is approximately the effective dose determined in Example 13.
[0269] Route of Administration: A cannula implanted in the right ventricle is connected to an osmotic minipump for intraventricular catheter (ICV) delivery.
[0270] Frequency of administration: Continuous infusion until sacrifice.
[0271] Dosage cycle: Group 1: 3 dpi; Group 2: 30 dpi.
[0272] Environmental conditions: 2 rats / cage, free access to food and water.
[0273] Test article identifier: RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptide fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159)
[0274] purity : ≥95%
[0275] Preparation of dosage formulations : Bulk every 4 days.
[0276] Dosage Formulation Testing and Stability : The stability and concentration of the dose formulation will be evaluated on Days 1 and 7 of the first week of the study. The acceptable concentration range is ±10% of the nominal concentration.
[0277] Controlled Cortical Impact (CCI) Model: The CCI model has been described previously. 6,130-134 Administration of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) or control (solvent only) will begin 6 hours after CCI.
[0278] Immunohistochemistry: These methods are described by Xiong, Y et al., 2007 and 2008 135-137 .
[0279] Morris water maze: These methods were previously described by Choi et al., 2006 138 .
[0280] Example 13 - RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) can be used to improve regeneration after peripheral nerve injury.
[0281] Methods: Functional recovery after peripheral nerve injury (PNI) requires trophic factors (NTFs), and their presence or absence is a biomarker of the strength of the regenerative response. 139,140 Several NTF genes, including brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), pleitrophin (PTN), and neurotrophin-3 (NTF-3), are known to be repressed by injury-induced REST expression, and we have shown that RPP (SEQ ID NO: 2) can reverse this transcriptional repression, at least in the case of BDNF and NGF ( Figure 7 、 9 , 10, and 16) 141-142 .
[0282] 1) Real-time quantitative reverse transcription PCR (qRT-PCR) analysis showed that injection of 1 μM linear (SEQ ID NO: 4) or circular (SEQ ID NO: 2) RPP into NBFL cells 16 or 48 hours later increased the expression of BDNF and NGF mRNA ( Figure 9 A and B and the table below).
[0283]
[0284] 2) After 48 hours, RPP (SEQ ID NO: 9, 3 μM) increased the NTFs BDNF and NGF by approximately 2-fold and 3-fold, respectively, compared to the water control. This finding confirms that RPP is active in MPCs ( Figure 10 MPCs were cultured in universal medium as described by Geravasi et al., 2020. 76 .
[0285] 3) We quantified the effects of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) on the expression of NGF, BDNF, PTN, and NTF-3 in mesenchymal progenitor cells (MPCs) isolated from male and female musculoskeletal trauma patients. MPCs are present at sites of peripheral nerve injury and have been extensively characterized. 143 MPC will be harvested during normal and pre-planned surgical procedures using a standard isolation protocol developed by Dr. Leon Nesti. 116,143MPCs from three different subjects will be expanded in culture. First, we will passage the cells four times without neuronal induction to establish a baseline for REST and NTF transcript and protein expression by qRT-PCR and Western blotting (WB). Next, we will repeat the neuronal induction expansion described by Bulken Hoover et al. 144 In brief, MPCs were cultured in pre-induction medium for 2 days, then supplemented with all-trans retinoic acid (RA) for 1 day, and then cultured in neural induction medium for 7 days. The neural induction medium was changed every three days. REST and NTF levels were assessed on day 7 after induction. We expected that neuronal induction should result in a decrease in REST expression and a corresponding increase in NTFs expression.
[0286] To evaluate the efficacy of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 159 to 143) in inducing NTF expression in MPCs, we first needed to determine the dose by evaluating the cytotoxicity of RPP (SEQ ID NOs: 118 to 137 and 140 to 159) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159). Briefly, MPCs will be plated for 1 day in modified pre-induction medium with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) replacing RA or in pre-induction medium (containing RA) at four dose levels (up to 10 μM). Each dosing group will have three technical and three biological replicates, and cytotoxicity will be determined using the MTT assay. 145To determine the optimal concentration of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) to reduce REST levels and increase NTF levels, we will perform a dose response (3 dose levels) in neural induction medium with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) replacing RA at 1, 3, and 6 days post-treatment (dpt). The dose of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will be based on the results of the MTT assay. 145 Our negative and positive controls will be neural induction medium or +RA, respectively. We will quantify the gene expression and protein levels of REST and NTFs using qRT-PCR and WB. 139,146 . Cells will be harvested at 1, 4, and 7 dpt, and RNA and protein will be isolated from cell lysates. Two-way ANOVA analysis followed by Tukey's post hoc test will be performed to compare the - and + control groups with the RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptide-administered groups fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) at the indicated time points. Overall means will be reported as mean ± SD, with a p-value of 0.05 or less considered statistically significant. Statistical analyses will be performed using the SAS statistical software package (SAS Institute, Cary NC).
[0287] 4) The potential of RPP (SEQ ID NO: 12) to induce BDNF and NGF expression was evaluated at 0, 0.3, 1, 3, and 10 μM in in vitro cultures of whole DRG neurons (L5, from male SD rats). Figure 16 RPP increased BDNF expression by approximately 25% at 0.3, 1, and 3 μM and by 75% at 10 μM. RPP increased NGF expression by approximately 50% and 2-fold at 3 and 10 μM, respectively. Figure 15 No effect was observed at 1 μM, and the effect at 0.3 μM was uncertain due to n=1 ( Figure 16 ).
[0288] 5) RPP (SEQ ID NO: 12) was evaluated in an LDH cytotoxicity assay performed on cultured whole DRG neurons (L5, from male SD rats). RPP showed no toxicity at 0, 1, 3, or 10 μM ( Figure 17 As expected, the positive control (2% triton) was neurotoxic, increasing by 90,000 RLU.
[0289] 6) We will evaluate the ability of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) to induce NTF expression and stimulate regeneration in ex vivo models of motor and sensory nerves using spinal cord and isolated dorsal root ganglion (DRG) explants, respectively. 147 These two models are widely used to study the neuroprotective and trophic properties of growth factors. 148 A 10 mm segment of intact DRG was extracted from both sides of the spine (L4-L6) (6 rats) and cultured ( Figure 21 and 22 ) 149,150 The remaining spinal material will be saved and used for spinal cord slice culture with motor neuron connections. These spinal cords will be sliced transversely at 300 μm intervals using a microtome. The slices will be transferred to culture inserts with semipermeable membranes and acclimatized under culture conditions for one week. 149,150 Inserts of one-week-old organotypic spinal cord slice cultures (with a stable population of surviving motor neurons) were transferred to 6-well plates and cultured for an additional 7 days.
[0290] Both ex vivo explant cultures will be maintained in neurobasal / B27 medium for 2 weeks to allow for extensive extension of neuronal processes. 147 To induce physical injury, a scratch wound was made with a glass Pasteur pipette on fine neuronal processes at the gray-white matter junction of ventral spinal cord sections, 6 mm from the circumference of the DRG ganglion. In vitro cultures were treated with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) (0, 1, 3, or 10 μM) starting 24 hours after injury.
[0291] The ability of damaged neurites (motor and sensory) to regenerate will be determined by monitoring cell viability and measuring axonal outgrowth. Cell viability will be assessed at 7 dpt by labeling live and dead cells with calcein AM and ethidium bromide dimer 1, respectively. Neurite extension, an indicator of neuronal regeneration, will be measured at 1, 4, and 7 dpt. Grayscale micrographs of the scratched area will be acquired using a Zeiss AxioObserver microscope connected to a monochrome digital camera. 151 The number, length, and total area of regenerated sprouts within the scratch area will be analyzed using ImageJ 152 .
[0292] NGF exerts most of its functional activity through its receptor, the TrkA receptor in DRG 153 , PTN induces increased axonal growth primarily in motor neurons 150-154 BDNF and NTF-3 are present in motor neurons and sensory neurons. We will quantify the gene expression and protein levels of NTF using qRT-PCR and Western blotting. 139,146 . Tissues of each ex vivo system were collected at 1, 4, and 7 dpi, and RNA and protein lysates were isolated. Two-way ANOVA analysis followed by Tukey's post hoc test will be performed to compare the control group and the RPP (SEQ ID NO: 1 and 15 to 17) or RPPv (SEQ ID NO: 18 to 117) peptide fused to CPP (SEQ ID NO: 118 to 137 and 140 to 159) administration groups at the designated time points. Overall means will be reported as mean ± standard deviation, with a p value of 0.05 or less being statistically significant. Statistical analyses will be performed using SAS software (SAS Institute, Cary NC).
[0293] 7) The ability of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) to improve regeneration and functional recovery following sciatic nerve defect in 100 rats will be evaluated. We have demonstrated that 48 hours after injection of RPP at the site of sciatic nerve injury, RPP accumulates in the nuclei of spinal sciatic nerve neurons ( Figure 4). RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will be administered intravenously (IV), which will allow us to test a higher maximum feasible dose (MFD) than intramuscular (IM) or subcutaneous (SC) administration. Intravenous administration also avoids the first-pass metabolism associated with oral and intraperitoneal (IP) injections. The dose concentrations for the regeneration and functional recovery studies will be based on the results of a one-month single IV dose range-finding toxicity and toxicokinetic study in Sprague-Dawley rats. Dose-ranging toxicity studies will be initiated after completion of 1). Briefly, the study will use four dose levels, up to 1000 mg / kg or maximum tolerated dose or MFD, as recommended by FDA guidance (M3(R2), 2009). The number of animals allocated to each group is as follows: Main study: 10 animals / sex / group; TK: 3 animals / sex / control group and 9 animals / sex / dosing group. Animals will be assessed for body weight, food consumption, clinical chemistry, hematology, urinalysis, organ weights, histopathology (8 core tissues), and toxicokinetics.
[0294] Sprague Dawley rats will be treated with chronic intravenous catheters weekly for regeneration and functional recovery studies 155 , RPP (SEQ ID NO: 1 and 15 to 17) or RPPv (SEQ ID NO: 18 to 117) peptides fused to CPP (SEQ ID NO: 118 to 137 and 140 to 159) were intravenously injected, and three treatment groups (TBD) plus a control group (10 animals / sex / group) were treated for 6 weeks. All animals were anesthetized before exposing the sciatic nerve. 156 After the nerve stump is retracted, a 0.7 cm segment is removed to create a segmental defect of approximately 1 cm. 157 . The nerve will be repaired using a decellularized nerve graft. The surgical incision will then be closed and the nerve allowed to regenerate for 6 weeks. Only the treatment group will be administered RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159). Over a 6-week period, we will assess functional recovery and dose tolerance of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159). Rats will be weighed, their temperature recorded, and a toe extension reflex test performed weekly (to determine the maximum footprint width of the injured leg, a test of motor nerve function) 156 Gait analysis (Digigait) will be performed every 2 weeks and electrophysiological studies will be performed158 . Briefly, electrophysiological testing will be performed on the rat sciatic nerve. Electrical stimulation will be applied to the native sciatic nerve trunk 5 mm proximal to the graft suture site using a single pulse electric shock (1 mA, 0.1 ms). The compound muscle action potential (CMAP) of the gastrocnemius belly will be recorded from 1 V to 12 V, or until a supramaximal CMAP is reached. The normal CMAP of the unoperated contralateral sciatic nerve will also be recorded for comparison. The recovery rate will be determined by the ratio of the CMAP of the injured hindlimb to the CMAP of the contralateral normal hindlimb 159,160 .
[0295] At the end of the 6th week, the sciatic nerve, ventral horn (VH) of the spinal cord, and DRGs associated with the L4 to L6 nerve roots will be harvested. 161,162 Nerve regeneration will be assessed histologically. The proximal, distal, and central ends of the grafts will be prepared for transmission electron microscopy (TEM) through cross-sections to assess myelination along the graft. 163,164 Briefly, ultrathin sections of approximately 70 nm were cut from the nerve using an ultramicrotome and stained with uranyl acetate and lead citrate. 10–15 fields were selected from random sections for analysis to quantify the number and size of myelinated fibers. Mean fiber density was calculated as previously described. 73 In addition to TEM, additional sections from the same nerve will be prepared for IHC visualization of β-tubulin III to determine direct axonal outgrowth, S100 to determine Schwann cell infiltration and outgrowth of the graft, von Willebrand factor to assess angiogenesis and capillary infiltration of the healing nerve, and Luxol blue staining. 165,166 Myelination within the grafts will be determined. Changes in the ventral horn and DRG associated with damaged motor and sensory nerve cells fused to RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will be assessed. Images of stained tissue will be taken using a light microscope, and the intensity and area proportion of positive reactions in anatomically matched tissue will be quantified using ImageJ software (https: / / imagej.nih.gov / ij), and nerve regeneration rates will be compared between groups. 165 The DRG neurons in the injured nerve were counted as described previously and compared with the contralateral uninjured DRG. 167 NTFs (BDNF, NGF, PTN, and NTF-3), CTDSP1, and REST will be examined by qPCR and WB.
[0296] Predicted outcomes and alternative strategies: We predict that mesenchymal progenitor cells (MPCs) treated with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) plus neural induction medium (-retinoic acid, RA) will increase neurotrophic factor (NTF) expression and decrease REST levels compared to neural induction medium RA, but similar to neural induction medium + RA. We predict that in vitro models treated with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will show increased neurite outgrowth due to decreased REST levels compared to untreated groups. In the absence of supporting cells, the regenerative effects of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) may not be significant. Supporting cells can secrete neurotrophic factors in vivo after neuronal injury. Another experiment will involve co-culturing neural supporting cells (such as Schwann cells and mesenchymal stem cells) with dorsal root ganglia (DRG) and spinal cord explants (rich in motor and sensory neurons) before injury and subsequent treatment with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159). Next, we will analyze the ability of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) to promote regeneration of severed nerves in a rat model. We anticipate that rats treated with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will demonstrate improved recovery compared to control rats, as determined by histological, electrophysiological, and functional assessments. We also anticipate that RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will increase NTF expression and decrease REST protein levels.If we do not observe signs of recovery and relief of REST blockade, we will increase the local concentration of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) by direct injection into the target site (i.e., graft site or intrathecally).
[0297] Materials and methods
[0298] Cell culture: The acquisition, culture, and neurotrophic induction of MPCs have been described previously. 168 In brief, MPCs were cultured in pre-induction medium for 2 days, then supplemented with all-trans retinoic acid (RA) for 1 day, and then cultured in neural induction medium for 7 days. The neural induction medium was changed every three days. On day 7 after induction, REST and NTF levels were assessed.
[0299] qRT-PCR: Method described in Example 10.
[0300] Western blot analysis: according to Ballas et al. 2001 119 Whole cell lysates were prepared using the standard procedure described in
[15] . Western blotting was performed using anti-REST-C. 64 , anti-NTF (using commercially available antibodies), anti-GAPDH (abcam), and anti-IgG conjugated to infrared dye (Thermo Fisher), and analyzed on an Odyssey Infrared Fluorescence Imager (LiCor).
[0301] Test product identification: RPP (SEQ ID NO: 1 and 15 to 17) or RPPv (SEQ ID NO: 18 to 117) peptide fused to CPP (SEQ ID NO: 118 to 137 and 140 to 159), purity ≥ 95%
[0302] Preparation of dosage formulations : One batch every 4 days.
[0303] Dosage Formulation and Stability : The stability and concentration of the dose formulation will be evaluated on Days 1 and 7 of the first week of the study. The acceptable concentration range is ±10% of the nominal concentration.
[0304] Vertebrates: Male and female adult Sprague-Dawley rats (approximately 250-300 g males, 150-200 g females) will be used to determine the efficacy of RPP (SEQ ID NOs: 1 and 15-17) or RPPv (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159) in improving recovery from PNI. This study will require 100 rats, 8-11 weeks old. Rats will be obtained from Charles River Laboratories.
[0305] Steps:
[0306] Surgery: Before all operations, rats were anesthetized with isoflurane (4% induction, 3% maintenance). 2) Organotypic spinal cord cultures will be prepared from the lumbar spinal cord of rats (Sprague-Dawley) on day 8 after birth using the aforementioned technology (Rothstein et al., 1993; Corse et al., 1999). In short, rats will be quickly killed, the lumbar spinal cord removed, and placed in a Gey balanced salt solution (Gibco) containing glucose (6.4 mg / L). In a laminar flow hood using aseptic technique, the meninges were carefully removed under a magnifying glass, and the lumbar spinal nerve roots were cut off. The spinal cord (cord) was placed on an Aclar membrane and sliced at intervals of 300 μm from L2 to L5 with a McIlwain tissue cutter. Gey's balanced salt / glucose solution will be used, and single spinal cord slices will be carefully transferred to a Millicell CM (microporous) permeable membrane in a 6-well culture plate. Five segments of wire will be placed on each membrane. Each well contains 1 mL of culture medium consisting of 50% minimum essential medium plus 25 mM Hepes; 25% Hanks' balanced salt solution containing D-glucose (25.6 mg / L); 25% heat-inactivated horse serum; and 2 mM L-glutamine. Cultures will be maintained in a humidified incubator at 37°C and 5% CO2 for one week, with medium changes every three days. After one week, slices will be transferred to another 6-well culture plate and allowed to stabilize and extend neurites in culture for seven days before any treatment.
[0307] In 3) we will expose the sciatic nerve 117 ( Figure 21 and 22) and remove a 0.7 cm section to create a segmental defect of approximately 1 cm after the nerve stump is retracted (Hems and Glasby, 1993). The nerve will be repaired using an acellular nerve graft. The surgical incision will then be closed and the nerve will be allowed to regenerate for 6 weeks. The first group (control group) will undergo a sciatic nerve resection of approximately 1 cm and a 1 cm acellular allograft will be transplanted. Groups 2 to 5 will undergo a 1 cm sciatic nerve resection, a 1 cm acellular allograft transplant, and weekly intravenous injections of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) at drug concentrations determined by dose ranging. All animals will be sacrificed at week 6.
[0308] Behavioral assessment Animals will be monitored for up to 6 weeks to assess functional recovery and tolerance to peptide treatment. Rats will be weighed, their temperature recorded, and a toe extension reflex test (to determine the maximum footprint width in the injured leg to test motor nerve function) will be performed weekly. 117 Gait analysis will be performed every 2 weeks, and electrophysiological examination will be performed before sacrifice at 6 weeks.
[0309] Electrophysiological assessment : Electrophysiological testing will be performed as before 158 . Briefly, the rat sciatic nerve was re-exposed, and electrical stimulation (single pulse electric shock, 1 mA, 0.1 ms) was applied to the native sciatic nerve trunk 5 mm near the graft suture point. CMAP was recorded from 1 V to 12 V in the gastrocnemius muscle belly, or until supramaximal CMAP was reached. The normal CMAP of the unoperated contralateral sciatic nerve was also recorded for comparison. A Grass Tech S88X stimulator (Astro Med Inc.) was used for testing, and PolyVIWE16 data acquisition software (Astro Med, Inc.) was used for recording. The recovery rate is the ratio of the CMAP of the injured hind limb of the rat to the CMAP of the contralateral normal hind limb 158 .
[0310] execution Rats will be sacrificed 6 weeks after injury. Following sacrifice, axonal growth through the graft, remyelination, MPC activity at the injury site, anterior horn cell and DRG activity, and vascularization of the regenerated nerve will be assessed histologically. Gastrocnemius and tibialis anterior muscles will be harvested from each rat after sacrifice to assess total weight and quantify atrophy.
[0311] Reasonable explanationFollowing percutaneous nitric oxide synthase (PNI), complex interactions occur among all cells and molecules within the vasculature, immune system, and peripheral nervous system. The order or interplay between different cells, signaling molecules, cell-cell interactions, and circuits following traumatic injury is not fully understood, and therefore cannot currently be modeled in vitro. Furthermore, RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) may affect neural progenitor cells, adult neurons, and other cell types, making their in vivo evaluation in the context of PNI crucial. The FDA also requires in vivo demonstration of efficacy before granting IND status for a biologic, further justifying the in vivo nature of these experiments. Rats were used because of the extensive behavioral studies conducted after PNI demonstrated its reliability in these types of experiments. Therefore, a substantial literature exists that provides a detailed framework for experimental design and execution. Rats are more intelligent and larger than mice, enabling better discrimination of changes in functional recovery following injury. Compared to mice, rat physiology has more similarities to humans, making the experimental data more translationally relevant. In addition, the REST pathway we targeted is conserved in rats.
