Immune inducers comprising polynucleotide-peptide conjugates and pharmaceutical compositions comprising the same
By replacing the amino acid at the N-terminus of the MHC-binding peptide and conjugating it with a CpG DNA derivative, a cleavable polynucleotide-peptide conjugate is formed, which solves the problem of insufficient CTL induction ability in the prior art and achieves efficient CTL induction for a wide range of antigenic peptides, making it suitable for the treatment of infectious diseases, tumors and allergic diseases.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- UNIVERSITY OF KITAKYUSHU
- Filing Date
- 2021-03-26
- Publication Date
- 2026-06-09
AI Technical Summary
In the prior art, CpG DNA-peptide conjugates have insufficient CTL induction ability for certain antigenic peptides, especially when amino acids such as cysteine are directly added to the N-terminus of the peptide, the MHC-binding peptide cannot bind to the MHC molecule, resulting in reduced CTL induction ability.
By replacing one or more consecutive amino acids at the N-terminus of the MHC-binding peptide with amino acids having reactive functional groups, such as cysteine, a covalent bond that can be broken in the biological environment is formed. Then, a polynucleotide derivative containing a CpG motif is used to conjugate the peptide to form a polynucleotide-peptide conjugate with a disulfide bond as the spacer group, ensuring that the peptide can form a covalent bond with the spacer group.
It achieves highly efficient CTL induction of a wide range of antigenic peptides, enhances immune responses, and is suitable for the treatment of infectious diseases, tumors, and allergic diseases, providing a wider range of possibilities for the application of antigenic peptides.
Smart Images

Figure CN115427079B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to immune inducers containing polynucleotide-peptide conjugates as active ingredients, pharmaceutical compositions containing the same, and the like. Background Technology
[0002] Toll-like receptor (TLR) families, known to exist on antigen-presenting cells such as dendritic cells, macrophages, and B cells, react with various pathogens, inducing cytokine production and inducing acquired immunity by promoting the differentiation of naive T cells into Th1 cells and activating cytotoxic T cells. The pathogens recognized by a range of TLR families are highly diverse, including DNA with a CpG motif (CpG DNA), which acts as a ligand for TLR9. The CpG motif is based on a six-base sequence: cytosine (C) and guanine (G) arranged at the center, with two purine bases before and two pyrimidine bases before and after it. The sequence is represented as -PuPu-CG-PyPy- (Pu represents a purine base, Py represents a pyrimidine base). (GTCGTT is also known to have ligand activity against TLR9 in humans.) This is a rare base sequence in mammals but common in microorganisms. Furthermore, most of the CpG motifs present in mammals are methylated. Unmethylated CpG motifs, almost entirely absent in mammals, possess potent immune-activating activity (e.g., see Non-Patent Literature 1–3). CpG DNA ingested into cells via phagocytosis can be recognized by TLR9 cells located in the phagosome-like endoplasmic reticulum, leading to the production of Th1 cytokines such as interferon-γ (IFN-γ) and interleukin-2 (IL-2), strongly inducing a Th1 response. The Th1 response suppresses the Th2-dominated allergic reactions and also activates macrophages and cytotoxic T cells (CTLs), exhibiting strong antitumor activity based on cell-mediated immunity.
[0003] Besides its potential for infection prevention, CpG DNA is also expected to serve as an adjuvant for allergic and neoplastic diseases. Conjugates formed by covalently binding CpG DNA to antigens have been reported, for example, as follows.
[0004] Non-patent document 4 describes how a conjugate of CpG DNA with an 18-24mer peptide from ovalbumin (OVA) antigen promotes dendritic cell uptake and antigen presentation.
[0005] Non-patent documents 5 and 6 describe the in vitro induction of T cell activation using a conjugate of CpG DNA and OVA antigen protein. Furthermore, non-patent document 5 describes the induction of antigen-specific cell-killing activity in vitro.
[0006] Non-patent literature 7 describes a method for preparing conjugates of CpG oligonucleotides with tumor-associated proteins or cells.
