A primer probe set, a kit and an application for quantitatively detecting murine infectious agents

Abstract

The application provides a primer probe set, a kit and application for quantitatively detecting murine infectious agents, and belongs to the technical field of genetic engineering.The six-reagent quantitative detection kit (fluorescent PCR method) for tsutsugamushi oriental body, fever with thrombocytopenia syndrome virus, prrillonella, hantavirus, leptospira, and rickettsia mooseri can detect the six pathogenic targets of tsutsugamushi oriental body, fever with thrombocytopenia syndrome virus, prrillonella, hantavirus, leptospira, and rickettsia mooseri in one reaction, and accurately quantitatively analyzes each pathogenic target.Through single-tube reaction, parallel detection and quantification of the six pathogenic targets are realized, the time consumed due to misjudgment of the targets is reduced, the consumption of consumables and the occupation of instrument space caused by multi-tube reaction are reduced.The quantitative results reflect the pathogenic load, and provide efficient detection and application support for rapid identification and quantitative monitoring of samples of murine origin or samples of the environment related to mouse activities.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a six-fold nucleic acid quantitative detection kit for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum, primer and probe compositions, and single-tube non-diagnostic detection applications. Background Technology

[0002] Orientia scrub typhus virus, fever with thrombocytopenia syndrome virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum are all common pathogens carried by rodents and can be transmitted to humans and other animals through rodents, causing corresponding infectious diseases and posing a serious threat to public health and safety. Among them, some pathogens can contaminate the environment, water sources, and food, further expanding the scope of transmission.

[0003] Orientia tsutsugamushi is the causative agent of scrub typhus, primarily parasitizing rodents such as rats and transmitted to humans through the bite of the mite. Clinical manifestations after infection are mainly characterized by fever, eschar or ulceration, swollen lymph nodes, and rash. Severe cases can lead to multiple organ failure and even death, especially in areas with high rodent activity such as the wild, farmland, and residential areas, where the risk of transmission is extremely high.

[0004] Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV) is a novel Bunyavirus. Rodents are its primary reservoir host, and it can be transmitted through tick bites, contact with the blood and secretions of infected animals. Typical symptoms after infection include fever, thrombocytopenia, and leukopenia. In some patients, the disease progresses rapidly, potentially leading to shock, multiple organ dysfunction, and a high mortality rate, posing a significant threat to human health.

[0005] Rickettsia prowazekii is the pathogen of epidemic typhus, primarily residing in rodents and transmitted through the bite of body lice. Infection has a rapid onset, manifesting as high fever, severe headache, and rash, which typically spreads from the trunk to the entire body. In severe cases, it can affect the central nervous system and cardiovascular system, leading to complications and even death. Outbreaks are prone to occur in areas with high rodent populations.

[0006] Hantavirus is the pathogen of hemorrhagic fever with renal syndrome. Rodents are the main source of infection. The virus can contaminate the environment, water sources, and food through rodent excrement (urine, feces, saliva). Humans become infected through contact with contaminated items or by inhaling virus-containing aerosols. The core symptoms after infection are fever, bleeding, and kidney damage. The disease progresses rapidly, and severe cases can lead to acute renal failure and shock. Without timely treatment, it can be fatal. It is one of the key rodent-borne infectious diseases that my country is focusing on controlling.

[0007] Leptospira is the pathogen of leptospirosis. Rodents are important reservoir hosts, and the pathogen can be excreted in rodent urine, contaminating water sources, soil, and crops. Humans become infected through contact with contaminated water or soil, or through contact with the tissues or secretions of infected animals. Clinical manifestations after infection are diverse. Mild cases may only present with fever, fatigue, and muscle aches, while severe cases can lead to serious complications such as jaundice, pulmonary hemorrhage, and kidney failure, even endangering life. The risk of transmission is significantly increased, especially during the rainy season and after floods.

[0008] Rickettsia mooseri is the pathogen of endemic typhus, primarily residing in rodents such as house mice and field mice, and transmitted to humans through the bite of fleas. Symptoms after infection are similar to those of epidemic typhus, but the illness is relatively milder, mainly manifesting as fever, headache, and rash. The rash is mostly maculopapular and sparsely distributed. With timely treatment, the prognosis is good; however, severe cases may still result in organ damage and affect overall health.

[0009] The aforementioned six rodent-borne pathogens can contaminate the environment, water sources, and food through rodent excrement and secretions during transmission, creating widespread transmission risks and easily leading to human infection and outbreaks. Therefore, establishing quantitative, highly sensitive, specific, short-time, low-cost, simple-to-operate, and equipment-required detection technologies for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum is of great significance for the rapid identification of rodent-borne infectious diseases and the control of epidemic transmission, and has important value for public health security and prevention.

[0010] Because the six-fold quantitative detection kit adds two fluorescence channels, QUASAR 705 and ATTO425, in addition to the commonly used FAM, HEX, CY5, and ROX channels, there is a significant broad-spectrum cross-interference between these channels. Furthermore, occasional and unpredictable competitive inhibition often occurs between two or more of the six primer pairs. Therefore, combining and harmoniously integrating the six primer pairs into a single reaction system requires not only completely overcoming the significant broad-spectrum cross-interference between the six fluorescence channels, but also fully balancing the different requirements of the six primer pairs in the amplification process. It also necessitates optimizing the reaction system structure and primer-probe composition to avoid cross-reactions between the six primer pairs and to resolve competitive inhibition between two or more primer pairs, ensuring that each channel maintains its unique high specificity and sensitivity.

