Preparation and application of cross-neutralizing antibodies against SARS-CoV-2 and SARS-CoV

Abstract

It involves the preparation of multiple cross-neutralizing humanized monoclonal antibodies. The antibody can cross-block the binding of SARS-CoV-2 and SARS-CoV spike protein (S protein) to the ACE2 receptor, and effectively neutralize SARS-CoV-2 and SARS-CoV virus infection of cells. The nucleic acid sequence encoding the antibody (including heavy / light chain variable regions), the vector containing the nucleic acid sequence, the pharmaceutical composition and the kit. The prepared humanized cross-neutralizing antibody can be used as a specific antibody drug for the simultaneous prevention and treatment of acute respiratory infectious diseases caused by SARS-CoV-2 and SARS-CoV viruses. The cross-neutralizing antibody also has diagnostic and other uses.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of Chinese patent application No. 202010219867.1 filed on March 25, 2020, the contents of which are incorporated herein by reference. Technical Field

[0003] The present invention relates to the field of cellular immunity technology, providing multiple humanized antibodies that can cross-block the binding of SARS-CoV-2 and SARS-CoV spike proteins (S proteins) to the ACE2 receptor and effectively neutralize SARS-CoV-2 and SARS-CoV virus-infected cells. These antibodies can be used to treat infectious diseases caused by SARS-CoV-2 and SARS-CoV. The present invention also provides nucleic acid sequences encoding the antibodies, vectors containing the nucleic acid sequences, and cells. Background Art

[0004] The human-to-human transmission route of SARS-CoV-2 is similar to that of SARS-CoV (Severe Acute Respiratory Syndrome coronavirus) and MERS-CoV (Middle East Respiratory Syndrome), mainly through respiratory droplets, but can also be transmitted through contact. The main source of infection for SARS-CoV-2 is COVID-19 patients, and asymptomatic infected persons may also become a source of infection. Relevant studies have shown that the basic reproduction number (R0 value) of SARS-CoV-2 is between 2.24 and 3.58, suggesting that it has a strong transmission ability [2]. The population is generally susceptible to SARS-CoV-2, with an incubation period of 1-14 days, mostly 3-7 days. The main clinical symptoms are fever, dry cough, and fatigue. Mild patients only show low fever, mild fatigue, etc., without pneumonia. Severe patients often show dyspnea and / or hypoxemia, acute respiratory distress syndrome, septic shock, difficult-to-correct metabolic acidosis and coagulation dysfunction and multiple organ failure [3,4].

[0005] SARS-CoV-2 and SARS-CoV share a common host cell receptor protein, angiotensin-converting enzyme 2 (ACE2)[5]. After the virus's trimeric spike protein (S protein) binds to the ACE2 receptor, it is cleaved by host proteases into the S1 polypeptide containing the receptor binding domain (RBD) and the S2 polypeptide responsible for mediating the fusion of the virus with the cell membrane, thereby invading the body[6]. Therefore, finding and preparing effective antibodies to prevent the binding of the SARS-CoV-2 RBD protein to the ACE2 receptor, thereby inhibiting the virus from infecting cells, has become one of the methods for preventing and treating SARS-CoV-2 virus infection. Currently, clinical exploration of convalescent plasma treatment has been conducted and has achieved positive therapeutic effects. However, the source of convalescent plasma is limited, the operation is cumbersome, the cost is high, and there are safety issues. By preparing monoclonal antibodies against the SARS-CoV-2 RBD protein, screening for neutralizing antibodies that can specifically bind to it, and further humanizing them, it has become an effective means of preparing preventive or therapeutic antibody drugs. SARS-CoV-2 and SARS-CoV share similar S protein structures and high RBD amino acid sequence homology, approximately 75% and 73.7%, respectively. Given their shared receptors and high sequence homology, screening for antibodies that effectively neutralize both SARS-CoV-2 and SARS-CoV has the potential to become a specific anti-coronavirus drug.

[0006] Since there are no therapeutic drugs for SARS-CoV-2 infection, the current treatment options for COVID-19 are mainly focused on relieving symptoms, preventing secondary infections, reducing complications, and supporting organ function. Therefore, there is an urgent need in this field to develop high-affinity coronavirus neutralizing antibodies with good virus neutralization effects, especially monoclonal antibodies. The humanized monoclonal antibodies invented in this patent can effectively neutralize SARS-CoV-2 and SARS-CoV viruses and can be used as specific antibody drugs for the simultaneous prevention and treatment of acute respiratory infectious diseases caused by SARS-CoV-2 and SARS-CoV viruses. Summary of the Invention

[0007] The first aspect of the present invention provides an isolated antibody or antigen-binding fragment thereof that blocks the binding of SARS-CoV-2 spike protein and / or SARS-CoV spike protein to ACE2 receptor, comprising any one of a) to d), wherein

[0008] a) i) a heavy chain variable region, whose heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 domains are SEQ ID NOs: 13, 14 and 15, respectively, or have at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto,

[0009] ii) a light chain variable region, whose light chain CDR1, light chain CDR2, and light chain CDR3 domains are SEQ ID NOs: 10, 11, and 12, respectively, or have at least 75%, 78%, 80%, 85%, 90%, 91%, 95%, 98%, or 99% sequence identity thereto;

[0010] b) i) a heavy chain variable region, the heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 domains of which are SEQ ID NOs: 13, 14 and 15, respectively, having at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto,

[0011] ii) a light chain variable region, whose light chain CDR1, light chain CDR2, and light chain CDR3 domains are SEQ ID NOs: 45, 11, and 46, respectively, or have at least 75%, 78%, 80%, 85%, 90%, 91%, 95%, 98%, or 99% sequence identity thereto;

[0012] c) i) a heavy chain variable region, the heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 domains of which are SEQ ID NOs: 67, 68 and 69, respectively, having at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto,

[0013] ii) a light chain variable region, whose light chain CDR1, light chain CDR2, and light chain CDR3 domains are SEQ ID NOs: 10, 11, and 12, respectively, or have at least 75%, 78%, 80%, 85%, 90%, 91%, 95%, 98%, or 99% sequence identity thereto; and

[0014] d) i) a heavy chain variable region, the heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 domains of which are SEQ ID NOs: 67, 68 and 69, respectively, having at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto,

[0015] ii) a light chain variable region, whose light chain CDR1, light chain CDR2 and light chain CDR3 domains are SEQ ID NOs: 45, 11 and 12, respectively, or have at least 75%, 78%, 80%, 85%, 90%, 91%, 95%, 98% or 99% sequence identity thereto.

[0016] In a specific embodiment, the antibody or antigen-binding fragment thereof comprises any one of a)-d), wherein:

[0017] a) i) a heavy chain variable region having the sequence of SEQ ID NO: 22 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto;

[0018] ii) a light chain variable region having a sequence of SEQ ID NO: 23 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto;

[0019] b) i) a heavy chain variable region having the sequence of SEQ ID NO: 51 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto;

[0020] ii) a light chain variable region having the sequence of SEQ ID NO: 52 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto;

[0021] c) i) a heavy chain variable region having the sequence of SEQ ID NO: 74 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto;

[0022] ii) a light chain variable region having the sequence of SEQ ID NO: 75 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto;

[0023] d) i) a heavy chain variable region having the sequence of SEQ ID NO: 94 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto;

[0024] ii) a light chain variable region having the sequence of SEQ ID NO: 95 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto.

[0025] The average KD value of its binding affinity to SARS-CoV-2S1 is 0.9E-11 to 8.7E-10M, preferably 2.0E-11 to 3E-10M, and more preferably 2.6E-10, 2.9E-10, 2.1E-10 and 2.7E-11M; the average KD value of its binding affinity to SARS-CoV S1 is 0.4E-11 to 6.0E-10M, preferably 1.0E-11 to 8E-10M, and more preferably 1.2E-11, 1.1E-10, 2.0E-10 and 7.5E-11M.

[0026] After a single intravenous injection into mice, the average exposure in vivo was C max and AUC last The average half-life was 136.15 μg / mL and 10930.35 h×μg / mL, respectively. 1 / 2 The clearance time was 281.20 h, and the clearance rate Cl was 0.27 mL / h / kg.

[0027] In one embodiment, the antibody is expressed by a Fut8 gene-knockout mammalian cell, preferably, the cell is a Fut8 gene-knockout HEK-293 cell, which exhibits binding ability to CD16a that is significantly better than that of the IgG1 subtype, weak binding to CD32a or CD32b protein at high concentrations, and binding levels to CD64, C1q complement protein, and FcRn that are similar to those of IgG1 subtype antibodies; ADCC function that is significantly better than that of the IgG1 subtype and ADCP function that is similar to that of the IgG1 subtype, and no change in CDC function.

[0028] In one embodiment, the antibody further comprises:

[0029] a heavy chain constant region, preferably having a sequence of SEQ ID NO: 106 or having at least 90%, 92%, 95%, 98% or 99% sequence identity thereto;

[0030] The light chain constant region, preferably, has a sequence of SEQ ID NO: 25 or has at least 90%, 92%, 95%, 98% or 99% sequence identity thereto. It has the following characteristics: no binding to CD32a, CD32b, CD16a and C1q complement proteins, very weak binding to CD64 at high concentrations, and binding to FcRn similar to that of IgG1 subtype antibodies at pH 6.0; no significant ADCC, CDC and ADCP functions; and an average in vivo exposure of C max and AUC last The average half-life was 144.66 μg / mL and 11940.01 h×μg / mL, respectively. 1 / 2 The clearance time was 290.08h, and the clearance rate Cl was 0.26mL / h / kg.

[0031] In one embodiment, the antibody further comprises:

[0032] i) a heavy chain constant region, preferably, the sequence of SEQ ID NO: 108 or a sequence having at least 90%, 92%, 95%, 98% or 99% sequence identity thereto;

[0033] ii) a light chain constant region, preferably having a sequence of SEQ ID NO: 25 or having at least 90%, 92%, 95%, 98% or 99% sequence identity thereto. It has the following characteristics: no binding to CD32a, CD32b, CD16a, CD64, and C1q complement proteins, very weak binding to FcRn at pH 6.0 and high concentrations, and essentially no ADCC, CDC, or ADCP functions. Following a single intravenous injection into mice, the average in vivo exposure to C max and AUC lastThe average half-life was 125.11 μg / mL and 1202.18 h×μg / mL, respectively. 1 / 2 It is only 11.72h, and the clearance Cl is 4.13mL / h / kg.

[0034] In one embodiment, it is a monoclonal antibody.

[0035] In one embodiment, it is Fv, Fab, Fab′, Fab′-SH, F(ab′)2, Fd fragment, Fd′ fragment, single-chain antibody molecule or single-domain antibody; wherein the single-chain antibody molecule is preferably scFv, di-scFv, tri-scFv, diabody or scFab.

[0036] In one embodiment, the epitope is a structural region comprising S375, K378, D405, and R408 in the spike protein of SARS-CoV-2 and SARS-CoV viruses.

[0037] The second aspect of the present invention relates to an antibody-drug conjugate, which comprises the aforementioned antibody or antigen-binding fragment thereof and another therapeutic agent, preferably the antibody or antigen-binding fragment thereof and the other therapeutic agent are connected via a linker.

[0038] The third aspect of the present invention relates to a nucleic acid encoding the aforementioned antibody or antigen-binding fragment thereof, which may be DNA and / or mRNA.

[0039] In one embodiment, it comprises

[0040] a) a heavy chain variable region nucleotide sequence as shown in SEQ ID NO: 30, 55, 78 and 98 and / or a light chain variable region nucleotide sequence as shown in SEQ ID NO: 31, 56, 79 and 99, respectively; and optionally

[0041] b) the heavy chain constant region nucleotide sequence shown in SEQ ID NO: 6, 105 and 107, respectively, and / or the light chain constant region nucleotide sequence shown in SEQ ID NO: 7; or variants of a) and b).

[0042] The third aspect of the present invention relates to an expression vector comprising the aforementioned nucleic acid.

[0043] The fourth aspect of the present invention relates to a host cell comprising the aforementioned nucleic acid or the aforementioned expression vector.

[0044] The fifth aspect of the present invention relates to a method for producing the aforementioned antibody or antigen-binding fragment thereof, which comprises culturing the aforementioned host cell under conditions suitable for antibody expression, and recovering the expressed antibody from the culture medium.

[0045] The sixth aspect of the present invention relates to a pharmaceutical composition comprising the aforementioned antibody or antigen-binding fragment thereof, the aforementioned antibody-drug conjugate, the aforementioned nucleic acid, or the aforementioned expression vector, and a pharmaceutically acceptable carrier.

[0046] Optionally one or more additional therapeutic agents.

[0047] The seventh aspect of the present invention relates to the aforementioned antibody or antigen-binding fragment thereof or the aforementioned antibody-drug conjugate or the aforementioned pharmaceutical composition, which is used to prevent and treat diseases caused by SARS-CoV-2 and / or SARS-CoV infection.

[0048] The eighth aspect of the present invention relates to the use of the aforementioned antibody or antigen-binding fragment thereof or the aforementioned antibody-drug conjugate for preparing a medicament for preventing and treating diseases caused by SARS-CoV-2 and / or SARS-CoV infection.

[0049] The ninth aspect of the present invention relates to a pharmaceutical combination comprising the aforementioned antibody or antigen-binding fragment thereof, or the aforementioned antibody-drug conjugate, or the aforementioned pharmaceutical composition and one or more additional therapeutic agents.

[0050] The tenth aspect of the present invention relates to a kit comprising the aforementioned antibody or antigen-binding fragment thereof, the aforementioned antibody-drug conjugate, or the aforementioned pharmaceutical composition, and preferably further comprising a drug administration device.

[0051] The eleventh aspect of the present invention relates to a method for preventing and treating diseases caused by SARS-CoV-2 and / or SARS-CoV infection, which comprises administering to a subject the aforementioned antibody or antigen-binding fragment thereof, or the aforementioned antibody-drug conjugate, or the aforementioned pharmaceutical composition, the aforementioned drug combination, or the aforementioned kit.

[0052] The twelfth aspect of the present invention relates to an isolated antibody or antigen-binding fragment thereof that blocks the binding of SARS-CoV-2 spike protein / SARS-CoV spike protein to the ACE2 receptor, wherein the binding epitope is a structural region comprising S375, K378, D405 and R408.