[0007] Patent Document 1 discloses an immune inducer comprising a conjugate of a single-chain polynucleotide or polynucleotide derivative containing a CpG motif and an antigenic peptide as an active ingredient, and discloses an immune induction activity with high antigen specificity.
[0008] Existing technical documents
[0009] Patent documents
[0010] Patent Document 1: PCT / JP2019 / 038090
[0011] Non-patent literature
[0012] Non-patent literature 1: Bacterial CpG DNA Activates Immune Cells to Signal Infectious Danger. H. Wagner, Adv. Immunol., 73, 329-368 (1999).
[0013] Non-patent literature 2: CpG Motifs in Bacterial DNA and Their Immune Effects. M. Krieg, Annu. Rev. Immunol., 20, 709-760 (2002).
[0014] Non-patent document 3: The discovery of immunostimulatory DNA sequence. S. Yamamoto, T. Yamamoto, and T. Tokunaga, Springer Seminars in Immunopathology, 22, 11-19 (2000).
[0015] Non-patent document 4: Distinct Uptake Mechanisms but Similar Intracellular Processing of Two Different Toll-like Receptor Ligand-Peptide Conjugates in Dendritic Cells. Khan S. et al., J. Biol. Chem. 282, 21145-21159 (2007).
[0016] Non-patent document 5: Intracellular Cleavable CpG Oligodeoxynucleotide-AntigenConjugate Enhances Anti-tumor Immunity. Kramer K. et al., Mol. Ther. 25, 62-70 (2017).
[0017] Non-patent document 6: Comparative Study of 5'-and 3'-Linked CpG-AntigenConjugates for the Induction of Cellular Immune Responses.Kramer K. et al., ACSOmega 2(1),227-235(2017)
[0018] Non-patent literature 7: TLR-9 agonist immunostimulatory sequence adjuvants linked to cancer antigens, Shirota H. and Klinman DM, Methods Mol. Biol. 1139, 337-344 (2014) Summary of the Invention
[0019] The problem the invention aims to solve
[0020] In Patent Document 1, the inventors demonstrated, through research using antigenic peptides derived from OVA, that CpG DNA-peptide conjugates possess high cytotoxic T cell (CTL) induction capacity. However, it has been found that when preparing the same CpG DNA-peptide conjugates from other antigenic peptides, sufficient CTL induction capacity is sometimes not obtained. The object of the present invention is to provide, with respect to a wider range of antigenic peptides, an immune inducer capable of inducing CTL activity, etc.
[0021] Solution for solving the problem
[0022] The inventors investigated peptides that did not exhibit sufficient CTL induction ability during the preparation of CpG DNA-peptide conjugates. They discovered that adding amino acids such as cysteine to the N-terminus of the peptide for conjugation caused peptides that were originally bound to MHC molecules (MHC-binding peptides) to become unable to bind to MHC molecules. Furthermore, they found that CpG DNA-peptide conjugates with high CTL induction ability could be prepared by using peptides obtained by replacing one or more consecutive amino acids at the N-terminus (excluding anchor residues) with amino acids such as cysteine, rather than using peptides with amino acids such as cysteine directly added to the N-terminus of MHC-binding peptides. The inventors conducted further in-depth research, thus completing this invention.
[0023] That is, the present invention includes the following inventions.
[0024] [1] An immune inducer comprising a polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof as an active ingredient.
[0025] The aforementioned polynucleotide-peptide conjugate is composed of a single-stranded polynucleotide or polynucleotide derivative containing a CpG motif, a peptide, and a spacer group, wherein the spacer group is covalently bonded to the aforementioned polynucleotide or polynucleotide derivative at one end and covalently bonded to the aforementioned peptide at the other end.
[0026] The above-mentioned peptide is a peptide in which one or more consecutive amino acids at the N-terminus of an MHC-binding peptide are replaced with amino acids having reactive functional groups for forming covalent bonds with the above-mentioned spacer group. Here, the above-mentioned one or more consecutive amino acids do not include anchor residues for binding MHC.