[0312] Minimize pain and suffering Rats will be anesthetized with isoflurane (3-4%) for segmental peripheral nerve defects. Following surgery, animals will be allowed to recover on a heating pad until ambulatory. Rats will be given acetaminophen (6 mg / mL in drinking water) for 2 days after surgery and additionally if signs of pain or distress are observed. Rats will be observed daily by laboratory and veterinary staff, and animals deemed distressed will be treated or euthanized based on veterinary advice.
[0313] Euthanasia : The euthanasia used was in accordance with the recommendations of the American Veterinary Medical Association Guidelines for Animal Euthanasia.
[0314] Example 14 - RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) can be used to prevent and treat chronic pain.
[0315] Completed Assessments:
[0316] Activation of REST after nerve injury leads to reduced expression of several genes required for normal excitability of sensory neurons, including the potassium channels Kv4.3 (Kcnd3) and Kv7.2 (Kcnq2), the sodium channel Nav1.8 (Scn10a), and the μ-opioid receptor Oprm1. 60,72-74Blocking REST to alleviate chronic pain is based on published research using mouse and rat models of peripheral nerve injury (PNI). 60,72-74 .
[0317] 1) Real-time quantitative reverse transcription PCR (qRT-PCR) analysis showed that injection of 1 μM linear (SEQ ID NO: 4) or circular (SEQ ID NO: 2) RPP into NBFL cells for 16 or 48 hours resulted in increased Kv4.3 mRNA expression (Figure 2). Figure 9 C and Table 16).
[0318]
[0319] 4) RPP (SEQ ID NO: 12; 0 (water), 1, 3, or 10 μM) was incubated in vitro for 48 hours in whole DRG (L5, from male SD rats) cultures and its potential to induce the expression of chronic pain-related genes Kv4.3, KV7.2, Nav1.8, and OPRM1 was evaluated ( Figure 14 At 10 μM, RPP increased Kv4.3 expression by 2-fold compared to the control group; at 3 μM and 10 μM, it increased KV7.2 expression by 7.5-fold and 9-fold, respectively; at 3 μM and 10 μM, it increased NaV1.8 expression by 2.9-fold and 4.8-fold, respectively; at 3 μM and 10 μM, it increased OPRM1 expression by 1.5-fold and 2.8-fold, respectively. Figure 14 ). In ex vivo cultures of whole DRG (L5, from male SD rats), RPP SEQ ID NOs: 13 and 14 were evaluated after a 48-hour dosing period at 3 μM and NaV1.8 was evaluated. Sequences 13 and 14 increased NaV1.8 expression by 6-fold and 13-fold, respectively, compared to the control group ( Figure 15 ).
[0320] 5) RPP (SEQ ID NO: 12) showed no neurotoxicity in the LDH assay performed on whole DRG neurons (L5, from male SD rats) cultured in vitro. RPP did not increase the RLU level compared to the control group. As expected, the positive control group (2% ) increased by 90,000 times ( Figure 17 ).
[0321] Program Evaluation :
[0322] Objective 1: Determine the pharmacokinetics, distribution, and dosing of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159)
[0323] Sub-objective 1.1: Development and validation of a liquid chromatography-tandem mass spectrometry (LC-MS / MS) method for the detection of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) in rat and monkey plasma, cerebrospinal fluid, and tissues (ranging from 10 to 10,000 ng / mL).
[0324] Sub-objective 1.2: To determine the route of administration for in vivo animal studies and clinical trials, an exploratory pharmacokinetic (PK) study will be conducted in Sprague-Dawley rats. Following intravenous, subcutaneous, or postoperative injection of 1000 mg / kg RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117), plasma samples will be collected at 5 minutes, 30 minutes, 4 hours, 8 hours, 24 hours, and 48 hours (two sexes / time points) to assess peak drug concentration (Cmax), area under the curve (AUC), and half-life (t1 / 2). To assess the central and peripheral nervous system penetration of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPPs (SEQ ID NOs: 118 to 137 and 140 to 159), target tissues (CSF, brain, lumbar spinal cord, and dorsal root ganglia (DRG)) will also be collected upon euthanasia and drug concentrations will be determined. RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will be detected using a validated LS-MS / MS method (Subgoal 1.1).
[0325] Sub-goal 1.3: To determine the dose in the rat efficacy study (Goal 2), a single dose range determination will be performed on SD rats using the optimal route of administration determined in Sub-goal 1.1. Based on the PK data in Sub-goal 1.1, four dose levels + solvent control (3 / sex / group) will be selected. The high dose (HD) should determine the limiting dose (maximum feasible dose (MFD)), maximum tolerated dose (MTD) and / or exposure saturation). Lower doses will be spaced in 1 / 3 increments. Animal survival and clinical symptoms (abnormalities and symptoms of pain or distress) will be assessed daily. Blood will be collected at 6 time points after dosing, which are selected based on the PK data in Sub-goal 1.1, and C max , AUC and t 1 / 2Tissues that will be evaluated for genetic alterations in efficacy studies (DRG, lumbar spinal cord, brain) will be collected at euthanasia and assessed for concentrations of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159).
[0326] Aim 2: To evaluate the effects of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) on chronic pain.
[0327] We have demonstrated that RPP accumulates in the nuclei of motoneurons in the rat lumbar (L4–L6) spinal cord 48 h after administration at the sciatic nerve transection site ( Figure 4 To evaluate the effects of our drug on pain, we will use the preclinical SNI model of the sciatic nerve. SNI is a well-established animal model of neuropathic pain that produces strong and long-lasting changes in thermal sensitivity, peripheral and central morphine analgesia, and C-fiber hypoesthesia. 60,72,74 Furthermore, as predicted, we observed an increase in CTDSP1 levels ( Figure 18 ).
[0328] The efficacy of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) in reducing chronic pain will be completed in Phase 1, and the durability of pain reduction will be determined in Phase 2. The SNI sciatic nerve rat model will be used to test whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) can reduce chronic neuropathic pain. RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will be administered, or the vehicle or standard of care drug oxycodone for treating neuropathic pain will be administered. Table 17 below summarizes the experimental steps for Phase 1:
[0329] Table 17
[0330]
[0331]
[0332] To achieve this goal, a total of 312 2-month-old SD rats (equal numbers of males and females) are required. A sample size of 12 rats per group will have an 80% power to detect a difference of 1.20 standard deviations in pain assessments. Efficacy analysis is based on an independent sample t-test with a two-sided significance level of 5%. For efficacy studies, rats were randomly assigned to the experimental groups specified in the table on the right (n=12 / group). Ten randomly grouped rats were subjected to stimulation-induced and non-stimulation-induced behavioral tests, morphology, immunohistochemistry analysis, quantitative RT-PCR (qRT-PCR) analysis, and WB analysis. At euthanasia, blood will be drawn at two time points (14 days and 28 days) after the start of dosing, and standard PK parameters will be evaluated. DRG and brain will be extracted to determine Oprm1, NaV1.8, Kv4.3, and KV7.2 levels. In addition, tissues will be collected for LC-MS / MS analysis to determine rpp concentrations.
[0333] Surgery: SNI or sham surgery (surgery that exposes nerve branches without damaging the nerve) will be performed as previously described. 169 . Briefly, rats were anesthetized and the common peroneal and tibial nerves were ligated. A 2-4 mm segment of each nerve distal to the ligature was cut and removed, leaving the sural nerve, the third branch of the sciatic nerve, intact. The sural nerve developed an enhanced response to noxious and non-noxious stimulation of the ipsilateral innervation area starting 4 days after injury, which was stable at 7 days and maintained for 6 months. 7 days after injury is a recognized time point for the development of chronic neuropathic pain and has translational relevance.
[0334] Drug / Solvent: Administration begins on day 5 after surgery. For RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159), the route, frequency, and drug concentration tested will be based on the PK studies in Specific Aim 1. For oxycodone, the route of administration and effective drug exposure (close to that in humans) in rats (0.56 mg / kg dose of oxycodone and 0.2 mL of solvent) are known. 170 .
[0335] Behavioral Testing: Effects on pain transmission and motor function will be assessed the day before surgery and every other day starting on postoperative day 4. Stimulus-evoked and non-stimulus-evoked behavioral tests will be used to determine the functional effectiveness of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) compared to oxycodone and vehicle. In recent years, interest in the translatability of some stimulus-evoked behavioral tests has led to an increasing use of stimulus-evoked, non-stimulus-evoked, and operant or voluntary behavioral tests. For this proposal, we will use the most widely used and translatable stimulus-evoked behavioral tests: electronic Von Frey and thermal hyperalgesia tests, non-stimulus-evoked gait analysis, and a place escape / avoidance paradigm to measure pain aversive states. 171 Recent studies have shown the value of incorporating gait analysis into animal models to detect subtle improvements and deteriorations. 172 Rat handlers and assessors performing behavioral testing will be randomly assigned to the experimental / control groups. Each animal will be assigned a unique animal number. A confidential color code will be used to designate the control and experimental groups. This code will only be revealed after analysis.
[0336] Stimulus-evoked behavior testing: Hypersensitivity to mechanical stimulation Mechanical withdrawal thresholds will be measured in the left and right hind paws using an electronic Von Frey (Bioseb, Chaville, France), consisting of a handheld force transducer fitted with a plastic tip. The tip of the force transducer will be applied to the medial plantar surface of the paw to test the saphenous nerve and to the lateral plantar surface of the paw to test the sciatic nerve (peroneal nerve).
[0337] Thermal hyperalgesia: Will be determined according to a published method 173 We modified this method to use a laser as a heat source. An 808 nm wavelength laser (2 W output power, beam diameter on the skin = 3 mm) was used as the heat source and applied to the skin at the site of the nerve being tested. The small beam size allowed for specific targeting of the relevant skin corpuscles. For the sciatic and saphenous nerves, the limb withdrawal latency induced by the thermal stimulus was recorded at a cutoff of 10 seconds.
[0338] Non-stimulus-evoked behavioral testing: Gait analysis: Assessment of sciatic motor function using Digigait and Sciatic Index 172Briefly, sciatic nerve function will be measured pre-injury and on days 7, 14, and 28 post-surgery using the Digigait device available in the Rodent Behavioral Core (characterized and optimized in our laboratory). Rats will be placed on a motorized treadmill within the Digigait holder and recorded at a speed of 20 cm / s for all animals. The Sciatic Nerve Index program will be used to analyze the function of the affected hindlimb.
[0339] Conditioned escape / avoidance: This step aims to test the hypothesis that rats will avoid situations associated with mechanical stimulation of the hyperalgesic area. Injured rats have been reported to be sensitive to changes in escape / avoidance behavior following treatment with analgesics (Baastrup et al., 2010). 174 . LaBuda and Fuchs (2000) 171 This study describes a brain-dependent conditioned escape / avoidance test that relies on escape / avoidance learning to a novel aversive environment. Animals will be tested only once, three to five weeks after injury, by the same trained researcher. Testing will be conducted at the USURodent Behavioral Core. Animals will be allowed to acclimate to ambient light and noise conditions in the testing room for at least one hour. In this test, rats have free access to both the "non-aversive" dark side and the "aversive" light side of an enclosure with a mesh floor, easily accessible from below via a Von Frey wire. The injured and uninjured hind paws are routinely stimulated while the rat is in the dark or light area, respectively. Every 15 seconds for 30 minutes, a mechanical stimulus (Von Frey wire) sufficient to elicit a withdrawal response in the injured paw is applied to the lateral plantar surface of one hind paw, depending on the animal's position during this time. Escape / avoidance behavior will be defined as a shift from the dark to the light area. The percentage of time spent on the white side of the box and the number of crossings between the black and white sides will be recorded. The cumulative time spent on the white side and the total number of crossings will serve as indicators of escape / avoidance learning.
[0340] Euthanasia: For morphological and immunohistochemical analyses, rats were anesthetized with ketamine / xylazine (80 to 100 mg / kg + 10 mg / kg, ip, 21-gauge needle) and transcardially perfused with 300 ml of phosphate-buffered saline (pH 7.4), followed by 300 ml of 4% paraformaldehyde in 0.1 M phosphate buffer. After perfusion, nerves, DRGs, and spinal cords were dissected, fixed in 4% paraformaldehyde for 24 hours, and cryopreserved in 30% sucrose for 24 hours. Tissue samples were cut into 10 μm sections using a cryostat (Leica CM3050 S, Leica Biosystems, Wetzlar, Germany).
[0341] Histology: Following euthanasia and nerve sampling, sections will be stained with hematoxylin and eosin. The expression levels and distribution of the remaining target genes, Oprm1, NaV1.8, Kv4.3, and Kv7.2, will be assessed by immunofluorescence.
[0342] Gene expression analysis: For gene expression analysis of the sciatic nerve and its associated DRG and spinal cord segments, REST target genes Oprm1, NaV1.8, Kv4.3, and Kv7.2 and control genes (Hprt, Gapd, Rn18s) will be assessed by qRT-PCR.
[0343] Protein expression analysis: Protein expression analysis of sciatic nerve-associated DRG will be assessed by SDS-PAGE immunoblotting for Oprm1, NaV1.8, Kv4.3, and Kv7.2. GAPDH will be used as a loading control.
[0344] Statistical methods: For behavioral data , results will be expressed as mean ± standard error of the mean (SEM). Two-way analysis of variance will be used to evaluate each group of animals based on the time after treatment. The Bonferroni-Holm method will be used to adjust for multiple comparisons. Two-tailed statistical significance will be determined as P < 0.05. For immunohistochemistry analysis, two-way ANOVA will be used to compare the means of interactions and the effects of group and time. For qRT-PCR, values will be reported as mean ± standard error of the mean (SEM). Statistically significant effects of drugs on gene expression will be determined by one-way analysis of variance (ANOVA) and Tukey's multiple comparison test.
[0345] Table 18 below summarizes the experimental steps for Phase 2:
[0346] Table 18
[0347]
[0348]
[0349] In Phase 2, the durability of pain relief achieved by RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will be examined. In this study, the dose (low, medium, or high) of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) and the dosing period (14 or 28 days) determined to be most effective in Phase 1 will be used. The same methods as described above for the Phase 1 efficacy study will be followed. The difference is that after the administration period (14 or 28 days), the rats will be monitored and behaviorally assessed for pain response and motor function every 30 days. The rats will be euthanized on Day 30. A total of 72 2-month-old SD rats (equal numbers of males and females) are required for this study. A sample size of 12 rats per group would provide 80% power to detect a difference of 1.20 standard deviations in pain assessment. Power analysis was based on an independent-samples t-test with a 5% two-sided significance level. Rats were randomly assigned to the experimental groups specified in the table to the right. Ten randomly assigned rats underwent stimulus-evoked and nonstimulus-evoked behavioral testing, morphological analysis, immunohistochemical analysis, quantitative RT-PCR (qRT-PCR) analysis, and Western blot analysis.
[0350] Objective 3: Toxicology and safety pharmacology evaluation of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159). To support first-in-human dosing, we will follow the recommendations of FDA guidelines M3(R2), S2B, S6(R1), S7A, and S7B. 175-179 Two RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will be evaluated for in vitro cardiotoxicity and genotoxicity, as well as in vivo toxicology, safety pharmacology, and toxicokinetics. In both species, the route of administration will be selected based on the PK evaluation results in Aim 1.
[0351] Sub-Aim 3.1: Single Dose Range-Range Determination in Monkeys: Four dose levels plus vehicle control will be evaluated in 3 monkeys / sex / group. The HD should determine the MTD, MFD, and / or exposure saturation. Lower doses will be spaced in 1 / 3 increments. Blood will be collected at 6 time points (determined based on the PK data collected in Aim 1) and C max , AUC and t 1 / 2Survival and clinical symptoms will be assessed daily.
[0352] Sub-objectives 3.2 and 3.3: Toxicology studies in rats (3.2) and monkeys (3.3). Both species were dosed for 4 weeks to support the same duration of human dosing plus a 6-week recovery period, chosen due to the high stability of RPP observed in cell-based assays. 77 There will be three dose levels + solvent control. The high dose will be the maximum tolerated dose determined in the dose ranging (target 1.2 in rats and target 3.1 in monkeys). The MD will be 1 / 3 lower than the HD based on AUC in the ranging. The LD will be close to the effective dose in the in vivo efficacy studies (target 2). The dosing interval will be t2 of each species with RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159). 1 / 2 . In the rat study, there will be 15 animals / sex / group. 10 animals / sex / group will be sacrificed at the end of the dosing period and 5 animals / sex / solvent will be sacrificed at the end of the recovery period. In addition, 9 animals / sex / rpp group and 3 animals / sex / solvent group will be assigned to the toxicokinetic portion of the study. In the monkey study, toxicology and TK assessments will be performed on all animals (3 animals / sex / group in the main study and 2 animals / sex / group in the recovery period). The following toxicology parameters will be assessed in both species: clinical observations, body weight, food consumption, fundoscopy (ophthalmoscopy and slit lamp examination), and a standard panel of clinical chemistry, organ weights, and histology parameters will be assessed. Monkeys will undergo respiratory assessments (e.g., tidal volume and hemoglobin oxygen saturation) and cardiac electrocardiographic recordings using non-surgical telemetry function measurements. 179 , as recommended by FDA guidance S7A 179 Cardiovascular assessments will be performed twice: before treatment, after the first dose, and at the end of the recovery period (if needed). These recordings will be qualitatively evaluated by an advisory board-certified cardiologist. All waveforms will be qualitatively evaluated to detect rhythm or conduction disturbances, including assessment of PR and QRS intervals. Central nervous system function will be assessed in rats using a modified Irwin functional observation battery (battery). 179,180 Plasma TK will be assessed at 6 time points (determined by the scoping study) (C max , AUC and t 1 / 2 ).
[0353] Sub-goal 3.4: In vitro hERG detection 177. hERG channel inhibition is a common cause of long QT syndrome and is also associated with arrhythmias that can lead to ventricular fibrillation and sudden cardiac death. To test whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) inhibit hERG channel currents, we will perform electrophysiological assessments of hERG channel currents in CHO cells treated with high concentrations of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) (10 μM) or a positive control (cisapride, 0.03 μM). Each cell will serve as its own positive control. Whole-cell recordings will be performed using conventional voltage clamp techniques.
[0354] Sub-goal 3.5: Genotoxicity will be tested in the OECD in vitro Ames and in vitro chromosome aberration assays (S2B, November 1997) 176 RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) were evaluated in order to determine their genotoxic potential.
[0355] Aim 4: Assessment of the abuse potential of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159). Since opioid receptor gene expression is inhibited by REST, RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) may enhance the activity of endogenous opioid receptor ligands such as endorphins. 181,182 Furthermore, recent studies have indeed shown that REST expression is increased in DRG and periaqueductal gray (PAG) in conditions involving pain. 183,184 To determine whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) produce reward-seeking behavior, we will assess their effects in rats using conditioned place preference (CPP), a widely used behavioral assay for testing the rewarding properties of drugs. 185-189CPP is a well-established method that has demonstrated morphine-induced reward-seeking behavior in SNI animal models.
[0356] First, RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) were administered to uninjured rats (Pathway TBD), followed by CPP. To maintain consistency with Aim 2, oxycodone was used instead of morphine as a positive control, and saline was injected into separate rats as a negative control.
[0357] The apparatus consisted of three compartments: two outer compartments designed with different properties (such as white and black walls) and a central compartment with no special properties. Each experiment consisted of three phases. Phase I pilot study (Day 1) After saline administration, rats were placed in the center compartment, and the guillotine door was opened to allow access to the other compartments. Rats were monitored for 15 minutes to determine baseline preference by recording the time spent in each compartment. The average spontaneous preference for each compartment was determined. Rats that spent more than 60% of the trial time in any one compartment were considered to have a preference and were removed from the trial. Phase II Article Reflection formation (Day 2-7) Rats will be injected with solvent or RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) and then randomly assigned / conditioned to receive RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) in one compartment and RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) in the other compartment. The dose of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will be based on the concentration that produces a measurable effect on mechanical and thermal hyperalgesia as determined in Objective 2. Treatment compartments and the order of drug and solvent administration will be counterbalanced across all groups to avoid bias. This phase consisted of six consecutive 30-minute conditioning sessions. A separate group also received oxycodone. Phase III trial (Day 8)Rats will be injected with saline, placed in the center of the CPP box, and monitored for 15 minutes. The difference between the time spent in the drug pair compartment during the post-treatment period and the time spent during the pre-treatment period will be used to assess the extent of positional modulation caused by RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159). 190 .