[0011] Because of these difficulties, most commercially available multiplex nucleic acid detection kits are quantitative detection kits with four or fewer components. However, the primer and probe sets of this invention are cleverly combined, and the components of the reaction system are perfectly matched, thus achieving a balanced six-fold reaction system and enabling the kit to detect six pathogen targets with high specificity and sensitivity. Summary of the Invention

[0012] The purpose of this invention is to provide a primer and probe kit, reagent kit, and applications for the quantitative detection of rodent infectious pathogens. This includes a six-fold quantitative detection kit for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV), Rickettsia prowley, Hantavirus, Leptospira, and Rickettsia molluscum, along with primer and probe compositions and single-tube quantitative non-diagnostic applications. This kit enables the quantitative detection of six pathogen targets: Orientia tsutsugamushi, SFTSV, Rickettsia prowley, Hantavirus, Leptospira, and Rickettsia molluscum, and provides accurate quantitative analysis of each pathogen target. The single-tube reaction enables parallel detection and quantification of the six pathogen targets, reducing the time wasted due to incorrect reagent selection caused by target misidentification, and reducing the consumption of consumables and instrument space required by multiple-tube reactions. The quantitative results reflect the pathogen load, providing efficient detection support for the rapid identification and quantitative monitoring of rodent samples or environmental samples related to rodent activity.

[0013] The technical solution of this invention is implemented as follows: This invention provides a primer and probe composition for the quantitative detection of rodent infectious pathogens, comprising primer and probe compositions for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum. The primers for *Oriental Scrub Typhus* were sequence OT-1: (AF173040.1:30-48, which is the sequence number and location of the primer in NCBI, the same below) aatgtctgcattgtcattg; OT-2: (AF173040.1:178-162) cagcatcagctggatcc; the probe was sequence OT-3: (AF173040.1:125-143) ttggaggaatKRttactgg; The primers for the fever with thrombocytopenia syndrome virus are the sequence SFTSV-1: (PQ808895.1:4576-4593) tttggcctgaaaaggact; SFTSV-2: (PQ808895.1:4699-4681)taagaaaaggaccatccct; and the probe is the sequence SFTSV-3: (PQ808895.1:4642-4667) tcttttgcatggctgagcacagaccc; The primers for the Protozoan rickettsia are sequence Rp-1: (CP003396.1:882538-882560)gtatcatttaagtttactgtagt; Rp-2: (CP003396.1:882260-882203)gatccttctgatgttgca; the probe is sequence Rp-3: (CP003396.1:882564-882591) ctgtgactcttcttcctgctgcag; The primers for the Hantavirus are the sequence HTNV-1: (NC_005218.1:935-954)agtcaccatcatcaatatgg; HTNV-2: (NC_005218.1:1014-994)agcaatacctgctataaacaa; and the probe is the sequence HTNV-3: (NC_005218.1:963-985) tggagcaccagaccgttgtccac; The primers for the leptospira are the sequence LEP-1: (PV534492.1:29-46)aggccaagagtcaatcta; LEP-2: (PV534492.1:135-114) taaccattgaataatcgtctga; and the probe is the sequence LEP-3: (PV534492.1:74-100) tgatgccgatcatttttgcttcgtctt. The primers for the Mohr's rickettsia are sequence RT-1: (L04661.1:239-255)aatgggtgctgttatgc; RT-2: (L04661.1:316-298) gtttgatcaaatcctgcac; and the probe is sequence RT-3: (L04661.1:266-290) aacaacaaatgcagcagctacaact.

[0014] As a further improvement of the present invention, the kit includes a six-pair composition of specific primers and probes as described above.

[0015] As a further improvement of the present invention, the six-fold quantitative detection kit for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV-3), Rickettsia proterenella, Hantavirus, Leptospira, and Rickettsia moghornis is characterized in that: the 5' end of the Orientia tsutsugamushi probe sequence OT-3 is modified with FAM, and the 3' end is modified with BHQ1; the 5' end of the SSFTSV-3 probe sequence is modified with HEX, and the 3' end is modified with BHQ1; the 5' end of the Rp-3 probe sequence is modified with CY5, and the 3' end is modified with BHQ2; the 5' end of the HTNV-3 probe sequence is modified with ROX, and the 3' end is modified with BHQ2; the 5' end of the LEP-3 probe sequence is modified with QUASAR 705, and the 3' end is modified with BHQ3; and the 5' end of the RT-3 probe sequence is modified with ATTO. The 425 modifier is used, and the 3' end is modified with BHQ1.

[0016] As a further improvement of the present invention, the molar ratio of the forward primer, the reverse primer, and the specific fluorescent probe is: Orientia scrub typhus: (2-5): (1-2): 5; Fever with thrombocytopenia syndrome virus: (1-3): (1-3): 2; Rickettsia prowazekii: (3-5): (3-5): 3; Hantavirus: (1-2): (1-2): 3; Leptospira: (1-3): (1-3): 2; Mohr's rickettsia: (3-5): (3-5): 5.