[0027] [2] According to the immune inducer described in [1], one or both of the covalent bonds between the spacer and the polynucleotide or polynucleotide derivative and the covalent bonds between the spacer and the peptide are covalent bonds that can be broken in the biological environment.
[0028] [3] According to the immune inducer described in [1] or [2], wherein the amino acid having a reactive functional group for forming a covalent bond with the spacer group is cysteine or a cysteine analog having a thiol group.
[0029] [4] The immune inducer according to any one of [1] to [3], wherein the covalent bond between the spacer group and the peptide is a disulfide bond.
[0030] [5] An immune inducer according to any one of [1] to [4], wherein the above-mentioned MHC-binding peptide is an MHC-1-binding peptide.
[0031] [6] According to the immune inducer described in [5], wherein the above-mentioned MHC-1 binding peptide is an HLA-A binding peptide or an HLA-B binding peptide.
[0032] [7] According to the immune inducer described in [5] or [6], wherein the amino acid length of the MHC-1 binding peptide is 8 or more and 11 or less.
[0033] [8] An immune inducer according to any one of [1] to [4], wherein the above-mentioned MHC-binding peptide is an MHC-2-binding peptide.
[0034] [9] An immune inducer according to any one of [1] to [8], wherein the polynucleotide or polynucleotide derivative is a polydeoxyribonucleotide (DNA) or DNA derivative containing two or more CpG motifs.
[0035]
[10] An immune inducer according to any one of [1] to [9], wherein the base length of the polynucleotide or polynucleotide derivative is 15 or more and 40 or less.
[0036]
[11] According to the immune inducer of
[10] , wherein the base length of the above-mentioned polynucleotide or polynucleotide derivative is 20 or more and 30 or less.
[0037]
[12] An immune inducer according to any one of [1] to
[11] , wherein the polynucleotide or polynucleotide derivative is a polynucleotide derivative in which at least a portion of the phosphodiester bond is replaced by a thiophosphate bond.
[0038]
[13] According to the immune inducer of
[12] , wherein in the polynucleotide derivative in which at least a portion of the above phosphodiester bonds are replaced by thiophosphate bonds, more than 50% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0039]
[14] According to the immune inducer of
[13] , in the polynucleotide derivative in which at least a portion of the above phosphodiester bonds are replaced by thiophosphate bonds, more than 90% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0040]
[15] An immune inducer according to any one of [1] to
[14] , wherein the spacer comprises a repeating unit as shown in the following formula.
[0041]
[0042] In the above formula,
[0043] X represents an oxygen atom or a sulfur atom (here, each X can be chosen to be the same or different).
[0044] R represents (CH2)p O, (CH2) q NH and (CH2CH2O) m Any of the following (m, p, and q independently represent natural numbers less than 10).
[0045] n represents a natural number less than 10.
[0046]
[16] An immune inducer according to any one of [1] to
[15] , wherein the spacer group has a structure shown in any of the following formulas.
[0047]
[0048]
[17] An immune inducer according to any one of [1] to
[14] , wherein the spacer group has a structure shown in any of the following formulas.
[0049]
[0050]
[18] An immune inducer comprising, as an active ingredient, the polynucleotide-peptide conjugate described in [1] or a pharmaceutically acceptable salt thereof.
[0051] One or both of the covalent bonds between the aforementioned spacer group and the aforementioned polynucleotide or polynucleotide derivative, and the covalent bonds between the aforementioned spacer group and the aforementioned peptide, are covalent bonds that can be broken in the biological environment.
[0052] The aforementioned polynucleotides or polynucleotide derivatives are polydeoxyribonucleotides (DNA) or DNA derivatives containing two or more CpG motifs.
[0053] The aforementioned polynucleotides or polynucleotide derivatives are polynucleotide derivatives in which at least a portion of the phosphodiester bonds are replaced with thiophosphate bonds.