[0358] Eight groups of 12 injured rats (SNI and sham groups, conditioned with oxycodone, RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159), RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159), and saline) will be evaluated. A sample size of 12 rats per group will provide 80% power to detect a difference of 1.20 standard deviations in pain assessment. Power analysis will be based on independent sample t-tests with a 5% two-sided significance level. Rats will be randomly assigned to experimental groups. Rats will be randomly assigned to SNI or sham surgery. Von Frey tests will be performed one day before, 4 days, and 8 days after injury to monitor pain status. Eight days after injury, CPP testing will be conducted as previously described. Research assistants conducting behavioral testing will be unaware of the experimental / control group to which the rats were randomly assigned. Each animal will be assigned a unique animal number. A confidential color code will be used to designate control and experimental groups. This code will only be revealed after analysis. The animals will be euthanized, and samples will be analyzed as described in Aim 2.
[0359] Predicted outcomes and alternative strategies: We predict that RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will reduce REST levels in damaged neurons and restore proper expression of ion channels required for excitability. At the behavioral level, RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) should restore stimulation- or non-stimulation-evoked behavioral tests in SNI rats to baseline levels. Furthermore, given their mode of action, we do not expect RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) to have addictive properties. However, if the drug administration showed abuse potential, we would confirm this positive result by using a progressive ratio (PR) reinforcement schedule during the administration of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159).
[0360] Example 15 - RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) can be used to prevent recurrence of glioblastoma multiforme (GBM)
[0361] Evaluation of the neurogenesis and anticancer efficacy of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) on brain tumor initiating cells (BTICs) and in vivo. The activity of the test article RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) will be evaluated in primary cultured BTC from 10 patients with grade IV GBM obtained from Mayo Clinic using our established method. 191-193 The cells (0.25×10 4 )Plank on (3.8cm 2TC dish) medium (250 μL) was added to the medium with 5 μL of solvent or 3 dose levels of the test article at the optimal dose range (determined in the neuronal differentiation study described in Example 13) for 0, 2, 4 or 8 days (main study), followed by recovery after 8 days of washing out the test article (recovery period). By WB and RT-PCR, markers of pluripotency (Sox2 and nestin), proliferation (Ki67), cell death (caspase 3) and differentiation (MAP2, neurons and GFAP, glial cells) were monitored on days 0, 2, 4 and 8 during the dosing period (main study) and on days 10, 13 and 16 during the recovery period (3 per TC well / group per day).
[0362] Primary cultured BTC from 10 patients with grade IV GBM will be used in the intracranial xenograft tumorigenesis model previously described by us and others. 191,192,194 Briefly, cells (5 × 10 4 ) were suspended in 5 μL of PBS (control group) or PBS containing one of the test article dose levels of 3TBD (based on the above BTIC neurogenic efficacy assay) and delivered using an automated syringe pump with a lead screw system. 112,195 The injection coordinates are X:1.5; Y:1.34; Z:-3.5, targeting the mouse striatum; a highly reliable tumor implantation site. 196 Using the Kaplan-Meier method 197 Mice were monitored for survival at 4, 8, 16, and 20 weeks, followed by postmortem histopathology to assess tumor size and invasiveness (H&E staining), cell death (TUNEL), and proliferation (anti-human nuclei) (three mice / sex / group for all procedures).
[0363] Statistical Methods: Values will be reported as mean ± standard error of the mean (SEM) or standard deviation (SD) as indicated in the figures. Statistical significance will be determined by applying Student's t-test for parametric or nonparametric changes as appropriate or one-way analysis of variance (ANOVA). Briefly, the ratio of total REST to phosphorylated REST for different controls and candidate drug treatments will be statistically tested using the Kruskal-Wallis test. Differences in marker expression between BTIC control and candidate drug cultures and orthotopic xenografts will be statistically tested using Tukey's multiple comparison test. Differences in tumor size and invasiveness between BTIC-injected mice treated with control or test article will be statistically tested using the Mann-Whitney U test, and differences in survival will be tested using the log-rank test and Cox proportional hazards test. 198 Perform statistical tests.
[0364] Predicted Outcomes: We anticipate that mice receiving BTIC (test article) xenografts will have tumor-free or less aggressive tumors, greater cell death (TUNEL), and less GBM proliferation (anti-human nuclei) compared to controls at each time point. Furthermore, we anticipate that mice injected with test article and BTIC will survive longer than mice injected with BTIC alone.
[0365] Materials and methods
[0366] Test system
[0367] Cells: Primary cultures of brain tumor-initiating cells (BTICs) were obtained from 10 patients with grade IV GBM. Dr. Alfredo Quinones Hinojosa and his research team have previously described methods for extracting and propagating BTICs. 191-193 .
[0368] Species / Strain: Nu / Nu-Harlan Sprague-Dawley mice
[0369] Age: At study start: 6 weeks
[0370] Body weight: At the start of the study: Males: 20-30 g; Females: 18-35 g
[0371] Test sample identification.
[0372] RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159)
[0373] Purity: ≥95% HPLC
[0374] Dosage Formulation and Stability: Batches of RPP (SEQ ID NOs: 1 and 15 to 17) or RPPv (SEQ ID NOs: 18 to 117) peptides fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) and solvent controls will be prepared weekly. Dosage form concentration will be assessed at the beginning of each week. The acceptable concentration range is ±10% of the nominal concentration.
[0375] Solvent: Water
[0376] Study Design
[0377] Study on the neurogenic efficacy of the test article:
[0378] Dosage: 3 test article dose levels + solvent control. The test article dose will be determined based on the results of the neuronal differentiation study described in Example 11.
[0379] Administration: Administer the drug once every 2 days and replace the culture medium.
[0380] Duration: Main study: 0, 2, 4, or 8 days; Recovery: 2, 5, or 8 days.
[0381] Replication number: 3 tissue culture (TC) wells per group.
[0382] Dosing volume: 5 μL
[0383] Analytical Parameters: Markers of pluripotency (Sox2 and Nestin), proliferation (Ki67), cell death (caspase 3), and differentiation (MAP2, neurons and GFAP, glial cells) will be monitored by WB and RT-PCR on days 0, 2, 4, and 8 during the dosing period (main study) and on days 10, 13, and 16 during the recovery period (3 / TC wells / group per day) (Table 10).
[0384]
[0385] Anticancer efficacy of the test article on mouse BTIC:
[0386] Dosage: 3 doses of test article + vehicle control. Test article dosage will be based on the results of the neurogenic efficacy study.
[0387] Frequency of administration: Single dose
[0388] Pathway: Automatic syringe pump with lead screw system 112,195 The injection coordinates are X:1.5; Y:1.34; Z:-3.5, targeting the mouse striatum; a highly reliable tumor implantation site. 196 .
[0389] Solvent: Phosphate buffered saline (PBS)
[0390] Number of animals: 3 / sex / group
[0391] Dosing volume: 5 μL
[0392] Parametric analysis: Kaplan-Meier method will be used 197 Mice were monitored for survival at 4, 8, 16, and 20 weeks, followed by postmortem histopathology to assess tumor size and invasiveness (H&E staining), cell death (TUNEL), and proliferation (anti-human nuclei) (Table 11).
[0393]
[0394] Environmental conditions
[0395] Housing conditions: 2 animals / cage, 12 h light / dark cycle.
[0396] Diet: Food and water are allowed ad libitum.
[0397] Table 19 below shows the sequences of SEQ ID NOs: 1 to 324:
[0398]
[0399]
[0400]
[0401]
[0402]
[0403]
[0404]
[0405]
[0406]
[0407]
[0408]
[0409]
[0410]
[0411]
[0412]
[0413]
[0414]
[0415]
[0416]
[0417]
[0418]
[0419] While certain presently preferred embodiments of the present invention have been described in detail herein, it will be apparent to those skilled in the art that changes and modifications of the various embodiments shown and described herein may be made without departing from the spirit and scope of the invention.
[0420] References (excluding instructions and examples)
[0421] 1 Bruce,AWet al.Genome-wide analysis of repressor element1silencing transcription factor / neuron-restrictive silencing factor(REST / NRSF)target genes.Proc Natl Acad Sci USA 101,10458-10463,doi:10.1073 / pnas.04018271010401827101[pii](2004).
[0422] 2 Nesti,E.,Corson,GM,McCleskey,M.,Oyer,JA&Mandel,GC-terminaldomain small phosphatase 1 and MAP kinase reciprocally control REST stabilityand neuronal differentiation.Proc Natl Acad Sci USA 111,E3929-3936,doi:1414770111[pii]10.1073 / pnas.1414770111(2014).
[0423] 3 Nesti, E. METHODS AND COMPOSITIONS USEFUL IN MANIPULATING THESTABILITY OF RE1 SILENCING TRANSCRIPTION FACTOR. US, PTC patent (2014, 2015).
[0424] 4 Nesti,E.Harnessing the master transcriptional repressor REST toreciprocally regulate neurogenesis..Neurogenesis 2,doi:10.1080 / 23262133.2015.1055419(2015).
[0425] 5 Calderone,A.et al.Ischemic insults derepress the gene silencer RESTin neurons destined to die.JNeurosci 23,2112-2121,doi:23 / 6 / 2112[pii](2003).
[0426] 6 Kaneko,N.,Hwang,J.Y.,Gertner,M.,Pontarelli,F.&Zukin,R.S.Caseinkinase 1suppresses activation ofREST in insulted hippocampal neurons andhalts ischemia-induced neuronal death.J Neurosci 34,6030-6039,doi:34 / 17 / 6030[pii]10.1523 / JNEUROSCI.4045-13.2014(2014).
[0427] 7 Noh,K.M.et al.Repressor element-1silencing transcription factor(REST)-dependent epigenetic remodeling is critical to ischemia-inducedneuronal death.Proc Natl Acad Sci USA 109,E962-971,doi:1121568109[pii]10.1073 / pnas.1121568109(2012).
[0428] 8 Abe,K.Therapeutic potential of neurotrophic factors and neural stemcells against ischemic brain injury.J Cereb Blood Flow Metab 20,1393-1408,doi:10.1097 / 00004647-200010000-00001(2000).
[0429] 9 Kan Ding,P.K.G.,and Ramon Diaz-Arrastia.in Translational Researchin Traumatic Brain Injury(ed Grant G Laskowitz D)Ch.14,(Taylor and Francis,2016).
[0430] 10 Pasquina,P.,Kirtley,R.&Ling,G.Moderate-to-severe traumatic braininjury.Semin Neurol 34,572-583,doi:10.1055 / s-0034-1396010(2014).
[0431] 11 Hwang,J.Y.,Kaneko,N.,Noh,K.M.,Pontarelli,F.&Zukin,R.S.The genesilencing transcription factor REST represses miR-132 expression inhippocampal neurons destined to die.J Mol Biol 426,3454-3466,doi:10.1016 / j.jmb.2014.07.032(2014).
[0432] 12 McClelland,S.et al.The transcription factor NRSF contributes toepileptogenesis by selective repression of a subset of target genes.Elife 3,e01267(2014).
[0433] 13 Lu,T.et al.REST and stress resistance in ageing and Alzheimer'sdisease.Nature 507,448-454,doi:nature13163[pii]10.1038 / nature13163(2014).
[0434] 14 Orta-Salazar,E.et al.REST / NRSF-induced changes of ChAT proteinexpression in the neocortex and hippocampus of the 3xTg-AD mouse model forAlzheimer's disease.Life sciences 116,83-89,doi:10.1016 / j.lfs.2014.09.013(2014).
[0435] 15 Sharp,D.J.,Scott,G.&Leech,R.Network dysfunction after traumaticbrain injury.Nat Rev Neurol 10,156-166,doi:10.1038 / nrneurol.2014.15(2014).
[0436] 16 Roopra,A.,Dingledine,R.&Hsieh,J.Epigenetics and epilepsy.Epilepsia53 Suppl 9,2-10,doi:10.1111 / epi.12030(2012).
[0437] 17 Bergsland,M.,Covacu,R.,Perez Estrada,C.,Svensson,M.&Brundin,L.Nitric oxide-induced neuronal to glial lineage fate-change depends on NRSF / REST function in neural progenitor cells.Stem Cells 32,2539-2549,doi:10.1002 / stem.1749(2014).
[0438] 18 Conaco,C.,Otto,S.,Han,J.J.&Mandel,G.Reciprocal actions of REST anda microRNA promote neuronal identity.Proc Natl Acad Sci USA 103,2422-2427,doi:0511041103[pii]10.1073 / pnas.0511041103(2006).
[0439] 19 Covey,M.V.,Streb,J.W.,Spektor,R.&Ballas,N.REST regulates the poolsize of the different neural lineages by restricting the generation ofneurons and oligodendrocytes from neural stem / progenitor cells.Development139,2878-2890,doi:dev.074765[pii]10.1242 / dev.074765(2012).
[0440] 20 Gao,Z.et al.The master negative regulator REST / NRSF controls adultneurogenesis by restraining the neurogenic program in quiescent stem cells.JNeurosci 31,9772-9786,doi:31 / 26 / 9772[pii]10.1523 / JNEUROSCI.1604-11.2011(2011).
[0441] 21 Kohyama,J.et al.BMP-induced REST regulates the establishment andmaintenance of astrocytic identity.J Cell Biol 189,159-170,doi:jcb.200908048[pii]10.1083 / jcb.200908048(2010).
[0442] 22 Mandel,G.et al.Repressor element 1 silencing transcription factor(REST)controls radial migration and temporal neuronal specification duringneocortical development.Proc Natl Acad Sci USA 108,16789-16794,doi:1113486108[pii]10.1073 / pnas.1113486108(2011).
[0443] 23 Vincent,A.S.,Roebuck-Spencer,T.M.&Cernich,A.Cognitive changes anddementia risk after traumatic brain injury:implications for aging militarypersonnel.Alzheimers Dement 10,S174-187,doi:10.1016 / j.jalz.2014.04.006(2014).
[0444] 24 Kirn,J.R.The relationship of neurogenesis and growth of brainregions to song learning.Brain Lang 115,29-44,doi:S0093-934X(09)00135-7[pii]10.1016 / j.bandl.2009.09.006(2010).
[0445] 25 Oomen,C.A.,Bekinschtein,P.,Kent,B.A.,Saksida,L.M.&Bussey,T.J.Adulthippocampal neurogenesis and its role in cognition.Wiley Interdiscip Rev CognSci 5,573-587,doi:10.1002 / wcs.1304(2014).
[0446] 26 Samuels,I.S.et al.Deletion of ERK2 mitogen-activated proteinkinase identifies its key roles in cortical neurogenesis and cognitivefunction.J Neurosci 28,6983-6995,doi:28 / 27 / 6983[pii]10.1523 / JNEUROSCI.0679-08.2008(2008).
[0447] 27 Shors,T.J.et al.Neurogenesis in the adult is involved in theformation of trace memories.Nature 410,372-376,doi:10.1038 / 35066584(2001).
[0448] 28 Villeda,S.A.et al.The ageing systemic milieu negatively regulatesneurogenesis and cognitive function.Nature 477,90-94,doi:10.1038 / nature10357(2011).
[0449] 29 Bird,C.M.&Burgess,N.The hippocampus supports recognition memoryfor familiar words but not unfamiliar faces.Curr Biol 18,1932-1936,doi:10.1016 / j.cub.2008.10.046(2008).
[0450] 30 T.J.Shors,G.M.,A.Beylin,M.Zhao,T.Rydel,E.Gould.Neurogenesis in theadult is involved in the formation oftrace memories.Nature 410,372-376(2001).
[0451] 31 VanElzakker,M.,Fevurly,R.D.,Breindel,T.&Spencer,R.L.Environmentalnovelty is associated with a selective increase in Fos expression in theoutput elements of the hippocampal formation and the perirhinal cortex.LearnMem 15,899-908,doi:10.1101 / lm.1196508(2008).
[0452] 32 Thornton,G.K.&Woods,C.G.Primary microcephaly:do all roads lead toRome?Trends Genet 25,501-510,doi:10.1016 / j.tig.2009.09.011(2009).
[0453] 33 Ghaziuddin,M.,Zaccagnini,J.,Tsai,L.&Elardo,S.Is megalencephalyspecific to autism?J Intellect Disabil Res 43(Pt 4),279-282(1999).
[0454] 34 Kuhn,H.G.,Cooper-Kuhn,C.M.,Boekhoorn,K.&Lucassen,P.J.Changes inneurogenesis in dementia and Alzheimer mouse models:are they functionallyrelevant?Eur Arch Psychiatry Clin Neurosci 257,281-289,doi:10.1007 / s00406-007-0732-4(2007).
[0455] 35 Baker,M.Tumours spark stem-cell review.Nature 457,941,doi:10.1038 / 457941a(2009).
[0456] 36 Brederlau,A.et al.Transplantation of human embryonic stem cell-derived cells to a rat model of Parkinson's disease:effect of in vitrodifferentiation on graft survival and teratoma formation.Stem Cells 24,1433-1440,doi:2005-0393[pii]10.1634 / stemcells.2005-0393(2006).
[0457] 37 Burns,T.C.,Verfaillie,C.M.&Low,W.C.Stem cells for ischemic braininjury:a critical review.J Comp Neurol 515,125-144,doi:10.1002 / cne.22038(2009).
[0458] 38 Carlson,A.P.,Schermer,C.R.&Lu,S.W.Retrospective evaluation ofanemia and transfusion in traumatic brain injury.J Trauma 61,567-571,doi:10.1097 / 01.ta.0000231768.44727.a200005373-200609000-00007[pii](2006).
[0459] 39 Carmeliet,P.&Storkebaum,E.Vascular and neuronal effects of VEGF inthe nervous system:implications for neurological disorders.Semin Cell DevBiol 13,39-53,doi:10.1006 / scdb.2001.0290S1084952101902903[pii](2002).
[0460] 40 Choe,Y.,Kozlova,A.,Graf,D.&Pleasure,S.J.Bone morphogenic proteinsignaling is a major determinant of dentate development.J Neurosci 33,6766-6775,doi:33 / 16 / 6766[pii]10.1523 / JNEUROSCI.0128-13.2013(2013).
[0461] 41 Erdo,F.et al.Host-dependent tumorigenesis of embryonic stem celltransplantation in experimental stroke.J Cereb Blood Flow Metab 23,780-785,doi:10.1097 / 01.WCB.0000071886.63724.FB(2003).
[0462] 42 Greig,N.H.et al.Incretin mimetics as pharmacologic tools toelucidate and as a new drug strategy to treat traumatic braininjury.Alzheimers Dement 10,S62-75,doi:S1552-5260(13)02925-7[pii]10.1016 / j.jalz.2013.12.011(2014).
[0463] 43 Kaplan,G.B.,Vasterling,J.J.&Vedak,P.C.Brain-derived neurotrophicfactor in traumatic brain injury,post-traumatic stress disorder,and theircomorbid conditions:role in pathogenesis and treatment.Behav Pharmacol 21,427-437,doi:10.1097 / FBP.0b013e32833d8bc9(2010).
[0464] 44 Knoepfler,P.S.Deconstructing stem cell tumorigenicity:a roadmap tosafe regenerative medicine.Stem Cells 27,1050-1056,doi:10.1002 / stem.37(2009).
[0465] 45 Luca Longhia,,Elisa R.Zaniera,Nicolas Royob,Nino Stocchettia,TracyK.McIntosha.Stem cell transplantation as a therapeutic strategy for traumaticbrain injury.Transplant Immunology 15,134-148(2005).
[0466] 46 Robertson,C.S.et al.Effect of erythropoietin and transfusionthreshold on neurological recovery after traumatic brain injury:a randomizedclinical trial.JAMA 312,36-47,doi:1884575[pii]10.1001 / jama.2014.6490(2014).
