A biological agent for improving pork quality

Abstract

The present invention provides a biological preparation for improving pork quality, belonging to the technical field of animal husbandry. The biological preparation is composed of a specific siRNA of LncRNA TCONS_00654335. The present invention finds through experiments that transfection of si-LncRNA TCONS_00654335 in pig precursor fat cells can effectively inhibit the expression of adipogenic conversion-related proteins PPAR-γ and C / EBPα and can inhibit the differentiation of pig precursor fat cells. Therefore, the inhibitor of LncRNA TCONS_00654335 can be used in pig breeding to reduce fat deposition in pork and thus improve meat quality.

Description

[0001] This case is a divisional application. The name of the invention of the original application is: A fluorescent quantitative PCR kit for assisting in predicting pork quality. The application date of the original application is: 2021-03-17, and the application number of the original application is: CN202110284400.X. Technical Field

[0002] The invention belongs to the technical field of animal husbandry, and in particular relates to a biological preparation for improving pork quality. Background Art

[0003] China is the largest producer and consumer of pork, and pork is the main source of meat for residents. With the continuous improvement of our country's economic level and people's living standards, people's consumption of pork has changed from simply demanding large quantities in the past to caring about the intrinsic quality of pork, which has put forward higher requirements for pork producers, processing companies, and retailers.

[0004] From a nutritional point of view, pork is a high-quality source of protein, fat, vitamins and minerals for the human body. Eating a moderate amount of pork is beneficial for obtaining the nutrients needed by the human body, but excessive meat intake is not good for health. The fat traits of pigs directly affect the quality of pork, such as intramuscular fat content and carcass lean meat rate. When the human body eats too much pork with a high fat content, it is easy to cause various diseases, such as obesity, cardiovascular and cerebrovascular diseases, diabetes, etc. Therefore, studying the molecular markers and molecular mechanisms related to pork fat deposition is of great significance for predicting and improving pork quality. Summary of the invention

[0005] The purpose of the present invention is to provide a fluorescent quantitative PCR kit that can assist in predicting pork quality.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] First, the present invention provides a fluorescent quantitative RCR kit for assisting in predicting pork quality, wherein the kit comprises a reagent for detecting the expression amount of LncRNA TCONS_00654335.

[0008] Preferably, the gene sequence of the LncRNA TCONS_00654335 is shown as SEQ ID NO.1.

[0009] Preferably, the reagent for detecting the expression amount of LncRNA TCONS_00654335 is a primer pair of LncRNA TCONS_00654335.

[0010] Preferably, the upstream primer sequence of the primer pair is as shown in SEQ ID NO.2,

[0011] The upstream primer sequence of the primer pair is CAAAGCCTCTCACTTCTTTGGC, SEQ ID NO.2;

[0012] The downstream primer sequence of the primer pair is TTATTGTAGCAGCCTCACCTGG, SEQ ID NO.3.

[0013] Preferably, the kit further comprises SYBR Green fluorescent dye, GAPDH primer pair, and ddH2O.

[0014] Secondly, the present invention provides the use of a reagent for detecting the expression amount of LncRNA TCONS_00654335 in preparing a fluorescent quantitative PCR kit for assisting in predicting pork quality.

[0015] Preferably, the reagent for detecting the expression amount of LncRNA TCONS_00654335 is a primer pair of LncRNA TCONS_00654335.

[0016] Preferably, the upstream primer sequence of the primer pair is as shown in SEQ ID NO.2,

[0017] The upstream primer sequence of the primer pair is CAAAGCCTCTCACTTCTTTGGC, SEQ ID NO.2;

[0018] The downstream primer sequence of the primer pair is TTATTGTAGCAGCCTCACCTGG, SEQ ID NO.3.

[0019] Finally, the present invention provides the use of LncRNA TCONS_00654335 inhibitor in the preparation of precursor adipocyte differentiation inhibitor.

[0020] Preferably, the LncRNA TCONS_00654335 inhibitor is siRNA of LncRNA TCONS_00654335.

[0021] The positive strand of the siRNA: GGAUAGAUUUCAACCUCAAGC, SEQ ID NO.6;

[0022] The antisense strand of the siRNA: UUGAGGUUGAAAUCUAUCCCU, SEQ ID NO.7.