[0054]
[19] An immune inducer comprising, as an active ingredient, the polynucleotide-peptide conjugate described in [1] or a pharmaceutically acceptable salt thereof.
[0055] The amino acid having a reactive functional group for forming a covalent bond with the above-mentioned spacer group is cysteine or a cysteine analogue with a thiol group.
[0056] The covalent bond between the spacer group and the peptide is a disulfide bond.
[0057] The aforementioned MHC-binding peptide is an MHC-1 binding peptide.
[0058] The aforementioned MHC-1 binding peptide is either an HLA-A binding peptide or an HLA-B binding peptide.
[0059] The amino acid length of the aforementioned MHC-1 binding peptide is 8 or more and 11 or less.
[0060] The aforementioned polynucleotides or polynucleotide derivatives are polydeoxyribonucleotides (DNA) or DNA derivatives containing two or more CpG motifs.
[0061] The aforementioned polynucleotides or polynucleotide derivatives have a base length of 20 or more but less than 30.
[0062] In polynucleotide derivatives where at least a portion of the phosphodiester bonds are replaced with thiophosphate bonds, more than 90% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0063] The aforementioned spacer base has the structure shown in the following arbitrary formula.
[0064]
[0065]
[20] The immune inducer according to any one of [1] to
[19] further comprises a substance having immune-activating activity as an adjuvant.
[0066]
[21] A pharmaceutical composition comprising any one of [1] to
[20] an immune inducer.
[0067]
[22] The pharmaceutical composition according to
[21] is used to treat or prevent infectious diseases, tumors or allergic diseases.
[0068]
[23] The pharmaceutical composition according to
[21] is used for the treatment or prevention of tumors.
[0069]
[24] A method of treating or preventing an infectious disease, tumor or allergic disease, comprising the step of administering to a patient any of the immune inducers described in any one of [1] to
[20] .
[0070]
[25] A method of treating or preventing tumors, comprising the step of administering to a patient the immune inducer described in any one of [1] to
[20] .
[0071]
[26] An immune inducer according to any one of [1] to
[20] , which is used in the treatment or prevention of infectious diseases, tumors or allergic diseases.
[0072]
[27] An immune inducer according to any one of [1] to
[20] , which is used in the treatment or prevention of tumors.
[0073] The use of any of the immune inducers described in
[28] [1] to
[20] in the manufacture of a medicament for the treatment or prevention of infectious diseases, tumors or allergic diseases.
[0074] The use of any of the immune inducers described in
[29] [1] to
[20] in the manufacture of a medicament for the treatment or prevention of tumors.
[0075]
[30] A polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof.
[0076] The aforementioned polynucleotide-peptide conjugate is composed of a single-stranded polynucleotide or polynucleotide derivative containing a CpG motif, a peptide, and a spacer group, wherein the spacer group is covalently bonded to the aforementioned polynucleotide or polynucleotide derivative at one end and covalently bonded to the aforementioned peptide at the other end.
[0077] The above-mentioned peptide is an MHC-binding peptide in which one or more consecutive amino acids at the N-terminus are replaced with amino acids having reactive functional groups for forming covalent bonds with the above-mentioned spacer group. Here, the above-mentioned one or more consecutive amino acids do not include anchor residues for binding MHC.
[0078]
[31] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to
[30] , wherein,
[0079] One or both of the covalent bonds between the aforementioned spacer group and the aforementioned polynucleotide or polynucleotide derivative, and the covalent bonds between the aforementioned spacer group and the aforementioned peptide, are covalent bonds that can be broken in the biological environment.
[0080] The aforementioned polynucleotides or polynucleotide derivatives are polydeoxyribonucleotides (DNA) or DNA derivatives containing two or more CpG motifs.
[0081] The aforementioned polynucleotides or polynucleotide derivatives are polynucleotide derivatives in which at least a portion of the phosphodiester bonds are replaced with thiophosphate bonds.