[0467] 47 Salim,A.et al.Role ofanemia in traumatic brain injury.JAm CollSurg 207,398-406,doi:S1072-7515(08)00322-0[pii]10.1016 / j.jamcollsurg.2008.03.013(2008).
[0468] 48 Deng,W.,Aimone,J.B.&Gage,F.H.New neurons and new memories:how doesadult hippocampal neurogenesis affect learning and memory?Nat Rev Neurosci11,339-350,doi:nrn2822[pii]10.1038 / nrn2822(2010).
[0469] 49 Goldman,S.A.&Nottebohm,F.Neuronal production,migration,anddifferentiation in a vocal control nucleus of the adult female canarybrain.Proc Natl Acad Sci USA 80,2390-2394(1983).
[0470] 50 Gould,E.,Beylin,A.,Tanapat,P.,Reeves,A.&Shors,T.J.Learningenhances adult neurogenesis in the hippocampal formation.Nat Neurosci 2,260-265,doi:10.1038 / 6365(1999).
[0471] 51 Kirn,J.R.&Nottebohm,F.Direct evidence for loss and replacement ofprojection neurons in adult canary brain.J Neurosci 13,1654-1663(1993).
[0472] 52 Mu,Y.&Gage,F.H.Adult hippocampal neurogenesis and its role inAlzheimer's disease.Mol Neurodegener 6,85,doi:1750-1326-6-85[pii]10.1186 / 1750-1326-6-85(2011).
[0473] 53 Pytte,C.L.,Gerson,M.,Miller,J.&Kirn,J.R.Increasing stereotypy inadult zebra finch song correlates with a declining rate of adultneurogenesis.Dev Neurobiol 67,1699-1720,doi:10.1002 / dneu.20520(2007).
[0474] 54 Scharff,C.,Kirn,J.R.,Grossman,M.,Macklis,J.D.&Nottebohm,F.Targetedneuronal death affects neuronal replacement and vocal behavior in adultsongbirds.Neuron 25,481-492,doi:S0896-6273(00)80910-1[pii](2000).
[0475] 55 Seib,D.R.et al.Loss of Dickkopf-1 restores neurogenesis in old ageand counteracts cognitive decline.Cell Stem Cell 12,204-214,doi:S1934-5909(12)00644-3[pii]10.1016 / j.stem.2012.11.010(2013).
[0476] 56 Deister,C.&Schmidt,C.E.Optimizing neurotrophic factor combinationsfor neurite outgrowth.JNeural Eng 3,172-179,doi:10.1088 / 1741-2560 / 3 / 2 / 011(2006).
[0477] 57 Zhao,Y.et al.Brain REST / NRSF Is Not Only a Silent Repressor butAlso an Active Protector.Mol Neurobiol 54,541-550,doi:10.1007 / s12035-015-9658-4(2017).
[0478] 58 Uchida,H.,Ma,L.&Ueda,H.Epigenetic Gene Silencing Underlies C-FiberDysfunctions in Neuropathic Pain.Journal ofNeuroscience 30,4806-4814,doi:10.1523 / JNEUROSCI.5541-09.2010(2010).
[0479] 59 Rose,K.et al.Transcriptional repression of the M channel subunitKv7.2 in chronic nerve injury.Pain 152,742-754,doi:10.1016 / j.pain.2010.12.028(2011).
[0480] 60 Costigan,M.et al.Multiple chronic pain states are associated witha common amino acid-changing allele in KCNS1.Brain 133,2519-2527,doi:10.1093 / brain / awq195(2010).
[0481] 61 Ueda,H.et al.A mimetic of the mSin3-binding helix of NRSF / RESTameliorates abnormal pain behavior in chronic pain models.Bioorg Med ChemLett 27,4705-4709,doi:10.1016 / j.bmcl.2017.09.006(2017).
[0482] 62 Zhang,J.,Chen,S.R.,Chen,H.&Pan,H.L.RE1-silencing transcriptionfactor controls the acute-to-chronic neuropathic pain transition and Chrm2receptor gene expression in primary sensory neurons.J Biol Chem 293,19078-19091,doi:10.1074 / jbc.RA118.005846(2018).
[0483] 63 Banerjee,P.N.,Filippi,D.&Allen Hauser,W.The descriptiveepidemiology of epilepsy-a review.Epilepsy Res 85,31-45,doi:10.1016 / j.eplepsyres.2009.03.003(2009).
[0484] 64 Mucha,M.et al.Transcriptional control of KCNQ channel genes andthe regulation of neuronal excitability.J Neurosci 30,13235-13245,doi:10.1523 / JNEUROSCI.1981-10.2010(2010).
[0485] 65 Escayg,A.et al.Mutations of SCN1A,encoding a neuronal sodiumchannel,in two families with GEFS+2.Nat Genet 24,343-345,doi:10.1038 / 74159(2000).
[0486] 66 Martin,D.et al.REST represses a subset of the pancreatic endocrinedifferentiation program.Dev Biol 405,316-327,doi:10.1016 / j.ydbio.2015.07.002(2015).
[0487] 67 Abderrahmani,A.et al.Neuronal traits are required for glucose-induced insulin secretion.FEBS Lett 565,133-138,doi:10.1016 / j.febslet.2004.04.002(2004).
[0488] 68 Martin,D.et al.Functional significance of repressor element 1silencing transcription factor(REST)target genes in pancreatic betacells.Diabetologia 51,1429-1439,doi:10.1007 / s00125-008-0984-1(2008).
[0489] 69 Rigamonti,D.et al.Loss of huntingtin function complemented bysmall molecules acting as repressor element 1 / neuron restrictive silencerelement silencer modulators.J Biol Chem 282,24554-24562,doi:10.1074 / jbc.M609885200(2007).
[0490] 70 Sipione,S.et al.Early transcriptional profiles in huntingtin-inducible striatal cells by microarray analyses.Hum Mol Genet 25,210,doi:10.1093 / hmg / ddv416(2016).
[0491] 71 Zuccato,C.et al.Huntingtin interacts with REST / NRSF to modulatethe transcription of NRSE-controlled neuronal genes.Nat Genet 35,76-83,doi:10.1038 / ng1219(2003).
[0492] 72 Bao,S.et al.Targeting cancer stem cells through L1CAM suppressesglioma growth.Cancer Res 68,6043-6048,doi:10.1158 / 0008-5472.CAN-08-1079(2008).
[0493] 73 Jackson,M.,Hassiotou,F.&Nowak,A.Glioblastoma stem-like cells:atthe root of tumor recurrence and a therapeutic target.Carcinogenesis 36,177-185,doi:10.1093 / carcin / bgu243(2015).
[0494] 74 Liu,G.et al.Analysis of gene expression and chemoresistance ofCD133+cancer stem cells in glioblastoma.Mol Cancer 5,67,doi:10.1186 / 1476-4598-5-67(2006).
[0495] 75 Persano,L.,Rampazzo,E.,Basso,G.&Viola,G.Glioblastoma cancer stemcells:role of the microenvironment and therapeutic targeting.BiochemPharmacol 85,612-622,doi:10.1016 / j.bcp.2012.10.001(2013).
[0496] 76 Conti, L. et al. REST controls self-renewal and tumorigenic competence of human glioblastoma cells. PLoS One 7, e38486, doi:10.1371 / journal.pone.0038486 (2012).
[0497] 77 Kamal, M. M. et al. REST regulates oncogenic properties of glioblastoma stem cells. Stem Cells 30, 405 - 414, doi:10.1002 / stem.1020 (2012).
[0498] 78 Wagoner, M. P. & Roopra, A. A REST derived gene signature stratifies glioblastomas into chemotherapy resistant and responsive disease. BMC Genomics 13, 686, doi:10.1186 / 1471 - 2164 - 13 - 686 (2012).
[0499] 79 Taylor, P. et al. REST is a novel prognostic factor and therapeutic target for medulloblastoma. Mol Cancer Ther 11, 1713 - f1723, doi:10.1158 / 1535 - 7163.MCT - 11 - 0990 (2012).
[0500] 80 Jin, H. et al. Identification of RE1 - Silencing Transcription Factor as a Promoter of Metastasis in Pancreatic Cancer. Front Oncol 9, f291, doi:10.3389 / fonc.XX.00291 (2019).
[0501] References (only for embodiments)
[0502] It should be noted that there seems to be a formatting issue in the original text where "f1723" and "f291" in the English translation might be incorrect. It's possible they should be "1723" and "291" respectively. Also, "XX" in the "doi:10.3389 / fonc.XX.00291" should be "2019" as per the original. The above translation is adjusted based on the best understanding of the text.1 Bruce,A.W.et al.Genome-wide analysis of repressor element1silencing transcription factor / neuron-restrictive silencing factor(REST / NRSF)target genes.Proc Natl Acad Sci USA 101,10458-10463,doi:10.1073 / pnas.04018271010401827101[pii](2004).
[0503] 2 Nesti,E.,Corson,G.M.,McCleskey,M.,Oyer,J.A.&Mandel,G.C-terminaldomain small phosphatase 1 and MAP kinase reciprocally control REST stabilityand neuronal differentiation.Proc Natl Acad Sci USA 111,E3929-3936,doi:1414770111[pii]10.1073 / pnas.1414770111(2014).
[0504] 3 Nesti,E.METHODS AND COMPOSITIONS USEFUL IN MANIPULATING THESTABILITY OF RE1 SILENCING TRANSCRIPTION FACTOR.US,PTC patent(2014,2015).
[0505] 4 Nesti,E.Harnessing the master transcriptional repressor REST toreciprocally regulate neurogenesis..Neurogenesis 2,doi:10.1080 / 23262133.2015.1055419(2015).
[0506] 5 Arranz-Gibert,P.et al.Immunosilencing peptides by stereochemicalinversion and sequence reversal:retro-D-peptides.Sci Rep 8,6446,doi:10.1038 / s41598-018-24517-6(2018).
[0507] 6 Hall,E.D.,Bryant,Y.D.,Cho,W.&Sullivan,P.G.Evolution of post-traumatic neurodegeneration after controlled cortical impact traumatic braininjury in mice and rats as assessed by the de Olmos silver and fluorojadestaining methods.J Neurotrauma 25,235-247,doi:10.1089 / neu.2007.0383(2008).
[0508] 7 Calderone,A.et al.Ischemic insults derepress the gene silencer RESTin neurons destined to die.JNeurosci 23,2112-2121,doi:23 / 6 / 2112[pii](2003).
[0509] 8 Kaneko,N.,Hwang,J.Y.,Gertner,M.,Pontarelli,F.&Zukin,R.S.Caseinkinase 1 suppresses activation of REST in insulted hippocampal neurons andhalts ischemia-induced neuronal death.J Neurosci 34,6030-6039,doi:34 / 17 / 6030[pii]10.1523 / JNEUROSCI.4045-13.2014(2014).
[0510] 9 Noh,K.M.et al.Repressor element-1 silencing transcription factor(REST)-dependent epigenetic remodeling is critical to ischemia-inducedneuronal death.Proc Natl Acad Sci USA 109,E962-971,doi:1121568109[pii]10.1073 / pnas.1121568109(2012).
[0511] 10 Abe,K.Therapeutic potential of neurotrophic factors and neuralstem cells against ischemic brain injury.J Cereb Blood Flow Metab 20,1393-1408,doi:10.1097 / 00004647-200010000-00001(2000).
[0512] 11 Kan Ding,P.K.G.,and Ramon Diaz-Arrastia.in Translational Researchin Traumatic Brain Injury(ed Grant G Laskowitz D)Ch.14,(Taylor and Francis,2016).
[0513] 12 Pasquina,P.,Kirtley,R.&Ling,G.Moderate-to-severe traumatic braininjury.Semin Neurol34,572-583,doi:10.1055 / s-0034-1396010(2014).
[0514] 13 Hwang,J.Y.,Kaneko,N.,Noh,K.M.,Pontarelli,F.&Zukin,R.S.The genesilencing transcription factor REST represses miR-132 expression inhippocampal neurons destined to die.J Mol Biol 426,3454-3466,doi:10.1016 / j.jmb.2014.07.032(2014).
[0515] 14 McClelland,S.et al.The transcription factor NRSF contributes toepileptogenesis by selective repression of a subset of target genes.Elife 3,e01267(2014).
[0516] 15 Lu,T.et al.REST and stress resistance in ageing and Alzheimer'sdisease.Nature 507,448-454,doi:nature13163[pii]10.1038 / nature13163(2014).
[0517] 16 Orta-Salazar,E.et al.REST / NRSF-induced changes of ChAT proteinexpression in the neocortex and hippocampus of the 3xTg-AD mouse model forAlzheimer's disease.Life sciences 116,83-89,doi:10.1016 / j.lfs.2014.09.013(2014).
[0518] 17 Sharp,D.J.,Scott,G.&Leech,R.Network dysfunction after traumaticbrain injury.NatRevNeurol 10,156-166,doi:10.1038 / nrneurol.2014.15(2014).
[0519] 18 Roopra,A.,Dingledine,R.&Hsieh,J.Epigenetics and epilepsy.Epilepsia53 Suppl 9,2-10,doi:10.1111 / epi.12030(2012).
[0520] 19 Bergsland,M.,Covacu,R.,Perez Estrada,C.,Svensson,M.&Brundin,L.Nitric oxide-induced neuronal to glial lineage fate-change depends on NRSF / REST function in neural progenitor cells.Stem Cells 32,2539-2549,doi:10.1002 / stem.1749(2014).
[0521] 20 Conaco,C.,Otto,S.,Han,J.J.&Mandel,G.Reciprocal actions ofREST anda microRNA promote neuronal identity.Proc Natl Acad Sci USA 103,2422-2427,doi:0511041103[pii]10.1073 / pnas.0511041103(2006).
[0522] 21 Covey,M.V.,Streb,J.W.,Spektor,R.&Ballas,N.REST regulates the poolsize of the different neural lineages by restricting the generation ofneurons and oligodendrocytes from neural stem / progenitor cells.Development139,2878-2890,doi:dev.074765[pii]10.1242 / dev.074765(2012).
[0523] 22 Gao,Z.et al.The master negative regulator REST / NRSF controls adultneurogenesis by restraining the neurogenic program in quiescent stem cells.JNeurosci 31,9772-9786,doi:31 / 26 / 9772[pii]10.1523 / JNEUROSCI.1604-11.2011(2011).
[0524] 23 Kohyama,J.et al.BMP-induced REST regulates the establishment andmaintenance of astrocytic identity.J Cell Biol 189,159-170,doi:jcb.200908048[pii]10.1083 / jcb.200908048(2010).
[0525] 24 Mandel,G.et al.Repressor element 1 silencing transcription factor(REST)controls radial migration and temporal neuronal specification duringneocortical development.Proc Natl Acad Sci USA 108,16789-16794,doi:1113486108[pii]10.1073 / pnas.1113486108(2011).
[0526] 25 Vincent,A.S.,Roebuck-Spencer,T.M.&Cernich,A.Cognitive changes anddementia risk after traumatic brain injury:implications for aging militarypersonnel.Alzheimers Dement 10,S174-187,doi:10.1016 / j.jalz.2014.04.006(2014).
[0527] 26 Kirn,J.R.The relationship of neurogenesis and growth of brainregions to song learning.Brain Lang 115,29-44,doi:S0093-934X(09)00135-7[pii]10.1016 / j.bandl.2009.09.006(2010).
[0528] 27 Oomen,C.A.,Bekinschtein,P.,Kent,B.A.,Saksida,L.M.&Bussey,T.J.Adulthippocampal neurogenesis and its role in cognition.Wiley Interdiscip Rev CognSci 5,573-587,doi:10.1002 / wcs.1304(2014).
[0529] 28 Samuels,I.S.et al.Deletion of ERK2 mitogen-activated proteinkinase identifies its key roles in cortical neurogenesis and cognitivefunction.J Neurosci 28,6983-6995,doi:28 / 27 / 6983[pii]10.1523 / JNEUROSCI.0679-08.2008(2008).
[0530] 29 Shors,T.J.et al.Neurogenesis in the adult is involved in theformation of trace memories.Nature 410,372-376,doi:10.1038 / 35066584(2001).
[0531] 30 Villeda,S.A.et al.The ageing systemic milieu negatively regulatesneurogenesis and cognitive function.Nature 477,90-94,doi:10.1038 / nature10357(2011).
[0532] 31 Bird,C.M.&Burgess,N.The hippocampus supports recognition memoryfor familiar words but not unfamiliar faces.Curr Biol 18,1932-1936,doi:10.1016 / j.cub.2008.10.046(2008).
[0533] 32 T.J.Shors,G.M.,A.Beylin,M.Zhao,T.Rydel,E.Gould.Neurogenesis in theadult is involved in the formation of trace memories.Nature 410,372-376(2001).
[0534] 33 VanElzakker,M.,Fevurly,R.D.,Breindel,T.&Spencer,R.L.Environmentalnovelty is associated with a selective increase in Fos expression in theoutput elements ofthe hippocampal formation and the perirhinal cortex.LearnMem 15,899-908,doi:10.1101 / lm.1196508(2008).
[0535] 34 Thornton,G.K.&Woods,C.G.Primary microcephaly:do all roads lead toRome?Trends Genet 25,501-510,doi:10.1016 / j.tig.2009.09.011(2009).
[0536] 35 Ghaziuddin,M.,Zaccagnini,J.,Tsai,L.&Elardo,S.Is megalencephalyspecific to autism?J Intellect Disabil Res 43(Pt 4),279-282(1999).
[0537] 36 Kuhn,H.G.,Cooper-Kuhn,C.M.,Boekhoorn,K.&Lucassen,P.J.Changes inneurogenesis in dementia and Alzheimer mouse models:are they functionallyrelevant?Eur Arch Psychiatry Clin Neurosci 257,281-289,doi:10.1007 / s00406-007-0732-4(2007).
[0538] 37 Baker,M.Tumours spark stem-cell review.Nature 457,941,doi:10.1038 / 457941a(2009).
[0539] 38 Brederlau,A.et al.Transplantation of human embryonic stem cell-derived cells to a rat model of Parkinson's disease:effect of in vitrodifferentiation on graft survival and teratoma formation.Stem Cells 24,1433-1440,doi:2005-0393[pii]10.1634 / stemcells.2005-0393(2006).
[0540] 39 Burns,T.C.,Verfaillie,C.M.&Low,W.C.Stem cells for ischemic braininjury:a critical review.J Comp Neurol 515,125-144,doi:10.1002 / cne.22038(2009).
[0541] 40 Carlson,A.P.,Schermer,C.R.&Lu,S.W.Retrospective evaluation ofanemia and transfusion in traumatic brain injury.J Trauma 61,567-571,doi:10.1097 / 01.ta.0000231768.44727.a200005373-200609000-00007[pii](2006).
[0542] 41 Carmeliet,P.&Storkebaum,E.Vascular and neuronal effects of VEGF inthe nervous system:implications for neurological disorders.Semin Cell DevBiol 13,39-53,doi:10.1006 / scdb.2001.0290S1084952101902903[pii](2002).
[0543] 42 Choe,Y.,Kozlova,A.,Graf,D.&Pleasure,S.J.Bone morphogenic proteinsignaling is a major determinant of dentate development.J Neurosci 33,6766-6775,doi:33 / 16 / 6766[pii]10.1523 / JNEUROSCI.0128-13.2013(2013).
[0544] 43 Erdo,F.et al.Host-dependent tumorigenesis of embryonic stem celltransplantation in experimental stroke.J Cereb Blood Flow Metab 23,780-785,doi:10.1097 / 01.WCB.0000071886.63724.FB(2003).
[0545] 44 Greig,N.H.et al.Incretin mimetics as pharmacologic tools toelucidate and as a new drug strategy to treat traumatic braininjury.Alzheimers Dement 10,S62-75,doi:S1552-5260(13)02925-7[pii]10.1016 / j.jalz.2013.12.011(2014).
[0546] 45 Kaplan,G.B.,Vasterling,J.J.&Vedak,P.C.Brain-derived neurotrophicfactor in traumatic brain injury,post-traumatic stress disorder,and theircomorbid conditions:role in pathogenesis and treatment.Behav Pharmacol 21,427-437,doi:10.1097 / FBP.0b013e32833d8bc9(2010).
