A method for mass production of exogenous protein using chicken ovalbumin gene

Abstract

The invention relates to the technical field of genetic engineering, and discloses a method for mass production of exogenous protein using chicken ovalbumin gene. The method comprises the following steps: gene editing of chicken endogenous ovalbumin gene is performed, and the exogenous gene is connected by any amino acid fragment with a linking effect, so that the exogenous protein is expressed and secreted together with the ovalbumin in the chicken oviduct, and is integrated into eggs, thereby realizing mass production of the exogenous protein. The method has the characteristics of large production volume, stability and high efficiency, and also has good applicability to non-secretory exogenous proteins, thereby providing a practical solution for mass production of exogenous recombinant proteins using poultry.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a method for mass production of foreign protein using chicken ovalbumin gene. Background Art

[0002] The production of recombinant proteins is of great value to basic scientific research, vaccine production, clinical medical applications, etc. At present, the commonly used vectors in the production of recombinant proteins are microbial vectors (such as Escherichia coli, yeast) and animal cell vectors (293T cells). Microbial systems can express recombinant proteins in vitro by constructing recombinant protein expression plasmids, etc., which can increase production and reduce production costs when mass and industrial production is carried out; when animal cells are used as vectors, overexpression plasmid transfection, gene integration and other schemes can be used to enable cell lines to produce proteins in large quantities, which can be collected and purified for subsequent applications. Although the production of recombinant proteins using microorganisms and animal cells has the advantages of flexibility and convenience, these schemes often encounter problems such as protein misfolding and microbial endotoxin residues, and the yield still cannot meet the requirements of the pharmaceutical industry and industrial-grade applications.

[0003] The use of animals as bioreactors for the production of recombinant proteins has a very good application prospect. Milk, eggs and meat are the main sources of animal protein for humans. Among them, milk and eggs are obtained in large quantities through non-slaughter, sustainable production methods. Therefore, the tissues that produce these two types of products (cow mammary glands, chicken oviducts) are ideal bioreactors for recombinant protein production. Among them, chickens are one of the ideal animals for recombinant protein production because the feeding cost, production cost, and management cost of chickens are lower than those of large animals.

[0004] In the past, in the production of recombinant proteins using chickens, retrovirus schemes were often used to infect the entire tissue with viruses in the early stages of chicken embryo development, so that the whole body tissues of the chickens after development contained high expression of recombinant proteins, and there was also relevant expression in the chicken oviduct, thereby realizing the production of recombinant proteins in eggs. Although the viral transcription scheme can achieve production, the viral scheme used has obvious disadvantages in terms of product safety and animal welfare. With the development of scientific level, subsequent studies have found that chicken primordial germ cells can still maintain good gonadal genetic ability after long-term culture in vitro, so they are of great value in the production of transgenic chickens. Therefore, schemes for the production of recombinant proteins using primordial germ cells have gradually emerged, and various attempts at recombinant protein production have been made, but the amount of protein produced in these studies is still low.

[0005] There are many reasons for the low yield of recombinant proteins in chicken oviduct bioreactors, among which the secretion of proteins is one of the key factors limiting the yield. Protein expression and secretion are two different characteristics. The high expression of recombinant proteins in chicken oviducts does not mean that they can be secreted outside the cells to become a component of eggs. Therefore, most of the various expression schemes used in the past only considered the expression amount of recombinant proteins, but did not consider the problem of their secretion amount. Therefore, most schemes are only applicable to proteins with certain secretion ability such as IFN-b. In the production of non-secretory recombinant proteins using animal bioreactors such as chicken oviducts, it is necessary to add secretory signal peptide sequences at both ends of the protein to help the recombinant protein pass through the cell membrane of the carrier cell, thereby achieving the purpose of secretion. However, research on secretable signal peptides is still lacking, and they do not necessarily have corresponding secretion effects in special cell types such as bovine mammary cells and chicken oviduct epithelial cells. Therefore, it is difficult to use animals to produce non-secretory recombinant proteins.