[0082]
[32] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to
[30] , wherein,
[0083] The amino acid having a reactive functional group for forming a covalent bond with the above-mentioned spacer group is cysteine or a cysteine analogue with a thiol group.
[0084] The covalent bond between the spacer group and the peptide is a disulfide bond.
[0085] The aforementioned MHC-binding peptide is an MHC-1 binding peptide.
[0086] The aforementioned MHC-1 binding peptide is either an HLA-A binding peptide or an HLA-B binding peptide.
[0087] The amino acid length of the aforementioned MHC-1 binding peptide is 8 or more and 11 or less.
[0088] The aforementioned polynucleotides or polynucleotide derivatives are polydeoxyribonucleotides (DNA) or DNA derivatives containing two or more CpG motifs.
[0089] The aforementioned polynucleotides or polynucleotide derivatives have a base length of 20 or more but less than 30.
[0090] In polynucleotide derivatives where at least a portion of the phosphodiester bonds are replaced with thiophosphate bonds, more than 90% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0091] The aforementioned spacer base has the structure shown in the following arbitrary formula.
[0092]
[0093] In addition, the present invention provides the following [A1] to [A19].
[0094] [A1] A polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof.
[0095] The aforementioned polynucleotide-peptide conjugate is composed of a single-stranded polynucleotide or polynucleotide derivative containing a CpG motif, a peptide, and a spacer group, wherein the spacer group is covalently bonded to the aforementioned polynucleotide or polynucleotide derivative at one end and covalently bonded to the aforementioned peptide at the other end.
[0096] The above-mentioned peptide is an MHC-binding peptide in which one or more consecutive amino acids at the N-terminus are replaced with amino acids having reactive functional groups for forming covalent bonds with the above-mentioned spacer group. Here, the above-mentioned one or more consecutive amino acids do not include anchor residues for binding MHC.
[0097] [A2] The polynucleotide-peptide conjugate or its pharmaceutically acceptable salt according to [A1], wherein one or both of the covalent bond between the spacer group and the polynucleotide or polynucleotide derivative and the covalent bond between the spacer group and the peptide are covalent bonds that can be broken in a biological environment.
[0098] [A3] The polynucleotide-peptide conjugate or its pharmaceutically acceptable salt according to A1 or A2, wherein the amino acid having a reactive functional group for forming a covalent bond with the spacer group is cysteine or a cysteine analog having a thiol group.
[0099] [A4] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to any one of A1 to A3, wherein the covalent bond between the spacer group and the peptide is a disulfide bond.
[0100] [A5] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to any one of A1 to A4, wherein the MHC-binding peptide is an MHC-1 binding peptide.
[0101] [A6] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof as described in A5, wherein the MHC-1 binding peptide is an HLA-A binding peptide or an HLA-B binding peptide.
[0102] [A7] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof as described in A5 or A6, wherein the amino acid length of the MHC-1 binding peptide is 8 or more and 11 or less.
[0103] [A8] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to any one of A1 to A4, wherein the MHC-binding peptide is an MHC-2-binding peptide.
[0104] [A9] The polynucleotide-peptide conjugate or its pharmaceutically acceptable salt according to any one of A1 to A8, wherein the polynucleotide or polynucleotide derivative is a polydeoxyribonucleotide (DNA) or DNA derivative containing two or more CpG motifs.
[0105] [A10] The polynucleotide-peptide conjugate or its pharmaceutically acceptable salt according to any one of A1 to A9, wherein the base length of the polynucleotide or polynucleotide derivative is 15 or more and 40 or less.
[0106] [A11] The polynucleotide-peptide conjugate or its pharmaceutically acceptable salt according to A10, wherein the base length of the polynucleotide or polynucleotide derivative is 20 or more and 30 or less.
[0107] [A12] The polynucleotide-peptide conjugate or its pharmaceutically acceptable salt according to any one of A1 to A11, wherein the polynucleotide or polynucleotide derivative is a polynucleotide derivative in which at least a portion of the phosphodiester bond is replaced by a thiophosphate bond.