[0547] 46 Knoepfler,P.S.Deconstructing stem cell tumorigenicity:a roadmap tosafe regenerative medicine.Stem Cells 27,1050-1056,doi:10.1002 / stem.37(2009).
[0548] 47 Luca Longhia,,Elisa R.Zaniera,Nicolas Royob,Nino Stocchettia,TracyK.McIntosha.Stem cell transplantation as a therapeutic strategy for traumaticbrain injury.Transplant Immunology 15,134-148(2005).
[0549] 48 Robertson,C.S.et al.Effect of erythropoietin and transfusionthreshold on neurological recovery after traumatic brain injury:a randomizedclinical trial.JAMA 312,36-47,doi:1884575[pii]10.1001 / jama.2014.6490(2014).
[0550] 49 Salim,A.et al.Role of anemia in traumatic brain injury.J Am CollSurg 207,398-406,doi:S1072-7515(08)00322-0[pii]10.1016 / j.jamcollsurg.2008.03.013(2008).
[0551] 50 Deng,W.,Aimone,J.B.&Gage,F.H.New neurons and new memories:how doesadult hippocampal neurogenesis affect learning and memory?Nat Rev Neurosci11,339-350,doi:nrn2822[pii]10.1038 / nrn2822(2010).
[0552] 51 Goldman,S.A.&Nottebohm,F.Neuronal production,migration,anddifferentiation in a vocal control nucleus of the adult female canarybrain.Proc Natl Acad Sci USA 80,2390-2394(1983).
[0553] 52 Gould,E.,Beylin,A.,Tanapat,P.,Reeves,A.&Shors,T.J.Learningenhances adult neurogenesis in the hippocampal formation.Nat Neurosci 2,260-265,doi:10.1038 / 6365(1999).
[0554] 53 Kirn,J.R.&Nottebohm,F.Direct evidence for loss and replacement ofprojection neurons in adult canary brain.J Neurosci 13,1654-1663(1993).
[0555] 54 Mu,Y.&Gage,F.H.Adult hippocampal neurogenesis and its role inAlzheimer's disease.Mol Neurodegener 6,85,doi:1750-1326-6-85[pii]10.1186 / 1750-1326-6-85(2011).
[0556] 55 Pytte,C.L.,Gerson,M.,Miller,J.&Kirn,J.R.Increasing stereotypy inadult zebra finch song correlates with a declining rate of adultneurogenesis.Dev Neurobiol 67,1699-1720,doi:10.1002 / dneu.20520(2007).
[0557] 56 Scharff,C.,Kirn,J.R.,Grossman,M.,Macklis,J.D.&Nottebohm,F.Targetedneuronal death affects neuronal replacement and vocal behavior in adultsongbirds.Neuron 25,481-492,doi:S0896-6273(00)80910-1[pii](2000).
[0558] 57 Seib,D.R.et al.Loss of Dickkopf-1 restores neurogenesis in old ageand counteracts cognitive decline.Cell Stem Cell 12,204-214,doi:S1934-5909(12)00644-3[pii]10.1016 / j.stem.2012.11.010(2013).
[0559] 58 Deister,C.&Schmidt,C.E.Optimizing neurotrophic factor combinationsfor neurite outgrowth.J Neural Eng 3,172-179,doi:10.1088 / 1741-2560 / 3 / 2 / 011(2006).
[0560] 59 Zhao,Y.et al.Brain REST / NRSF Is Not Only a Silent Repressor butAlso an Active Protector.Mol Neurobiol 54,541-550,doi:10.1007 / s12035-015-9658-4(2017).
[0561] 60 Uchida,H.,Ma,L.&Ueda,H.Epigenetic Gene Silencing Underlies C-FiberDysfunctions in Neuropathic Pain.Journal of Neuroscience 30,4806-4814,doi:10.1523 / JNEUROSCI.5541-09.2010(2010).
[0562] 61 Alvarado,S.et al.Peripheral nerve injury is accompanied by chronictranscriptome-wide changes in the mouse prefrontal cortex.Mol Pain 9,21,doi:10.1186 / 1744-8069-9-21(2013).
[0563] 62 Hammer,P.et al.mRNA-seq with agnostic splice site discovery fornervous system transcriptomics tested in chronic pain.Genome Res 20,847-860,doi:10.1101 / gr.101204.109(2010).
[0564] 63 Willis,D.E.,Wang,M.,Brown,E.,Fones,L.&Cave,J.W.Selectiverepression of gene expression in neuropathic pain by the neuron-restrictivesilencing factor / repressor element-1 silencing transcription(NRSF / REST).NeuroscienceLetters 625,20-25,doi:10.1016 / j.neulet.2015.12.003(2016).
[0565] 64 Ballas,N.,Grunseich,C.,Lu,D.D.,Speh,J.C.&Mandel,G.REST and itscorepressors mediate plasticity of neuronal gene chromatin throughoutneurogenesis.Cell 121,645-657,doi:S0092-8674(05)00285-0[pii]10.1016 / j.cell.2005.03.013(2005).
[0566] 65 Chong,J.A.et al.REST:a mammalian silencer protein that restrictssodium channel gene expression to neurons.Cell 80,949-957,doi:0092-8674(95)90298-8[pii](1995).
[0567] 66 Mortazavi,A.,Leeper Thompson,E.C.,Garcia,S.T.,Myers,R.M.&Wold,B.Comparative genomics modeling of the NRSF / REST repressor network:fromsingle conserved sites to genome-wide repertoire.Genome Res 16,1208-1221,doi:gr.4997306[pii]10.1101 / gr.4997306(2006).
[0568] 67 Otto,S.J.et al.A new binding motif for the transcriptionalrepressor REST uncovers large gene networks devoted to neuronal functions.JNeurosci 27,6729-6739,doi:27 / 25 / 6729[pii]10.1523 / JNEUROSCI.0091-07.2007(2007).
[0569] 68 Schoenherr,C.J.&Anderson,D.J.Silencing is golden:negativeregulation in the control ofneuronal gene transcription.Curr Opin Neurobiol5,566-571,doi:0959-4388(95)80060-3[pii](1995).
[0570] 69 Schoenherr,C.J.,Paquette,A.J.&Anderson,D.J.Identification ofpotential target genes for the neuron-restrictive silencer factor.ProcNatlAcad Sci USA 93,9881-9886(1996).
[0571] 70 Rose,K.et al.Transcriptional repression of the M channel subunitKv7.2 in chronic nerve injury.Pain 152,742-754,doi:10.1016 / j.pain.2010.12.028(2011).
[0572] 71 Costigan,M.et al.Multiple chronic pain states are associated witha common amino acid-changing allele in KCNS1.Brain 133,2519-2527,doi:10.1093 / brain / awq195(2010).
[0573] 72 Zhang,F.et al.Repressor element 1-silencing transcription factordrives the development of chronic pain states.Pain,doi:10.1097 / j.pain.0000000000001633(2019).
[0574] 73 Zhang,J.,Chen,S.R.,Chen,H.&Pan,H.L.RE1-silencing transcriptionfactor controls the acute-to-chronic neuropathic pain transition and Chrm2receptor gene expression in primary sensory neurons.J Biol Chem 293,19078-19091,doi:10.1074 / jbc.RA118.005846(2018).
[0575] 74 Ueda,H.et al.A mimetic of the mSin3-binding helix of NRSF / RESTameliorates abnormal pain behavior in chronic pain models.Bioorg Med ChemLett 27,4705-4709,doi:10.1016 / j.bmcl.2017.09.006(2017).
[0576] 75 Uchida,H.,Sasaki,K.,Ma,L.&Ueda,H.Neuron-restrictive silencerfactor causes epigenetic silencing of Kv4.3 gene after peripheral nerveinjury.Neuroscience 166,1-4,doi:10.1016 / j.neuroscience.2009.12.021(2010).
[0577] 76 Gervasi NM.,D.A.,Clark DM.,Dingle M,,Pisarchik AV.,Nesti LJ.C-terminal domain small phosphatase 1(CTDSP1)regulates growth factor expressionand axonal regeneration.Journal of Translational Medicine Manuscriptedsubmitted for publication.(2020).
[0578] 77 Nesti,E.,Pisarchik,A.COMPOSITIONS AND METHODS FOR DEREPRESSING RE1SILENCING TRANSCRIPTION FACTOR TARGET GENES.USApatent(2019).
[0579] 78 Cole,L.A.,Kurscheid,S.,Nekrasov,M.,Domaschenz,R.,Dennis,J.H.,Tremethick,D.J.Redefining the nucleosomal architecture of active and inactivepromoters in the context of cellular plasticity and cancer.NatureCommunications revision returned(2020).
[0580] 79 Ren,Y.,Vera,D.L.,Hughes,K.A.&Dennis,J.H.Stimulation of theDrosophila immune system alters genome-wide nucleosome occupancy.Genom Data3,146-147,doi:10.1016 / j.gdata.2015.01.001(2015).
[0581] 80 Sexton,B.S.et al.The spring-loaded genome:nucleosomeredistributions are widespread,transient,and DNA-directed.Genome Res 24,251-259,doi:10.1101 / gr.160150.113(2014).
[0582] 81 Sexton,B.S.et al.Hierarchical regulation of the genome:globalchanges in nucleosome organization potentiate genome response.Oncotarget 7,6460-6475,doi:10.18632 / oncotarget.6841(2016).
[0583] 82 Lunyak,V.V.&Rosenfeld,M.G.No rest for REST:REST / NRSF regulationofneurogenesis.Cell 121,499-501,doi:10.1016 / j.cell.2005.05.003(2005).
[0584] 83 Dirks,P.B.Making a commitment:neurons refuse cancer's advances.NatNeurosci 22,507-508,doi:10.1038 / s41593-019-0373-8(2019).
[0585] 84 Kaspar,A.A.&Reichert,J.M.Future directions for peptidetherapeutics development.Drug Discov Today 18,807-817,doi:10.1016 / j.drudis.2013.05.011(2013).
[0586] 85 Hamzeh-Mivehroud,M.,Alizadeh,A.A.,Morris,M.B.,Bret Church,W.&Dastmalchi,S.Phage display as a technology delivering on the promise ofpeptide drug discovery.Drug Discovery Today 18,1144-1157,doi:10.1016 / j.drudis.2013.09.001(2013).
[0587] 86 Hoekstra,E.,Peppelenbosch,M.P.&Fuhler,G.M.Meeting reporteurophosphatase 2015:Phosphatases as drug targets in cancer.Cancer Research76,193-196,doi:10.1158 / 0008-5472.CAN-15-2091(2016).
[0588] 87 Shi,Y.Serine / Threonine Phosphatases:Mechanism throughStructure.Cell 139,468-484,doi:10.1016 / j.cell.2009.10.006(2009).
[0589] 88 Sussman,F.,Villaverde,M.C.,L.Dominguez,J.&Danielson,U.H.On theActive Site Protonation State in Aspartic Proteases:Implications for DrugDesign.Current Pharmaceutical Design,Volume 19,Number 23 19,4257-4275,
[0590] doi:10.1002 / (SICI)1520-667X(1998)10:1<19::AID-MCS3>3.0.CO;2-1(2013).
[0591] 89 Anobom,C.D.et al.From structure to catalysis:Recent developmentsin the biotechnological applications of lipases.BioMedResearch International2014,doi:10.1155 / 2014 / 684506(2014).
[0592] 90 Blundell,T.L.,Jhoti,H.&Abell,C.High-Throughput Crystallography forLead Discovery in Drug Design.Nature Reviews Drug Discovery 1,45-54,doi:10.1038 / nrd706(2002).
[0593] 91 Weir,M.R.Renin inhibitors:novel agents for renoprotection or abetter angiotensin receptor blocker for blood pressure lowering?Currentopinion in nephrology and hypertension 16,416-421,doi:10.1097 / MNH.0b013e328209fe00(2007).
[0594] 92 Yeo,M.et al.Small CTD phosphatases function in silencing neuronalgene expression.Science 307,596-600,doi:307 / 5709 / 596[pii]10.1126 / science.1100801(2005).
[0595] 93 Fulda,S.,Wick,W.,Weller,M.&Debatin,K.M.Smac agonists sensitize forApo2L / TRAIL-or anticancer drug-induced apoptosis and induce regression ofmalignant glioma in vivo.Nature Medicine 8,808-815,doi:10.1038 / nm735(2002).
[0596] 94 Noguchi,H.et al.A new cell-permeable peptide allows successfulallogeneic islet transplantation in mice.Nature Medicine 10,305-309,doi:10.1038 / nm994(2004).
[0597] 95 Pooga,M.et al.Cellular translocation of proteins bytransportan.The FASEB journal:official publication of the Federation ofAmerican Societies for Experimental Biology 15,1451-1453,doi:10.1096 / fj.00-0780fje(2001).
[0598] 96 Schwarze,S.R.,Ho,A.,Vocero-Akbani,A.&Dowdy,S.F.In vivo proteintransduction:delivery of a biologically active protein into the mouse.Science(New York,N.Y.)285,1569-1572,doi:10.1126 / science.285.5433.1569(1999).
[0599] 97 Yeo,M.,Lin,P.S.,Dahmus,M.E.&Gill,G.N.A Novel RNA Polymerase II C-terminal Domain Phosphatase That Preferentially Dephosphorylates Serine5.Journal of Biological Chemistry 278,26078-26085,doi:10.1074 / jbc.M301791200(2003).
[0600] 98 Banerjee,P.N.,Filippi,D.&Allen Hauser,W.The descriptiveepidemiology of epilepsy-a review.Epilepsy Res 85,31-45,doi:10.1016 / j.eplepsyres.2009.03.003(2009).
[0601] 99 Mucha,M.et al.Transcriptional control of KCNQ channel genes andthe regulation of neuronal excitability.J Neurosci 30,13235-13245,doi:10.1523 / JNEUROSCI.1981-10.2010(2010).
[0602] 100 Escayg,A.et al.Mutations of SCN1A,encoding a neuronal sodiumchannel,in two families with GEFS+2.Nat Genet 24,343-345,doi:10.1038 / 74159(2000).
[0603] 101 Martin,D.et al.REST represses a subset of the pancreaticendocrine differentiation program.Dev Biol 405,316-327,doi:10.1016 / j.ydbio.2015.07.002(2015).
[0604] 102 Abderrahmani,A.et al.Neuronal traits are required for glucose-induced insulin secretion.FEBS Lett 565,133-138,doi:10.1016 / j.febslet.2004.04.002(2004).
[0605] 103 Martin,D.et al.Functional significance of repressor element 1silencing transcription factor(REST)target genes in pancreatic betacells.Diabetologia 51,1429-1439,doi:10.1007 / s00125-008-0984-1(2008).
[0606] 104 Rigamonti,D.et al.Loss of huntingtin function complemented bysmall molecules acting as repressor element 1 / neuron restrictive silencerelement silencer modulators.J Biol Chem 282,24554-24562,doi:10.1074 / jbc.M609885200(2007).
[0607] 105 Sipione,S.et al.Early transcriptional profiles in huntingtin-inducible striatal cells by microarray analyses.Hum Mol Genet 25,210,doi:10.1093 / hmg / ddv416(2016).
[0608] 106 Zuccato,C.et al.Huntingtin interacts with REST / NRSF to modulatethe transcription of NRSE-controlled neuronal genes.Nat Genet 35,76-83,doi:10.1038 / ng1219(2003).
[0609] 107 Bao,S.et al.Targeting cancer stem cells through L1CAM suppressesglioma growth.Cancer Res 68,6043-6048,doi:10.1158 / 0008-5472.CAN-08-1079(2008).
[0610] 108 Jackson,M.,Hassiotou,F.&Nowak,A.Glioblastoma stem-like cells:atthe root of tumor recurrence and a therapeutic target.Carcinogenesis 36,177-185,doi:10.1093 / carcin / bgu243(2015).
[0611] 109 Liu,G.et al.Analysis of gene expression and chemoresistance ofCD133+cancer stem cells in glioblastoma.Mol Cancer 5,67,doi:10.1186 / 1476-4598-5-67(2006).
[0612] 110 Persano,L.,Rampazzo,E.,Basso,G.&Viola,G.Glioblastoma cancer stemcells:role of the microenvironment and therapeutic targeting.BiochemPharmacol 85,612-622,doi:10.1016 / j.bcp.2012.10.001(2013).
[0613] 111 Conti,L.et al.REST controls self-renewal and tumorigeniccompetence of human glioblastoma cells.PLoS One 7,e38486,doi:10.1371 / journal.pone.0038486(2012).
[0614] 112 Kamal,M.M.et al.REST regulates oncogenic properties ofglioblastoma stem cells.Stem Cells 30,405-414,doi:10.1002 / stem.1020(2012).
[0615] 113 Wagoner,M.P.&Roopra,A.A REST derived gene signature stratifiesglioblastomas into chemotherapy resistant and responsive disease.BMC Genomics13,686,doi:10.1186 / 1471-2164-13-686(2012).
[0616] 114 Taylor,P.et al.REST is a novel prognostic factor and therapeutictarget for medulloblastoma.Mol Cancer Ther 11,1713-1723,doi:10.1158 / 1535-7163.MCT-11-0990(2012).
[0617] 115 Jin,H.et al.Identification of RE1-Silencing Transcription Factoras a Promoter of Metastasis in Pancreatic Cancer.Front Oncol 9,291,doi:10.3389 / fonc.2019.00291(2019).
[0618] 116 Jackson,W.M.et al.Mesenchymal progenitor cells derived fromtraumatized human muscle.J Tissue Eng Regen Med 3,129-138,doi:10.1002 / term.149(2009).
[0619] 117 Schmitz,H.C.&Beer,G.M.The toe-spreading reflex of the rabbitrevisited--functional evaluation of complete peroneal nerve lesions.Lab Anim35,340-345,doi:10.1258 / 0023677011911930(2001).
[0620] 118 Hems,T.E.&Glasby,M.A.The limit ofgraft length in the experimentaluse of muscle grafts for nerve repair.J Hand Surg Br 18,165-170(1993).
[0621] 119 Ballas,N.et al.Regulation of neuronal traits by a noveltranscriptional complex.Neuron 31,353-365,doi:10.1016 / s0896-6273(01)00371-3(2001).
[0622] 120 Symes,A.J.et al.Ciliary neurotrophic factor coordinatelyactivates transcription of neuropeptide genes in a neuroblastoma cellline.Proc Natl Acad Sci USA 90,572-576,doi:10.1073 / pnas.90.2.572(1993).
[0623] 121 Chou,B.K.et al.Efficient human iPS cell derivation by a non-integrating plasmid from blood cells with unique epigenetic and geneexpression signatures.Cell Res 21,518-529,doi:10.1038 / cr.2011.12(2011).
[0624] 122 Swistowski,A.et al.Xeno-free defined conditions for culture ofhuman embryonic stem cells,neural stem cells and dopaminergic neurons derivedfrom them.PLoS One 4,e6233,doi:10.1371 / journal.pone.0006233(2009).
[0625] 123 Yan,Y.et al.Efficient and rapid derivation of primitive neuralstem cells and generation of brain subtype neurons from human pluripotentstem cells.Stem Cells Transl Med 2,862-870,doi:10.5966 / sctm.2013-0080(2013).
[0626] 124 Efthymiou,A.et al.Functional screening assays with neuronsgenerated from pluripotent stem cell-derived neural stem cells.J BiomolScreen 19,32-43,doi:10.1177 / 1087057113501869(2014).
[0627] 125 Malik,N.et al.Compounds with species and cell type specifictoxicity identified in a 2000 compound drug screen of neural stem cells andrat mixed cortical neurons.Neurotoxicology 45,192-200,doi:10.1016 / j.neuro.2014.10.007(2014).
[0628] 126 Pei,Y.et al.Comparative neurotoxicity screening in human iPSC-derived neural stem cells,neurons and astrocytes.Brain Res 1638,57-73,doi:10.1016 / j.brainres.2015.07.048(2016).
[0629] 127 Lischka,F.W.et al.Neonatal mouse cortical but not isogenic humanastrocyte feeder layers enhance the functional maturation of inducedpluripotent stem cell-derived neurons in culture.Glia 66,725-748,doi:10.1002 / glia.23278(2018).