[0023] The beneficial effects of the present invention are:

[0024] 1. The present invention provides a fluorescent quantitative PCR kit for assisting in predicting pork quality. When the expression level of LncRNA TCONS_00654335 is high, it indicates that the fat content of the meat is high, and when the expression level of LncRNA TCONS_00654335 is low, it indicates that the lean meat content of the meat is high. Therefore, it can be used to identify the quality of pork, and the kit can be used in breeding to select high-quality pigs with the required meat quality. Compared with traditional methods, fluorescent quantitative PCR has higher sensitivity and specificity.

[0025] 2. Secondly, the present invention provides a specific siRNA of LncRNA TCONS_00654335, and the present invention has found through experiments that transfection of si-LncRNA TCONS_00654335 in pig preadipocytes can effectively inhibit the expression of adipogenic conversion-related proteins PPAR-γ and C / EBPα and can inhibit the differentiation of pig preadipocytes. Therefore, the inhibitor of LncRNA TCONS_00654335 can be used in pig breeding to improve meat quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The expression difference of lncRNA TCONS_00654335 in subcutaneous adipose tissue of Landrace pig and Laiwu pig and the ROC curve of the difference;

[0027] Figure 2 Detection of the inhibitory effect of the designed si-LncRNA TCONS_00654335;

[0028] Figure 3 Effects of si-LncRNA TCONS_00654335 on differentiation of porcine preadipocytes;

[0029] Figure 4 Effect of si-LncRNA TCONS_00654335 on adipogenic transformation-related proteins PPAR-γ and C / EBPα in porcine preadipocytes. DETAILED DESCRIPTION

[0030] In order to clearly illustrate the technical features of this solution, this solution is described below through a specific implementation method.

[0031] Example 1 Differential expression of LncRNA TCONS_00654335 in subcutaneous adipose tissue of Landrace pigs and Laiwu pigs

[0032] 1. RNA Sample Extraction

[0033] (1) Subcutaneous adipose tissues of 32 Landrace pigs and 32 Laiwu pigs at 150 days of age were collected and stored in a -80°C refrigerator for later use;

[0034] (2) Take about 100 mg of tissue in a pre-cooled mortar, add a small amount of liquid nitrogen and quickly grind it into powder. After grinding, transfer it to a 1.5 ml EP tube;

[0035] (3) Add 1 ml of Trizol reagent to each tube, vortex to mix the tissue and reagent thoroughly, and let stand at room temperature for 15 minutes;

[0036] (4) Centrifuge at 12000 rpm for 10 min at 4°C and transfer the supernatant to a new EP tube;

[0037] (5) Add 200 μl of chloroform, shake and mix, let stand at room temperature for 15 min, centrifuge at 12,000 rpm at 4°C for 15 min, and transfer the supernatant to a new EP tube;

[0038] (6) Add 0.5 ml of isopropanol and mix well. Incubate at room temperature for 10 min. Centrifuge at 12,000 g for 10 min at 4 °C. Discard the supernatant to obtain RNA precipitate.

[0039] (7) Add 1 ml of 75% ethanol, gently shake the EP tube to suspend the precipitate, centrifuge at 8000 g for 5 min at room temperature, and discard the supernatant;

[0040] (8) After drying at room temperature, use 40ul DEPC water to dissolve the precipitate.

[0041] 2. Reverse transcription reaction and fluorescence quantitative PCR reaction

[0042] (1) Using the total RNA obtained in step 1 as a template, reverse transcription was performed to obtain cDNA. The reverse transcription reaction system was: 5.5 μL RNA, 8 μL dNTPs, 1.5 μL Random primer, 4 μL 5×M-MLV Buffer, 0.5 μL RRI, 0.5 μL M-MLV;

[0043] The reverse transcription reaction conditions were: 30°C for 10 min, 42°C for 1 h, and 70°C for 5 min;

[0044] (2) Primers were designed based on the gene sequence of LncRNA TCONS_00654335, which is located at 117789046-117791862 on pig chromosome 7, and the sequence is shown in SEQ ID NO.1;

[0045] The primer sequences of LncRNA TCONS_00654335 are as follows:

[0046] Upstream primer: CAAAGCCTCTCACTTCTTTGGC, SEQ ID NO. 2;