[0108] [A13] The polynucleotide-peptide conjugate or its pharmaceutically acceptable salt according to A12, wherein in the polynucleotide derivative in which at least a portion of the phosphodiester bonds are replaced by thiophosphate bonds, more than 50% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0109] [A14] The polynucleotide-peptide conjugate or its pharmaceutically acceptable salt according to A13, wherein in the polynucleotide derivative in which at least a portion of the phosphodiester bonds are replaced by thiophosphate bonds, more than 90% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0110] [A15] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to any one of A1 to A14, wherein the spacer group comprises a repeating unit as shown in the following formula.
[0111]
[0112] In the above formula,
[0113] X represents an oxygen atom or a sulfur atom (here, each X can be chosen to be the same or different).
[0114] R represents (CH2) p O, (CH2) q NH and (CH2CH2O) m Any of the following (m, p, and q independently represent natural numbers less than 10).
[0115] n represents a natural number less than 10.
[0116] [A16] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to any one of A1 to A15, wherein the spacer group has a structure shown in any of the following formulas.
[0117]
[0118] [A17] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to any one of A1 to A14, wherein the spacer group has a structure shown in any of the following formulas.
[0119]
[0120] [A18] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to [A1], wherein,
[0121] One or both of the covalent bonds between the aforementioned spacer group and the aforementioned polynucleotide or polynucleotide derivative, and the covalent bonds between the aforementioned spacer group and the aforementioned peptide, are covalent bonds that can be broken in the biological environment.
[0122] The aforementioned polynucleotides or polynucleotide derivatives are polydeoxyribonucleotides (DNA) or DNA derivatives containing two or more CpG motifs.
[0123] The aforementioned polynucleotides or polynucleotide derivatives are polynucleotide derivatives in which at least a portion of the phosphodiester bonds are replaced with thiophosphate bonds.
[0124] [A19] The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to [A1], wherein,
[0125] The amino acid having a reactive functional group for forming a covalent bond with the above-mentioned spacer group is cysteine or a cysteine analogue with a thiol group.
[0126] The covalent bond between the spacer group and the peptide is a disulfide bond.
[0127] The aforementioned MHC-binding peptide is an MHC-1 binding peptide.
[0128] The aforementioned MHC-1 binding peptide is either an HLA-A binding peptide or an HLA-B binding peptide.
[0129] The amino acid length of the aforementioned MHC-1 binding peptide is 8 or more and 11 or less.
[0130] The aforementioned polynucleotides or polynucleotide derivatives are polydeoxyribonucleotides (DNA) or DNA derivatives containing two or more CpG motifs.
[0131] The aforementioned polynucleotides or polynucleotide derivatives have a base length of 20 or more but less than 30.
[0132] In polynucleotide derivatives where at least a portion of the phosphodiester bonds are replaced with thiophosphate bonds, more than 90% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0133] The aforementioned spacer base has the structure shown in the following arbitrary formula.
[0134]
[0135] In addition, the present invention provides the following [A20] and [A21].
[0136] [A20] A method for manufacturing an immune inducer comprising a polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof as an active ingredient, comprising the following steps:
[0137] (1) Prepare single-stranded polynucleotides or polynucleotide derivatives containing CpG motifs;
[0138] (2) A peptide in which one or more consecutive amino acids at the N-terminus of an MHC-binding peptide are replaced with amino acids having reactive functional groups for forming covalent bonds with the aforementioned spacer groups, wherein the aforementioned one or more consecutive amino acids do not include anchor residues; and
[0139] (3) The polynucleotide or polynucleotide derivative of (1) is linked to the peptide of (2) by means of a spacer, wherein the spacer is covalently bonded to the polynucleotide or polynucleotide derivative at one end and to the peptide at the other end.
[0140] [A21] The method according to [A20], wherein the immune inducer is any one of [1] to
[20] ,
[26] and
[27] .
[0141] In addition, the present invention provides the following [A22] and [A23].