[0630] 128 Papapetrou,E.P.&Schambach,A.Gene Insertion Into Genomic SafeHarbors for Human Gene Therapy.Mol Ther 24,678-684,doi:10.1038 / mt.2016.38(2016).
[0631] 129 He,R.et al.Recombinant luciferase-expressing humancytomegalovirus(CMV)for evaluation of CMV inhibitors.Virol J 8,40,doi:10.1186 / 1743-422X-8-40(2011).
[0632] 130 Jacqmain,J.,Nudi,E.T.,Fluharty,S.&Smith,J.S.Pre and post-injuryenvironmental enrichment effects functional recovery following medial frontalcortical contusion injury in rats.Behav Brain Res 275,201-211,doi:10.1016 / j.bbr.2014.08.056(2014).
[0633] 131 Monaco,C.M.et al.Environmental enrichment promotes robustfunctional and histological benefits in female rats after controlled corticalimpact injury.Exp Neurol 247,410-418,doi:10.1016 / j.expneurol.2013.01.007(2013).
[0634] 132 Shear,D.A.et al.Nicotinamide Treatment in Traumatic Brain Injury:Operation Brain Trauma Therapy.J Neurotrauma 33,523-537,doi:10.1089 / neu.2015.4115(2016).
[0635] 133 Wagner,A.K.,Postal,B.A.,Darrah,S.D.,Chen,X.&Khan,A.S.Deficits innovelty exploration after controlled cortical impact.J Neurotrauma 24,1308-1320,doi:10.1089 / neu.2007.0274(2007).
[0636] 134 Zhang,J.,Groff,R.F.&Dayawansa,S.Imipramine treatment increasescell proliferation following fluid percussion brain injury in rats.Neurol Res35,247-254,doi:10.1179 / 1743132813Y.0000000164(2013).
[0637] 135 Xiong,Y.et al.Histological and functional outcomes aftertraumatic brain injury in mice null for the erythropoietin receptor in thecentral nervous system.Brain Res 1230,247-257,doi:10.1016 / j.brainres.2008.06.127(2008).
[0638] 136 Susarla,B.T.,Villapol,S.,Yi,J.H.,Geller,H.M.&Symes,A.J.Temporalpatterns of cortical proliferation of glial cell populations after traumaticbrain injury in mice.ASN Neuro 6,159-170,doi:10.1042 / AN20130034(2014).
[0639] 137 Xiong,Y.et al.Role of gender in outcome after traumatic braininjury and therapeutic effect of erythropoietin in mice.Brain Res 1185,301-312,doi:10.1016 / j.brainres.2007.09.052(2007).
[0640] 138 Choi,S.H.,Woodlee,M.T.,Hong,J.J.&Schallert,T.A simplemodification of the water maze test to enhance daily detection of spatialmemory in rats and mice.J Neurosci Methods 156,182-193,doi:10.1016 / j.jneumeth.2006.03.002(2006).
[0641] 139 Omura,T.et al.Different expressions of BDNF,NT3,and NT4 in muscleand nerve after various types ofperipheral nerve injuries.JPeripher Nerv Syst10,293-300,doi:10.1111 / j.1085-9489.2005.10307.x(2005).
[0642] 140 Zhang,J.Y.,Luo,X.G.,Xian,C.J.,Liu,Z.H.&Zhou,X.F.Endogenous BDNFis required for myelination and regeneration of injured sciatic nerve inrodents.Eur J Neurosci 12,4171-4180(2000).
[0643] 141 Zhao,Y.et al.Brain REST / NRSF Is Not Only a Silent Repressor butAlso an Active Protector.Molecular Neurobiology 54,541-550,doi:10.1007 / s12035-015-9658-4(2017).
[0644] 142 Charbord,J.et al.High throughput screening for inhibitors of RESTin neural derivatives of human embryonic stem cells reveals a chemicalcompound that promotes expression of neuronal genes.Stem Cells 31,1816-1828,doi:10.1002 / stem.1430(2013).
[0645] 143 Nesti,L.J.et al.Differentiation potential of multipotentprogenitor cells derived from war-traumatized muscle tissue.J Bone Joint SurgAm 90,2390-2398,doi:10.2106 / JBJS.H.00049(2008).
[0646] 144 Bulken-Hoover,J.D.et al.Inducible expression of neurotrophicfactors by mesenchymal progenitor cells derived from traumatically injuredhuman muscle.Mol Biotechnol 51,128-136,doi:10.1007 / s12033-011-9445-z(2012).
[0647] 145 Mosmann,T.Rapid colorimetric assay for cellular growth andsurvival:application to proliferation and cytotoxicity assays.J ImmunolMethods 65,55-63,doi:10.1016 / 0022-1759(83)90303-4(1983).
[0648] 146 Chan,J.R.,Cosgaya,J.M.,Wu,Y.J.&Shooter,E.M.Neurotrophins are keymediators of the myelination program in the peripheral nervous system.ProcNatl Acad Sci USA 98,14661-14668,doi:10.1073 / pnas.251543398(2001).
[0649] 147 Leung,J.Y.et al.Metallothionein promotes regenerative axonalsprouting of dorsal root ganglion neurons after physical axotomy.Cell MolLife Sci 69,809-817,doi:10.1007 / s00018-011-0790-7(2012).
[0650] 148 Rothstein,J.D.,Jin,L.,Dykes-Hoberg,M.&Kuncl,R.W.Chronicinhibition of glutamate uptake produces a model of slow neurotoxicity.ProcNatl Acad Sci USA 90,6591-6595(1993).
[0651] 149 Corse,A.M.et al.Preclinical testing of neuroprotectiveneurotrophic factors in a model of chronic motor neurondegeneration.Neurobiol Dis 6,335-346,doi:10.1006 / nbdi.1999.0253(1999).
[0652] 150 Mi,R.,Chen,W.&Hoke,A.Pleiotrophin is a neurotrophic factor forspinal motor neurons.Proc Natl Acad Sci USA 104,4664-4669,doi:10.1073 / pnas.0603243104(2007).
[0653] 151 Cargnin,F.et al.An RNA binding protein promotes axonal integrityin peripheral neurons by destabilizing REST.J Neurosci 34,16650-16661,doi:10.1523 / JNEUROSCI.1650-14.2014(2014).
[0654] 152 Rueden,C.T.et al.ImageJ2:ImageJ for the next generation ofscientific image data.BMC Bioinformatics 18,529-529,doi:10.1186 / s12859-017-1934-z(2017).
[0655] 153 Woolf,C.J.Phenotypic modification ofprimary sensory neurons:therole of nerve growth factor in the production of persistent pain.Philos TransR Soc Lond B Biol Sci 351,441-448,doi:10.1098 / rstb.1996.0040(1996).
[0656] 154 Fremin,C.et al.ERK2 but not ERK1 plays a key role in hepatocytereplication:an RNAi-mediated ERK2 knockdown approach in wild-type and ERK1null hepatocytes.Hepatology 45,1035-1045,doi:10.1002 / hep.21551(2007).
[0657] 155 River,C.Sergical Services,< https: / / www.criver.com / sites / default / files / resources / VascularCatheterSurgeryOptionsInformationSheet.pdf >(2018).
[0658] 156 Beer,S.a.The toe-spreading reflex of the rabbit revisited--functional evaluation of complete peroneal nerve lesions.Laboratory Animals35,340-345(2001).
[0659] 157 Glasby,M.A.&Hems,T.E.Repairing spinal roots after brachial plexusinjuries.Paraplegia 33,359-361,doi:10.1038 / sc.1995.80(1995).
[0660] 158 Jin,J.et al.Functional motor recovery after peripheral nerverepair with an aligned nanofiber tubular conduit in a rat model.Regen Med 7,799-806,doi:10.2217 / rme.12.87(2012).
[0661] 159 Han,D.,Lu,J.,Xu,L.&Xu,J.Comparison of two electrophysiologicalmethods for the assessment of progress in a rat model of nerverepair.International Journal of Clinical and Experimental Medicine 8,2392-2398(2015).
[0662] 160 A.et al.Perineural dexmedetomidine effects on sciaticnerve in rat.Brazilian Journal of Anesthesiology(English Edition)67,57-66,doi:10.1016 / j.bjane.2015.08.012(2017).
[0663] 161 Rigaud,M.et al.Species and strain differences in rodent sciaticnerve anatomy:implications for studies of neuropathic pain.Pain 136,188-201,doi:10.1016 / j.pain.2008.01.016(2008).
[0664] 162 Sleigh,J.N.,Weir,G.A.&Schiavo,G.A simple,step-by-step dissectionprotocol for the rapid isolation ofmouse dorsal root ganglia.BMC Res Notes 9,82,doi:10.1186 / s13104-016-1915-8(2016).
[0665] 163 Ronchi,G.et al.Discrepancies in quantitative assessment of normaland regenerated peripheral nerve fibers between light and electronmicroscopy.J Peripher Nerv Syst 19,224-233,doi:10.1111 / jns.12090(2014).
[0666] 164 Varejao,A.S.et al.Functional and morphological assessment of astandardized rat sciatic nerve crush injury with a non-serrated clamp.JNeurotrauma 21,1652-1670,doi:10.1089 / neu.2004.21.1652(2004).
[0667] 165 Carriel,V.,Garzon,I.,Alaminos,M.&Cornelissen,M.Histologicalassessment in peripheral nerve tissue engineering.Neural Regen Res 9,1657-1660,doi:10.4103 / 1673-5374.141798(2014).
[0668] 166 Hazari,A.,Wiberg,M.,Johansson-Ruden,G.,Green,C.&Terenghi,G.Aresorbable nerve conduit as an alternative to nerve autograft in nerve gaprepair.Br J Plast Surg 52,653-657,doi:10.1054 / bjps.1999.3184(1999).
[0669] 167 Shi,T.J.et al.Effect of peripheral nerve injury on dorsal rootganglion neurons in the C57 BL / 6J mouse:marked changes both in cell numbersand neuropeptide expression.Neuroscience 105,249-263(2001).
[0670] 168 Jackson,W.M.et al.Mesenchymal progenitor cells derived fromtraumatized muscle enhance neurite growth.J Tissue Eng Regen Med 7,443-451,doi:10.1002 / term.539(2013).
[0671] 169 Kobiela Ketz A,B.K.,Grunberg NE,Kasper CE,Osborne L,Pryor B,Tosini NL,Wu X,Anders JJ.Characterization of macrophage / microglial activationand effect of photobiomodulation in the spared nerve injury model ofneuropathic pain..Pain Medicine 5,932-946,doi:10.1093 / pm / pnw144(2016).
[0672] 170 Whiteside,G.T.,Adedoyin A,Leventhal L.Predictive validity ofanimal pain models?A comparison ofthe pharmacokinetic-pharmacodynamicrelationship for pain drugs in rats and humans.Neuropharm,767-775,doi:10.1016 / j.neuropharm.2008.01.001(2008).
[0673] 171 LaBuda,C.J.&Fuchs,P.N.A behavioral test paradigm to measure theaversive quality ofinflammatory and neuropathic pain in rats.Exp Neurol 163,490-494,doi:10.1006 / exnr.2000.7395(2000).
[0674] 172 Xu,Y.et al.Gait Assessment of Pain and Analgesics:Comparison ofthe DigiGait and CatWalk Gait Imaging Systems.Neurosci Bull 35,401-418,doi:10.1007 / s12264-018-00331-y(2019).
[0675] 173 Hargreaves,K.,Dubner,R.,Brown,F.,Flores,C.&Joris,J.A new andsensitive method for measuring thermal nociception in cutaneoushyperalgesia.Pain 32,77-88,doi:10.1016 / 0304-3959(88)90026-7(1988).
[0676] 174 Baastrup,C.,Jensen,T.S.&Finnerup,N.B.Pregabalin attenuates placeescape / avoidance behavior in a rat model of spinal cord injury.Brain Res1370,129-135,doi:10.1016 / j.brainres.2010.11.008(2011).
[0677] 175 FDA.Guidance for industry(ed CDER;CBER)(FDA,https: / / www.fda.gov / downloads / Drugs / GuidanceComplianceRegulatoryInformation / Guidances / UCM074957.pdf,1997).
[0678] 176 FDA.S2B Genotoxicity:A Standard Battery for Genotoxicity Testingof Pharmaceuticals,<https: / / www.fda.gov / media / 71971 / download>(1997).
[0679] 177 FDA.S7B Nonclinical Evaluation of the Potential for DelayedVentricular Repolarization(QT Interval Prolongation)by Human Pharmaceuticals,<https: / / www.fda.gov / media / 72043 / download>(2005).
[0680] 178 FDA.(ed CDER;CBER)(FDA,https: / / www.fda.gov / downloads / drugs / guidances / ucm073246.pdf,2010).
[0681] 179 FDA.(ed CDER;CBER)(FDA,https: / / www.fda.gov / downloads / drugs / guidances / ucm074959.pdf,July 2001).
[0682] 180 Irwin,S.Comprehensive observational assessment:Ia.A systematic,quantitative procedure for assessing the behavioral and physiologic state ofthe mouse.Psychopharmacologia 13,222-257(1968).
[0683] 181 Morrone,L.,Scuteri,D.,Rombola,L.,Mizoguchi,H.&Bagetta,G.OpioidsResistance in Chronic Pain Management.Current Neuropharmacology 15,444-456,doi:10.2174 / 1570159X14666161101092822(2017).
[0684] 182 Ploj,K.,Roman,E.&Nylander,I.Long-term effects of short and longperiods of maternal separation on brain opioid peptide levels in male Wistarrats.Neuropeptides 37,149-156,doi:10.1016 / S0143-4179(03)00043-X(2003).
[0685] 183 Zhu,C.et al.Neuron-restrictive silencer factor–mediateddownregulation of μ-opioid receptor contributes to the reduced morphineanalgesia in bone cancer pain.PAIN 158,879-890,doi:10.1097 / j.pain.0000000000000848(2017).
[0686] 184 Lu,C.e.et al.Neuron-restrictive silencer factor in periaqueductalgray contributes to remifentanil-induced postoperative hyperalgesia viarepression of the mu-opioid receptor.Journal ofthe Neurological Sciences 352,48-52,doi:10.1016 / j.jns.2015.03.018(2015).
[0687] 185 Schwartz,A.S.&Marchok,P.L.Depression ofmorphine-seeking behaviourby dopamine inhibition.Nature 248,257-258(1974).
[0688] 186 Spyraki,C.,Fibiger,H.C.&Phillips,A.G.Attenuation of heroin rewardin rats by disruption of the mesolimbic dopamine system.Psychopharmacology79,278-283(1983).
[0689] 187 Phillips,A.G.&LePiane,F.G.Reinforcing effects of morphinemicroinjection into the ventral tegmental area.Pharmacology,biochemistry,andbehavior 12,965-968(1980).
[0690] 188 Phillips,A.G.,LePiane,F.G.&Fibiger,H.C.Dopaminergic mediation ofreward produced by direct injection of enkephalin into the ventral tegmentalarea of the rat.Life sciences 33,2505-2511(1983).
[0691] 189 Prus AJ,J.J.,Rosecrans JA.in Methods of Behavior Analysis inNeuroscience (ed Buccafusco JJ)Ch.4,(CRC Press / Taylor&Francis,2009).
[0692] 190 Carr,K.D.,Bak,T.H.,Simon,E.J.&Portoghese,P.S.Effects of theselective kappa opioid antagonist,nor-binaltorphimine,on electrically-elicited feeding in the rat.Life sciences 45,1787-1792(1989).
[0693] 191 Galli,R.et al.Isolation and characterization oftumorigenic,stem-like neural precursors from human glioblastoma.Cancer Res 64,7011-7021,doi:10.1158 / 0008-5472.CAN-04-1364(2004).
[0694] 192 Garzon-Muvdi,T.et al.Regulation of brain tumor dispersal by NKCC1through a novel role in focal adhesion regulation.PLoS Biol 10,e1001320,doi:10.1371 / journal.pbio.1001320(2012).
[0695] 193 Guerrero-Cazares,H.,Chaichana,K.L.&Quinones-Hinojosa,A.Neurosphere culture and human organotypic model to evaluate brain tumorstem cells.Methods Mol Biol 568,73-83,doi:10.1007 / 978-1-59745-280-9_6(2009).
[0696] 194 Tilghman,J.et al.Regulation of Glioblastoma Tumor-PropagatingCells by the Integrin Partner Tetraspanin CD151.Neoplasia 18,185-198,doi:10.1016 / j.neo.2016.02.003(2016).
[0697] 195 Lal,S.et al.An implantable guide-screw system for brain tumorstudies in small animals.J Neurosurg 92,326-333,doi:10.3171 / jns.2000.92.2.0326(2000).
[0698] 196 Manton,C.A.et al.Induction ofcell death by the novel proteasomeinhibitor marizomib in glioblastoma in vitro and in vivo.Sci Rep 6,18953,doi:10.1038 / srep18953(2016).
[0699] 197 Kaplan,E.L.M.,P.Nonparametric estimation from incompleteobservations.Journal of the American Statistical Association 53,457-481,doi:10.2307 / 2281868(1958).