[0006] In view of the problem of low protein yield in the existing production of recombinant proteins using the chicken oviduct as a bioreactor, the inventors have established a method for mass production of exogenous proteins by gene editing the endogenous ovalbumin gene of the chicken and connecting the exogenous gene through a special linker (such as (EAAAK)n), so that the exogenous protein is expressed and secreted together with the ovalbumin in the chicken oviduct and integrated into the egg. Experiments show that the present invention has the characteristics of large recombinant protein production, stable and efficient, and also has good applicability to non-secretory exogenous proteins, providing a practical solution for mass production of exogenous recombinant proteins using poultry. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a method for mass production of exogenous protein using chicken ovalbumin gene, comprising the following steps:

[0008] (1) Rapid isolation and establishment of chicken gonadal primordial germ cells;

[0009] (2) Gene editing and purification of the chicken ovalbumin gene in chicken primordial germ cells;

[0010] (3) Transplantation of chicken primordial germ cells and production of gene-edited chickens;

[0011] (4) preliminary collection of recombinant protein, i.e., ovalbumin-linker-foreign protein;

[0012] (5) Maintaining a population of chickens producing recombinant protein, i.e., ovalbumin-linker-foreign protein.

[0013] Preferably, the gene editing site in step (2) is the coding region of the last exon of the chicken ovalbumin gene, i.e., the CDS region, and by adding a synonymous mutation to the inserted gene fragment, no frameshift mutation is generated when it is connected to the exogenous protein for expression, so that the recombinant protein is expressed correctly.

[0014] Preferably, the optimal amino acid sequence for connecting ovalbumin and the exogenous gene linker in the gene editing of step (2) is (EAAAK)n, where n represents a number from 1 to 5, that is, specifically including the following amino acid sequences: EAAAK, EAAAKEAAA, EAAAKEAAAKEAAAK, EAAAKEAAAKEAAAKEAAAKEAAAK, EAAAKEAAAKEAAAKEAAAKEAAAK.

[0015] Preferably, the linker connecting ovalbumin and the exogenous protein in the gene editing of step (2) is any amino acid fragment having a connecting effect.

[0016] Preferably, the specific operation of step (2) is: after the isolation of chicken primordial germ cells is completed, gene editing is performed during in vitro culture for 14-20 days, and the gene editing technology uses CRISPR / Cas9, TALEN and other related technologies. After gene editing, cells with red fluorescence can be sorted and enriched using a flow cytometer, and culture is continued for 3-5 days.

[0017] Preferably, the specific operation of step (3) is: after gene editing and enrichment of the primordial germ cells, continue to culture the primordial germ cells for 3-5 days, use chicken embryos with an embryonic age of 50-55 hours as recipients, transplant the primordial germ cells into the heart of the chicken embryo, return them to the incubator and continue to incubate until the F0 generation of chicks are born; after the F0 generation chicks are born, mate the F0 generation roosters with wild-type chickens to produce F1 generation chickens, and the chickens with red fluorescence in the F1 generation are gene-edited chickens.

[0018] Preferably, the specific operation of step (4) is: after the F1 generation gene-edited hens start laying eggs, directly collect the egg supernatant, which contains a large amount of recombinant protein and can be directly used for downstream industrial-grade purification.

[0019] Preferably, the specific operation of step (5) is: when maintaining the population, maintaining a group of roosters expressing fluorescent protein; when performing mass production, continuously using the group of roosters edited with the ovalbumin gene to mate with wild-type hens, thereby maintaining the continuous production of gene-edited egg-laying hens.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] 1. Utilize the complete expression elements of endogenous ovalbumin gene, such as enhancer and promoter, to drive the expression of exogenous recombinant protein, so as to achieve the effect of specific and large-scale expression in oviduct tissue;

[0022] 2. The exogenous protein produced by the present invention can reach an expression level of mg / mL in egg white. Taking EGFP as an example, the recombinant protein egg produced by the present invention has an EGFP protein content of about 1.0-3 mg / mL in 1 mL of egg white, and this production characteristic can be well maintained in gene editing of subsequent generations;

[0023] 3. The mass production scheme of recombinant proteins established by the present invention has wide applicability and is applicable to both non-secretory proteins and secretory proteins;