[0017] As a further improvement of the present invention, the molar ratio of the forward primer, the reverse primer, and the specific fluorescent probe is: Orientia scrub typhus: 2.5:1.5:5; Fever with thrombocytopenia syndrome virus ratio: 2:3:2; Rickettsia prowazekii: 3.5:3.5:3; Hantavirus: 1.8:1.8:3; Hooked spirochete: 2:2.5:2; Mohr's rickettsia: 4:4:5.

[0018] As a further improvement of the present invention, its components include: (1) RT-PCR reaction solution: including a. PCR reaction solution: fluorescent PCR buffer, dNTPs, and DEPC water used in RT-PCR; b. Primer-probe mixture: including primers OT-1, OT-2; SFTSV-1, SFTSV-2; Rp-1, Rp-2; HTNV-1, HTNV-2; LEP-1, LEP-2; RT-1, RT-2 and probes OT-3, SFTSV-3, Rp-3, HTNV-3, LEP-3, RT-3; c. Mixed enzyme solution: including RNase inhibitor, reverse transcriptase, and DNA polymerase; The above three components are premixed into one tube and can be used directly without preparation.

[0019] (2) Positive controls: These include Orientia tsutsugamushi, SFTSV-1, SFTSV-2, Rp-1, Rp-2, HTNV-1, HTNV-2, LEP-1, LEP-2, and RT-1, RT-2 containing primers OT-1, OT-2; SFTSV-1, SFTSV-2; Rp-1, Rp-2; HTNV-1, HTNV-2; LEP-1, LEP-2; and RT-1, RT-2 amplifying the target fragments of these viruses; (3) Negative control: TE solution.

[0020] (4) Gradient standards: 10-fold gradient dilutions of plasmids / RNA transcripts containing target gene fragments of 6 pathogens, at concentrations of: 1.5×10 7 copies / μL, 1.5×10 6 copies / μL, 1.5×10 5 copies / μL, 1.5×10 4 copies / μL, 1.5×10 3 Copies / μL are used to establish a standard curve for absolute quantification.

[0021] This invention further protects the application of a reagent kit for quantitative detection of rodent infectious pathogens, the detection method comprising the following steps: S1. Extract total nucleic acid from the sample to be tested; S2. Using the total nucleic acid as a template and the primer and probe set described in claim 1, a recombinase polymerase amplification reaction is performed; S3. Collect fluorescence signals from the detection channels of FAM, HEX, CY5, ROX, QUASAR 705, and ATTO 425, establish standard curves, and obtain quantitative results: S301. Quality Control Standards: Positive controls show an increase in fluorescence index for FAM, HEX, CY5, ROX, QUASAR 705, and ATTO 425, with Ct values ​​≤32; negative controls and blank controls show no increase in fluorescence index, with Ct values ​​≥39.6; gradient standard amplification curves are good, with standard curve R² ≥0.99 and amplification efficiency of 90%–110%. S302 Standard Curve Establishment: log of gradient standards 10 The X-axis represents the copy number concentration, and the Y-axis represents the Ct value. The instrument automatically fits the standard curves for each of the six pathogens. Y = -kX + b; The following conditions must be met for a sample to be suitable for quantification: R² ≥ 0.99 and amplification efficiency of 90%–110%.

[0022] S303. Positive Sample: When S301 is met, FAM and / or HEX and / or CY5 and / or ROX and / or QUASAR 705 and / or ATTO 425 show an increase in fluorescence index, and the Ct value is ≤37. Substitute the sample Ct value into the corresponding standard curve to automatically calculate the initial copy number concentration (copies / μL). S304. Negative Samples: When S301 is established, the lack of fluorescence index growth in FAM and / or HEX and / or CY5 and / or ROX and / or QUASAR 705 and / or ATTO 425, and a Ct value ≥39.6, indicates that the sample does not contain Orientia scrub typhus virus or / and fever with thrombocytopenia syndrome virus or / and Rickettsia proteus virus or / and Hantavirus or / and Leptospira or / and Rickettsia molluscum. S305. Suspected Sample: When S301 is established, FAM and / or HEX and / or CY5 and / or ROX and / or QUASAR 705 and / or ATTO 425 show an increase in fluorescence index, and 37≤Ct value≤39.6. Repeat the test once. If the retest result is still 37≤Ct value≤39.6 and there is a significant increase in the index, it is judged as positive; otherwise, it is negative.

[0023] As a further improvement of the present invention, the PCR reaction solution is a fully aliquoted liquid reagent, which has been aliquoted into eight-tube, 96-well plate, and cryopreservation tube, and does not require preparation.