[0047] Downstream primer: TTATTGTAGCAGCCTCACCTGG, SEQ ID NO.3;

[0048] GAPDH was used as an internal reference. The primer sequence of GAPDH is as follows:

[0049] Upstream primer: TTCCAGTATGATTCCACCCACG, SEQ ID NO. 4;

[0050] Downstream primer: GGACTCCACAACATACGTAGCA, SEQ ID NO. 5;

[0051] (3) Fluorescence quantitative PCR detection

[0052] Fluorescence quantitative PCR reaction was carried out according to the following reaction system and reaction conditions

[0053] Reaction system: 10 μl SYBR Green Premix Ex Taq (2×), 0.4 μl upstream primer, 0.4 μl downstream primer, 2 μl cDNA template, 7.2 μl ddH2O.

[0054] Reaction conditions: 95°C for 5 min; 95°C for 10 s, 60°C for 30 s, 72°C for 25 s, 35 cycles; 72°C for 7 min

[0055] Adoption 2 -△△Ct Methods The relative expression levels were calculated.

[0056] Experimental Results

[0057] The experimental results obtained from Example 1 are as follows Figure 1 As shown in the figure, in the subcutaneous fat tissue of Laiwu pigs, the relative expression of LncRNA TCONS_00654335 is 3.769±1.569, indicating that the expression of LncRNA TCONS_00654335 in the subcutaneous fat tissue of Laiwu pigs with high fat content is significantly higher than that in the subcutaneous fat tissue of Landrace pigs with low fat content. At the same time, the ROC curve shows that the AUC value between the two is 0.9521, indicating that the differential expression has excellent specificity and sensitivity. Therefore, the expression of LncRNA TCONS_00654335 in the subcutaneous fat tissue of pigs can be used to assist in the diagnosis of high and low fat content in pork, and to assist in the breeding of pigs with different fat contents. Compared with traditional methods, the fluorescence quantitative PCR detection method has higher sensitivity and specificity.

[0058] Example 2

[0059] Obtaining Laiwu pig preadipocytes

[0060] (1) A 1-day-old Laiwu pig was killed by inserting a scalpel directly into the heart, placed in an alcohol basin for disinfection, and subcutaneous fat tissue was dissected in an ultra-clean workbench and placed in the prepared penicillin-streptomycin mixture;

[0061] (2) Use ophthalmic scissors to cut the tissue into 1 mm pieces. 3 Transfer the pellet to a 15 ml centrifuge tube and add 10 times the volume of collagenase I;

[0062] (3) Place the centrifuge tube in a 37°C incubator for 100 min, shaking the centrifuge tube every 10 min;

[0063] (4) Filter the liquid in the centrifuge tube using a 100 μm filter membrane, centrifuge at 200 g for 10 min, discard the supernatant, add an equal volume of red blood cell lysis buffer, and leave at room temperature for 20 min;

[0064] (5) Centrifuge at 200 g for 10 min, remove the supernatant, and count the cells using trypan blue. 5 The cells were seeded into 25 cm 2 in cell culture flasks;

[0065] (6) Place the cell culture flask in a cell culture incubator and replace the culture medium after culturing for 24 hours to obtain porcine preadipocytes.

[0066] Example 3

[0067] Design and validation of siRNA targeting LncRNA TCONS_00654335

[0068] (1) Design siRNA based on the gene sequence of LncRNA TCONS_00654335. The designed siRNA is as follows:

[0069] Sense chain: GGAUAGAUUUCAACCUCAAGC, SEQ ID NO.6;

[0070] Antisense strand: UUGAGGUUGAAAUCUAUCCCU, SEQ ID NO.7;

[0071] (2) The preadipocytes obtained in Example 2 were inoculated into a cell culture plate and transfected according to the groups of empty group (empty liposome lipofectamine 2000), si-NC group (transfected with siNC), and si-LncRNA TCONS_00654335 group (transfected with LncRNA TCONS_00654335 siRNA), with 5 replicates in each group;

[0072] (3) After transfection, RNA was extracted according to the steps in the example, reverse transcription reaction was performed, and fluorescence quantitative PCR was performed to detect the relative expression level of LncRNA TCONS_00654335.