[0053] The thirteenth aspect of the present invention relates to a binding epitope of the SARS-CoV-2 spike protein / SARS-CoV spike protein, which is a structural region of the SARS-CoV-2 spike protein / SARS-CoV spike protein comprising S375, K378, D405 and R408. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 : Screening of monoclonal phages that cross-bind to SARS-CoV-2 and SARS-CoV proteins.

[0055] Figure 2 : Cross-binding ability of mouse antibodies to SARS-CoV-2 and SARS-CoV S1 proteins.

[0056] Figure 3 :Flow cytometry detection of the binding of mouse antibodies to SARS-CoV-2S1 protein.

[0057] Figure 4 : Mouse antibodies cross-compete for the binding of ACE2 to SARS-CoV-2 or SARS-CoV RBD protein.

[0058] Figure 5 : Mouse antibodies cross-neutralize SARS-CoV-2 and SARS-CoV pseudovirus.

[0059] Figure 6 : The ability of humanized antibodies to bind to SARS-CoV-2 and SARS-CoV RBD.

[0060] Figure 7 : Humanized antibodies compete for the binding of ACE2 protein to SARS-CoV-2 and SARS-CoV RBD protein.

[0061] Figure 8 : Affinity detection of humanized antibodies to SARS-CoV-2 S1 protein (A) and SARS-CoV S1 protein (B).

[0062] Figure 9 : Humanized antibodies cross-neutralize SARS-CoV-2 and SARS-CoV pseudoviruses.

[0063] Figure 10 Schematic diagram of SARS-2-H014 epitope analysis (A) and ELISA test results (B). In A, the SARS-CoV-2 RBD is represented by a white surface model, all designed mutation sites are represented by light gray, the identified highly significant and significant SARS-2-H014 epitopes are represented by black and dark gray, respectively, and ACE2 is represented by a gray ribbon model.

[0064] Figure 11 : Binding of SARS-2-H014 antibodies with different Fc functional forms to CD16a.

[0065] Figure 12 : Binding of SARS-2-H014 antibodies with different Fc functional forms to CD32.

[0066] Figure 13 : Binding of SARS-2-H014 antibodies with different Fc functional forms to CD64.

[0067] Figure 14 : Binding of SARS-2-H014 antibodies with different Fc functional forms to C1q.

[0068] Figure 15 : Binding of SARS-2-H014 antibodies with different Fc functional forms to FcRn.

[0069] Figure 16 : ADCC effects of SARS-2-H014 antibodies with different Fc functional forms on target cells expressing SARS-CoV-2S protein (A) or SARS-CoVS protein (B).

[0070] Figure 17 : ADCP mediated by different effector cells against SARS-2-H014 antibodies with different Fc functional forms on target cells expressing SARS-CoV-2 S protein (A) or SARS-CoV S protein (B).

[0071] Figure 18 : CDC effects mediated by SARS-2-H014 antibodies with different Fc functional forms on target cells expressing SARS-CoV-2S protein (A) or SARS-CoVS protein (B).

[0072] Figure 19 : Mean blood concentration-time curve of SARS-2-H014 after a single intravenous injection in mice (n=4).

[0073] Figure 20 : Mean blood drug concentration-time curve after a single intravenous injection of SARS-2-H014-Fd11-IgG4 in mice (n=6).

[0074] Figure 21 : Mean blood drug concentration-time curve after a single intravenous injection of SARS-2-H014-Fd19-IgG4 in mice (n=4). DETAILED DESCRIPTION

[0075] definition

[0076] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. For the purposes of the present invention, the following terms are further defined.

[0077] As used herein and in the appended claims, the singular forms "a," "an," "another," and "the" include plural referents unless the context clearly dictates otherwise.

[0078] The term "antibody" refers to an immunoglobulin molecule and refers to any form of an antibody that exhibits the desired biological activity. This includes, but is not limited to, monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, and multispecific antibodies (e.g., bispecific antibodies), and even antibody fragments. Typically, a full-length antibody structure preferably comprises four polypeptide chains, typically two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain comprises a heavy chain variable region and a heavy chain constant region. Each light chain comprises a light chain variable region and a light chain constant region. In addition to this typical full-length antibody structure, other derivatives are also encompassed.

[0079] The term "variable region" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to the antigen. The variable regions of the heavy and light chains of native antibodies (VH and VL, respectively) generally have similar structures and can be further subdivided into hypervariable regions, called complementarity-determining regions (CDRs), interspersed with more conserved regions, called framework regions (FRs).

[0080] The term "complementarity determining region" (CDR, e.g., CDR1, CDR2, and CDR3) refers to the amino acid residues in an antibody variable region whose presence is essential for antigen binding. Each variable region typically has three CDR regions identified as CDR1, CDR2, and CDR3. Each complementary determining region may comprise amino acid residues from a "complementarity determining region" as defined by Kabat (Kabat et al., Sequences of Proteins of Immulological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. 1991) and / or from those residues in a "hypervariable loop" (Chothia and Lesk; J Mol Biol 196:901-917 (1987)).

[0081] The term "framework" or "FR" residues are those variable region residues other than the CDR residues as herein defined.

[0082] Each heavy and light chain variable region typically comprises three CDRs and up to four FRs, arranged from amino-terminus to carboxyl-terminus in the following order, for example: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0083] The complementarity determining regions (CDRs) and framework regions (FRs) of a given antibody can be identified using the Kabat system (Kabat et al.: Sequences of Proteins of Immunological Interest, 5th ed., U.S. Department of Health and Human Services, PHS, NIH, NIH Publication No. 91-3242, 1991).

[0084] The term "constant region" refers to amino acid sequences on the light and heavy chains of antibodies that are not directly involved in binding the antibody to the antigen, but exhibit various effector functions, such as antibody-dependent cellular toxicity.

[0085] Based on the amino acid sequence of their heavy chain constant regions, intact antibodies can be classified into five classes: IgA, IgD, IgE, IgG, and IgM. IgG and IgA can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. Accordingly, the heavy chains of these five classes are classified as α, δ, ε, γ, and μ chains, respectively. Based on the amino acid sequence of their light chain constant regions, antibody light chains can be classified as κ or λ.

[0086] An "antigen-binding fragment of an antibody" comprises a portion of an intact antibody molecule that retains at least some of the binding specificity of the parent antibody, typically including at least a portion of the antigen-binding region or variable region (e.g., one or more CDRs) of the parent antibody. Examples of antigen-binding fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2, Fd fragment, Fd' fragment, single-chain antibody molecules (e.g., scFv, di-scFv or tri-scFv, diabodies or scFab), and single-domain antibodies.

[0087] "Antibody fragments" are non-intact antibody molecules that retain at least some of the biological properties of the parent antibody, examples of which include, but are not limited to, Fc fragments in addition to those mentioned above for "antigen-binding fragments".

[0088] The term "remodeled drug molecule" refers to an antibody or a fragment thereof, such as an antigen-binding fragment, that forms a covalent or non-covalent linker with another molecule or forms a recombinant multi-target fusion drug, wherein the other molecule is selected from a small molecule compound or a biomacromolecule.

[0089] The term "chimeric" antibody refers to an antibody in which a portion of the heavy and / or light chain is derived from a particular source or species, while the remainder is derived from a different source or species. "Humanized antibodies" are a subset of "chimeric antibodies."

[0090] The term "humanized antibody" or "humanized antigen-binding fragment" is defined herein as an antibody or antibody fragment that is: (i) derived from a non-human source (e.g., a transgenic mouse carrying a heterologous immune system) and based on a human germline sequence; or (ii) a chimeric antibody in which the variable region is of non-human origin and the constant region is of human origin; or (iii) CDR-grafted, wherein the CDRs of the variable region are from a non-human source, while one or more framework regions of the variable region are of human origin, and the constant region (if any) is of human origin. The purpose of "humanization" is to eliminate the immunogenicity of non-human antibodies in the human body while retaining affinity to the greatest extent possible. It is advantageous to select a human framework sequence that is most similar to the framework sequence of the non-human antibody as a template for humanization. In some cases, it may be necessary to replace one or more amino acids in the human framework sequence with the corresponding residues in the non-human framework to avoid loss of affinity.

[0091] " monoclonal antibody " refers to the antibody obtained from a substantially homogeneous antibody colony, that is, the colony comprising a single antibody is identical except that a possible mutation (such as natural mutation) may exist in a small amount. Therefore, the term " monoclonal antibody " shows the character of the antibody, i.e., is not a mixture of unrelated antibodies. Contrary to the polyclonal antibody preparations that generally include different antibodies for different determinants (epitopes), each monoclonal antibody of the monoclonal antibody preparation is directed to a single determinant on the antigen. Except for its specificity, the advantage of the monoclonal antibody preparation is that they are not contaminated by other antibodies conventionally. The term " monoclonal antibody " should not be construed as needing to produce the antibody by any specific method. The term monoclonal antibody specifically includes chimeric antibodies, humanized antibodies and human antibodies.

[0092] An antibody "specifically binds" to an antigen of interest, such as a viral-associated antigenic protein (herein, spike protein S), i.e., it binds to the antigen with sufficient affinity to allow the antibody to be used as a therapeutic agent, targeting viruses or cells expressing the antigen, and has no significant cross-reactivity with other proteins or with proteins other than homologs and variants (e.g., mutant forms, splice variants, or proteolytically truncated forms) of the antigenic target mentioned above.

[0093] The term "binding affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule and its binding partner. Unless otherwise indicated, "binding affinity" as used herein refers to intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., antibody and antigen). "KD", "association rate constant k on and the dissociation rate constant k off"Affinity" is often used to describe the affinity between a molecule (e.g., an antibody) and its binding partner (e.g., an antigen), that is, how tightly a ligand binds to a specific protein. Binding affinity is influenced by non-covalent intermolecular interactions, such as hydrogen bonding, electrostatic interactions, and hydrophobic and van der Waals forces between the two molecules. In addition, the binding affinity between a ligand and its target molecule may be affected by the presence of other molecules. Affinity can be analyzed by conventional methods known in the art, including the ELISA described herein.

[0094] The term "epitope" includes any protein determinant capable of specific binding to an antibody or T-cell receptor. Epitope determinants usually consist of chemically active surface groupings of molecules (such as amino acids or sugar side chains, or a combination thereof) and usually have specific three-dimensional structural characteristics as well as specific charge characteristics.

[0095] An "isolated" antibody is one that has been identified and separated from cells that naturally express the antibody. Isolated antibodies include antibodies in situ within recombinant cells as well as antibodies that have generally been prepared by at least one purification step.

[0096] "Sequence identity" between two polypeptide or nucleic acid sequences refers to the percentage of residues that are identical between the sequences to the total number of residues. In calculating percent identity, the sequences being compared are aligned to produce the largest match between the sequences, and gaps in the alignment, if any, are resolved by a particular algorithm. Preferred computer program methods for determining identity between two sequences include, but are not limited to, the GCG program package, including GAP, BLASTP, BLASTN, and FASTA (Altschul et al., 1990, J. Mol. Biol. 215:403-410). The aforementioned programs are publicly available from the National Center for Biotechnology Information (NCBI) and other sources. The well-known Smith-Waterman algorithm can also be used to determine identity.

[0097] The term "receptor" is a biochemical concept that refers to a class of molecules that transmit extracellular signals and produce specific effects within cells. These effects may be short-lived, such as altering cell metabolism or motility. Alternatively, they may be long-lasting, such as upregulating or downregulating the expression of a specific gene or genes.

[0098] The term "Fc receptor" or "FcR" refers to a receptor that binds to the Fc region of an antibody. Native sequence human FcRs are preferred, and preferably receptors that bind to IgG antibodies (gamma receptors), including FcγRI, FcγRII, and FcγRIII subtypes, as well as variants of these receptors. Other FcRs are encompassed by the term "FcR." The term also includes the neonatal receptor (FcRn), which is responsible for the transport of maternal IgG to the fetus (Guyer et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol. 24:249 (1994)).

[0099] The term "neonatal Fc receptor," or "FcRn" for short, refers to the binding of the Fc region of IgG antibodies. Neonatal Fc receptors (FcRn) play an important role in the metabolic fate of IgG antibodies in vivo. FcRn functions to rescue IgG from lysosomal degradation, thereby reducing its clearance in serum and increasing its half-life. Therefore, the in vitro FcRn binding properties / characteristics of IgG are indicative of its pharmacokinetic properties in the bloodstream.

[0100] The term "effector function" refers to those biological activities attributable to the Fc region of an antibody, which vary with the antibody isotype. Examples of antibody effector functions include: C1q binding and complement-dependent cytotoxicity (CDC), Fc receptor binding, "antibody-dependent cell-mediated cytotoxicity" (ADCC), antibody-dependent cellular phagocytosis (ADCP), cytokine secretion, immune complex-mediated uptake of antigens by antigen-presenting cells, downregulation of cell surface receptors (e.g., B cell receptors), and B cell activation.

[0101] The term "effector cell" refers to a leukocyte that expresses one or more FcRs and exercises effector functions. In one aspect, the effector cell expresses at least FcγRIII and performs ADCC effector functions. Examples of human leukocytes that mediate ADCC include peripheral blood mononuclear cells (PBMCs), natural killer (NK) cells, monocytes, cytotoxic T cells, and neutrophils. Effector cells can be isolated from natural sources, for example, blood. Effector cells are typically lymphocytes associated with the effector stage and function to produce cytokines (helper T cells), kill cells infected by pathogens (cytotoxic T cells), or secrete antibodies (differentiated B cells).

[0102] "Immune cells" include cells that have hematopoietic origin and play a role in immune responses. Immune cells include: lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils and granulocytes.

[0103] "Antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig bound to Fcγ receptors present on certain cytotoxic cells (e.g., NK cells, neutrophils, and macrophages) enables these cytotoxic effector cells to specifically bind to antigen-bearing target cells, which are then killed using, for example, cytotoxins. In order to assess the ADCC activity of an antibody of interest, an in vitro ADCC assay, such as that described in U.S. Patent No. 5,500,362 or 5,821,337 or U.S. Patent No. 6,737,056 (Presta), or the methods described in the Examples of this application, can be performed. Useful effector cells for such assays include PBMCs and NK cells.