[0024] 4. The recombinant protein produced in the present invention is connected to the ovalbumin by a linker, and there is a certain spatial distance between the two proteins, which maintains the spatial distance between the two proteins and better maintains the independence of their functions;

[0025] 5. The present invention utilizes primordial germ cells to produce gene-edited chickens. The gene editing process does not use virus-related vectors and has good biosafety. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a diagram of primordial germ cells cultured in vitro after separation and purification according to the present invention;

[0027] Figure 2 This is a schematic diagram of the design of the gene editing scheme for primordial germ cells of the present invention;

[0028] Figure 3 3 are morphological diagrams of primordial germ cells of the present invention, wherein A is a morphological diagram of primordial germ cells after gene editing, and B is a morphological diagram of primordial germ cells after flow sorting and enrichment;

[0029] Figure 4 This is a graph showing the expression of the non-secreted recombinant protein EGFP in the egg white of gene-edited chickens after the production of gene-edited chickens.

[0030] Figure 5 This is a graph showing the production of EGFP recombinant protein in gene-edited chickens after two generations of mating. DETAILED DESCRIPTION

[0031] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the implementation rules and drawings. The exemplary implementation modes of the present invention and their descriptions are only used to explain the present invention and are not intended to limit the present invention.

[0032] Example:

[0033] 1. Material Preparation

[0034] The breeding eggs used in the experiment come from Guangdong Wuhei chickens and Guangxi Sanhuang chickens; local chicken breeding eggs can be used in actual operations.

[0035] 2. Methods

[0036] By quickly isolating and culturing chicken primordial germ cells, editing the chicken endogenous ovalbumin gene site in the primordial germ cells, integrating the exogenous protein gene into the 3' end position of any exon of chicken ovalbumin using linkers such as (EAAAK)n and other amino acid fragments with linking effects, fusing the exogenous gene with the ovalbumin gene, and transplanting the gene-edited primordial germ cells into recipient chicken embryos, and after the recipient chickens become sexually mature, mating with wild-type hens, i.e., hens that have not been gene-edited, to produce gene-edited chickens; after the gene-edited chickens start laying eggs, the "ovalbumin-linker-exogenous protein" fusion protein will be secreted together in the oviduct of the gene-edited chickens, achieving mass production of exogenous protein in eggs; after the gene-edited chickens are produced, the exogenous protein production flock can be maintained by maintaining the survival of the ovalbumin gene-edited roosters, and the specific process is as follows.

[0037] 2.1 Rapid isolation and establishment of chicken gonadal primordial germ cells;

[0038] The isolation and in vitro culture of primordial germ cells adopt existing technology. After the isolation and culture expansion of primordial germ cells, the cells can be frozen in liquid nitrogen for later use.

[0039] 2.2 Gene editing and purification of chicken ovalbumin gene in chicken primordial germ cells

[0040] After the isolation of chicken primordial germ cells is completed, gene editing is performed during 14-20 days of in vitro culture. The gene editing technology uses CRISPR / Cas9, TALEN and other related technologies. After gene editing, flow cytometry can be used to sort and enrich cells with red fluorescence, and continue to culture for 3-5 days.

[0041] 2.2.1 Construction of gene editing plasmid

[0042] a. Construction of U6-sgRNA-CMV-Cas9 plasmid:

[0043] After annealing the oligo fragment of sgRNA, insert it into the Cas9 plasmid (with a backbone of U6-sgRNA-CMV-Cas9) through T4 ligation, transform it into competent cells, shake the bacteria overnight, and extract the plasmid for later use;

[0044] b. Construction of Donor plasmid:

[0045] Design PCR amplification primers for the sequence to be inserted. In this embodiment, the inserted sequence is the non-secretory recombinant protein EGFP. Design PCR amplification primers with (EAAAK) 3 -EGFP protein as an example, the primers required for PCR are:

[0046] EGFP-INSERT-F:GAAGCCGCTGCTAAGGGATCCATGGTGAGCAAGGGCGAG

[0047] EGFP-INSERT-R:CAAAGAAGAGAACGGGAATTCTTACTTGTACAGCTCGTCCA

[0048] The fragment to be expressed is amplified by PCR, and then the PCR fragment is integrated into the homology arm linear vector by Gibson homologous recombination. It is transformed into competent cells, amplified, and the plasmid is extracted for later use.