[0024] As a further improvement to the present invention, the reaction conditions are shown in Table 1 below: Table 1 Reaction conditions

[0025] The present invention has the following beneficial effects: The six-fold quantitative detection kit (fluorescent PCR method) for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowley, Hantavirus, Leptospira, and Rickettsia molluscum can simultaneously detect six pathogen targets: Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowley, Hantavirus, Leptospira, and Rickettsia molluscum, and perform accurate quantitative analysis of each pathogen target. Parallel detection and quantification of the six pathogen targets are achieved through a single-tube reaction, reducing the time spent on selecting the wrong detection reagent due to target misidentification, and reducing the consumption of consumables and instrument space occupied by multiple-tube reactions. The quantitative results reflect the pathogen load, providing efficient detection application support for the rapid identification and quantitative monitoring of rodent samples or rodent-related environmental samples. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 This is a positive control diagram of the present invention; Figure 2 Amplification curve of BNCC scrub typhus oriental body control sample; Figure 3 Amplification curve of Bondesheng Biotechnology's scrub typhus oriental body constitution control sample; Figure 4 Amplification curve of the virus quality control sample for fever with thrombocytopenia syndrome (FNCC); Figure 5 Amplification curve of the quality control product for fever with thrombocytopenia syndrome virus from Bondsheng Biotechnology; Figure 6 Amplification curve of BNCC Proteus rickettsia quality control sample; Figure 7 Amplification curve of Bondesheng Biotechnology's Rickettsia proteomycin quality control sample; Figure 8 Amplification curve of BNCC Hantavirus quality control sample; Figure 9 Amplification curve of Hantavirus quality control sample from Bondsheng Biotechnology; Figure 10Amplification curve of BNCC Leptospira quality control sample; Figure 11 Amplification curve of Leptospira quality control sample from Bondsheng Biotechnology; Figure 12 Amplification curve of BNCC Mohr's rickettsia quality control sample; Figure 13 Amplification curve of the quality control sample of Rickettsia molluscum from Bondesheng Biotechnology; Figure 14 This is a negative control diagram of the present invention; Figure 15 Amplification curve of scrub typhus sample from Orientia tsutsugamushi; Figure 16 Amplification curve of viral samples for fever with thrombocytopenia syndrome; Figure 17 Amplification curve of Proteus rickettsia sample; Figure 18 Amplification curve of Hantavirus sample; Figure 19 Amplification curve of Leptospira sample; Figure 20 Amplification curve of the rickettsia mollusks sample; Figure 21 Overall graph of gradient concentration amplification curves for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia mogheri. Figure 22 Standard curve of Orientia tsutsugamushi; Figure 23 Amplification curve of Orientia tsutsugamushi concentration gradient; Figure 24 Standard curve of viral load for fever with thrombocytopenia syndrome; Figure 25 Amplification curves of viral gradient concentrations in patients with fever and thrombocytopenia syndrome; Figure 26 Prototype Rickettsia standard curve; Figure 27 Amplification curves of Proteus rickettsia gradient concentrations; Figure 28 Hantavirus standard curve; Figure 29 Hantavirus gradient concentration amplification curve; Figure 30 Standard curve of hook-tip spirochete; Figure 31 Leptospira gradient concentration amplification curve; Figure 32 Mohr's Ricketts standard curve; Figure 33Mohr's rickettsia gradient concentration amplification curve. Detailed Implementation

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; the terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to limit the invention; the term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0029] This invention provides a primer and probe composition and kit for the quantitative detection of Orientia scrub typhus virus, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum in samples using real-time fluorescence PCR. Specifically, it relates to the detection applications of Orientia scrub typhus virus, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum. Its basic principle utilizes six sets of specific primers and six specific probes of oligonucleotides, in a sample containing reverse transcriptase, DNA polymerase, RNase inhibitor (RNasin), high-quality deoxyribonucleoside triphosphates (dNTPs), and Mg... 2+ In a PCR reaction solution with equal components, the target polynucleotide is cyclically amplified using a commercially available real-time quantitative PCR instrument, thereby achieving rapid, real-time, and quantitative detection of the target polynucleotide.

[0030] To achieve the present invention, the following technical solution is adopted: Using appropriate nucleic acid analysis software, homology comparisons were performed on the nucleotide sequences of known pathogens including *Oriental scrub typhus*, *Severe fever with thrombocytopenia syndrome virus*, *Rickettsia prowleri*, hantavirus, *Leptospira*, and *Rickettsia molluscum*. Based on the identification of homologous regions, oligonucleotide primers and probes were designed. Because the designed primers and probes are complementary to the sequences of *Oriental scrub typhus*, *Rickettsia prowleri*, hantavirus, *Leptospira*, and *Rickettsia molluscum*, and show no homology with the nucleotide sequences of other pathogens, and do not contain any common endonuclease cleavage sites, false negatives and false positives in the detection of *Oriental scrub typhus*, *Rickettsia prowleri*, hantavirus, *Leptospira*, and *Rickettsia molluscum* are avoided, thus improving the reliability and accuracy of the detection.

[0031] Order commercially available primers and probes based on the designed primer and probe sequences.

[0032] Establish a suitable reaction system and fluorescence detection system for multiplex PCR amplification. The nucleic acid amplification reaction system includes an RNase inhibitor, reverse transcriptase, DNA polymerase, dNTPs, a forward primer that binds to the first strand of the double-stranded target polynucleotide, a reverse primer that binds to the second strand of the double-stranded target polynucleotide, an oligonucleotide probe that binds to the target polynucleotide and has a fluorophore and a fluorescence quencher at each end, respectively, and a buffer containing magnesium ions. The concentrations of the forward primer, reverse primer, and oligonucleotide probe all need to be adjusted to ensure that the curves for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia proteus, Hantavirus, Leptospira, and Rickettsia moghornis are consistent and meet the testing requirements.