[0073] Experimental Results

[0074] The experimental results obtained in Example 3 are as follows Figure 2 As shown in the figure, it can be seen that there is no significant difference in the expression level of LncRNA TCONS_00654335 between the siNC group and the idle group, while the relative expression level of LncRNA TCONS_00654335 in the si-LncRNA TCONS_00654335 group was significantly reduced to 0.278±0.089, indicating that the si-LncRNA TCONS_00654335 designed in the present invention can effectively inhibit the expression of LncRNA TCONS_00654335 in pig preadipocytes.

[0075] Example 4

[0076] Effect of transfection of si-LncRNA TCONS_00654335 on differentiation of porcine preadipocytes

[0077] 1. Induction and differentiation of porcine preadipocytes

[0078] (1) Porcine preadipocytes transfected with si-NC and si-LncRNA TCONS_00654335 were inoculated into cell culture plates. When the cell density reached 100%, contact inhibition was performed for 48 h. Three replicates were set for each group.

[0079] (2) The culture medium was replaced with induction medium I (10% DMEM / F12 medium containing 1 M dexamethasone, 5 g / ml insulin and 0.5 mM IBMX). After 2 days of culture, the culture medium was replaced with induction medium II and cultured for another 6 days, with the medium changed every 2 days.

[0080] 2. Oil Red O Staining

[0081] (1) Add 2g of Oil Red O powder to 200ml of isopropanol to fully dissolve it. When using, mix it in the ratio of 2 parts of Oil Red O saturated liquid to 3 parts of distilled water;

[0082] (2) Gently rinse the cells in step 1 three times with PBS and add 10% formaldehyde to fix them at room temperature for 15 minutes;

[0083] (3) Discard the methanol fixative, wash twice with deionized water, and then wash twice with 60% isopropanol;

[0084] (4) Discard the washing solution, add Oil Red O staining solution to completely cover the cells, and place in a dark place for 20 minutes;

[0085] (5) Aspirate the staining solution, wash twice with deionized water, and then observe and take pictures using an inverted microscope;

[0086] (6) After taking the photo, add 500 μl of isopropanol to extract the Oil Red O staining solution bound to the cells;

[0087] (7) After 20 minutes, add the extract into a 96-well plate and measure the OD value at 490 nm.

[0088] Experimental Results

[0089] The experimental results obtained in Example 4 are as follows Figure 3 As shown in the figure, it can be seen that after transfection of si-LncRNA TCONS_00654335, the lipid droplet content in pig preadipocytes was significantly reduced, among which the OD value of the si-LncRNA TCONS_00654335 group was 0.643±0.041, and the OD value of the si-NC group was 1.344±0.078. The results indicate that the differentiation of pig preadipocytes into adipocytes can be effectively inhibited by inhibiting LncRNATCONS_00654335.

[0090] Example 5

[0091] Effects of transfection of si-LncRNA TCONS_00654335 on the expression of adipogenic transformation-related proteins PPAR-γ and C / EBPα during the transformation of porcine preadipocytes into adipocytes

[0092] 1. Protein Extraction

[0093] (1) The culture medium of the porcine preadipocytes induced in step 1 of Example 4 was removed, and the cells were washed twice with PBS. 150 μl of cell lysis solution was added to each well. The cells were completely scraped off the culture plate with a cell scraper and added to a 1.5 ml sterile centrifuge tube;

[0094] (2) Centrifuge at 12000g for 5 min, carefully aspirate the supernatant, determine the protein concentration using the BCA protein quantification method, add loading buffer, and heat in boiling water for 5 min to obtain a protein sample;

[0095] 2. Electrophoresis

[0096] (1) Prepare a 5% upper gel and a 10% lower gel, and add the protein maker and protein sample into the gel wells according to the electrophoresis rack;

[0097] (2) The voltage of the upper layer of glue is set to a constant voltage of 80 V, and the voltage of the lower layer of glue is set to a constant voltage of 120 V, until bromophenol blue runs out of the lower layer of glue;

[0098] 3. Transfer and Blocking

[0099] (1) Cut the PVDF membrane, activate it in methanol for 30 seconds, remove the upper gel, and soak the cut gel in transfer buffer for about 5 minutes;

[0100] (2) Place the negative electrode of the transfer clip with the sponge in the transfer solution, place 3 soaked filter papers on it, then place the gel on the filter papers, place the PVDF membrane on the gel and use a plastic plate to gently squeeze to remove bubbles;

[0101] (3) Cover the PVDF membrane with three pieces of soaked filter paper and a soaked sponge, fix the positive and negative electrodes of the transfer clip together, place it in the electrotransfer tank, and electrotransfer at 250 mA for 1.5 h.