[0104] "Complement-dependent cytotoxicity" or "CDC" refers to the lysis of target cells in the presence of complement. Activation of the classical complement pathway is initiated by binding of the first component of the complement system (CIq) to an antibody (of the appropriate subclass), wherein the antibody is bound to its corresponding antigen. To assess complement activation, a CDC assay, such as that described in Gazzano-Santoro et al., J. Immunol Methods 202:163 (1996), such as that described in the Examples of this application, such as that described in U.S. Patent No. 6,194,551B1 and WO 1999 / 51642, which describes polypeptide variants having altered Fc region amino acid sequences (polypeptides having variant Fc regions) and polypeptide variants having enhanced or decreased CIq binding, may be performed.

[0105] "Antibody-dependent cellular phagocytosis" (ADCP) refers to a cell-mediated reaction in which nonspecific cytotoxic cells expressing FcγRs recognize bound antibody on a target cell and subsequently induce phagocytosis of the target cell.

[0106] The amino acid sequence and nucleotide sequence of the antibody of the present invention, and Fc functional modification

[0107] The present invention first immunizes mice with a recombinant SARS-CoV RBD protein. Four scFv antibody clones that dually bind to both SARS-CoV-2 and SARS-CoV RBD proteins are then obtained through phage antibody library screening. The nucleotide sequences encoding the heavy and light chain variable regions of the scFv antibodies are then spliced ​​with nucleotide sequences encoding the mouse IgG1 heavy chain constant region and the mouse kappa light chain constant region, respectively, using PCR. The clones are then inserted into a transient expression vector for expression in culture. Highly purified mouse antibodies are then purified using a Protein A purification column.

[0108] The classic CDR transplantation method was used to humanize mouse antibodies [10,11]. Antibodies with at least 50% similarity to the mouse light and heavy chain variable regions, and whose framework regions showed at least 50% amino acid sequence similarity to the light and heavy chain variable regions of the antibody to be humanized, were selected as humanization templates. By comparing the heavy and light chain variable region germline genes of the human antibody IMGT database, the germline genes of the heavy and light chain variable regions with high homology were selected as humanization templates. The three CDR sequences of the light and heavy chains of the four mouse antibodies were transplanted into the corresponding humanized templates. Because key sites in the mouse framework region are crucial for supporting CDR activity, these key sites were backmutated to the mouse antibody sequence. The light chain / heavy chain signal peptide sequences, the variable region sequences of the backmutated humanized antibody light chain / heavy chain, and the human IgG4 heavy chain constant region / human kappa light chain constant region sequences were spliced ​​in sequence to obtain the amino acid sequences and nucleotide sequences of the humanized antibodies SARS-2-H014, SARS-2-H157, SARS-2-H202, and SARS-2-H697.

[0109] The present invention further modifies the Fc function of SARS-2-H014. These include: 1) a defucosylated IgG1 subtype expressed in mammalian cells with the Fut8 gene knocked out; 2) a humanized IgG4 subtype antibody with reduced Fc function, SARS-2-H014-Fd11-IgG4; and 3) a humanized IgG4 subtype antibody, SARS-2-H014-Fd19-IgG4, with FcRn binding removed.

[0110] Nucleic acid of the present invention

[0111] The present invention also relates to nucleic acid molecules encoding the antibodies of the present invention or portions thereof. Some exemplary sequences of these nucleic acid molecules are shown in the sequence listing.

[0112] The nucleic acid molecules of the present invention are not limited to the sequences disclosed herein, but also include variants and other nucleic acid forms corresponding thereto, such as mRNA, cDNA, and variants thereof. Variants herein can be described with reference to their physical properties during hybridization. Those skilled in the art will recognize that nucleic acids can be used to identify their complements, as well as their equivalents or homologs, using nucleic acid hybridization techniques. They will also recognize that hybridization can occur with less than 100% complementarity. However, given the appropriate choice of conditions, hybridization techniques can be used to distinguish DNA sequences based on their structural relatedness to specific probes. For guidance on such conditions, see Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 and Ausubel, FM, Brent, R., Kingston, RE, Moore, DD, Sedman, JG, Smith, JA, & Struhl, K. eds. (1995). Current Protocols in Molecular Biology. New York: John Wiley and Sons.

[0113] Recombinant vectors and expression

[0114] The present invention also provides a recombinant construct comprising one or more nucleotide sequences of the present invention. The recombinant construct of the present invention can be used together with a vector, such as a plasmid, phagemid, phage or viral vector, into which the nucleic acid molecule encoding the antibody of the present invention is inserted.

[0115] The antibodies provided herein can be prepared by recombinantly expressing nucleotide sequences encoding light and heavy chains or portions thereof in host cells. In order to express antibodies by recombinant methods, host cells can be transfected with one or more recombinant expression vectors carrying nucleotide sequences encoding light and / or heavy chains or portions thereof so that the light and heavy chains are expressed in the host cells. Standard recombinant DNA methodology is used to prepare and / or obtain nucleic acids encoding heavy and light chains, incorporate these nucleic acids into recombinant expression vectors and introduce the vectors into host cells, such as Sambrook, Fritsch and Maniatis (eds.), Molecular Cloning; A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, (1989), Ausubel, FM et al. (eds.) Current Protocols in Molecular Biology, Greene Publishing Associates, (1989) and Boss et al. U.S. Patent No. 4,816,397.

[0116] In addition, the nucleotide sequence encoding the variable region of the heavy chain and / or light chain can be converted into a nucleotide sequence such as encoding a full-length antibody chain, a Fab fragment or an scFv: for example, a DNA fragment encoding a light chain variable region or a heavy chain variable region can be operably connected (so that the amino acid sequences encoded by the two DNA fragments are all in frame) to another DNA fragment encoding, for example, an antibody constant region or a flexible linker. The sequences of human heavy and light chain constant regions are known in the art (see, for example, Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, US Department of Health and Human Services, NIH Publication No. 91-3242), and DNA fragments comprising these regions can be obtained by standard PCR amplification.

[0117] To express the antibody, standard recombinant DNA expression methods can be used (see, e.g., Goeddel; Gene Expression Technology. Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)). For example, the nucleotide sequence encoding the desired antibody can be inserted into an expression vector, which is then transfected into a suitable host cell. Suitable host cells are prokaryotic and eukaryotic cells. Examples of prokaryotic host cells are bacteria, and examples of eukaryotic host cells are yeast, insect, or mammalian cells. It will be understood that the design of the expression vector, including the selection of regulatory sequences, is influenced by a variety of factors, such as the choice of host cell, the level of expression of the desired protein, and whether expression is constitutive or inducible.

[0118] The antibodies of the present invention can be recovered and purified from recombinant cell cultures by known methods, including but not limited to ammonium sulfate or ethanol precipitation, acid extraction, protein A affinity chromatography, protein G affinity chromatography, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography. High performance liquid chromatography ("HPLC") can also be used for purification. See, for example, Colligan, Current Protocols in Immunology, or Current Protocols in Protein Science, John Wiley & Sons, NY, NY, (1997-2001), e.g., Chapters 1, 4, 6, 8, 9, 10, each of which is incorporated herein by reference in its entirety.

[0119] The antibodies of the present invention include naturally purified products, products of chemical synthesis methods, and products produced by recombinant technology from prokaryotic and eukaryotic hosts, including, for example, yeast, higher plants, insects, and mammalian cells. The antibodies of the present invention may be glycosylated or non-glycosylated. Such methods are described in many standard laboratory manuals, such as Sambrook, supra, Sections 17.37-17.42; Ausubel, supra, Chapters 10, 12, 13, 16, 18, and 20.

[0120] Therefore, embodiments of the present invention are also host cells comprising the vector or nucleic acid molecule, wherein the host cell can be a higher eukaryotic host cell such as mammalian and insect cells, a lower eukaryotic host cell such as yeast cells, and a prokaryotic cell such as bacterial cells.

[0121] Characteristics and functions of the antibodies of the present invention

[0122] ELISA tests showed that the four mouse antibodies obtained, SARS-2-mh014, SARS-2-mh157, SARS-2-mh202 and SARS-2-mh697, were able to effectively block the binding of SARS-CoV-2 and SARS-CoV RBD to ACE, and cross-neutralize SARS-CoV-2 and SARS-CoV pseudoviruses.

[0123] Humanized antibodies SARS-2-H014, SARS-2-H157, SARS-2-H202, and SARS-2-H697 have good cross-binding with SARS-CoV-2 and SARS-CoV RBD proteins, cross-competing for the binding of ACE2 receptors to SARS-CoV-2 and SARS-CoV RBD proteins, and have high affinity for SARS-CoV-2 S1 protein. They cross-neutralize SARS-CoV-2 and SARS-CoV pseudoviruses. The SARS-2-H014 humanized antibody can effectively neutralize the SARS-CoV-2 novel coronavirus at the cellular level. After a single intravenous injection into mice, the average exposure in vivo was C max and AUC last The average half-life was 136.15 μg / mL and 10930.35 h×μg / mL, respectively. 1 / 2 The clearance time was 281.20 h, and the clearance rate Cl was 0.27 mL / h / kg.

[0124] The SARS-2-H014 humanized antibody expressed by Fut8 gene-knockout mammalian cells exhibited significantly better binding ability to CD16a than the IgG1 subtype, weak binding to CD32a or CD32b proteins at high concentrations, and binding levels to CD64, C1q complement protein, and FcRn similar to those of IgG1 subtype antibodies; its ADCC function was significantly better than that of the IgG1 subtype and its ADCP function was similar to that of the IgG1 subtype, and its CDC function remained unchanged.

[0125] The SARS-2-H014-Fd11-IgG4 antibody did not bind to CD32a, CD32b, CD16a, and C1q complement proteins, but had very weak binding to CD64 at high concentrations and FcRn binding similar to that of IgG1 subtype antibodies at pH 6.0. It had no significant ADCC, CDC, and ADCP functions. After a single intravenous injection into mice, the average in vivo exposure to C max and AUC last The average half-life was 144.66 μg / mL and 11940.01 h×μg / mL, respectively. 1 / 2 The clearance time was 290.08h, and the clearance rate Cl was 0.26mL / h / kg.

[0126] The SARS-2-H014-Fd19-IgG4 antibody has the following characteristics: no binding to CD32a, CD32b, CD16a, CD64, and C1q complement proteins, very weak binding to FcRn at pH 6.0 and high concentrations; essentially no ADCC, CDC, and ADCP functions. After a single intravenous injection into mice, the average in vivo exposure to C max and AUC last The average half-life was 125.11 μg / mL and 1202.18 h×μg / mL, respectively. 1 / 2 Only 11.72h, clearance rate Cl is 4.13

[0127] mL / h / kg.

[0128] use

[0129] The antibodies of the present invention can be used to treat, prevent or detect diseases caused by SARS-CoV-2 and SARS-CoV viruses, such as acute respiratory infectious diseases caused by SARS-CoV-2 and SARS-CoV viruses.

[0130] Pharmaceutical composition

[0131] One or more of the antibodies, antigen-binding fragments, antibody-drug conjugates, nucleic acids, and vectors of the present invention can be prepared with at least one other chemical agent into a pharmaceutical composition comprising the above-mentioned active ingredient and one or more pharmaceutically acceptable carriers, diluents, or excipients; optionally, one or more other therapeutic agents.

[0132] Reagent test kit

[0133] The present invention also relates to pharmaceutical packaging and kits comprising one or more containers containing the pharmaceutical compositions of the present invention as described above. Associated with such containers may be a notice in a form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals or biological products, reflecting approval by the agency for manufacture, use, or sale of the product for human administration.

[0134] Preparation and storage

[0135] The pharmaceutical compositions of the present invention can be manufactured in a manner known in the art, such as by means of conventional mixing, dissolving, granulating, levigating, emulsifying, encapsulating, entrapping or lyophilizing methods.

[0136] After pharmaceutical compositions comprising compounds of the invention formulated in an acceptable carrier have been prepared, they can be placed in appropriate containers and labeled for use in treating an indicated condition. Such labeling will include the amount, frequency, and method of administration.

[0137] Drug combinations

[0138] The above-mentioned pharmaceutical compositions comprising the antibodies of the present invention are also combined with one or more other therapeutic agents, where the resulting combination does not cause unacceptable adverse effects.

[0139] The following examples are provided to illustrate the present invention, but are not intended to limit the present invention.

[0140] Example

[0141] Example 1: Screening of murine antibodies that cross-bind to SARS-CoV-2 and SARS-CoV using a phage antibody display library

[0142] 1.1 Immunization of mice

[0143] Mice were immunized subcutaneously with 50 μg of recombinant SARS-CoV RBD protein (source: Beijing Sino-Bio Technologies Co., Ltd., Cat. 40150-V08B2, SEQ ID NO: 1) mixed with Freund's adjuvant. The specific immunization method is described in reference [7].

[0144] 1.2 Construction of phage antibody library

[0145] RNA was extracted from mouse spleen tissue using the TriPure Isolation Reagent Kit (Source: Roche, Cat. No. 11 667 165 001) and reverse transcribed using the Reverse Transcription Kit (Source: Beijing Sino-Bio Technologies Co., Ltd., Cat. No. SRT) to obtain cDNA. The nucleotide sequences encoding the mouse antibody light and heavy chain variable regions were amplified by PCR and then spliced ​​together using overlap extension PCR to form the nucleotide sequence encoding the scFv. The light and heavy chain variable regions were linked via a linker:

[0146] TCTAGTGGTGGCGGTGGTTCGGGCGGTGGTGGAGGTGGTAGTTCTAGATCTT CC (SEQ ID NO: 2)

[0147] The ligation was performed [8], and then the restriction endonuclease Sfi I (source: Fermentas) was used to digest the phage vector pComb3x (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.), and the phage display scFv antibody library for immunizing mice was constructed by electroporation of X-Blue competent cells.

[0148] 1.3 Screening of phages cross-binding to SARS-CoV-2 and SARS-CoV RBD

[0149] A solid-phase screening method was used to screen for phage that dually bind to both SARS-CoV-2 and the SARS-CoV RBD proteins. Protocol 1: 100 μL of 10 μg / mL SARS-CoV S1 protein (Source: Beijing Sino-Bio Technologies Co., Ltd., Cat. 40150-V08B1) was coated onto a 96-well plate, with each well coated overnight at 4°C for the first round of screening. The plates were washed the next day and blocked at room temperature for 1 hour. The phage antibody library was then added and incubated at 37°C for 2 hours. Unbound phage were then washed to remove the plate, and 800 μL of elution buffer (Source: Sino-Bio Technologies Co., Ltd.) was added for incubation for 8 minutes. Neutralization was then performed by adding 10 μL of 2 M Tris buffer (Source: Sino-Bio Technologies Co., Ltd.) to each well. The eluted phage were then infecting X-BLUE bacteria (Source: Biomed) and expressing with helper phage. The expressed phage antibody library was harvested the next day. In the second round of screening, 10 μg / mL of SARS-CoV-2 RBD protein (source: Beijing Sino Biological Technology Co., Ltd., Cat. 40592-V05H) was coated onto a 96-well plate, and the screening method was the same as above. Option 2: 5 μg / mL of SARS-CoV-2 RBD protein was coated onto a 96-well plate, and the specific screening method was the same as above.