[0033] Nucleic acid is extracted from the sample to be tested and added to the aforementioned reaction system. Amplification is performed using a real-time PCR instrument. The presence of genes for Orientia scrub typhus, fever with thrombocytopenia syndrome virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum can be determined from the fluorescence amplification curve. At the same time, the sample Ct value can be substituted into the corresponding standard curve to automatically calculate the initial copy number concentration.

[0034] The six-fold quantitative detection kit (fluorescent PCR method) for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum includes amplification primers and specific fluorescent probes. The sequences of the amplification primers and specific fluorescent probes are shown below: ① The primers for Orientia tsutsugamushi were sequence OT-1: (AF173040.1:30-48, which is the sequence number and primer location in NCBI, the same below) aatgtctgcattgtcattg; OT-2: (AF173040.1:178-162) cagcatcagctggatcc; the probe was sequence OT-3: (AF173040.1:125-143) ttggaggaatKRttactgg; ② The primers for the virus of fever with thrombocytopenia syndrome are the sequence SFTSV-1: (PQ808895.1:4576-4593) tttggcctgaaaaggact; SFTSV-2: (PQ808895.1:4699-4681)taagaaaaggaccatccct; the probe is the sequence SFTSV-3: (PQ808895.1:4642-4667) tcttttgcatggctgagcacagaccc; ③ The primers for Rickettsia protozoa were sequence Rp-1: (CP003396.1:882538-882560)gtatcatttaagtttactgtagt; Rp-2: (CP003396.1:882260-882203)gatccttctgatgttgca; the probe was sequence Rp-3: (CP003396.1:882564-882591) ctgtgactcttcttcctgctgcag; ④ The primers for Hantavirus are the sequence HTNV-1: (NC_005218.1:935-954)agtcaccatcatcaatatgg; HTNV-2: (NC_005218.1:1014-994)agcaatacctgctataaacaa; the probe is the sequence HTNV-3: (NC_005218.1:963-985) tggagcaccagaccgttgtccac; ⑤ The primers for Leptospira were the sequence LEP-1: (PV534492.1:29-46) aggccaagagtcaatcta; LEP-2: (PV534492.1:135-114) taaccattgaataatcgtctga; and the probe was the sequence LEP-3: (PV534492.1:74-100) tgatgccgatcatttttgcttcgtctt. ⑥ The primers for Rickettsia moghorn were sequence RT-1: (L04661.1:239-255) aatgggtgctgttatgc; RT-2: (L04661.1:316-298) gtttgatcaaatcctgcac; and the probe was sequence RT-3: (L04661.1:266-290)aacaacaaatgcagcagctacaact.

[0035] In a preferred embodiment of the present invention, the molar ratios of the forward primers:reverse primers:specific fluorescent probes for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum are respectively: Orientia scrub typhus: 2.5:1.5:5; Fever with thrombocytopenia syndrome virus ratio: 2:3:2; Rickettsia prowazekii: 3.5:3.5:3; Hantavirus: 1.8:1.8:3; Hooked spirochete: 2:2.5:2; Mohr's rickettsia: 4:4:5.

[0036] ① Orientia scrub typhus: 250 nM: 150 nM: 500 nM; ② Fever with thrombocytopenia syndrome virus: 200nM: 300nM: 200nM; ③ Proteus rickettsiae: 350 nM: 350 nM: 300 nM; ④Hantavirus: 180nM: 180nM: 300nM; ⑤ Hooked Helix: 200nM: 250nM: 200nM; ⑥ Mohr's rickettsia: 400 nM: 400 nM: 500 nM.

[0037] The six-fold detection kit (fluorescent PCR method) provided by this invention for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum, includes PCR reaction solution (containing RT-PCR reaction solution, primer and probe mixture, and mixed enzyme solution), positive control, negative control, and gradient standards. Specifically, it includes: Multiple eight-tube sets, 96-well plates, or cryovials containing PCR reaction solution (including RT-PCR reaction solution, primer and probe mixture, and mixed enzyme solution), positive control, negative control, and gradient standards, and sealed with caps. ② Separate and group these eight-tube or 96-well plate or cryopreservation tubes into packaging boxes.

[0038] The negative control in the kit described in this invention is a TE solution, the positive control is a synthetic positive model containing template sequences of Orientia scrub typhus virus, Severe fever with thrombocytopenia syndrome virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum, and the gradient standards are 10-fold gradient dilutions of plasmids / RNA transcripts containing target gene fragments of 6 pathogens, used for quality control in actual detection.

[0039] The present invention provides a six-fold detection kit (fluorescent PCR method) for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowley, Hantavirus, Leptospira, and Rickettsia moghornis. This kit allows for the quantitative detection of Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowley, Hantavirus, Leptospira, and Rickettsia moghornis. The method includes the following steps: Nucleic acid was extracted from the sample using a commercially available nucleic acid extraction kit for PCR testing. The extraction was performed according to the kit's instruction manual.

[0040] ② Add the extracted nucleic acid to a PCR reaction tube containing PCR reaction solution for PCR amplification. Use a commercially available real-time quantitative PCR instrument for detection. The sample Ct value can be substituted into the corresponding standard curve to automatically calculate the initial copy number concentration.