[0049] 2.2.2 Gene editing and purification of primordial germ cells

[0050] The gene editing process of primordial germ cells is as follows:

[0051] a. Two days before gene editing, chicken primordial germ cells were taken out of the liquid nitrogen tank, thawed quickly in a 37°C water bath, transferred to a 15 mL centrifuge tube, centrifuged at 700 g for 5 minutes, the supernatant was removed, and the cells were transferred to culture medium and cultured for 2 days;

[0052] b. On the day of gene editing, count the cells, transfer 200,000 cells to one well of a 24-well plate, and resuspend in 200ul of culture medium;

[0053] c. Gene editing design scheme Figure 2 As shown, the transfection solution was prepared according to the following system: Opti-MEM culture medium 100ul, Cas9 plasmid 2ug, sgRNA plasmid 1ug, recombinant protein donor plasmid (Donor) 1ug, the structure of the recombinant protein donor plasmid (Donor) is "homologous arm-linker-recombinant protein C-promoter-fluorescent marker-homologous arm", lipo20004ul; after mixing the transfection solution, let it stand at room temperature for 10 minutes, and add it to the cells. The morphology of primordial germ cells after gene editing is shown in the figure below. Figure 3 As shown in A;

[0054] d. Transfer the cells to a 37°C, 5% CO2 incubator and incubate for 6-8 hours. After the incubation is completed, collect the cells, centrifuge at 700g for 5 minutes, remove the supernatant, resuspend the cells with 1mL of culture medium, and transfer to a 12-well plate to continue culturing for 2-4 days; on the 4th day after transfection, observe the expression of red fluorescence. PGC cells that still express red fluorescence are cells that have successfully integrated the exogenous gene. After the PGC cells are transplanted, red fluorescence expression is found in the sperm of the F0 generation recipient;

[0055] Purification after gene editing: On the 2nd to 4th day after gene editing, most of the "linker-recombinant protein-promoter-fluorescent marker" fragments in the donor plasmid have been successfully integrated into the cell genome. Collect the cells and use a sorting flow cytometer to sort the positive cells according to the fluorescent marker contained in the donor plasmid (Donor). After the sorted cells are centrifuged at 1500g for 10 minutes, remove the supernatant, resuspend in culture medium, and transfer to a 24-well plate for continuous culture for 5-8 days. The morphology of primordial germ cells enriched by flow sorting is shown in the figure below. Figure 3 As shown in B; 200,000 cells were taken for cell cryopreservation, and the remaining cells were used for transplantation into recipient chicken embryos. The primordial germ cells were isolated and purified and cultured in vitro. Figure 1 shown.

[0056] 2.3 Transplantation of primordial germ cells and production of gene-edited chickens

[0057] Transplantation of primordial germ cells: On the 5th to 8th day after the purification of primordial germ cells, take 1X104 primordial germ cells and resuspend them in 50μL of culture medium; take fertilized eggs with an incubation time of 50-55h, disinfect the surface of the eggs with alcohol, open a round hole with a diameter of 0.5cm at the top of the eggs, use a glass needle with a diameter of 30μL to absorb the cells and inject them into the heart of the chicken embryos incubated for 50-55h; after the injection, use sealing film to seal the opening at the top of the eggs and transfer them back to the incubator for further culture;

[0058] Production of gene-edited chickens: After the transplanted recipient chicken embryos are successfully hatched, the recipient chickens are cultured to sexual maturity, the roosters are taken to mate with wild-type (non-gene-edited) hens, and the chickens with fluorescent markers are selected from the F1 generation chicks born, which are the offspring of the gene-edited chickens;