[0150] Monoclonal phages were picked from the enriched library for expression, and their binding to SARS-CoV-2 and SARS-CoV S proteins was detected by ELISA. SARS-CoV-2S1, SARS-CoV S1 (Source: Beijing Yiqiao Shenzhou Technology Co., Ltd., Cat.40591-V05H), SARS-CoV-2RBD, SARS-CoV RBD and negative control CD155 (D1)-mFc (Source: Shenzhou Cell Engineering Co., Ltd.) proteins at a concentration of 5 μg / mL were coated on 96-well plates, 100 μL per well, and coated overnight at 4°C. The plate was washed the next day, blocked at room temperature for 2 hours, and the unbound protein was removed by washing the plate. A 10-fold diluted phage monoclonal was added for incubation, and the unbound phage was removed by washing the plate. X-BLUE was added for incubation and the plate was washed repeatedly. Substrate color development solution was added for color development, and the OD was read on a microplate reader after termination. 450 The horizontal axis is the detected protein, OD 450 The vertical axis was used for analysis and plotting using GraphPadPrism software.

[0151] The results are as follows Figure 1As shown, four scFv clones that specifically cross-bind to SARS-CoV-2 and SARS-CoV S1 and RBD proteins were screened from the enriched library, namely SARS-2-m014, SARS-2-m157, SARS-2-m202 and SARS-2-m697, and the nucleotide sequences of the scFv antibodies were obtained by sequencing (SEQ ID NO: 3 / 40 / 62 / 85).

[0152] 1.4 Production of mouse antibodies cross-binding to SARS-CoV-2 and SARS-CoV RBD

[0153] The nucleotide sequences of the heavy chain variable regions of the SARS-2-m014, SARS-2-m157, SARS-2-m202, and SARS-2-m697 scFv antibodies were amplified by PCR, respectively, and inserted into the pSE vector (source: self-prepared) digested with ScaI+NheI (source: Fermentas) containing a heavy chain signal peptide (SEQ ID NO: 28) and a human IgG1 constant region (SEQ ID NO: 6) by the in-fusion method to obtain expression vectors for the human-mouse chimeric antibody SARS-2-mh014 heavy chain (SEQ ID NO: 36), SARS-2-mh157 heavy chain (SEQ ID NO: 58), SARS-2-mh202 heavy chain (SEQ ID NO: 81), and SARS-2-mh697 heavy chain (SEQ ID NO: 101). The nucleotide sequences of the light chain variable regions of SARS-2-m014, SARS-2-m157, SARS-2-m202 and SARS-2-m697 scFv antibodies were amplified by PCR and inserted into the pSE vector digested with Sca I + BsiWI (source: Fermentas) with a light chain signal peptide (SEQ ID NO: 29) and a human kappa constant region (SEQ ID NO: 7) by the in-fusion method to obtain expression vectors for human-mouse chimeric SARS-2-mh014 light chain (SEQ ID NO: 37), SARS-2-mh157 light chain (SEQ ID NO: 59), SARS-2-mh202 light chain (SEQ ID NO: 82) and SARS-2-mh697 light chain (SEQ ID NO: 102).

[0154] Primers for amplifying variable regions:

[0155]

[0156]

[0157] 293E cells were passaged in SCD4-4-TC2 medium (source: Beijing Sino Biological Technology Co., Ltd.) to a volume of 200 mL / flask, with an initial seeding density of 0.3–0.4 × 10 6 cell / mL, and culture the cells in a CO2 shaker at 37°C and 175 rpm. 6 After eluting to 10 cells / mL, add 100 μg of a 1:1 mixture of light and heavy chain plasmid DNA and 800 μL of TF2 transfection reagent (Source: Beijing Sino-Bio Technology Co., Ltd.) and continue culturing on a shaker until day 7, when the culture is harvested. Centrifuge the culture at 4000 rpm for 25 minutes, collect the supernatant, and add 1 / 5 the volume of stock buffer (Source: Sino-Bio Technology Co., Ltd.). Equilibrate a Protein A chromatography column (Source: Sino-Bio Technology Co., Ltd.) with PBS for 5-10 column volumes. Add the filtered culture supernatant to the column, equilibrate again for 5-10 column volumes, and elute the sample with sodium acetate buffer (Source: Sino-Bio Technology Co., Ltd.). After elution, neutralize the sample with Tris buffer until neutral and set aside.

[0158] Example 2: Functional detection of cross-binding SARS-CoV-2 and SARS-CoV mouse antibodies

[0159] 2.1 Cross-binding of mouse antibodies to SARS-CoV-2 and SARS-CoV S1 proteins

[0160] 0.3 μg / mL, 0.1 μg / mL, 0.03 μg / mL, and 0.01 μg / mL of SARS-CoV-2 or SARS-CoV S1 protein were coated on a 96-well plate, with 100 μL per well, and coated overnight at 4°C. The next day, the plate was washed, blocked at room temperature for 1 hour, and 100 μL of 1 μg / mL mouse antibody was added and incubated for 1 hour. The plate was then washed to remove unbound antibody, and 0.25 μg / mL Goat anti-human IgG Fc / HRP (source: KPL) was added for incubation. After repeated washing, the substrate colorimetric solution was added for color development, and the OD value was detected after termination. 450 .

[0161] The results are as follows Figure 2 As shown in the results, SARS-2-mh014, SARS-2-mh157, SARS-2-mh202 and SARS-2-mh697 antibodies all had good cross-binding with SARS-CoV-2S1 protein and SARS-CoV S1 protein, and were concentration-dependent.

[0162] This example further verified the binding ability of mouse antibodies to transiently expressed SARS-CoV-2 S1 protein (2019) nCoV-SPIKE-8D3 cells by flow cytometry. (2019)-Ncov-SPIKE-8D3 cells in the logarithmic growth phase (source: Shenzhou Cell Engineering Co., Ltd.) were placed in a flow cytometer, and 5×10 5 cell / tube. Add 16.67μg / mL of four mouse antibodies and H7N9-R1 negative control antibody (source: Shenzhou Cell Engineering Co., Ltd.), incubate at 4℃ for 20min, then wash with PBS and remove unbound antibodies by centrifugation. Add FITC-labeled Goat anti-Human IgG Fc secondary antibody (source: KPL Company), incubate at 4℃ for 20min, then wash repeatedly with PBS. Resuspend the cells in 200μL PBS, filter through 400 mesh, and detect on a flow cytometer. The results are as follows Figure 3 As shown, all four mouse antibodies have good binding to (2019)-nCoV-SPIKE-8D3 cells, among which SARS-2-mh014 has a slightly higher binding ability, and the negative control has no binding.

[0163] 2.2 Mouse Antibodies Cross-Compete for Binding of ACE2 Receptors to SARS-CoV-2 and SARS-CoV RBD Proteins

[0164] SARS-CoV-2 or SARS-CoV RBD protein at a concentration of 1 μg / mL was coated on a 96-well plate, 100 μL per well, and coated overnight at 4°C. The next day, the plate was washed and blocked at room temperature for 1 hour. 100 μL of 0.08 μg / mL ACE2 protein (Source: Beijing Yiqiao Shenzhou Technology Co., Ltd.) was added, along with 1 μg / mL of mouse antibody and negative control antibody H7N9-R1 for co-incubation. The plate was washed to remove unbound antibodies, and 0.5 μg / mL C-his-R023 / HRP (Source: Shenzhou Cell Engineering Co., Ltd.) was added for incubation. After repeated washing, the substrate colorimetric solution was added for color development. After termination, the OD value was detected. 450 Inhibition rate PI% = (OD 空白 –OD 样品 ) / OD 空白 ×100, where OD 空白 The OD value of the normal coating group with only ACE2 and no antibody added is shown in the figure. 样品 It indicates the OD value of the detection group with normal coating and addition of ACE2 and antibody.

[0165] The results are as follows Figure 4As shown, ACE2 protein can bind to the coated SARS-CoV-2 and SARS-CoV RBD proteins. The four mouse antibodies can effectively cross-compete for the binding of ACE2 protein with SARS-CoV-2 and SARS-CoV RBD proteins, and the negative control antibody has no competitive effect.

[0166] 2.3 Mouse Antibodies Cross-Neutralize SARS-CoV-2 and SARS-CoV Pseudoviruses

[0167] Pseudoviruses expressing the full-length SARS-CoV-2 or SARS-CoV S protein were packaged using Lenti-X 293 cells (source: Clontech). A total of 62 μg of PSD, pWPXL-Luc, and pCMV3-SARS-CoV-2-S or pCMV3-SARS-CoV-S plasmids (source: Sino Cell Engineering Co., Ltd.) were mixed in a 3:4:2 ratio and 72 μL of Sinofection TF02 transfection reagent (source: Beijing Sino Biological Technology Co., Ltd.) was added. After mixing, the cells were incubated at room temperature for 10 minutes before being added to Lenti-X293 cells. The cell plates were incubated at 37°C, 5% CO2 for 6 hours, after which the medium was replaced. After a further 48 hours of incubation, the supernatant was collected and filtered through a 0.45 μm filter to remove cell debris. The pseudovirus solution was then stored at -80°C.

[0168] The virus was diluted 10-fold using the limiting dilution method, with a total of 10 virus concentrations and 6 replicates per well. The inoculation density in a 96-well plate was 5×10 5 cell / mL of VERO-E6 cell (source: Basic Medical Cell Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences) suspension, 100 μL / well. Add 50 μL of gradient dilution of virus to each well, use cell culture medium as negative control, mix well and place in a 37°C, 5% CO2 incubator for 24 hours. After the culture is completed, add 5× passive lysis buffer (source: Promega), 30 μL / well, mix well and lyse the cells. Take 10 μL / well and transfer to a 96-well white bottom plate to detect the fluorescence signal, and calculate the half tissue cell infection dose (TCID) by the Reed-Muench method. 50 )value.

[0169] Different concentrations of antibodies (80.0 μg / mL, 26.7 μg / mL, 8.9 μg / mL, 3.0 μg / mL, 0.99 μg / mL, 0.33 μg / mL, 0.11 μg / mL, 0.037 μg / mL, and 0.012 μg / mL) were added to a 96-well cell culture plate at 50 μL / well. 300 TCID 50The pseudovirus was added at a density of 50 μL / well. The virus-free group was used as a positive control, and the virus-free and antibody-free group was used as a negative control. After mixing, the cells were incubated at 37°C, 5% CO2 for 1 hour. After incubation, the cells were seeded at a density of 5 × 10 cells / well at a density of 100 μL / well. 5 Cell / mL VERO-E6 cell suspension was mixed and placed in a 37°C, 5% CO2 incubator for 24 hours. After the culture was completed, 5× passive lysis buffer (source: Promega) was added at 30 μL / well and mixed to lyse the cells. 10 μL / well was transferred to a 96-well white bottom plate and the fluorescence signal value (RLU) was used to calculate the neutralization rate. Neutralization rate % = (positive control RLUs – sample RLUs) / (positive control RLUs – negative control RLUs) × 100%. The results are as follows Figure 5 As shown, all four mouse antibodies can effectively neutralize SARS-CoV-2 and SARS-CoV pseudoviruses in a concentration-dependent manner.

[0170] Example 3: Humanized transformation and production of murine antibodies

[0171] 3.1 Determination of CDRs of Mouse Antibody Light and Heavy Chains

[0172] Based on the nucleotide sequences determined in Example 1.3, the variable region amino acid sequences of the heavy and light chains of four murine cross-neutralizing antibodies were deduced: the heavy chain variable region amino acid sequence (SEQ ID NO: 8) and the light chain variable region amino acid sequence (SEQ ID NO: 9) of the SARS-2-mh014 antibody; the heavy chain variable region amino acid sequence (SEQ ID NO: 43) and the light chain variable region amino acid sequence (SEQ ID NO: 44) of the SARS-2-mh157 antibody; the heavy chain variable region amino acid sequence (SEQ ID NO: 65) and the light chain variable region amino acid sequence (SEQ ID NO: 66) of the SARS-2-mh202 antibody; and the heavy chain variable region amino acid sequence (SEQ ID NO: 88) and the light chain variable region amino acid sequence (SEQ ID NO: 89) of the SARS-2-mh697 antibody.

[0173] The amino acid sequences of the three CDRs in each of the light and heavy chains of the four murine neutralizing antibodies were determined with reference to Kabat[9] and the IMGT numbering system. The light and heavy chain CDRs of these four antibodies were directly transplanted into the resulting humanized antibodies during the subsequent CDR grafting and humanization steps. The sequences and homology analysis of the light and heavy chain CDRs of the four murine neutralizing antibodies are shown in Tables 1 and 2.

[0174] Table 1 CDR sequences and homology analysis of mouse neutralizing antibody light chains

[0175]

[0176] Table 2 Murine neutralizing antibody heavy chain CDR sequences and homology analysis

[0177]

[0178]

[0179] 3.2 Humanized CDR transplantation of mouse antibodies

[0180] The classic CDR transplantation method was used to humanize mouse antibodies [10,11]. Antibodies with at least 50% similarity to the mouse light and heavy chain variable regions, and with at least 50% amino acid sequence similarity between the framework regions of the light and heavy chain variable regions of the antibody to be modified, were selected as humanization templates. By comparing the IMGT human antibody heavy and light chain variable region germline gene database, the heavy and light chain variable region germline genes with high homology to SARS-2-mh014, SARS-2-mh157, SARS-2-mh202, and SARS-2-mh697 were selected as humanization templates. The three CDR sequences of the light and heavy chains of these four mouse antibodies were transplanted into the corresponding humanized templates. The selection of humanized templates for the four mouse cross-neutralizing antibodies in this example and their homology to the corresponding mouse antibodies are shown in Table 3.