[0041] The six-fold quantitative detection kit (fluorescent PCR method) for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowley, Hantavirus, Leptospira, and Rickettsia molluscum can simultaneously detect six pathogen targets: Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowley, Hantavirus, Leptospira, and Rickettsia molluscum, and perform accurate quantitative analysis of each pathogen target. Parallel detection and quantification of the six pathogen targets are achieved through a single-tube reaction, reducing the time wasted due to incorrect reagent selection caused by target misidentification, and reducing the consumption of consumables and instrument space occupied by multiple-tube reactions. The quantitative results reflect the pathogen load, providing efficient detection application support for the rapid identification and quantitative monitoring of rodent samples or rodent-related environmental samples.

[0042] Example 1: Quantitative testing of quality control samples: We used our company's nucleic acid extraction kit (Guangzhou Shengling Nucleic Acid Extraction Kit) to extract quality control samples for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum. Two brands were selected for each quality control sample: BNCC (Beina Biotechnology): Orientia tsutsugamushi (batch number: 251121), Severe Fever with Thrombocytopenia Syndrome Virus (batch number: 250915), Rickettsia prowleri (batch number: 260221), Hantavirus (batch number: 260112), Leptospira (batch number: 251102), Rickettsia mogheri (batch number: 251218). Bondsheng Biotechnology: Orientia tsutsugamushi (batch number: 202509021), Severe Fever with Thrombocytopenia Syndrome Virus (batch number: 202601012), Rickettsia prowleri (batch number: 202602001), Leptospira (batch number: 202511012), Rickettsia mogheri (batch number: 202512011).

[0043] Primer solution, probe solution, and positive control are the main components of the kit described in this patent; negative control is TE solution. Configure according to Table 2, and set the relevant parameters according to Table 3 for instrument-based detection (Shanghai Hongshi Real-Time PCR Instrument, model SLAN-96H).

[0044] Table 2 Reaction System

[0045] Table 3 Reaction conditions

[0046] The gradient standard (1.5 × 10⁻⁶) described in this invention is used. 3 ~1.5×10 7 Fluorescent PCR amplification was performed using samples (copies / μL). Primer solutions, probe solutions, and gradient standards are the main components of the kit described in this patent. Configure the kit according to Table 2 and set the relevant parameters according to Table 3 for instrument-based detection (Shanghai Hongshi Real-Time PCR Instrument, model SLAN-96H). Establish standard curves for six pathogens. See Table 4.

[0047] Standard curve: The FAM, HEX, CY5, ROX, QUASAR 705, and ATTO 425 channels of the kit all showed a logarithmic increase in fluorescence in the detection of 10-fold diluted gradient standards, with R² ≥ 0.99 and amplification efficiency of 90%–110%, which meets the quality control requirements.

[0048] Table 4 Experimental Results

[0049] log of gradient standards 10 The X-axis represents the copy number concentration, and the Y-axis represents the Ct value. The instrument automatically fits the standard curves for each of the six pathogens, ensuring the accuracy of the data.

[0050] The test results are shown in Table 5: ① Quality control standards: The positive control FAM, HEX, CY5, ROX, QUASAR 705, and ATTO 425 fluorescence signals showed a logarithmic increase in fluorescence, and the Ct value was ≤32.

[0051] ② Samples tested: FAM, HEX, CY5, ROX, QUASAR 705, and ATTO 425 all showed logarithmic fluorescence growth, indicating that the kit detected Orientia scrub typhus virus, fever with thrombocytopenia syndrome virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum, respectively.

[0052] ③ Negative control: FAM, HEX, CY5, ROX, QUASAR 705, and ATTO 425 all showed no fluorescence log growth, with Ct values ​​≥39.6, demonstrating the specificity and anti-interference ability of the method in this application.

[0053] ④ Substitute the CT values ​​of Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum into the standard curve to calculate the copy number.

[0054] Table 5 Experimental Results

[0055] The Ct values ​​above were automatically read by the real-time PCR instrument based on the amplified fluorescence signal and curve shape, ensuring the accuracy of the data.

[0056] Example 2: Quantitative testing of real samples: Nucleic acid extraction was performed using our company's nucleic acid extraction kit (Guangzhou Shengling Nucleic Acid Extraction Kit). Six pathogens were detected: Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum. Two samples of each pathogen were collected for testing. Primer solution, probe solution, and positive control are the main components of the kit described in this patent; the negative control is TE solution. The kit was configured according to Table 2, and the relevant parameters were set according to Table 3 for instrument-based detection (Shanghai Hongshi Real-Time PCR Instrument, model SLAN-96H).

[0057] The test results are shown in Table 6: Tested samples: All channels of the kit (FAM, HEX, CY5, ROX, QUASAR 705, ATTO 425) showed a log increase in fluorescence for the target pathogens, indicating that the kit accurately detects *Orientalis tsutsugamushi*, *Severe Fever with Thrombocytopenia Syndrome* virus, *Rickettsia prowleri*, *Hantavirus*, *Leptospira*, and *Rickettsia molluscum*. Furthermore, no log increase in fluorescence was observed in the other five detection channels corresponding to non-target pathogens, demonstrating the accuracy and sensitivity of the reagent. Substituting the obtained CT values ​​into Table 4, the data are as follows: Table 6 Experimental Results

[0058] The Ct values ​​above were automatically read by the real-time PCR instrument based on the amplified fluorescence signal and curve shape, ensuring the accuracy of the data.