[0700] 198 Marubini E, VMCEstimation of Survival Probabilities. Analyzing survival data from clinical trials and observational studies. 41–81 (John Wiley and Sons, 1995). Sequence Listing <110> Alcamena Stem Cell Therapy, LLC <120> Compositions and methods for derepressing RE1-silencing transcription factor target genes <130> 09097.001_PCT <140> PCT / US2020 / 061632 <141> 2020-11-20 <150> 63 / 086,248 <151> 2020-10-01 <150> 62 / 939,149 <151> 2019-11-22 <160> 350 <170> PatentIn version 3.5 <210> 1 <211> 15 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 1 Thr Glu Asp Leu Glu Pro Pro Glu Pro Pro Leu Pro Lys Glu Asn 1 5 10 15 <210> 2 <211> 49 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 2 Met Cys Thr Glu Asp Leu Glu Pro Pro Glu Pro Pro Leu Pro Lys Glu 1 5 10 15 Asn Cys Gly Ser Gly Ser Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 20 25 30 Gly Gly Ser Gly Ser Leu Gly His His His His His Gly Thr Gly 35 40 45 Tyr <210> 3 <211> 49 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 3 Met Cys Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro Ala Pro Phe Tyr 1 5 10 15 Pro Cys Gly Ser Gly Ser Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 20 25 30 Gly Gly Ser Gly Ser Leu Gly His His His His His Gly Thr Gly 35 40 45 Tyr <210> 4 <211> 38 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 4 Cys Ala Gln Lys Asp Tyr Lys Asp Asp Asp Asp Lys Thr Glu Asp Leu 1 5 10 15 Glu Pro Pro Glu Pro Pro Leu Pro Lys Glu Asn Gly Arg Lys Lys Arg 20 25 30 Arg Gln Arg Arg Arg Gly 35 <210> 5 <211> 49 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 5 Cys Thr Glu Asp Leu Glu Pro Pro Glu Pro Pro Pro Leu Pro Lys Glu Asn 1 5 10 15 Ser Gly Asp Ile Met Gly Glu Trp Gly Asn Glu Ile Phe Gly Ala Ile 20 25 30 Ala Gly Phe Leu Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 35 40 45 Gly <210> 6 <211> 30 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (30)..(30) <223> D-amino acids <400> 6 Thr Glu Asp Leu Glu Pro Pro Glu Pro Pro Leu Pro Lys Glu Asn Arg 1 5 10 15 Arg Trp Trp Arg Arg Trp Arg Arg Arg Arg Trp Trp Arg Arg 20 25 30 <210> 7 <211> 26 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (26) <223> D-amino acids <400> 7 Glu Asp Leu Glu Pro Pro Glu Pro Pro Leu Pro Lys Arg Trp Trp Arg 1 5 10 15 Arg Arg Arg Trp Arg Arg Trp Trp Arg Arg 20 25 <210> 8 <211> 27 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (27) <223> D-amino acids <400> 8 Ala Gly Asp Leu Glu Gln Pro Glu Pro Pro Val Ala Lys Lys Lys Lys 1 5 10 15 Lys Asn Arg Arg Trp Trp Arg Arg Trp Arg Arg 20 25 <210> 9 <211> 29 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(29) <223> D-amino acids <400> 9 Arg Arg Arg Arg Trp Arg Arg Trp Trp Arg Arg Trp Arg Arg Asn Glu 1 5 10 15 Lys Pro Leu Pro Pro Glu Pro Pro Glu Leu Asp Glu Thr 20 25 <210> 10 <211> 29 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (16)..(29) <223> D-amino acids <400> 10 Thr Glu Asp Leu Glu Pro Pro Glu Pro Pro Leu Pro Lys Glu Asn Arg 1 5 10 15 Arg Arg Arg Trp Arg Arg Trp Trp Arg Arg Trp Arg Arg 20 25 <210> 11 <211> 29 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (22)..(22) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (29)..(29) <223> D-amino acids <400> 11 Thr Glu Asp Leu Glu Pro Pro Glu Pro Pro Leu Pro Lys Glu Asn Arg 1 5 10 15 Arg Arg Arg Arg Arg Xaa Arg Arg Trp Trp Arg Arg Arg 20 25 <210> 12 <211> twenty four <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(6) <223> D-amino acids <220> <221> MOD_RES <222> (7)..(7) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (8)..(24) <223> D-amino acids <400> 12 Arg Arg Trp Trp Arg Arg Xaa Arg Arg Arg Arg Arg Lys Pro Leu Pro 1 5 10 15 Pro Glu Pro Pro Glu Leu Asp Glu 20 <210> 13 <211> twenty three <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(2) <223> D-amino acids <220> <221> MOD_RES <222> (3)..(3) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (4)..(5) <223> D-amino acids <220> <221> MOD_RES <222> (6) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (7)..(23) <223> D-amino acids <400> 13 Arg Arg Xaa Arg Arg Xaa Arg Arg Arg Arg Arg Lys Pro Leu Pro Pro 1 5 10 15 Glu Pro Pro Glu Leu Asp Glu 20 <210> 14 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(2) <223> D-amino acids <220> <221> MOD_RES <222> (3)..(3) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (4)..(18) <223> D-amino acids <400> 14 Arg Arg Xaa Arg Arg Arg Lys Pro Leu Pro Pro Glu Pro Pro Glu Leu 1 5 10 15 Asp Glu <210> 15 <211> 12 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 15 Glu Asp Leu Glu Pro Pro Glu Pro Pro Leu Pro Lys 1 5 10 <210> 16 <211> 15 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(15) <223> D-amino acids <400> 16 Asn Glu Lys Pro Leu Pro Pro Glu Pro Pro Glu Leu Asp Glu Thr 1 5 10 15 <210> 17 <211> 12 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(12) <223> D-amino acids <400> 17 Lys Pro Leu Pro Pro Glu Pro Pro Glu Leu Asp Glu 1 5 10 <210> 18 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 18 Met Cys Thr Glu Asp Leu Glu Pro Pro Glu Pro Pro Leu Pro Lys Glu 1 5 10 15 Asn Cys <210> 19 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 19 Met Cys Thr Glu Ala Pro Ala Pro Pro Glu Pro Ala Leu Pro Lys Lys 1 5 10 15 Lys Lys Lys Asn Cys 20 <210> 20 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 20 Met Cys Thr Glu Asp Leu Gln Pro Pro Thr Ala Val Pro Gln Glu Asn 1 5 10 15 Cys <210> twenty one <211> 20 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> twenty one Met Cys Thr Glu Ala Pro Ala Pro Pro Glu Pro Ala Leu Pro Lys Lys 1 5 10 15 Lys Lys Asn Cys 20 <210> twenty two <211> 20 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> twenty two Met Cys Thr Ala Asp Leu Glu Pro Pro Glu Pro Arg Met Glu Lys Lys 1 5 10 15 Lys Val Asp Cys 20 <210> twenty three <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> twenty three Met Cys Thr Gly Asp Leu Gln Pro Pro Lys Thr Thr Val Ser Lys Lys 1 5 10 15 Asp Cys <210> twenty four <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> twenty four Met Cys Thr Glu Asp Leu Gln Ser Pro Lys Thr Thr Met Thr Lys Glu 1 5 10 15 Asn Cys <210> 25 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 25 Met Cys Thr Glu Asp Leu Glu Pro Pro Glu Pro Pro Leu Pro Lys Glu 1 5 10 15 Asp Cys <210> 26 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 26 Met Cys Thr Glu Asp Gln Glu Gln Gln Glu Glu Gln Leu Pro Glu Glu 1 5 10 15 Asn Cys <210> 27 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 27 Met Cys Thr Ala Asp Leu Lys Pro Pro Lys Thr Thr Met Thr Lys Gln 1 5 10 15 Asn Cys <210> 28 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 28 Met Cys Pro Gly Asp Leu Lys Gln Pro Glu Pro Pro Met Pro Lys Glu 1 5 10 15 Tyr Cys <210> 29 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 29 Met Cys Thr Glu Asp Leu Glu Pro Pro Lys Ala Thr Met Thr Lys Lys 1 5 10 15 Asp Cys <210> 30 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 30 Met Cys Thr Glu Asp Gln Glu Arg Pro Pro Val Thr Lys Glu Asp Cys 1 5 10 15 <210> 31 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 31 Met Cys Ile Ala Asp Pro Glu Pro Pro Glu Ala Gln Leu Pro Glu Gly 1 5 10 15 Asn Cys <210> 32 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 32 Met Cys Thr Gly Val Gln Glu Pro Pro Glu Ala Thr Leu Pro Lys Lys 1 5 10 15 Asn Cys <210> 33 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 33 Met Cys Ser Glu Ala Gln Glu Pro Pro Glu Ser Arg Leu Pro Gln Val 1 5 10 15 Asn Cys <210> 34 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 34 Met Cys Thr Lys His Leu Glu Pro Pro Gly Pro Pro Leu Pro Gln Glu 1 5 10 15 Asn Cys <210> 35 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 35 Met Cys Thr Ala Ala Pro Glu Pro Pro Glu Pro Pro Val Ser Lys Glu 1 5 10 15 Tyr Cys <210> 36 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 36 Met Cys Thr Glu Asp Leu Gln Leu Pro Lys Thr Thr Met Thr Lys Glu 1 5 10 15 Tyr Cys <210> 37 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 37 Met Cys Ser Val Asp Leu Gln Pro Pro Ala Arg Leu Arg Pro Met Val 1 5 10 15 Asn Cys <210> 38 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 38 Met Cys Thr Gly Asp Leu Gln Pro Pro Glu Ser Arg Gln Pro Gln Val 1 5 10 15 Asn Cys <210> 39 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 39 Met Cys Thr Gly Asp Leu Gln Pro Pro Glu Ala Gln Val Ile Glu Val 1 5 10 15 Asn Cys <210> 40 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 40 Met Cys Thr Glu Asp Leu Gln Pro Pro Glu Pro Gln Leu Pro Glu Val 1 5 10 15 Asn Cys <210> 41 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 41 Met Cys Thr Glu Asp Met Glu Pro Arg Lys Thr Thr Met Thr Lys Lys 1 5 10 15 Tyr Cys <210> 42 <211> twenty two <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 42 Met Cys Thr Glu Ala Pro Ala Pro Pro Glu Pro Ala Leu Pro Lys Lys 1 5 10 15 Lys Lys Lys Lys Asn Cys 20 <210> 43 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 43 Met Cys Thr Glu Ala Pro Ala Pro Pro Glu Pro Ala Leu Pro Lys Lys 1 5 10 15 Lys Lys Lys Asn Cys 20 <210> 44 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 44 Met Cys Thr Glu Asp Leu Gln Ser Pro Lys Thr Thr Met Thr Lys Glu 1 5 10 15 Asn Cys <210> 45 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 45 Met Cys Thr Gly Asp Leu Lys Leu Pro Glu Pro Pro Met Ser Lys Lys 1 5 10 15 Lys Lys Lys Asn Cys 20 <210> 46 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 46 Met Cys Thr Glu Asp Leu Gln Pro Pro Lys Thr Thr Met Ala Glu Lys 1 5 10 15 Tyr Cys <210> 47 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 47 Met Cys Ser Glu Asp Pro Glu Pro Pro Lys Thr Thr Met Thr Lys Lys 1 5 10 15 Asn Cys <210> 48 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 48 Met Cys Thr Glu Asp Leu Lys Pro Pro Glu Ala Ser Leu Pro Glu Glu 1 5 10 15 Asn Cys <210> 49 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 49 Met Cys Ala Gly Asp Leu Glu Gln Pro Glu Pro Pro Val Ala Lys Lys 1 5 10 15 Lys Lys Lys Asn Cys 20 <210> 50 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 50 Met Cys Asn Gly Asp Leu Glu Arg Pro Glu Pro Pro Val Ala Lys Glu 1 5 10 15 Tyr Cys <210> 51 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 51 Met Cys Thr Glu Asp Leu Lys Pro Pro Glu Pro Pro Leu Pro Lys Glu 1 5 10 15 Asn Cys <210> 52 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 52 Met Cys Asn Glu Ala Leu Glu Pro Pro Pro Leu Arg Lys Glu His Cys 1 5 10 15 <210> 53 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 53 Met Cys Pro Glu Asp Leu Glu Arg Pro Pro Leu Thr Lys Glu His Cys 1 5 10 15 <210> 54 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 54 Met Cys Thr Glu Asp Leu Glu Pro Pro Glu Arg Pro Leu Pro Arg Glu 1 5 10 15 Ile Cys <210> 55 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 55 Met Cys Ala Gly Asp Leu Lys Pro Pro Glu Thr Thr Met Ser Lys Lys 1 5 10 15 Asn Cys <210> 56 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 56 Met Cys Thr Glu Asp Leu Gln Gln Pro Glu Arg Ser Gln Pro Met Glu 1 5 10 15 Ser Cys <210> 57 <211> 37 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 57 Met Cys Pro Glu Asp Leu Gln Pro Pro Glu Pro Ala Leu Pro Glu Lys 1 5 10 15 Lys Lys Lys Lys Ile Val Val Leu Ala Leu Val Val Lys Ser Ala Val 20 25 30 Ser Val Gly Val Val 35 <210> 58 <211> 35 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 58 Met Cys Thr Glu Val Leu Val Pro Arg Thr Thr Ser Gly Lys Gly Arg 1 5 10 15 Leu Trp Phe Trp Leu Trp Ser Gln Lys Gly His Pro Ser Ala Ser Ala 20 25 30 Cys Gly Ser 35 <210> 59 <211> 28 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 59 Met Cys Ala Glu Asp Leu Gln Pro Pro Pro Leu Leu Glu Ala His Cys 1 5 10 15 Gly Ser Asp Ser Gly Arg Lys Lys Arg Arg Gln Cys 20 25 <210> 60 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 60 Met Cys Thr Ala Ala Pro Glu Pro Pro Glu Pro Gln Leu Pro Gln Ala 1 5 10 15 Asn Cys <210> 61 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 61 Met Cys Pro Ala Asp Leu Gln Gln Pro Glu Thr Ser Leu Pro Glu Glu 1 5 10 15 Asn Cys <210> 62 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 62 Met Cys Ser Val Asp Leu Gln Pro Pro Ala Arg Leu Arg Pro Met Val 1 5 10 15 Asn Cys <210> 63 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 63 Met Cys Thr Glu Ala Leu Glu Pro Pro Glu Pro Pro Leu Thr Lys Glu 1 5 10 15 Asn Cys <210> 64 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 64 Met Cys Thr Glu Ala Met Glu Pro Pro Glu Pro Pro Leu Ala Arg Glu 1 5 10 15 Ser Cys <210> 65 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 65 Met Cys Thr Ala Asp Leu Gln Pro Pro Glu Ala Ser Leu Pro Gln Gln 1 5 10 15 Asn Cys <210> 66 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 66 Met Cys Thr Ala Ala Pro Glu Pro Pro Glu Pro Arg Leu Pro Glu Gly 1 5 10 15 Asn Cys <210> 67 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 67 Met Cys Thr Lys Asp Leu Ala Pro Gln Ala Pro Pro Leu Leu Lys Glu 1 5 10 15 Asn Cys <210> 68 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 68 Cys Asn Glu Lys Pro Leu Pro Pro Glu Pro Pro Pro Glu Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 69 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(21) <223> D-amino acids <400> 69 Cys Asn Lys Lys Lys Lys Lys Pro Leu Ala Pro Glu Pro Pro Ala Pro 1 5 10 15 Ala Glu Thr Cys Met 20 <210> 70 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(17) <223> D-amino acids <400> 70 Cys Asn Glu Gln Pro Val Ala Thr Pro Pro Gln Leu Asp Glu Thr Cys 1 5 10 15 Met <210> 71 <211> 20 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(20) <223> D-amino acids <400> 71 Cys Asn Lys Lys Lys Lys Pro Leu Ala Pro Glu Pro Pro Ala Pro Ala 1 5 10 15 Glu Thr Cys Met 20 <210> 72 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 72 Cys Asp Lys Lys Ser Val Thr Thr Lys Pro Pro Gln Leu Asp Gly Thr 1 5 10 15 Cys Met <210> 73 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 73 Cys Asp Lys Lys Ser Val Thr Thr Lys Pro Pro Gln Leu Asp Gly Thr 1 5 10 15 Cys Met <210> 74 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 74 Cys Asn Glu Lys Thr Met Thr Thr Lys Pro Ser Gln Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 75 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 75 Cys Asp Glu Lys Pro Leu Pro Pro Glu Pro Pro Glu Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 76 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 76 Cys Asn Glu Glu Pro Leu Gln Glu Glu Leu Leu Glu Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 77 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 77 Cys Asn Gln Lys Thr Met Thr Thr Lys Pro Pro Lys Leu Asp Gly Pro 1 5 10 15 Cys Met <210> 78 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(17) <223> D-amino acids <400> 78 Cys Tyr Glu Lys Pro Met Pro Pro Glu Pro Gln Leu Asp Gly Pro Cys 1 5 10 15 Met <210> 79 <211> 19 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(19) <223> D-amino acids <400> 79 Cys Asp Glu Lys Lys Thr Met Thr Ala Lys Pro Pro Glu Leu Asp Glu 1 5 10 15 Thr Cys Met <210> 80 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(16) <223> D-amino acids <400> 80 Cys Asp Glu Lys Thr Val Pro Pro Arg Glu Gln Asp Glu Thr Cys Met 1 5 10 15 <210> 81 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 81 Cys Asn Gly Glu Pro Leu Gln Ala Glu Pro Pro Glu Pro Asp Ala Ile 1 5 10 15 Cys Met <210> 82 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 82 Cys Asn Lys Lys Pro Leu Thr Ala Glu Pro Pro Glu Gln Val Gly Thr 1 5 10 15 Cys Met <210> 83 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 83 Cys Asn Val Gln Pro Leu Pro Pro Gly Pro Pro Glu Leu His Lys Thr 1 5 10 15 Cys Met <210> 84 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 84 Cys Asn Glu Gln Pro Leu Pro Pro Gly Pro Pro Glu Pro Ala Ala Thr 1 5 10 15 Cys Met <210> 85 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 85 Cys Tyr Glu Lys Ser Val Pro Pro Glu Pro Pro Glu Pro Ala Ala Thr 1 5 10 15 Cys Met <210> 86 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 86 Cys Tyr Glu Lys Thr Met Thr Thr Lys Pro Leu Gln Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 87 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 87 Cys Asn Val Met Pro Arg Leu Arg Ala Pro Pro Gln Leu Asp Val Ser 1 5 10 15 Cys Met <210> 88 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 88 Cys Asn Val Gln Pro Gln Arg Ser Glu Pro Pro Gln Leu Asp Gly Thr 1 5 10 15 Cys Met <210> 89 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 89 Cys Asn Val Glu Ile Val Gln Ala Glu Pro Pro Gln Leu Asp Gly Thr 1 5 10 15 Cys Met <210> 90 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 90 Cys Asn Val Glu Pro Leu Gln Pro Glu Pro Pro Gln Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 91 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 91 Cys Tyr Lys Lys Thr Met Thr Thr Lys Pro Pro Glu Met Asp Glu Thr 1 5 10 15 Cys Met <210> 92 <211> twenty three <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(23) <223> D-amino acids <400> 92 Cys Asn Lys Lys Lys Lys Lys Lys Lys Pro Lys Leu Ala Pro Glu Pro Pro 1 5 10 15 Ala Pro Ala Glu Thr Cys Met 20 <210> 93 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(21) <223> D-amino acids <400> 93 Cys Asn Lys Lys Lys Lys Lys Pro Leu Ala Pro Glu Pro Pro Ala Pro 1 5 10 15 Ala Glu Thr Cys Met 20 <210> 94 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 94 Cys Asn Glu Lys Thr Met Thr Thr Lys Pro Ser Gln Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 95 <211> twenty two <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(22) <223> D-amino acids <400> 95 Cys Asn Lys Lys Lys Lys Lys Ser Met Pro Pro Glu Pro Pro Leu Lys 1 5 10 15 Leu Asp Gly Thr Cys Met 20 <210> 96 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 96 Cys Tyr Lys Glu Ala Met Thr Thr Lys Pro Pro Gln Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 97 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 97 Cys Asn Lys Lys Thr Met Thr Thr Lys Pro Pro Glu Pro Asp Glu Ser 1 5 10 15 Cys Met <210> 98 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 98 Cys Asn Glu Glu Pro Leu Ser Ala Glu Pro Pro Lys Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 99 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(21) <223> D-amino acids <400> 99 Cys Asn Lys Lys Lys Lys Lys Ala Val Pro Pro Glu Pro Gln Glu Leu 1 5 10 15 Asp Gly Ala Cys Met 20 <210> 100 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 100 Cys Tyr Glu Lys Ala Val Pro Pro Glu Pro Arg Glu Leu Asp Gly Asn 1 5 10 15 Cys Met <210> 101 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 101 Cys Asn Glu Lys Pro Leu Pro Pro Glu Pro Pro Pro Lys Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 102 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(16) <223> D-amino acids <400> 102 Cys His Glu Lys Arg Leu Pro Pro Pro Glu Leu Ala Glu Asn Cys Met 1 5 10 15 <210> 103 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(16) <223> D-amino acids <400> 103 Cys His Glu Lys Thr Leu Pro Pro Arg Glu Leu Asp Glu Pro Cys Met 1 5 10 15 <210> 104 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 104 Cys Ile Glu Arg Pro Leu Pro Arg Glu Pro Pro Glu Leu Asp Glu Thr 1 5 10 15 Cys Met <210> 105 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 105 Cys Asn Lys Lys Ser Met Thr Thr Glu Pro Pro Lys Leu Asp Gly Ala 1 5 10 15 Cys Met <210> 106 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 106 Cys Ser Met Pro Gln Ser Arg Glu Pro Gln Gln Leu Glu Asp Glu Thr 1 5 10 15 Cys Met <210> 107 <211> 38 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(38) <223> D-amino acids <400> 107 Cys Val Val Gly Val Ser Val Ala Ser Lys Val Val Leu Ala Leu Val 1 5 10 15 Val Ile Lys Lys Lys Lys Lys Glu Pro Leu Ala Pro Glu Pro Pro Gln 20 25 30 Leu Asp Glu Pro Cys Met 35 <210> 108 <211> 36 