[0102] (4) After electroporation, remove the PVDF membrane, place it in a plate, and add TBST to wash for 10 min.

[0103] (5) After washing, add blocking solution to completely cover the membrane and block for 1 hour;

[0104] 4. Antibody Incubation and Development

[0105] (1) After blocking, wash the membrane three times with TBST, add diluted PPAR-γ, C / EBPα and β-actin primary antibodies to the incubation box, and incubate in a 4°C refrigerator overnight;

[0106] (2) After the incubation, the primary antibody was recovered, washed three times with TBST, and the diluted secondary antibody was added and incubated at room temperature for 1 h.

[0107] (3) In a darkroom, develop and expose.

[0108] Experimental Results

[0109] The experimental results are as follows Figure 4As shown in the figure, it can be seen that after transfection with si-LncRNA TCONS_00654335, the protein expression of PPAR-γ and C / EBPα in adipogenic induced pig preadipocytes was significantly reduced, indicating that in the process of transformation of pig preadipocytes into adipocytes, inhibition of LncRNA TCONS_00654335 can effectively inhibit the expression of PPAR-γ and C / EBPα proteins, thereby effectively inhibiting the transformation of pig preadipocytes into adipocytes. Therefore, the LncRNA TCONS_00654335 inhibitor can be used to prepare pig preadipocyte differentiation inhibitors, thereby providing the possibility for further effective breeding of high-quality meat pigs. Sequence Listing <110> Qingdao Jiazhi Biotechnology Co., Ltd. Shandong New Hope Liuhe Group Co., Ltd. <120> A biological agent for improving pork quality <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2817 <212> DNA <213> Pig (Sus scrofa domestica) <400> 1 gttaagggat agatttcaac ctcaagcacc acgtaagaga ggatcagttt taaaatttag 60 gtctgagtta tctggctctt ttttcttaga atctaacatt gatttttttt tttctctcca 120 gtgacaggtg acatcccctc ccctccaatt acatctctgt gaaaatggca cccaggacct 180 caaagtttta aaacaaatgg ggtggtgaca ggcaatccaa gtctcgactg ttcttggctg 240 ttgctgttct gcttcaaaca ccaagtaaac accaagtaac cacaacaaaa cgatcgccct 300 gaagcaccgt ctccatggag acagggatgg cacagctca gtgcgtcctt caccagaaca 360 cctggagacc ctctcgctca gatgatggga agatggaact gcttacctgt ctcaatcctg 420 gactcccatc ctacaaact gcccctcgct cagacaacga agctgccgac tttccctctgc 480 aaacgcttcc accaggaag acatcattcc accaccagg aagccttcgg gaaggagaca 540 caccctccca agcggcagaa gcggtaggt ttgcagaaaa tacagccacg gatagcccctc 600 ccagggtgct taacttcggt ctcatttatc tacagttatt gtccaagtca tacagactcg 660 tcagtaagtt tcagtgacgg tctctgccaa ataatgcaa caccaatgga ccaaaacgaa 720 aatgaaaacc aaaaaaagtc tgaatggctt accttgata tgctgagga gaggcgggag 780 gtgtattgaa cacattcgag tgtgagtgat aaggtgtctt ttcaagcc tgaattagat 840 tttgtctata ctctgggtct atgcaccaca atgacccctt cccgatactc tgcaggaaa 900 attaaaatag agagtcatt aacacagaga cagtaagcat tctgcagtaa gtagacggat 960 agctcttatc acagttacta attttcaa gcctcact tctttgcaa ctgtttgccg 1020 gccttaacta ttgtactatt gtcctcagac aacagaacac cagacaatgc gcttccatgt 1080 acttggatta