[0181] Table 3 Selection of humanized templates for the framework region of SARS-CoV-2 neutralizing antibodies

[0182]

[0183] 3.3 Back mutations in the framework regions of humanized variable regions

[0184] Because key points in the mouse framework region are crucial for maintaining the stability of the CDR spatial structure, they need to be backmutated to the corresponding amino acids in the mouse antibody. The backmutation designs for the framework region of the humanized templates for the four CDR-grafted humanized SARS-CoV-2 neutralizing antibodies in this example are shown in Table 4.

[0185] Four humanized antibodies were obtained through CDR humanization transplantation and framework region back mutation: SARS-2-H014, SARS-2-H157, SARS-2-H202 and SARS-2-H697. The amino acid sequences of the heavy chain variable regions of the four humanized antibodies are SEQ ID NO: 22 / 51 / 74 / 94, and the amino acid sequences of the light chain variable regions are SEQ ID NO: 23 / 52 / 75 / 95, respectively. The amino acid sequences of the heavy chains containing signal peptides of the four humanized antibodies are SEQ ID NO: 18 / 49 / 72 / 92, respectively, which contain the heavy chain signal peptide amino acid sequence (SEQ ID NO: 20), the heavy chain variable region amino acid sequence (SEQ ID NO: 22 / 51 / 74 / 94) and the heavy chain constant region amino acid sequence (SEQ ID NO: 24) connected in sequence. The light chain amino acid sequences of the four humanized antibodies containing signal peptides are SEQ ID NOs: 19 / 50 / 73 / 93, respectively, which comprise the light chain signal peptide amino acid sequence (SEQ ID NO: 21), the heavy chain variable region amino acid sequence (SEQ ID NOs: 23 / 52 / 75 / 95), and the light chain constant region amino acid sequence (SEQ ID NO: 25), respectively. The light and heavy chain CDR sequences and homology analysis of the four humanized antibodies are shown in Tables 5 and 6.

[0186] Table 4 Design of reverse mutations of SARS-CoV-2 neutralizing antibodies after CDR grafting and humanization

[0187]

[0188]

[0189] Note: V71I means that the V at position 71 was mutated back to I according to the Kabat numbering system.

[0190] Table 5 Humanized antibody light chain CDR sequences and homology analysis

[0191]

[0192] Table 6 Humanized antibody heavy chain CDR sequences and homology analysis

[0193]

[0194] 3.4 Production of humanized antibodies

[0195] The nucleotide sequences of the SARS-2-H014 heavy chain variable region (SEQ ID NO: 30), SARS-2-H157 heavy chain variable region (SEQ ID NO: 55), SARS-2-H202 heavy chain variable region (SEQ ID NO: 78), and SARS-2-H697 heavy chain variable region (SEQ ID NO: 98) were obtained by whole gene synthesis. These sequences were then inserted into a pSE vector digested with Sca I and Nhe I (source: Fermentas) containing a heavy chain signal peptide (SEQ ID NO: 28) and a heavy chain IgG1 constant region (SEQ ID NO: 32) to generate expression vectors for the SARS-2-H014 heavy chain (SEQ ID NO: 26), SARS-2-H157 heavy chain (SEQ ID NO: 53), SARS-2-H202 heavy chain (SEQ ID NO: 76), and SARS-2-H697 heavy chain (SEQ ID NO: 96).

[0196] The SARS-2-H014 light chain variable region (SEQ ID NO: 31) and the SARS-2-H202 light chain variable region (SEQ ID NO: 79) were obtained by whole gene synthesis and inserted into the pSE vector digested with Sca I + BsiW I (source: Fermentas) containing a light chain signal peptide (SEQ ID NO: 29) and a light chain kappa constant region nucleotide sequence (SEQ ID NO: 33) by the in-fusion method to obtain the SARS-2-H014 light chain (SEQ ID NO: 27) expression vector and the SARS-2-H202 light chain (SEQ ID NO: 77) expression vector, respectively.

[0197] The nucleotide sequences of SARS-2-H157 light chain (SEQ ID NO: 54) and SARS-2-H697 light chain (SEQ ID NO: 97) were obtained by splicing PCR and inserted into the pSE vector digested with Hind III + Xba I (source: Fermentas) by the In-fusion method to obtain the SARS-2-H157 light chain (SEQ ID NO: 54) expression vector and the SARS-2-H697 light chain (SEQ ID NO: 97) expression vector, respectively.

[0198] After plasmid extraction, HEK-293 cells (source: Invitrogen) were transfected and cultured for expression for 7 days. High-purity antibodies were purified using a protein A purification column.

[0199] Primers for the full gene synthesis of SARS-2-H014 heavy chain variable region:

[0200]

[0201] Primers for the whole gene synthesis of SARS-2-H014 light chain variable region:

[0202]

[0203]

[0204] Primers for the full gene synthesis of SARS-2-H202 heavy chain variable region:

[0205]

[0206] Primers for the whole gene synthesis of SARS-2-H202 light chain variable region:

[0207]

[0208]

[0209] Primers for the full gene synthesis of SARS-2-H697 heavy chain variable region:

[0210]

[0211] Primers for the full gene synthesis of SARS-2-H157 heavy chain variable region:

[0212]

[0213] Primers for splicing SARS-2-H697 light chain:

[0214]

[0215]

[0216] Primers for splicing SARS-2-H157 light chain:

[0217]

[0218] Example 4: Antigen binding and neutralization ability detection of humanized antibodies

[0219] 4.1 Cross-binding of humanized antibodies to SARS-CoV-2 and SARS-CoV RBD proteins

[0220] SARS-CoV-2 or SARS-CoV RBD protein at different concentrations (1000 ng / mL, 333.3 ng / mL, 111.1 ng / mL, 37.0 ng / mL, 12.3 ng / mL, 1.37 ng / mL, and 0.46 ng / mL) were coated on a 96-well plate with 100 μL per well and coated overnight at 4°C. The plate was washed the next day, blocked at room temperature for 1 hour, and 100 μL of 1 μg / mL humanized antibody was added and incubated for 1 hour. The plate was then washed to remove unbound antibody, and 0.25 μg / mL Goat anti-human IgG Fc / HRP (source: KPL) was added for incubation. After repeated washing, the substrate colorimetric solution was added for color development, and the OD value was detected after termination. 450 .

[0221] The results are as follows Figure 6 As shown, humanized antibodies SARS-2-H014, SARS-2-H157, SARS-2-H202 and SARS-2-H697 have good cross-binding with SARS-CoV-2 and SARS-CoV RBD proteins, and the binding ability is similar, and the binding shows an "S"-shaped curve growth.

[0222] 4.2 Humanized Antibodies Cross-Compete for Binding of ACE2 Receptor to SARS-CoV-2 and SARS-CoV RBD Proteins

[0223] The ability of humanized antibodies to cross-compete for binding to ACE2 receptors with SARS-CoV-2 and SARS-CoV RBD proteins was tested with reference to Example 2.2. Figure 7 As shown in the results, humanized antibodies SARS-2-H014, SARS-2-H157, SARS-2-H202 and SARS-2-H697 can effectively inhibit the binding of ACE2 protein to SARS-CoV-2 and SARS-CoV RBD protein, with similar inhibitory abilities.

[0224] 4.3 Affinity testing of humanized antibodies against SARS-CoV-2 and SARS-CoV S1 proteins

[0225] The binding affinity of humanized antibodies to biotinylated SARS-CoV-2 and SARS-CoV S1 proteins (source: Beijing Sino-Bio Technologies Co., Ltd.) was determined using the Biomolecular Interaction Analysis System (OctetRED96e, Fortebio). Using the SA Sensor, 2 μg / mL of biotinylated SARS-CoV-2 or SARS-CoV S1 protein was added after equilibration for 60 seconds. Unbound protein was then washed away by equilibration for another 100 seconds. Humanized antibodies at varying concentrations (4.0 μg / mL, 2.0 μg / mL, 1.0 μg / mL, 0.5 μg / mL, 0.25 μg / mL, 0.13 μg / mL, and 0.06 μg / mL) were then added for 300 seconds, followed by dissociation for 300 seconds. Data were analyzed using Octet Data Analysis software to calculate antibody affinity (KD), association constant (kon), and dissociation constant (kdis).

[0226] The results, as shown in Table 7, show that all four humanized antibodies have high affinities for both SARS-CoV-2 and SARS-CoV S1 proteins. SARS-2-H014 has an affinity for SARS-CoV-2 S1 protein of 2.6E-10 M, an association constant of 4.5E+05 1 / Ms, and a dissociation constant of 1.2E-04 1 / s. It also has an affinity for SARS-CoV S1 protein of 1.2E-11 M, an association constant of 2.7E+05 1 / Ms, and a dissociation constant of 3.3E-06 1 / s. SARS-2-H157 has an affinity of 2.9E-10M for the SARS-CoV-2 S1 protein, an association constant of 6.9E+05 1 / Ms, and a dissociation constant of 2.0E-04 1 / s. It also has an affinity of 1.1E-10M for the SARS-CoV S1 protein, an association constant of 4.8E+05 1 / Ms, and a dissociation constant of 5.3E-05 1 / s. SARS-2-H202 has an affinity of 2.1E-10M for the SARS-CoV-2 S1 protein, an association constant of 5.8E+05 1 / Ms, and a dissociation constant of 1.2E-04 1 / s. It also has an affinity of 2.0E-10M for the SARS-CoV S1 protein, an association constant of 4.2E+05 1 / Ms, and a dissociation constant of 8.6E-05 1 / s. The affinity of SARS-2-H697 to SARS-CoV-2 S1 protein is 2.7E-11M, the association constant is 9.1E+05 1 / Ms, and the dissociation constant is 2.5E-05 1 / s; the affinity to SARS-CoV S1 protein is 7.5E-11M, the association constant is 4.6E+05 1 / Ms, and the dissociation constant is

[0227] 3.4E-05 1 / s. The above results show that the four humanized antibodies have similar binding abilities to SARS-CoV-2 and SARS-CoV S1 proteins. The specific kinetic characteristic parameter curves are shown in Figure 8 .

[0228] Table 7 Affinity test of humanized antibodies to SARS-CoV-2 S1 protein

[0229]

[0230] 4.4 Humanized antibodies cross-neutralize SARS-CoV-2 and SARS-CoV pseudoviruses

[0231] The ability of humanized antibodies to cross-neutralize SARS-CoV-2 and SARS-CoV pseudovirus was evaluated with reference to Example 2.3. Figure 9 As shown, the four humanized antibodies, SARS-2-H014, SARS-2-H157, SARS-2-H202, and SARS-2-H697, all effectively neutralized SARS-CoV-2 and SARS-CoV pseudoviruses in a concentration-dependent manner. Humanization did not alter the cross-neutralizing ability of the antibodies, and the four humanized antibodies had similar neutralizing potencies against SARS-CoV-2 and SARS-CoV pseudoviruses.

[0232] Example 5: Drug Quality and Drug Stability Analysis of Humanized Antibody SARS-2-H014

[0233] 5.1 SARS-2-H014 Purity and Particle Size Analysis

[0234] The purity of SARS-2-H014 was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and size-exclusion high performance liquid chromatography (SEC-HPLC). Specific steps of SDS-PAGE were as follows: (1) SDS-PAGE gel preparation: 3.9% stacking gel, 7.5% separation gel (non-reducing electrophoresis), and 13% separation gel (reducing electrophoresis); (2) the sample was boiled at 100°C for 2 minutes, centrifuged, and 8 μg was loaded; (3) electrophoresis was performed at 100 V for 1 hour; (4) Coomassie brilliant blue staining was performed and then destaining was performed, and the purity of the sample bands was calculated using BandScan software. The SEC-HPLC operation steps are as follows: (1) Instrument: liquid chromatography system (Agilent, model: Agilent1260), hydrophilic silica gel high performance molecular exclusion chromatography column (Tosoh, model: TSK-GEL G3000SW)XL (7.8×300mm, 5μm); (2) Mobile phase: 200mM NaH2PO4, 100mM Arginine, pH6.5; (2) Sample load: 80μg; (3) Detection wavelength: 280nm, analysis time: 30min, flow rate: 0.5mL / min, column temperature: 25℃; (4) Calculate the peak ratio by area normalization method.

[0235] The purities of SARS-2-H014 by reducing SDS-PAGE and non-reducing SDS-PAGE were 99.4% and 92.7%, respectively. SEC-HPLC revealed a main peak ratio of 99.4% and aggregates of 0.6% (Table X). Both assays demonstrate a high degree of purity for SARS-2-H014, with minimal aggregates present and no other components.

[0236] Dynamic light scattering (DLS) was used to detect the particle size and uniformity of SARS-2-H014. The specific operation steps were as follows: (1) Instrument: Dynamic light scattering instrument (Wyatt Technology, model: DynaProNanoStar); (2) The sample volume was 50 μL; (3) After data acquisition, the data were analyzed using Dynamics 7.1.8 software.

[0237] The radius of SARS-2-H014 was 5.7 nm, and the percent dispersity (%Pd) was 12.4%, indicating that the SARS-2-H014 particles were small, the normal size of IgG1 antibody particles, and had good uniformity (Table 8).

[0238] Table 8 SEC and DLS test results of SARS-2-H014 fusion protein

[0239]

[0240] 5.2 Thermal Stability Analysis of SARS-2-H014

[0241] Differential scanning fluorimetry (DSF) was used to detect the thermal stability of SARS-2-H014. Specific steps: (1) Instrument: Uncle system (Unchained Labs, model: UNCLE-0330); (2) Sample volume: 9 μL; (3) Experimental parameters: temperature range: 25°C to 95°C, heating rate: 0.3°C / min; (4) Data were analyzed using UNcle Analysis software. The midpoint of the internal fluorescence change curve under UV266 was taken as Tm, and the aggregation onset temperature of the aggregate change curve formed by the static light scattering signal under UV266 / Blue473 was taken as Tagg266 and Tagg473.

[0242] The results of the thermal stability test of SARS-2-H014 in Histidine buffer (40 mM Histidine, 120 mM NaCl, 0.02% Tween80, pH 6.0) are shown in Table 9, showing good thermal stability.