[0059] 2.4 Collection of recombinant proteins

[0060] After screening the offspring of gene-edited chickens, the F1 generation of hens already have the ability to produce recombinant proteins. Since the recombinant protein and ovalbumin are expressed in a fusion, after the F1 generation of hens lay eggs, the eggs of the F1 generation of hens are collected, and the egg white is taken as the primary product of the recombinant protein, which can be directly used in downstream industrial-grade purification and other production processes; after cracking the eggs, the egg white is irradiated with a green fluorescent exciter, and the presence of strong fluorescent protein can be seen in the egg white. Figure 4 In A, we can see that the eggs in the gene-edited group contained a lot of green fluorescent protein, while the eggs in the control group did not; Figure 4 As can be seen in B, the non-secreted green fluorescent protein is only expressed in the egg white, but not in the yolk;

[0061] like Figure 5 As shown, compared with the control group (WT) eggs, the eggs laid by hens with OVAL gene editing contained a large amount of EGFP protein, with the yield reaching 1-2 mg per milliliter of egg white.

[0062] 2.5 Maintenance of chicken flocks for recombinant protein production

[0063] Since the scheme described in the present invention inserts the relevant sequence of exogenous recombinant protein into the ovalbumin gene site of chicken, the eggs produced by gene-edited chickens have a high concentration of recombinant protein, and the original nutrients are not sufficient to support the complete development process of the embryo. Therefore, female gene-edited chickens cannot be used for population maintenance.

[0064] When maintaining a recombinant protein-producing flock, it is necessary to preserve the gene-edited roosters, carry out a planned and easy-to-manage breeding program during mass production, and continuously produce gene-edited laying hens to maintain the existence of the recombinant protein-producing flock and its production capacity.

[0065] The above is an embodiment of the present invention. The above embodiments and the specific parameters in the embodiments are only for the purpose of clearly describing the invention verification process, and are not intended to limit the patent protection scope of the present invention. The patent protection scope of the present invention is still subject to its claims. Any equivalent structural changes made by using the contents of the description and drawings of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for mass production of exogenous protein using chicken ovalbumin gene, characterized in that: The steps include: (1) Rapid isolation and establishment of chicken gonadal primordial germ cells; (2) Gene editing and purification of the chicken ovalbumin gene in chicken primordial germ cells; (3) Transplantation of chicken primordial germ cells and production of gene-edited chickens; (4) Preliminary collection of recombinant proteins; (5) Maintaining a population of chickens producing recombinant proteins; The gene editing site of the chicken ovalbumin gene in step (2) is the coding region of the last exon of the chicken ovalbumin gene; the amino acid sequence connecting the chicken ovalbumin and the exogenous gene is (EAAAK)3, and the EGFP protein is used as the exogenous protein.

2. The method according to claim 1, characterized in that The specific operation of step (2) is as follows: after the isolation of chicken primordial germ cells is completed, gene editing is performed during in vitro culture for 14-20 days, and the gene editing technology uses CRISPR / Cas9 and TALEN technology. After gene editing, cells with red fluorescence are sorted and enriched using a flow cytometer, and the culture is continued for 3-5 days.

3. The method according to claim 1, characterized in that The specific operation of step (3) is as follows: after gene editing and enrichment of the primordial germ cells, the primordial germ cells are continued to be cultured for 3-5 days, and a chicken embryo with an embryonic age of 50-55 hours is used as a recipient, and the primordial germ cells are transplanted into the heart of the chicken embryo, and the chicken embryo is returned to the incubator for continued incubation until the F0 generation chicks are born; after the F0 generation chicks are born, the F0 generation roosters are mated with wild-type chickens to produce F1 generation chickens, and the chickens with red fluorescence in the F1 generation are gene-edited chickens.

4. The method according to claim 1, characterized in that: The specific operation of step (4) is: after the F1 generation gene-edited hens start laying eggs, directly collect the egg supernatant, which contains a large amount of recombinant protein and can be directly used for downstream industrial-grade purification.

5. The method according to claim 1, characterized in that The specific operation of step (5) is: when maintaining the population, maintaining a group of roosters expressing fluorescent protein; when conducting mass production, continuously using the group of roosters edited with the ovalbumin gene to mate with wild-type hens, thereby maintaining the continuous production of gene-edited egg-laying hens.

Images