agtttgacaa aatgaacatg ttattaccag gtgaggctgc tacaataata 1140 ctgtaatttt catagcctac taaccaaaac cctcagatgc ctttattatt tttccgtgtc 1200 agctgtgaag aacctatgtg ttctaacaat gagttttaaa tctgccagat ttcaagggct 1260 tacagaaaaa gagggcagag gcggcctcaa aactttgtgc ctgctttaaa aatgccagag 1320 ttatgttttt caaaccatat tacatcaatg ccacttgaca aaaacaggaa agtgatccgc 1380 ttgttttttt tcctacttac aaaagacaga catttaaact tcgagtggca ttctgtgatg 1440 acctgcccca agaaaccaga gaactcaggc cgcaggggta aacctaaggc cagaatccca 1500 tatttattct ttggattcct cagtgctgga ttctgctcca gacctgaatc ttccaaagtc 1560 aaatttggca gaagtcagat ttacaacgcg aatctgatcg ggttccatgg aaagagggag 1620 actttgcttt gagacccact ttcagctgga cgctttcgtt ctgcatgcag cacattagaa 1680 aacaaatgta agaccttcct ctgaggcccg ctggaactgg aggcaggccg aggggcagtc 1740 ccggcttgga aggctggctt tcgagtgacc gaatgtaccc aagctgtttg ataaggtcat gtgtaaatt ttactaatct ggagagaaaa gaggtcaaat tatataacc cgtgcccacc ccatgcttcc agccaacgga ctctctcatt ttcacaacta ctgaacttca ggaagattca gaaagcacgc aggaaatca tttaactagg ctatggggca aagtgcacaa aagtccctta gaggagac tcaaaattaa gttattccta aaatctttaa agacgtttaa aaaatctgtt atttcggtca tcagtttcct aaatagttta cttccaaact tattcacaga acccattaa attccttcct atcaaccaca tgggtgccct gaatacaggg aattgctcaa agccaaggtc aggggctgga gccttcagtc acccccgtca cccatcccca ggtgcaggcc tgaccccaaa caccacccca gtcgggctga cgtgcctggg gctacacact aaagttcccg gagtttaa gacatgaaag attgcaactt tggaaaattc agtgtcctta cgtggccttt cctttctcgg gtacgtggtc aagcccagaa cagttccggg gggcttatga catttctgg gtaaagcagg cagggcccca acgatcagcc ctgaaccttc ctttctgtcc tttgggaaaa aactgttcag cacagttttc agaagaaag ccaagccaag ccaaaggggt agggaagcgg ggggcagagg agggcgaccg gtacggacta aatctgcata ctgcagaacc aagcaccaaa gccgggcatg ctctgggcag cgggggtccg cccctagaac cctgtgcctc tgggtgagac cacccttctg atccacctga aggagccagg gggaggccca gggcccacgt gcaaccctaa cacttcggcc 2700. aggagattat ctcagctctg ggaaccccgt ggggcttttg ttttcatcga ggtggctttc 2760. ggggtggggc cggttaatt ttcagggaat aaaaatatga caaagcgatg aaggga <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <400> 2 caaagcctct cacttctttg gc <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <400> 3 ttattgtagc agcctcacct gg <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <400> 4 ttccagtatg attccaccca cg <210> 5 <211> twenty two <212> DNA <213> Artificial Sequence <400> 5 ggactccaca acatacgtag ca 22 <210> 6 <211> twenty one <212> RNA <213> Artificial Sequence <400> 6 ggauagauuu caaccucaag c 21 <210> 7 <211> twenty one <212> RNA <213> Artificial Sequence <400> 7 uugagguuga aaucuauccc u 21

Claims

1. Application of LncRNA TCONS_00654335 inhibitor in the preparation of preadipocyte differentiation inhibitor, characterized in that: The LncRNA TCONS_00654335 inhibitor is siRNA of LncRNA TCONS_00654335, The positive strand of the siRNA: GGAUAGAUUUCAACCUCAAGC, SEQ ID NO.6; The antisense strand of the siRNA: UUGAGGUUGAAAUCUAUCCCU, SEQ ID NO.7; The gene sequence of LncRNA TCONS_00654335 is shown in SEQ ID NO.1; The preadipocytes are Laiwu pig subcutaneous preadipocytes.

Images