[0243] Table 9 Tm test results of SARS-2-H014 fusion protein

[0244]

[0245] 5.3 Analysis of Acid-Base Isomers of SARS-2-H014

[0246] IgG1 antibodies have uneven charge due to the presence of asparagine (Asn) deamidation, lysine (Lys) glycation, and methionine (Met) oxidation, showing acidic and basic isomers. Cation exchange high performance liquid chromatograph (CEX-HPLC) and capillary isoelectric focusing (cIEF) were used to analyze the acidic and basic isomer levels of SARS-2-H014, respectively. CEX-HPLC operation steps: (1) Instrument: liquid chromatography system (Agilent, model: Agilent1260), cation exchange chromatography column (Thermo, model: ProPac TMWCX-10 (4×250 mm, 5 μm); (2) Mobile phase A: buffer A, pH 5.6 (Thermo Fisher Scientific, Cat: 083273); (3) Mobile phase B: buffer B, pH 10.2 (Thermo Fisher Scientific, Cat: 083275); (4) Sample loading amount: 80 μg; (5) Detection wavelength: 280 nm, analysis time: 50 min, flow rate: 0.5 mL / min, column temperature: 25°C; (6) Peak ratios were calculated using the area normalization method. cIEF operation steps: (1) Instrument: Imaging capillary electrophoresis instrument (Proteinsimple, model: iCE3); (2) Take 10 μL of 5 mg / ml sample and mix it with 8 μL Pharmalyte 3-10, 70 μL 1% methyl cellulose (MC), 2 μL PI marker and ddH2O to prepare the analytical solution, with a total volume of 200 μL; (3) Place the sample in the iCE3 instrument, pre-focus at 1500 V for 1 min, and then focus at 3000 V for 6 min; (4) Use Chrom Perfect software to analyze the data.

[0247] CEX-HPLC analysis of SARS-2-H014 revealed an acidic peak ratio of 7.9% and a basic peak ratio of 4%. cIEF analysis revealed an acidic peak ratio of 16.0% and a basic peak ratio of 2.2% (Table 10). Both assays indicate that the acidic and basic isomers of SARS-2-H014 are present at low levels.

[0248] Table 10 CEX-HPLC and cIEF detection results of SARS-2-H014 fusion protein

[0249]

[0250] 5.4 Thermal Accelerated Stability Analysis of SARS-2-H014

[0251] After SARS-2-H014 samples were stored at 45°C for one week, the purity of the samples was analyzed by SDS-PAGE and SEC-HPLC, and the changes in the particle size of the samples were analyzed by DLS. The specific operation steps were as described in Example 5.1.

[0252] After one week of storage at 45°C, SARS-2-H014 showed a 0.9% decrease in purity by reducing SDS-PAGE, but no decrease in purity by non-reducing electrophoresis. SEC purity decreased by 2%, with a slight increase in aggregates and the appearance of a small amount of fragments. This suggests that SARS-2-H014 exhibits a small tendency to aggregate and fragment after thermal acceleration, but its purity remains high after thermal acceleration. DLS analysis revealed that although the radius of SARS-2-H014 increased by 0.4 nm after thermal acceleration, it remained within a normal particle size. The % Pd increased, and 40 nm particles appeared, while the intensity decreased, further demonstrating a low tendency for SARS-2-H014 to aggregate (Table 11). In summary, despite a low tendency to aggregate, SARS-2-H014 still exhibits good thermal acceleration stability.

[0253] Table 11 Results of thermal acceleration stability test of SARS-2-H014

[0254]

[0255] 5.5 Freeze-thaw stability analysis of SARS-2-H014

[0256] SARS-2-H014 samples were stored at -80°C for 3 hours, then transferred to 45°C for 1 hour and thawed. This freeze-thaw cycle was repeated five times. Sample purity was analyzed by SDS-PAGE and SEC-HPLC, and particle size changes were analyzed by DLS. The specific procedures were as described in Example 5.1.

[0257] After five freeze-thaw cycles, SARS-2-H014 showed no significant change in purity by SDS-PAGE or SEC, nor did it show a significant increase in aggregate or fragment levels; nor did it show a significant increase in DLS particle size (Table 12), indicating that SARS-2-H014 has good freeze-thaw stability.

[0258] Table 12 Freeze-thaw stability test results of SARS-2-H014

[0259]

[0260] 5.6 Analysis of the Oscillation Stability of SARS-2-H014

[0261] SARS-2-H014 samples were placed in deep-well plates and vortexed at 800 rpm for 24 h. The purity of the samples was analyzed by SDS-PAGE and SEC-HPLC, and the changes in sample particle size were analyzed by DLS. The specific procedures were as described in Example 5.1.

[0262] After 24 hours of shaking, SARS-2-H014 showed no significant change in purity by SDS-PAGE or SEC, nor did it show a significant increase in aggregate or fragment levels; nor did it show a significant increase in DLS particle size (Table 13), indicating that SARS-2-H014 has good shaking stability.

[0263] Table 13 Oscillation stability test results of SARS-2-H014

[0264]

[0265] 5.7 High-Concentration Stability Analysis of SARS-2-H014

[0266] The 10.3 mg / mL SARS-2-H014 sample was concentrated to 25.6 mg / mL, 50.9 mg / mL, 81.0 mg / mL, and 95.1 mg / mL using a 50 kDa ultrafiltration tube. The sample purity was analyzed by SDS-PAGE and SEC-HPLC, and the particle size changes of the samples were analyzed by DLS. The specific operation steps were similar to those in Example 5.1.

[0267] As the concentration of SARS-2-H014 gradually increased, there was no significant change in purity by SDS-PAGE or SEC, nor was there a significant increase in aggregate or fragment levels. However, the DLS particle radius slowly increased with increasing concentration, reaching a maximum radius of 9.8 nm (Table 14), indicating that SARS-2-H014 has good high-concentration stability.

[0268] Table 14 High concentration stability test results of SARS-2-H014

[0269]

[0270] Example 6: Epitope Analysis of Humanized Antibody SARS-2-H014

[0271] The results of Example 4 show that SARS-2-H014 can cross-bind to the RBD proteins of SARS-CoV-2 and SARS-CoV, and can cross-compete for the binding of ACE2 receptors to the RBD proteins of SARS-CoV-2 and SARS-CoV. Cryo-electron microscopy crystallization showed that residues 437-508 are the key amino acid residues required for the binding of SARS-CoV-2 RBD to ACE2

[12] . In addition, by comparing the sequences of SARS-CoV-2 and SARS-CoV, it was found that the similarity between the ACE2 binding region in the RBD of the two is low, while the non-ACE2 binding region in the RBD has a high similarity

[13] . Based on the above information, it is speculated that the epitope of SARS-2-H014 may be located in a region that is relatively similar in the structure of SARS-CoV-2 and SARS-CoV RBD, and that after SARS-2-H014 binds to the RBD, it will form a steric conflict with the structural conformation of ACE2. Therefore, this example selected 14 identical sites in the SARS-CoV-2 and SARS-CoV RBD or residue sites located in and near the ACE2 binding region, and mutated them to other residue types with properties that are significantly different from the original residue types, resulting in 13 mutants, namely V367F, K378D, T385Y, T415Y, N439R, N440Y, Y489R, T500Y, Y505E, A372Y, S375Y, D405R / R408D and V503Y.

[0272] In this example, SARS-CoV-2 RBD-His was used as a template (sequence source: https: / / www.gisaid.org / ). Site-directed mutagenesis was performed using PCR and verified by sequencing. Mutant and wild-type (WT) SARS-CoV-2 RBD proteins were transiently expressed, and the binding ability of the SARS-2-H014 antibody to the mutant protein was tested by ELISA. A non-ACE2-competing SARS-CoV neutralizing antibody, R007 (source: Beijing Sino Biological Technology Co., Ltd.), was also used as a control.

[0273] For ELISA test results ( Figure 10 B) Using the ELISA reading of WT SARS-CoV-2 RBD as the standard, when the ELISA binding signal of SARS-2-H014 against a specific mutant drops below 75% relative to WT SARS-CoV-2 RBD, the residue site is defined as a significant binding epitope. Similarly, if the ELISA binding signal of SARS-2-H014 against a specific mutant drops below 50%, it is defined as a highly significant epitope. Figure 10As shown, S375 and K378 in SARS-CoV-2 RBD are highly significant epitopes of SARS-2-H014, and D405 and R408 are significant epitopes of H014.

[0274] Example 7: Construction and production of humanized antibodies SARS-2-H014 with different Fc functional forms

[0275] 7.1 Construction and production of defucosylated IgG1 subtype SARS-2-H014

[0276] The SARS-2-H014 heavy chain (SEQ ID NO: 26) expression vector and the SARS-2-H014 light chain (SEQ ID NO: 27) expression vector plasmids were extracted and transfected into HEK-293 (Fut8 gene knockout) cells for culture and expression for 7 days. A highly pure defucosylated IgG1 subtype humanized SARS-2-H014 antibody, namely SARS-2-H014-Ae0-IgG1, was purified using a protein A purification column.

[0277] 7.2 Construction and Production of IgG4 Subtype Humanized Antibody SARS-2-H014 with Reduced Fc Function

[0278] To reduce the immune function mediated by the antibody Fc fragment, the constant region of the IgG4 subtype was mutated with nucleotides according to the literature

[14] , and a genetically engineered heavy chain IgG4 constant region nucleotide sequence (Fd11-IgG4, SEQ ID NO: 105) was obtained. The SARS-2-H014-Fd11-IgG4 heavy chain sequence (SEQ ID NO: 109) was obtained by splicing PCR, which contains the heavy chain signal peptide nucleotide sequence (SEQ ID NO: 28), the SARS-2-H014 heavy chain variable region nucleotide sequence (SEQ ID NO: 30) and the Fd11-IgG4 nucleotide sequence (SEQ ID NO: 105). The SARS-2-H014-Fd11-IgG4 heavy chain (SEQ ID NO: 109) expression vector was obtained by inserting it into the pSE vector digested with Hind III + Xba I (source: Fermentas) by the in-fusion method.

[0279] Primers for assembling SARS-2-H014-Fd11-IgG4 heavy chain:

[0280] F61 GTCACCGTCCTGACACGAAGCTTGCCGCCACCATG

[0281] R64 TGGGCCCTTGGTGCTTGC

[0282] F64 GCAAGCACCAAGGGCCCA

[0283] R63 ACTATAGAATAGGGCCCTCTAGA

[0284] The SARS-2-H014-Fd11-IgG4 heavy chain (SEQ ID NO: 109) and SARS-2-H014 light chain (SEQ ID NO: 27) expression vectors were extracted and transfected into HEK-293 cells for culture and expression for 7 days. A highly pure IgG4 subtype humanized SARS-2-H014 antibody with reduced Fc function, namely SARS-2-H014-Fd11-IgG4, was purified using a protein A purification column.

[0285] 7.3 Construction and Production of the FcRn-Depleted IgG4 Subtype Humanized Antibody SARS-2-H014

[0286] To eliminate antibody binding to FcRn and reduce the immune function mediated by the antibody Fc fragment, nucleotide mutations were performed on the constant region of the IgG4 subtype according to the literature [15,16], resulting in a genetically engineered Fc heavy chain IgG4 constant region nucleotide sequence (Fd19-IgG4, SEQ ID NO:107). The SARS-2-H014-Fd1d-IgG4 heavy chain sequence (SEQ ID NO:111) was obtained by splicing PCR, which contains the heavy chain signal peptide nucleotide sequence (SEQ ID NO:28), the SARS-2-H014 heavy chain variable region nucleotide sequence (SEQ ID NO:30), and the Fd19-IgG4 nucleotide sequence (SEQ ID NO:107). The SARS-2-H014-Fd19-IgG4 heavy chain sequence (SEQ ID NO: 111) was obtained by splicing PCR and inserted into the pSE vector digested with Hind III + Xba I (source: Fermentas) by the in-fusion method to obtain the SARS-2-H014-Fd19-IgG4 heavy chain (SEQ ID NO: 111) expression vector.

[0287] Primers for assembling SARS-2-H014-Fd19-IgG4 heavy chain:

[0288]

[0289]

[0290] The SARS-2-H014-Fd19-IgG4 heavy chain (SEQ ID NO: 111) expression vector and the SARS-2-H014 light chain (SEQ ID NO: 27) expression vector plasmids were extracted and transfected into HEK-293 cells for culture and expression for 7 days. The highly pure IgG4 subtype humanized SARS-2-H014 antibody with no FcRn binding and reduced Fc function, namely SARS-2-H014-Fd19-IgG4, was purified using a protein A purification column.

[0291] Example 8: Fc function of different forms of humanized antibody SARS-2-H014

[0292] 8.1 CD16a Binding Function of Humanized Antibodies SARS-2-H014 with Different Fc Functional Forms

[0293] Humanized antibodies with different Fc functional forms (SARS-2-H014-IgG1, SARS-2-H014-Ae0-IgG1, SARS-2-H014-Fd11-IgG4, and SARS-2-H014-Fd19-IgG4) at different concentrations (30,000 ng / mL, 10,000 ng / mL, 3,333.3 ng / mL, 1,111.1 ng / mL, 370.4 ng / mL, 123.5 ng / mL, and 41.2 ng / mL) were coated onto 96-well plates at 100 μL per well and incubated overnight at 4°C. The next day, the plates were washed and blocked at room temperature for 1 hour. Then, 5 μg / mL CD16a-His (F158V) protein (source: Beijing Sino Biological Technology Co., Ltd.) was added at 100 μL / well and incubated for 1 hour. Wash the plate to remove unbound proteins, add 0.5 μg / mL anti-His-MM02T / HRP (Source: Beijing Sino Biological Technology Co., Ltd.) and incubate, then wash the plate again. Add substrate colorimetric solution for color development, and detect OD after termination. 450 .

[0294] The results are as follows Figure 11 As shown, the defucosylated IgG1 subtype SARS-2-H014-Ae0-IgG1 antibody has a significantly better binding ability to CD16a than the IgG1 subtype SARS-2-H014 antibody, while the Fd11-IgG4 and Fd19-IgG4 subtype antibodies SARS-2-H014-Fd11-IgG4 and SARS-2-H014-Fd19-IgG4, which reduce the immune function mediated by the Fc fragment of the antibody, do not bind to CD16a.