[0059] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. For those skilled in the art, the present invention can have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A primer and probe set for quantitative detection of rodent infectious pathogens, comprising a primer and probe composition for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum, characterized in that, The primers for *Oriental Scrub Typhus* were sequence OT-1: (AF173040.1:30-48, which is the sequence number and location of the primer in NCBI, the same below) aatgtctgcattgtcattg; OT-2: (AF173040.1:178-162) cagcatcagctggatcc; the probe was sequence OT-3: (AF173040.1:125-143) ttggaggaatKRttactgg; The primers for the fever with thrombocytopenia syndrome virus are the sequence SFTSV-1: (PQ808895.1:4576-4593)tttggcctgaaaaggact; SFTSV-2: (PQ808895.1:4699-4681)taagaaaaggaccatccct; and the probe is the sequence SFTSV-3: (PQ808895.1:4642-4667) tcttttgcatggctgagcacagaccc; The primers for the Protozoan rickettsia are sequence Rp-1: (CP003396.1:882538-882560)gtatcatttaagtttactgtagt; Rp-2: (CP003396.1:882260-882203)gatccttctgatgttgca; the probe is sequence Rp-3: (CP003396.1:882564-882591) ctgtgactcttcttcctgctgcag; The primers for the Hantavirus were the sequence HTNV-1: (NC_005218.1:935-954)agtcaccatcatcaatatgg; HTNV-2: (NC_005218.1:1014-994)agcaatacctgctataaacaa; Probe sequence HTNV-3: (NC_005218.1:963-985) tggagcaccagaccgttgtccac; The primers for the leptospira are the sequence LEP-1: (PV534492.1:29-46) aggccaagagtcaatcta; LEP-2: (PV534492.1:135-114) taaccattgaataatcgtctga; and the probe is the sequence LEP-3: (PV534492.1:74-100) tgatgccgatcatttttgcttcgtctt. The primers for the Mohr's rickettsia are sequence RT-1: (L04661.1:239-255) aatgggtgctgttatgc; RT-2: (L04661.1:316-298) gtttgatcaaatcctgcac; and the probe is sequence RT-3: (L04661.1:266-290)aacaacaaatgcagcagctacaact.

2. A kit for quantitative detection of rodent infectious pathogens, comprising a six-fold quantitative detection kit for Orientia tsutsugamushi, Severe Fever with Thrombocytopenia Syndrome Virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia molluscum, characterized in that, The primer-probe composition includes the six pathogen targets described in claim 1.

3. The kit for quantitative detection of rodent infectious pathogens according to claim 2, characterized in that, The 5' end of the Orientia scrub typhus probe sequence OT-3 is modified with FAM, and the 3' end is modified with BHQ1; the 5' end of the SFTSV-3 probe sequence for fever with thrombocytopenia syndrome is modified with HEX, and the 3' end is modified with BHQ1; the 5' end of the Rickettsia proteoglycans probe sequence Rp-3 is modified with CY5, and the 3' end is modified with BHQ2; the 5' end of the Hantavirus probe sequence HTNV-3 is modified with ROX, and the 3' end is modified with BHQ2; the 5' end of the Leptospira probe sequence LEP-3 is modified with QUASAR 705, and the 3' end is modified with BHQ3; the 5' end of the Rickettsia moghornis probe sequence RT-3 is modified with ATTO 425, and the 3' end is modified with BHQ1.

4. The kit for quantitative detection of rodent infectious pathogens according to claim 2, characterized in that, The molar ratio of forward primer, reverse primer, and specific fluorescent probe is: Orientia scrub typhus: (2-5): (1-2): 5; Fever with thrombocytopenia syndrome virus: (1-3): (1-3): 2; Rickettsia prowazekii: (3-5): (3-5): 3; Hantavirus: (1-2): (1-2): 3; Leptospira: (1-3): (1-3): 2; Mohr's rickettsia: (3-5): (3-5):

5.

5. The kit for quantitative detection of rodent infectious pathogens according to claim 2, characterized in that, The molar ratio of forward primer, reverse primer, and specific fluorescent probe is: Orientia scrub typhus: 2.5:1.5:5; Fever with thrombocytopenia syndrome virus ratio: 2:3:2; Rickettsia prowazekii: 3.5:3.5:3; Hantavirus: 1.8:1.8:3; Hooked spirochete: 2:2.5:2; Mohr's rickettsia: 4:4:

5.