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(36) <223> D-amino acids <400> 108 Cys Ser Gly Cys Ala Ser Ala Ser Pro His Gly Lys Gln Ser Trp Leu 1 5 10 15 Trp Phe Trp Leu Arg Gly Lys Gly Ser Thr Thr Arg Pro Val Leu Val 20 25 30 Glu Thr Cys Met 35 <210> 109 <211> 28 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(28) <223> D-amino acids <400> 109 Cys Gln Arg Arg Lys Lys Arg Gly Ser Asp Ser Gly Cys His Ala Glu 1 5 10 15 Leu Leu Pro Pro Pro Gln Leu Asp Glu Ala Cys Met 20 25 <210> 110 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 110 Cys Asn Ala Gln Pro Leu Gln Pro Glu Pro Pro Glu Pro Ala Ala Thr 1 5 10 15 Cys Met <210> 111 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 111 Cys Asn Glu Glu Pro Leu Ser Thr Glu Pro Gln Gln Leu Asp Ala Pro 1 5 10 15 Cys Met <210> 112 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 112 Cys Asn Val Met Pro Arg Leu Arg Ala Pro Pro Gln Leu Asp Val Ser 1 5 10 15 Cys Met <210> 113 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 113 Cys Asn Glu Lys Thr Leu Pro Pro Glu Pro Pro Pro Glu Leu Ala Glu Thr 1 5 10 15 Cys Met <210> 114 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 114 Cys Ser Glu Arg Ala Leu Pro Pro Glu Pro Pro Glu Met Ala Glu Thr 1 5 10 15 Cys Met <210> 115 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 115 Cys Asn Gln Gln Pro Leu Ser Ala Glu Pro Pro Gln Leu Asp Ala Thr 1 5 10 15 Cys Met <210> 116 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 116 Cys Asn Gly Glu Pro Leu Arg Pro Glu Pro Pro Glu Pro Ala Ala Thr 1 5 10 15 Cys Met <210> 117 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 117 Cys Asn Glu Lys Leu Leu Pro Pro Ala Gln Pro Ala Leu Asp Lys Thr 1 5 10 15 Cys Met <210> 118 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 118 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 1 5 10 <210> 119 <211> 31 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 119 Gly Asp Ile Met Gly Glu Trp Gly Asn Glu Ile Phe Gly Ala Ile Ala 1 5 10 15 Gly Phe Leu Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 20 25 30 <210> 120 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 120 Arg Arg Arg Arg Arg Arg Arg Arg 1 5 <210> 121 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 121 Lys Lys Lys Lys Lys Lys Lys Lys 1 5 <210> 122 <211> 19 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 122 Asp Ile Met Gly Glu Trp Gly Asn Glu Ile Phe Gly Ala Ile Ala Gly 1 5 10 15 Phe Leu Gly <210> 123 <211> twenty two <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 123 Cys His His His His Arg Lys Lys Arg Arg Gln Arg Arg Arg Arg 1 5 10 15 His His His His His Cys 20 <210> 124 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 124 Cys His His His His Arg Arg Arg Arg Arg Arg Arg Arg Arg His 1 5 10 15 His His His His Cys 20 <210> 125 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 125 Phe Phe Leu Ile Pro Lys Gly Arg Arg Arg Arg Arg Arg Arg Arg Gly 1 5 10 15 Cys <210> 126 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (2)..(2) <223> L-2-naphthylalanine <400> 126 Phe Xaa Arg Arg Arg Arg 1 5 <210> 127 <211> 15 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (15)..(15) <223> D-amino acids <400> 127 Arg Arg Trp Trp Arg Arg Trp Arg Arg Arg Arg Trp Trp Arg Arg 1 5 10 15 <210> 128 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (14)..(14) <223> D-amino acids <400> 128 Arg Trp Trp Arg Arg Arg Arg Trp Arg Arg Trp Trp Arg Arg 1 5 10 <210> 129 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (14)..(14) <223> D-amino acids <400> 129 Arg Arg Trp Trp Arg Arg Trp Arg Arg Arg Arg Trp Trp Arg 1 5 10 <210> 130 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (11)..(11) <223> D-amino acids <400> 130 Arg Arg Trp Trp Arg Arg Trp Arg Arg Arg Arg 1 5 10 <210> 131 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (9)..(9) <223> D-amino acids <400> 131 Arg Arg Trp Trp Arg Arg Trp Arg Arg 1 5 <210> 132 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 132 Arg Arg Trp Trp Arg Arg Trp Arg Arg Arg 1 5 10 <210> 133 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (7)..(7) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (14)..(14) <223> D-amino acids <400> 133 Arg Arg Arg Arg Arg Arg Xaa Arg Arg Trp Trp Arg Arg Arg 1 5 10 <210> 134 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 134 Tyr Ala Leu Thr Ser Ala Ile Ser Arg Ile Ile Thr His His His His 1 5 10 15 His His <210> 135 <211> 12 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (6) <223> 2-Amino-tetradecanoic acid <400> 135 Arg Arg Arg Arg Arg Xaa Arg Arg Trp Trp Arg Arg 1 5 10 <210> 136 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (3) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (6) <223> 2-Amino-tetradecanoic acid <400> 136 Arg Arg Xaa Arg Arg Xaa Arg Arg Arg Arg Arg 1 5 10 <210> 137 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (3) <223> 2-Amino-tetradecanoic acid <400> 137 Arg Arg Xaa Arg Arg Arg 1 5 <210> 138 <211> 2 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 138 Gly Ser 1 <210> 139 <211> 4 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 139 Gly Ser Gly Ser 1 <210> 140 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(10) <223> D-amino acids <400> 140 Arg Arg Arg Gln Arg Arg Lys Lys Arg Gly 1 5 10 <210> 141 <211> 33 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(33) <223> D-amino acids <400> 141 Arg Arg Arg Gln Arg Arg Lys Lys Arg Gly Tyr Gly Leu Phe Gly Ala 1 5 10 15 Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Gly Met Ile Asp 20 25 30 Gly <210> 142 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(8) <223> D-amino acids <400> 142 Arg Arg Arg Arg Arg Arg Arg Arg 1 5 <210> 143 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(8) <223> D-amino acids <400> 143 Lys Lys Lys Lys Lys Lys Lys Lys 1 5 <210> 144 <211> 19 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(19) <223> D-amino acids <400> 144 Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Ile Asp <210> 145 <211> twenty two <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(22) <223> D-amino acids <400> 145 Cys His His His His Arg Arg Arg Arg Gln Arg Arg Lys Lys Arg 1 5 10 15 His His His His His Cys 20 <210> 146 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(21) <223> D-amino acids <400> 146 Cys His His His His Arg Arg Arg Arg Arg Arg Arg Arg Arg His 1 5 10 15 His His His His Cys 20 <210> 147 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 147 Cys Gly Arg Arg Arg Arg Arg Arg Arg Arg Gly Lys Pro Ile Leu Phe 1 5 10 15 Phe Cys <210> 148 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(4) <223> D-amino acids <220> <221> MOD_RES <222> (5)..(5) <223> L-2-naphthylalanine <220> <221> MOD_RES <222> (6) <223> D-amino acids <400> 148 Arg Arg Arg Arg Xaa Phe 1 5 <210> 149 <211> 15 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(15) <223> D-amino acids <400> 149 Arg Arg Trp Trp Arg Arg Arg Arg Trp Arg Arg Trp Trp Arg Arg 1 5 10 15 <210> 150 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(14) <223> D-amino acids <400> 150 Arg Arg Trp Trp Arg Arg Trp Arg Arg Arg Arg Trp Trp Arg 1 5 10 <210> 151 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(14) <223> D-amino acids <400> 151 Arg Trp Trp Arg Arg Arg Arg Trp Arg Arg Trp Trp Arg Arg 1 5 10 <210> 152 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(11) <223> D-amino acids <400> 152 Arg Arg Arg Arg Trp Arg Arg Trp Trp Arg Arg 1 5 10 <210> 153 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(9) <223> D-amino acids <400> 153 Arg Arg Trp Arg Arg Trp Trp Arg Arg 1 5 <210> 154 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(10) <223> D-amino acids <400> 154 Arg Arg Arg Trp Arg Arg Trp Trp Arg Arg 1 5 10 <210> 155 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(7) <223> D-amino acids <220> <221> MOD_RES <222> (8) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (9)..(14) <223> D-amino acids <400> 155 Arg Arg Arg Trp Trp Arg Arg Xaa Arg Arg Arg Arg Arg Arg 1 5 10 <210> 156 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(18) <223> D-amino acids <400> 156 His His His His His Thr Ile Ile Arg Ser Ile Ala Ser Thr Leu 1 5 10 15 Ala Tyr <210> 157 <211> 12 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(6) <223> D-amino acids <220> <221> MOD_RES <222> (7)..(7) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (8)..(12) <223> D-amino acids <400> 157 Arg Arg Trp Trp Arg Arg Xaa Arg Arg Arg Arg Arg 1 5 10 <210> 158 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(2) <223> D-amino acids <220> <221> MOD_RES <222> (3) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (4)..(5) <223> D-amino acids <220> <221> MOD_RES <222> (6) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (7)..(11) <223> D-amino acids <400> 158 Arg Arg Xaa Arg Arg Xaa Arg Arg Arg Arg Arg 1 5 10 <210> 159 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(2) <223> D-amino acids <220> <221> MOD_RES <222> (3) <223> 2-Amino-tetradecanoic acid <220> <221> MOD_RES <222> (4)..(6) <223> D-amino acids <400> 159 Arg Arg Xaa Arg Arg Arg 1 5 <210> 160 <211> 2 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(2) <223> D-amino acids <400> 160 Ser Gly 1 <210> 161 <211> 4 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <220> <221> MOD_RES <222> (1)..(4) <223> D-amino acids <400> 161 Ser Gly Ser Gly 1 <210> 162 <211> 816 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 162 atggatagta gtgcggtgat cacacaaatc tccaaggagg aagcccgtgg gccgctgcgg 60 gggaagggtg atcaaaaatc ggcagctagt caaaaacctc gctctcgtgg gatacttcat 120 tcgctgtttt gctgcgtctg ccgcgatgac ggagaagcat tgcctgcgca ttcaggggcg 180 cctttacttg ttgaggaaaa tggtgcaatt cctaaacaaa ctccagtaca atacttactg 240 ccggaggcaa aggcacaaga cagtgataag atatgtgtag taatagactt agatgaaaca 300 ctggtacatt cgtcattcaa acctgttaat aatgcggatt tcatcatacc tgtagaaatc 360 gacggggttg tccatcaggt ttacgtcctg aagcggcctc atgtagatga atttttacag 420 cggatgggcg agttatttga atgtgtgctg tttacagcta gtcttgccaa gtacgcggat 480 cctgtcgcgg atttgcttga taagtggggt gcgtttcggg cgagattatt tcgcgaatct 540 tgcgtttttc acagaggtaa ctacgtgaag gaccttagtc gtctgggtag agatcttaga 600 agagtgctga tccttgacaa cagcccagcc agctatgtct ttcatccgga taacgcagta 660 cccgtggcgt cttggttcga caatatgtcg gacacggagc tgcatgacct gttgccgttc 720 tttgagcagt tgagtcgcgt tgatgacgtt tactcggttt tgcgtcaacc ccgtccggga 780 tctggttctg gctctcacca tcaccatcac cactag 816 <210> 163 <211> 271 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 163 Met Asp Ser Ser Ala Val Ile Thr Gln Ile Ser Lys Glu Glu Ala Arg 1 5 10 15 Gly Pro Leu Arg Gly Lys Gly Asp Gln Lys Ser Ala Ala Ser Gln Lys 20 25 30 Pro Arg Ser Arg Gly Ile Leu His Ser Leu Phe Cys Cys Val Cys Arg 35 40 45 Asp Asp Gly Glu Ala Leu Pro Ala His Ser Gly Ala Pro Leu Leu Val 50 55 60 Glu Glu Asn Gly Ala Ile Pro Lys Gln Thr Pro Val Gln Tyr Leu Leu 65 70 75 80 Pro Glu Ala Lys Ala Gln Asp Ser Asp Lys Ile Cys Val Val Ile Asp 85 90 95 Leu Asp Glu Thr Leu Val His Ser Ser Phe Lys Pro Val Asn Asn Ala 100 105 110 Asp Phe Ile Ile Pro Val Glu Ile Asp Gly Val Val His Gln Val Tyr 115 120 125 Val Leu Lys Arg Pro His Val Asp Glu Phe Leu Gln Arg Met Gly Glu 130 135 140 Leu Phe Glu Cys Val Leu Phe Thr Ala Ser Leu Ala Lys Tyr Ala Asp 145 150 155 160 Pro Val Ala Asp Leu Leu Asp Lys Trp Gly Ala Phe Arg Ala Arg Leu 165 170 175 Phe Arg Glu Ser Cys Val Phe His Arg Gly Asn Tyr Val Lys Asp Leu 180 185 190 Ser Arg Leu Gly Arg Asp Leu Arg Arg Val Leu Ile Leu Asp Asn Ser 195 200 205 Pro Ala Ser Tyr Val Phe His Pro Asp Asn Ala Val Pro Val Ala Ser 210 215 220 Trp Phe Asp Asn Met Ser Asp Thr Glu Leu His Asp Leu Leu Pro Phe 225 230 235 240 Phe Glu Gln Leu Ser Arg Val Asp Asp Val Tyr Ser Val Leu Arg Gln 245 250 255 Pro Arg Pro Gly Ser Gly Ser Gly Ser His His His His His His 26atgtgtaccg aagatctgga accaccagaa ccaccactgc caaaggaaaa ttgtggatcc 60 ggttctggct caggttcttc ccctatacta ggttattgga aaattaaggg ccttgtgcaa 120 cccactcgac ttcttttgga atactttgaa gaaaaatatg aagagcattt gtatgagcgc 180 gatgaaggtg ataaatggcg aaacaaaaag tttgaattgg gtttggagtt tcccaatctt 240 ccttattata ttgatggtga tgttaaatta acacagtcta tggccatcat acgttatata 300 gctgacaagc acaacatgtt gggtggttgt ccaaaagagc gtgcagagat ttcaatgctt 360 gaaggagcgg ttttggatat tagatacggt gtttcgagaa ttgcatatag taaagacttt 420 gaaactctca aagttgattt tcttagcaag ctacctgaaa tgctgaaaat gttcgaagat 480 cgttatgtc ataaaacata tttaaatggt gatcatgtaa cccatcctga cttcatgttg 540 tatgacgctc ttgatgttgt tttatacatg gacccaatgt gcctggatgc gttcccaaaa 600 ttagtttgtt ttaaaaaacg tattgaagct atcccacaaa ttgataagta cttgaaatcc 660 agcaagtata tagcatggcc tttgcagggc tggcaagcca cgtttggtgg tggcgaccat 720 cctccaaaat aa 732 <210> 165 <211> 243 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 165 Met Cys Thr Glu Asp Leu Glu Pro Pro Glu Pro Pro Leu Pro Lys Glu 1 5 10 15 Asn Cys Gly Ser Gly Ser Gly Ser Gly Ser Ser Pro Ile Leu Gly Tyr 20 25 30 Trp Lys Ile Lys Gly Leu Val Gln Pro Thr Arg Leu Leu Leu Glu Tyr 35 40 45 Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg Asp Glu Gly Asp 50 55 60 Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly Leu Glu Phe Pro Asn Leu 65 70 75 80 Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu Thr Gln Ser Met Ala Ile 85 90 95 Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly Gly Cys Pro Lys 100 105 110 Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val Leu Asp Ile Arg 115 120 125 Tyr Gly Val Ser Arg Ile Ala Tyr Ser Lys Asp Phe Glu Thr Leu Lys 130 135 140 Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys Met Phe Glu Asp 145 150 155 160 Arg Leu Cys His Lys Thr Tyr Leu Asn Gly Asp His Val Thr His Pro 165 170 175 Asp Phe Met Leu Tyr Asp Ala Leu Asp Val Val Leu Tyr Met Asp Pro 180 185 190 Met Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe Lys Lys Arg Ile 195 200 205 Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu Lys Ser Ser Lys Tyr Ile 210 215 220 Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr Phe Gly Gly Gly Asp His 225 230 235 240 Pro Pro Lys <210> 166 <211> 53 <212> DNA <213> Artificial sequence <220> <223>Description of artificial sequence: Synthetic primer <400> 166 aataaagctt atgtgtaccg aagatctgga accaccagaa ccaccactgc caa 53 <210> 167 <211> 48 It should be noted that there may be some minor errors in the original text. For example, in the line "195 200 205 ", the numbers are in Chinese characters which might be a mistake. I translated them as numbers in the English text for consistency. If this is not what you intended, please correct the original text for a more accurate translation. <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 167 aataggatcc acaattttcc tttggcagtg gtggttctgg tggttcca 48 <210> 168 <211> 55 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 168 aataaagctt atgtgtaccg aagctccggc accaccagaa ccagcactgc caaag 55 <210> 169 <211> 55 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 169 aataggatcc acaatttttt ttttttttct ttggcagtgc tggttctggt ggtgc 55 <210> 170 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 170 aataaagctt atgtgtaccg aagatctgca accaccaaca gcagtgccac 50 <210> 171 <211> 52 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 171 aataggatcc acaattttcc tgtggcactg ctgttggtgg ttgcagatct tc 52 <210> 172 <211> 55 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 172 aataaagctt atgtgtaccg aagctccggc accaccagaa ccagcactgc caaag 55 <210> 173 <211> 52 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 173 aataggatcc acaatttttttttttctttg gcagtgctgg ttctggtggt gc 52 <210> 174 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 174 atgtgtaccg cagatctgga accaccagaa ccacgaatgg aa 42 <210> 175 <211> 54 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 175 aataggatcc acaatctacc tttttttttt ccattcgtgg ttctggtggt tcca 54 <210> 176 <211> 53 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 176 aataaagctt atgtgtaccg gagatctgca accaccaaaa acaacagtgt caa 53 <210> 177 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 177 aataggatcc acaatctttc tttgacactg ttgtttttgg tggttgcaga 50 <210> 178 <211> 53 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 178 aataaagctt atgtgtaccg aagatctgca atcaccaaaa acaacaatga caa 53 <210> 179 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 179 aataggatcc acaattttcc tttgtcattg ttgtttttgg tgattgcaga 50 <210> 180 <211> 53 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 180 aataaagctt atgtgtaccg aagatctgga accaccagaa ccaccactgc caa 53 <210> 181 <211> 51 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 181 aataggatcc cacaatcttc ctttggcagt ggtggttctg gtggttccag a 51 <210> 182 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 182 aataaagctt atgtgtaccg aagatcagga acaacaagaa gaacaactg 49 <210> 183 <211> 52 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 183 aataggatcc acaattttcc tctggcagtt gttcttcttg ttgttcctga tc 52 <210> 184 <211> 53 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 184 aataaagctt atgtgtaccg cagatctgaa accaccaaaa acaacaatga caa 53 <210> 185 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic primers <400> 185 aataggatcc acaattttgc tttgtcattg ttgtttttgg tggtttc...
Claims
1. An isolated peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 16 and 17.
2. The peptide according to claim 1, wherein the amino acid sequence is a fusion peptide.
3. The peptide according to claim 2, wherein the amino acid sequence is fused to a cell penetrating peptide or an endosomal release sequence.
4. The peptide according to claim 3, wherein the cell-penetrating peptide or the endosomal-releasing sequence is selected from SEQ ID NO: 118-137 or 140-159.
5. The peptide of claim 3, wherein a linker connects the amino acid sequence to the cell penetrating peptide or the endosomal release sequence. The peptide according to claim 5 , wherein the linker is selected from the group consisting of SEQ ID NOs: 138, 139, 160 and 161. 7 . The peptide according to claim 3 , wherein the cell penetrating peptide or the endosomal releasing sequence is fused to the amino acid sequence at the N-terminus or the C-terminus.
8. The peptide of claim 7, wherein the fusion peptide is cyclized. 9 . The peptide according to claim 3 , wherein the fusion peptide has an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 13, and 14.
10. Use of the peptide according to any one of claims 1 to 9 in the preparation of a medicament for treating or ameliorating a disease in an animal in need thereof, wherein the disease is selected from traumatic brain injury, chronic pain, and peripheral nerve injury. The use according to claim 10 , wherein the peptide binds to CTDSP1.
12. The use according to claim 10, wherein the peptide is administered intravenously, subcutaneously, orally or via a mucosal membrane.
13. The use according to claim 10, wherein the peptide is administered in multiple doses over a period of time.
14. Use according to claim 13, wherein the period of time is less than one month.
15. The use according to claim 13, wherein the dosage is 0.01 mg / kg to 1 g / kg.
16. A pharmaceutical composition comprising the peptide according to any one of claims 1 to 9.
17. The pharmaceutical composition of claim 16, wherein the peptide is contained in an oral solution, caplet, capsule, injection, infusion, suppository, lozenge, tablet, cream, ointment or inhalant.
18. The pharmaceutical composition according to claim 16, further comprising an excipient.
Citation Information
Patent Citations
Methods and compositions useful in manipulating the stability of re1 silencing transcription factor
US20160031958A1
Supercharged proteins for cell penetration
US20160280748A1