[0295] 8.2 CD32 Binding Function of Humanized Antibodies SARS-2-H014 with Different Fc Functional Forms

[0296] Different concentrations (30 μg / mL, 10 μg / mL, and 3.3 μg / mL) of humanized antibodies with different Fc functional forms: SARS-2-H014-IgG1, SARS-2-H014-Ae0-IgG1, SARS-2-H014-Fd11-IgG4, and SARS-2-H014-Fd19-IgG4 were coated on 96-well plates, 100 μL per well, and coated overnight at 4°C. The next day, the plates were washed and blocked at room temperature for 1 hour. 5 μg / mL of CD32a-His or CD32b-His protein (source: Beijing Sino Biological Technology Co., Ltd.) was added at 100 μL / well and incubated for 1 hour. The plates were washed to remove unbound proteins, and 0.5 μg / mL anti-His-MM02T / HRP (source: Beijing Sino Biological Technology Co., Ltd.) was added for incubation. After repeated washing, the substrate colorimetric solution was added for color development, and the OD value was measured after termination. 450 .

[0297] The results are as follows Figure 12 As shown, among the SARS-2-H014 antibodies with different Fc functional forms, the IgG1 and Ae0-IgG1 forms of antibodies bind to CD32a or CD32b proteins, and the binding is in a concentration gradient; the Fd11-IgG4 and Fd19-IgG4 forms of antibodies do not bind to CD32a or CD32b proteins.

[0298] 8.3 CD64 Binding Function of Humanized Antibodies SARS-2-H014 with Different Fc Functional Forms

[0299] Different concentrations (30,000 ng / mL, 10,000 ng / mL, 3,333.3 ng / mL, 1,111.1 ng / mL, 370.4 ng / mL, 123.5 ng / mL, and 41.2 ng / mL) of humanized antibodies with different Fc functional forms, including SARS-2-H014-IgG1, SARS-2-H014-Ae0-IgG1, SARS-2-H014-Fd11-IgG4, and SARS-2-H014-Fd19-IgG4, were coated onto 96-well plates at 100 μL per well and incubated overnight at 4°C. The plates were washed the next day, blocked at room temperature for 1 hour, and then 0.5 μg / mL CD64-his protein (source: Beijing Sino Biological Technology Co., Ltd.) was added at 100 μL / well for 1 hour. Wash the plate to remove unbound proteins, add 0.5 μg / mL anti-His-MM02T / HRP (Source: Beijing Sino Biological Technology Co., Ltd.) and incubate, then wash the plate again, add substrate color development solution for color development, and detect OD after termination. 450 .

[0300] The results are as follows Figure 13As shown, among the SARS-2-H014 antibodies with different Fc functional forms, the IgG1 and Ae0-IgG1 forms of antibodies showed an "S"-shaped curve growth with CD64, and the binding levels of the two were similar; the Fd11-IgG4 form of the antibody had a weaker binding to CD64 under high concentration conditions, while the Fd19-IgG4 form of the antibody had no binding to the CD64 protein.

[0301] 8.4 C1q Binding Function of Humanized Antibodies SARS-2-H014 with Different Fc Functional Forms

[0302] Humanized antibodies with different Fc functional forms (SARS-2-H014-IgG1, SARS-2-H014-Ae0-IgG1, SARS-2-H014-Fd11-IgG4, and SARS-2-H014-Fd19-IgG4) at different concentrations (30,000 ng / mL, 10,000 ng / mL, 3,333.3 ng / mL, 1,111.1 ng / mL, 370.4 ng / mL, 123.5 ng / mL, and 41.2 ng / mL) were coated onto 96-well plates at 100 μL per well and incubated overnight at 4°C. The next day, the plates were washed and blocked at room temperature for 1 hour. Then, 5 μg / mL of C1q complement protein (source: Beijing Sino Biological Technology Co., Ltd.) was added at 100 μg / well and incubated for 1 hour. Wash the plate to remove unbound proteins, add 0.5 μg / mL anti-His-MM02T / HRP (Source: Beijing Sino Biological Technology Co., Ltd.) and incubate, then wash the plate again. Add substrate colorimetric solution for color development, and detect OD after termination. 450 .

[0303] The results are as follows Figure 14 As shown, among the SARS-2-H014 antibodies with different Fc functional forms, the IgG1 and Ae0-IgG1 forms of antibodies showed an "S"-shaped curve growth with the C1q complement protein, and the binding levels of the two were similar; the Fd11-IgG4 and Fd19-IgG4 forms of antibodies did not bind to the C1q complement protein.

[0304] 8.5 FcRn Binding Function of Humanized Antibodies SARS-2-H014 with Different Fc Functional Forms

[0305] 10 μg / mL NeutrAvidin (Source: ThermoFisher) was coated onto a 96-well plate at 100 μL per well at 4°C overnight. The next day, the plate was washed and blocked at room temperature for 1 hour. Then, 5 μg / mL FCGRT&B2M-His-Biotin protein (Source: Beijing Sino Biological Technology Co., Ltd.) was added at 100 μL per well. In a pH 6.0 buffer, different concentrations (10000 ng / mL, 2500 ng / mL, 625 ng / mL, 156.3 ng / mL, 39.1 ng / mL, 9.8 ng / mL, 2.4 ng / mL, and 0.61 ng / mL) of humanized antibodies with different Fc functional forms: SARS-2-H014-IgG1, SARS-2-H014-Ae0-IgG1, SARS-2-H014-Fd11-IgG4, and SARS-2-H014-Fd19-IgG4 were added, mixed, and incubated for 1 hour. The plate was washed to remove unbound proteins and antibodies, and 0.25 μg / mL goat anti-human IgG F(ab)2 / HRP (pH 6.0) (Source: Jackson ImmunoResearch) was added for incubation. After repeated washing, the substrate colorimetric solution was added for color development, and the OD value was measured after termination. 450 .

[0306] like Figure 15 As shown, among the SARS-2-H014 antibodies with different Fc functional forms, the IgG1 form of the antibody has the strongest binding to the FCGRT&B2M-His-Biotin protein, the Ae0-IgG1 and Fd11-IgG4 forms of the antibody have similar binding levels to the FCGRT&B2M-His-Biotin protein, and the Fd19-IgG4 form of the antibody has no binding to the FCGRT&B2M-His-Biotin protein.

[0307] 8.6 ADCC function mediated by humanized antibodies SARS-2-H014 with different Fc functional forms

[0308] HEK293FT cells stably expressing the full-length SARS-CoV-2 or SARS-CoV S protein (HEK293FT-SARS-CoV-2-S or HEK293FT-SARS-CoV-S) were used as target cells, and Jurkat cells stably transfected with CD16AV and NFAT-Luc2P (Jurkat-NFAT / Luc2P-CD16AV) were used as effector cells. The ADCC function of the humanized antibody was detected using a reporter gene assay.

[0309] In a 96-well plate, the seeding density was 2 × 10 6cell / mL of target cells and equal volume and density of effector cells. Then add 50μL of different concentrations (20μg / mL, 1μg / mL and 0.05μg / mL) of humanized antibodies and H7N9-R1 negative control antibodies, mix well and incubate in a 37°C, 5% CO2 incubator for 6 hours. Finally, add 5×passive lysis buffer (source: Promega), 30μL / well, mix well and lyse the cells. Take 10μL / well cell sample to detect the RLU value. Use GraphPadPrism software to analyze and draw the dose-effect curve, with the horizontal axis representing the concentration of the sample and the vertical axis representing the RLU value. Bioluminescence intensity induction factor = RLU value of the sample group / RLU value of the negative control group.

[0310] The results are as follows Figure 16 As shown in Figure 2, among the SARS-2-H014 antibodies with different Fc functional forms, the Ae0-IgG1 form of the antibody can significantly mediate the expression of SARS-CoV-2 ( Figure 16 A) and SARS-CoV S protein target cells ( Figure 16 B) ADCC effect; IgG1 form of the antibody can only mediate a weak ADCC effect; Fd11-IgG4 and Fd19-IgG4 form of the antibody have no ADCC effect.

[0311] 8.7 ADCP function mediated by humanized antibodies SARS-2-H014 with different Fc functional forms

[0312] HEK293FT-SARS-CoV-2-S or HEK293FT-SARS-CoV-S was used as target cells, and Jurkat cells stably transfected with CD32A, CD32B or CD64 and NFAT-Luc2P (Jurkat-NFAT / Luc2P-CD32A, Jurkat-NFAT / Luc2P-CD32B or Jurkat-NFAT / Luc2P-CD64) were used as effector cells. The ADCP function mediated by humanized antibodies was detected by reporter gene assay.

[0313] In a 96-well plate, the seeding density was 2 × 10 6cell / mL of target cells and effector cells of equal volume and density. Then add 50μL / well of humanized antibodies of different concentrations (20μg / mL, 1μg / mL and 0.05μg / mL), and set up H7N9-R1 negative antibody control and cell-free control. After mixing, incubate in a 37°C, 5% CO2 incubator for 6 hours. Finally, add 5×passive lysis buffer (source: Promega), 30μL / well, mix and lyse the cells. Take 10μL / well cell sample to detect RLU value. Use GraphPad Prism software to analyze and draw the dose-effect curve, with the horizontal axis representing the concentration of the sample and the vertical axis representing the RLU value. Bioluminescence intensity induction factor = RLU value of sample group / RLU value of negative control group.

[0314] The results are as follows Figure 17 As shown, the expression of SARS-CoV-2 Spike protein target cells ( Figure 17 In the ADCP mediated by A), when Jurkat-NFAT / Luc2P-CD32A and Jurkat-NFAT / Luc2P-CD32B were used as effector cells, SARS-2-H014 antibodies in the form of IgG1, Ae0-IgG1 and Fd11-IgG4 induced weak ADCP, while the antibody in the form of Fd19-IgG4 had no ADCP effect. When Jurkat-NFAT / Luc2P-CD64 was used as effector cells, SARS-2-H014 antibodies in different Fc functional forms had no ADCP effect. Figure 17 In the ADCP-mediated effect (B), SARS-2-H014 antibodies with different Fc functional formats had no ADCP effect when Jurkat-NFAT / Luc2P-CD32A and Jurkat-NFAT / Luc2P-CD32B were used as effector cells. When Jurkat-NFAT / Luc2P-CD64 was used as effector cells, IgG1 and Ae0-IgG1 formats of SARS-2-H014 antibodies mediated weak ADCP, while Fd11-IgG4 and Fd19-IgG4 formats had no ADCP effect.

[0315] 8.8 CDC Function Mediated by Humanized Antibodies SARS-2-H014 with Different Fc Functional Forms

[0316] HEK293FT-SARS-CoV-2-S or HEK293FT-SARS-CoV-S was used as the target cell, and the CDC function of the humanized antibody was detected by the WST-8 assay.

[0317] In a 96-well plate, the seeding density was 2 × 106 cell / mL of target cells. Add 50μL of rabbit complement (source: One lambda) and different concentrations (100μg / mL, 20μg / mL, 4μg / mL, 0.8μg / mL, 1.16μg / mL, 0.032μg / mL, 0.0064μg / mL and 0.00128μg / mL) of humanized antibodies and set up detection blank wells (no cells), positive control group (only inoculated cells) control and H7N9-R1 negative control antibody group. After mixing, incubate in a 37℃, 5% CO2 incubator for 2h. After the incubation is completed, add WST-8 colorimetric solution, 10μL / well. Place the 96-well plate in a CO2 incubator for incubation. After the color development is stable, measure the absorbance at 450nm and 630nm on a microplate reader. The absorbance value (OD 450 –OD 630 ) and subtract the reading of the blank well to calculate the CDC killing effect of the antibody. Killing rate % = (positive control OD value - sample OD value) / positive control OD value × 100%.

[0318] The results are as follows Figure 18 As shown, different Fc functional forms of SARS-2-H014 antibodies express SARS-CoV-2 S protein ( Figure 18 A) or SARS-CoV S protein ( Figure 18 B) The target cells had no CDC effect.

[0319] Example 9: Pharmacokinetic evaluation of humanized antibodies SARS-2-H014 with different Fc functional forms in mice 9.1 Pharmacokinetic study of IgG1 humanized antibody SARS-2-H014 administered to mice

[0320] C57BL / 6 mice (4 mice, half male and half female, source: Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.) were administered SARS-2-H014 via a single tail vein injection at a dose of 5 mg / kg in a 10 mL / kg volume. Blood was collected from all mice at orbital examination before administration and at 5 minutes, 30 minutes, 1 hour, 3 hours, 6 hours, 10 hours, 24 hours, 32 hours, 48 ​​hours, 72 hours, 96 hours, 120 hours, 168 hours, 240 hours, 336 hours, 504 hours, and 672 hours after administration, and serum was collected by centrifugation. Plasma drug concentrations were determined by ELISA, and pharmacokinetic parameters were calculated using the non-compartmental model (NCA) in Phoenix-WinNonlin 6.4 software.

[0321] All mice were in normal condition during the experiment, and the drug-time curves were as follows: Figure 19As shown in Table 15, the drug concentration in mice changes over time, with a rapid decrease in the early stage, but then the blood concentration remains basically stable for a long time, with only a very small decrease. The metabolism is very slow, and there is no obvious gender difference. The pharmacokinetic parameters are shown in Table 15. After a single intravenous injection of SARS-2-H014 into mice, the average exposure C max and AUC last The average half-life was 136.15 μg / mL and 10930.35 h×μg / mL, respectively. 1 / 2 The clearance time was 281.20 h, and the clearance rate Cl was 0.27 mL / h / kg.

[0322] Table 15 Pharmacokinetic parameters of SARS-2-H014 after single intravenous injection in mice (0-336h)

[0323]

[0324] 9.2 Pharmacokinetic Study of SARS-2-H014-Fd11-IgG4 in Mice

[0325] Six C57BL / 6 mice (half male and half female, source: Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd.) were administered a single tail vein injection of SARS-2-H014-Fd11-IgG4 antibody at a dose of 5 mg / kg in a 10 mL / kg volume. Orbital blood was collected from all mice before and 5 minutes, 30 minutes, 1 hour, 3 hours, 6 hours, 10 hours, 24 hours, 32 hours, 48 ​​hours, 72 hours, 96 hours, 120 hours, 168 hours, 240 hours, 336 hours, 504 hours, and 672 hours after administration, and serum was collected by centrifugation. Plasma drug concentrations were determined by ELISA, and pharmacokinetic parameters were calculated using the non-compartmental model (NCA) in Phoenix-WinNonlin 6.4 software.

[0326] All mice were in normal condition during the experiment, and the drug-time curves were as follows: Figure 20 The drug concentration in mice changes over time, with a rapid decrease in the early stage, but then the blood concentration remains basically stable for a long time, with only a very small decrease. Metabolism is very slow, and there is no obvious gender difference. However, the blood concentration of mice No. 978 and No. 979 decreased significantly from 168 to 336 hours. The pharmacokinetic parameters are shown in Table 16. After a single intravenous injection of SARS-2-H014-Fd11-IgG4 into mice, the average exposure in the body, C max and AUC last The average half-life was 144.66 μg / mL and 11940.01 h×μg / mL, respectively. 1 / 2 The clearance time was 290.08h, and the clearance rate Cl was 0.26mL / h / kg.