6. The kit for quantitative detection of rodent infectious pathogens according to claim 2, characterized in that, Its components include: (1) PCR reaction solution: including: a. Reaction solution: Fluorescent PCR buffer, dNTPs, and DEPC water used in RT-PCR; b. Primer-probe mixture: including primers OT-1, OT-2; SFTSV-1, SFTSV-2; Rp-1, Rp-2; HTNV-1, HTNV-2; LEP-1, LEP-2; RT-1, RT-2 and probes OT-3, SFTSV-3, Rp-3, HTNV-3, LEP-3, RT-3; c. Mixed enzyme solution: including RNase inhibitor, reverse transcriptase, and DNA polymerase; The above three components are premixed into one tube and can be used directly without preparation. (2) Positive controls: These include Orientia tsutsugamushi, SFTSV-1, SFTSV-2, Rp-1, Rp-2, HTNV-1, HTNV-2, LEP-1, LEP-2, and RT-1, RT-2 containing primers OT-1, OT-2; SFTSV-1, SFTSV-2; Rp-1, Rp-2; HTNV-1, HTNV-2; LEP-1, LEP-2; and RT-1, RT-2 amplifying the target fragments of Orientia tsutsugamushi, Severe fever with thrombocytopenia syndrome virus, Rickettsia prowleri, Hantavirus, Leptospira, and Rickettsia mogheri. (3) Negative control: TE solution; (4) Gradient standards: 10-fold gradient dilutions of plasmids / RNA transcripts containing target gene fragments of 6 pathogens, at concentrations of: 1.5×10 7 copies / μL, 1.5×10 6 copies / μL, 1.5×10 5 copies / μL, 1.5×10 4 copies / μL, 1.5×10 3 Copies / μL are used to establish a standard curve for absolute quantification.

7. The application of the kit for quantitative detection of rodent infectious pathogens as described in claim 2, characterized in that, This method is applied to the quantitative detection of nucleic acids targeting six pathogens in a single tube, and is a six-fold fluorescent PCR quantitative method. Quantitative detection for non-diagnostic purposes, including detecting rodent-derived samples or environmental samples related to rodent activity that may be contaminated with rodent-borne pathogens, wherein the samples to be tested are not taken from humans, specifically including rodent tissue samples, rodent excrement samples, and environmental samples from areas where rodents have been active, includes the following steps: S1. Extract total nucleic acid from the sample to be tested; S2. Using the total nucleic acid as a template and the primer and probe set described in claim 1, a recombinase polymerase amplification reaction is performed; S3. Collect fluorescence signals from the detection channels of FAM, HEX, CY5, ROX, QUASAR 705, and ATTO 425, establish standard curves, and obtain quantitative results: S301. Quality Control Standards: Positive controls show an increase in fluorescence index for FAM, HEX, CY5, ROX, QUASAR 705, and ATTO 425, with Ct values ​​≤32; negative controls and blank controls show no increase in fluorescence index, with Ct values ​​≥39.6; gradient standard amplification curves are good, with standard curve R² ≥0.99 and amplification efficiency of 90%–110%. S302 Standard Curve Establishment: log of gradient standards 10 The X-axis represents the copy number concentration, and the Y-axis represents the Ct value. The instrument automatically fits the standard curves for each of the six pathogens. Y = -kX + b; The following conditions must be met for a sample to be used for quantification: R² ≥ 0.99 and amplification efficiency of 90%–110%. S303. Positive Sample: When S301 is met, FAM and / or HEX and / or CY5 and / or ROX and / or QUASAR 705 and / or ATTO 425 show an increase in fluorescence index, and the Ct value is ≤37. Substitute the sample Ct value into the corresponding standard curve to automatically calculate the initial copy number concentration (copies / μL). S304. Negative Samples: When S301 is established, the lack of fluorescence index growth in FAM and / or HEX and / or CY5 and / or ROX and / or QUASAR 705 and / or ATTO 425, and a Ct value ≥39.6, indicates that the sample does not contain Orientia scrub typhus virus or / and fever with thrombocytopenia syndrome virus or / and Rickettsia proteus virus or / and Hantavirus or / and Leptospira or / and Rickettsia molluscum. S305. Suspected Sample: When S301 is established, FAM and / or HEX and / or CY5 and / or ROX and / or QUASAR 705 and / or ATTO 425 show an increase in fluorescence index, and 37≤Ct value≤39.

6. Repeat the test once. If the retest result is still 37≤Ct value≤39.6 and there is a significant increase in the index, it is judged as positive; otherwise, it is negative.

8. The application according to claim 7, characterized in that, The PCR reaction solution is a fully aliquoted liquid in 8-tube, 96-well plate, and cryovial containers, requiring no further preparation.

9. The application according to claim 7, characterized in that, The reaction conditions are: The reaction volume was 25 μL. Pathogen corresponding model collection: Orientia scrub typhus: Fluorescence signal was collected using the FAM channel; Fever with thrombocytopenia syndrome virus: Fluorescence signals were acquired via HEX / VIC / HEX channels; Protozoa: Fluorescence signal was acquired using the CY5 channel; Hantavirus: Fluorescence signal was collected using the ROX channel; Leptospira: Fluorescence signals were acquired using QUASAR 705 channel; Mohr's rickettsiae: Fluorescence signals were acquired using the ATTO 425 channel; PCR reaction conditions include: Reverse transcription: 50℃, 15 min, one cycle; Pre-denaturation: 95℃, 5 min, cycle once; PCR: 95℃, 3s; 55℃, 45s, 45 cycles.

10. The application according to claim 7, characterized in that, The detection method described in this application enables quantitative detection: A standard curve was established using standards with 10-fold serial dilutions. The curve was fitted with log concentration as the X-axis and Ct value as the Y-axis, requiring R² ≥ 0.99 and amplification efficiency of 90%–110%. The sample Ct value was substituted into the standard curve to calculate the initial copy number concentration of the pathogen, achieving absolute quantification.

Images