[0327] Table 16 Pharmacokinetic parameters of SARS-2-H014-Fd11-IgG4 after single intravenous injection in mice (0-336h)

[0328]

[0329]

[0330] 9.3 Pharmacokinetic Study of SARS-2-H014-Fd19-IgG4 in Mice

[0331] Four C57BL / 6 mice (half male and half female, source: Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd.) were administered SARS-2-H014-Fd19-IgG4 via a single tail vein injection at a dose of 5 mg / kg in a 10 mL / kg volume. Blood was collected from all mice before and at 5 minutes, 30 minutes, 1 hour, 3 hours, 6 hours, 10 hours, 24 hours, 32 hours, 48 ​​hours, and 72 hours after administration, and serum was collected by centrifugation. Plasma drug concentrations were determined by ELISA, and pharmacokinetic parameters were calculated using the non-compartmental model (NCA) in Phoenix-WinNonlin 6.4 software.

[0332] The clinical observation of mice was normal during the whole experiment, and the serum drug concentration-time curve was as follows: Figure 21 As shown in Table 17, the drug is rapidly metabolized in mice, and the drug concentration decreases rapidly over time, with no significant gender difference. The pharmacokinetic parameters are shown in Table 17. After a single intravenous injection of SARS-2-H014-Fd19-IgG4 into mice, the average exposure in the body C max and AUC last The average half-life was 125.11 μg / mL and 1202.18 h×μg / mL, respectively. 1 / 2 The clearance time was only 11.72h, and the clearance rate Cl was 4.13mL / h / kg. Its metabolic characteristics were related to the modification of the FcRn binding site in the molecular structure.

[0333] Table 17 Pharmacokinetic parameters of SARS-2-H014-Fd19-IgG4 after single intravenous injection in mice (0-72h)

[0334]

[0335] References

[0336] 2.Zhao,S.,et al.,Preliminary estimation of the basic reproductionnumber of novel coronavirus(2019-nCoV)in China,from 2019to 2020:A data-drivenanalysis in the early phase of the outbreak.International Journal ofInfectious Diseases,2020.

[0337] 3.Chen,N.,et al.,Epidemiological and clinical characteristics of99cases of 2019novel coronavirus pneumonia in Wuhan,China:a descriptivestudy.The Lancet,2020.

[0338] 4.Jiang,S.,et al.,A novel coronavirus(2019-nCoV)causing pneumonia-associated respiratory syndrome.Cellular&Molecular Immunology,2020:p.1-1.

[0339] 5.Zhou,P.,et al.,Discovery of a novel coronavirus associated with therecent pneumonia outbreak in humans and its potential bat origin.BioRxiv,2020.

[0340] 6.Wan,Y.,et al.,Receptor recognition by novel coronavirus from Wuhan:An analysis based on decade-long structural studies of SARS.Journal ofvirology,2020.

[0341] 7.Westermark,G.T.,E.Ihse,and P.Westermark,Development of mousemonoclonal antibodies against human amyloid fibril proteins for diagnosticand research purposes,in Amyloid Proteins.2018,Springer.p.401-414.

[0342] 8.Jones,S.T.and M.M.Bendig,Rapid PCR-cloning of full-length mouseimmunoglobulin variable regions.Biotechnology(N Y),1991.9(6):p.579.

[0343] 9.Kabat,E.A.,et al.,Sequences of proteins of immunologicalinterest.1992:DIANE publishing.

[0344] 10.Jones,P.T.,et al.,Replacing the complementarity-determiningregions in a human antibody with those from a mouse.Nature,1986.321(6069):p.522.

[0345] 11.Verhoeyen,M.and L.Riechmann,Engineering of antibodies.BioEssays,1988.8(2-3):p.74-78.

[0346] 12.Yan,R.,et al.,Structural basis for the recognition of the SARS-CoV-2 by full-length human ACE2.Science,2020.

[0347] 13. Xie, L., et al., SARS-CoV-2 and SARS-CoV Spike-RBD Structure and Receptor Binding Comparison and Potential Implications on Neutralizing Antibody and Vaccine Development. bioRxiv, 2020.

[0348] 14. Ye, X., et al., Cd47 antibody, antigen-binding fragment and medical use thereof. 2018, Google Patents.

[0349] 15. Olafsen, T., Fc engineering: serum half-life modulation through FcRn binding, in Antibody Engineering. 2012, Springer. p. 537-556.

[0350] 16. Kelley, R., J. Scheer, and W. Shatz, Systems and methods for predicting vitreal half-life of therapeutic agent-polymer conjugates. 2018, Google Patents.

[0351] Nucleotide and Amino Acid Sequence List

[0352]

[0353] [[ID=二十]]

[0354]

[0355]

[0356]

[0357]

[0358]

[0359]

[0360]

[0361]

[0362]

[0363]

[0364]

[0365]

[0366]

[0367]

[0368]

[0369]

[0370]

[0371]

[0372]

[0373]

[0374]

[0375]

[0376]

[0377]

[0378]

[0379]

[0380]

[0381]

[0382]

Claims

1. An isolated antibody or antigen-binding fragment thereof that blocks the binding of SARS-CoV-2 spike protein and / or SARS-CoV spike protein to the ACE2 receptor, comprising any one of a) to d), wherein a) i) a heavy chain variable region, the heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3 domains of which are SEQ ID NOs: 13, 14, and 15, respectively, and ii) a light chain variable region, wherein the light chain CDR1, light chain CDR2 and light chain CDR3 domains are SEQ ID NOs: 10, 11 and 12, respectively; b) i) a heavy chain variable region, whose heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 domains are SEQ ID NOs: 13, 14 and 15, respectively, and ii) a light chain variable region, wherein the light chain CDR1, light chain CDR2, and light chain CDR3 domains are SEQ ID NOs: 45, 11, and 46, respectively; c) i) a heavy chain variable region, whose heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 domains are SEQ ID NOs: 67, 68 and 69, respectively, and ii) a light chain variable region, wherein the light chain CDR1, light chain CDR2, and light chain CDR3 domains are SEQ ID NOs: 10, 11, and 12, respectively; d) i) a heavy chain variable region, whose heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 domains are SEQ ID NOs: 67, 68 and 69, respectively, and ii) a light chain variable region, wherein the light chain CDR1, light chain CDR2 and light chain CDR3 domains are SEQ ID NOs: 45, 11 and 12, respectively.

2. The antibody or antigen-binding fragment thereof according to claim 1, comprising any one of a) to d), wherein: a) i) a heavy chain variable region having the sequence of SEQ ID NO: 22 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto; and / or ii) a light chain variable region having a sequence of SEQ ID NO: 23 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto; b) i) a heavy chain variable region having the sequence of SEQ ID NO: 51 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto; and / or ii) a light chain variable region having a sequence of SEQ ID NO: 52 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto; c) i) a heavy chain variable region having the sequence of SEQ ID NO: 74 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto; and / or ii) a light chain variable region having a sequence of SEQ ID NO: 75 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto; d) i) a heavy chain variable region having the sequence of SEQ ID NO: 94 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto; and / or ii) a light chain variable region having the sequence of SEQ ID NO: 95 or at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto.

3. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 2, which is a humanized antibody or a chimeric antibody.

4. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 2, wherein the antibody constant region is of IgG, IgM, or IgA subtype. The antibody or antigen-binding fragment thereof according to claim 4 , which is an IgG1, IgG2 or IgG4 subtype antibody.

6. The antibody or antigen-binding fragment thereof according to claim 4, which is an IgG1, IgG2 or IgG4 subtype antibody having altered binding function to Fc receptors, C1q complement and FcRn receptors due to changes in the amino acid sequence and / or glycosylation pattern of its Fc region.

7. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 2, wherein the antibody further comprises: a) a heavy chain constant region having the sequence of SEQ ID NO: 24 or at least 90%, 92%, 95%, 98% or 99% sequence identity thereto; and / or b) a light chain constant region having the sequence of SEQ ID NO: 25 or at least 90%, 92%, 95%, 98% or 99% sequence identity thereto.

8. The antibody or antigen-binding fragment thereof according to claim 7, a) Its binding affinity to SARS-CoV-2 S1 is between 0.9E-11M and 8.7E-10M on average; and / or b) The average KD of its binding affinity to SARS-CoV S1 is 0.4E-11M to 6.0E-10M.

9. The antibody or antigen-binding fragment thereof according to claim 7, a) Its binding affinity to SARS-CoV-2 S1 is, on average, between 2.0E-11M and 3E-10M; and / or b) The average KD of its binding affinity to SARS-CoV S1 is 1.0E-11M to 8E-10M.

10. The antibody or antigen-binding fragment thereof according to claim 7, a) Its binding affinity to SARS-CoV-2 S1 has an average KD of 2.6E-10M, 2.9E-10M, 2.1E-10M, or 2.7E-11M; and / or b) The average KD binding affinity of the binding site to SARS-CoV S1 is 1.2E-11M, 1.1E-10M, 2.0E-10M or 7.5E-11M.

11. The antibody or antigen-binding fragment thereof according to claim 2 a) or claim 7, wherein Fut8 Mammalian cell expression of gene knockout.

12. The antibody or antigen-binding fragment thereof according to claim 11, wherein the mammalian cell is Fut8 Knockout CHO and HEK-293 cells.

13. The antibody or antigen-binding fragment thereof according to claim 2 a), wherein the antibody further comprises: i) a heavy chain constant region having the sequence of SEQ ID NO: 106 or at least 90%, 92%, 95%, 98% or 99% sequence identity thereto; and / or ii) a light chain constant region having the sequence of SEQ ID NO: 25 or at least 90%, 92%, 95%, 98% or 99% sequence identity thereto.

14. The antibody or antigen-binding fragment thereof according to claim 2 a), wherein the antibody further comprises: i) a heavy chain constant region having the sequence of SEQ ID NO: 108 or at least 90%, 92%, 95%, 98% or 99% sequence identity thereto; and / or ii) a light chain constant region having the sequence of SEQ ID NO: 25 or at least 90%, 92%, 95%, 98% or 99% sequence identity thereto.

15. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 2, which is a monoclonal antibody. The antibody or antigen-binding fragment thereof according to claim 5 , which is a monoclonal antibody. The antibody or antigen-binding fragment thereof according to claim 6 , which is a monoclonal antibody. The antibody or antigen-binding fragment thereof according to claim 7 , which is a monoclonal antibody. The antibody or antigen-binding fragment thereof according to claim 13 , which is a monoclonal antibody.

20. The antibody or antigen-binding fragment thereof according to claim 14, which is a monoclonal antibody.

21. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 2, wherein the antigen-binding fragment is Fv, Fab, Fab', Fab'-SH, F(ab')2 or a single-chain antibody molecule.

22. The antibody or antigen-binding fragment thereof according to claim 21, wherein the single-chain antibody molecule is scFv, di-scFv, tri-scFv or scFab.

23. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 2, wherein the epitope is a structural region comprising S375, K378, D405 and R408 in the spike protein of SARS-CoV-2 and SARS-CoV viruses.

24. The antibody or antigen-binding fragment thereof according to claim 7, wherein the epitope is a structural region comprising S375, K378, D405 and R408 in the spike protein of SARS-CoV-2 and SARS-CoV viruses.

25. An antibody-drug conjugate comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 24 and an additional therapeutic agent.

26. The antibody-drug conjugate of claim 25, wherein the antibody or antigen-binding fragment thereof and the additional therapeutic agent are connected via a linker.

27. A nucleic acid encoding the antibody or antigen-binding fragment thereof according to any one of claims 1 to 24, which is mRNA and / or DNA.

28. The nucleic acid of claim 27, comprising a) the heavy chain variable region nucleotide sequences shown in SEQ ID NOs: 30, 55, 78 and 98, and the light chain variable region nucleotide sequences shown in SEQ ID NOs: 31, 56, 79 and 99, respectively; and b) the heavy chain constant region nucleotide sequences shown in SEQ ID NOs: 6, 105 and 107, respectively, and the light chain constant region nucleotide sequence shown in SEQ ID NO:

7.

29. An expression vector comprising the nucleic acid of claim 27 or 28.

30. A host cell comprising the nucleic acid of claim 27 or 28 or the expression vector of claim 29.

31. A method for producing the antibody or antigen-binding fragment thereof according to any one of claims 1 to 24, comprising culturing the host cell according to claim 30 under conditions suitable for antibody expression, and recovering the expressed antibody from the culture medium.

32. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 24, the antibody-drug conjugate according to any one of claims 25 to 26, the nucleic acid according to any one of claims 27 to 28, or the expression vector according to claim 29; a pharmaceutically acceptable carrier; One or more additional therapeutic agents.

33. The pharmaceutical composition according to claim 32, wherein the other therapeutic agent is selected from antiviral drugs or inflammatory factor inhibitors.

34. The pharmaceutical composition according to claim 32, wherein the other therapeutic agent is selected from small molecule chemical drugs with other mechanisms.

35. The pharmaceutical composition according to claim 33, wherein the antiviral drug is selected from type I interferon drugs, antibodies, protease inhibitors, RNA-dependent RNA polymerase (RdRP) inhibitors, and host-targeted antiviral drugs.

36. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 24, the antibody-drug conjugate according to any one of claims 25 to 26, the nucleic acid according to any one of claims 27 to 28, the expression vector according to claim 29, or the pharmaceutical composition according to any one of claims 32 to 35 in the preparation of a medicament for preventing and treating diseases caused by SARS-CoV-2 and / or SARS-CoV infection.

37. A pharmaceutical combination product comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 24, the antibody-drug conjugate according to any one of claims 25 to 26, the nucleic acid according to any one of claims 27 to 28, the expression vector according to claim 29, and the pharmaceutical composition according to any one of claims 32 to 35; and One or more additional therapeutic agents.

38. A kit comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 24, the antibody-drug conjugate according to any one of claims 25 to 26, the nucleic acid according to any one of claims 27 to 28, the expression vector according to claim 29, and the pharmaceutical composition according to any one of claims 32 to 35.

39. The kit according to claim 38, further comprising a device for administration.

Images