[0142] [A22] A method for producing a polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof, comprising the following steps:
[0143] (1) Prepare single-stranded polynucleotides or polynucleotide derivatives containing CpG motifs;
[0144] (2) A peptide in which one or more consecutive amino acids at the N-terminus of an MHC-binding peptide are replaced with amino acids having reactive functional groups for forming covalent bonds with the aforementioned spacer groups, wherein the aforementioned one or more consecutive amino acids do not include anchor residues; and
[0145] (3) The polynucleotide or polynucleotide derivative of (1) is linked to the peptide of (2) by means of a spacer, wherein the spacer is covalently bonded to the polynucleotide or polynucleotide derivative at one end and to the peptide at the other end.
[0146] [A23] According to the method of [A22], wherein the polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof is any one of [A1] to [A19], which is a polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof.
[0147] In addition, the present invention provides the following [a1] to [a19].
[0148] [a1] An immune inducer comprising a polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof as the active ingredient.
[0149] The aforementioned polynucleotide-peptide conjugate is composed of a single-stranded polynucleotide or polynucleotide derivative containing a CpG motif, a peptide, and a spacer group, wherein the spacer group is covalently bonded to the aforementioned polynucleotide or polynucleotide derivative at one end and covalently bonded to the aforementioned peptide at the other end.
[0150] The above-mentioned peptide is an MHC-binding peptide in which one or more consecutive amino acids at the N-terminus are replaced with amino acids having reactive functional groups for forming covalent bonds with the above-mentioned spacer group. Here, the above-mentioned one or more consecutive amino acids do not include anchor residues for binding MHC.
[0151] [a2] According to the immune inducer described in [a1], one or both of the covalent bonds between the spacer group and the polynucleotide or polynucleotide derivative and the covalent bonds between the spacer group and the peptide are covalent bonds that can be broken in the biological environment.
[0152] [a3] According to the immune inducer described in [a1] or [a2], wherein the amino acid having a reactive functional group for forming a covalent bond with the aforementioned spacer group is cysteine or a cysteine analog having a thiol group.
[0153] [a4] An immune inducer according to any one of [a1] to [a3], wherein the covalent bond between the spacer group and the peptide is a disulfide bond.
[0154] [a5] An immune inducer according to any one of [a1] to [a4], wherein the MHC-binding peptide is an MHC-1 binding peptide.
[0155] [a6] According to the immune inducer described in [a5], wherein the above-mentioned MHC-1 binding peptide is an HLA-A binding peptide or an HLA-B binding peptide.
[0156] [a7] According to the immune inducer described in [a5] or [a6], wherein the amino acid length of the above-mentioned MHC-1 binding peptide is 8 or more and 11 or less.
[0157] [a8] An immune inducer according to any one of [a1] to [a4], wherein the above-mentioned MHC-binding peptide is an MHC-2-binding peptide.
[0158] [a9] An immune inducer according to any one of [a1] to [a8], wherein the polynucleotide or polynucleotide derivative is a polydeoxyribonucleotide (DNA) or DNA derivative containing two or more CpG motifs.
[0159] [a10] An immune inducer according to any one of [a1] to [a9], wherein the base length of the polynucleotide or polynucleotide derivative is 15 or more and 40 or less.
[0160] [a11] According to the immune inducer described in [a10], the base length of the above-mentioned polynucleotide or polynucleotide derivative is 20 or more and 30 or less.
[0161] [a12] An immune inducer according to any one of [a1] to [a11], wherein the polynucleotide or polynucleotide derivative is a polynucleotide derivative in which at least a portion of the phosphodiester bond is replaced by a thiophosphate bond.
[0162] [a13] According to the immune inducer described in [a12], in the polynucleotide derivative in which at least a portion of the phosphodiester bonds are replaced with thiophosphate bonds, more than 50% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0163] [a14] According to the immune inducer described in [a13], in the polynucleotide derivative in which at least a portion of the phosphodiester bonds are replaced with thiophosphate bonds, more than 90% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0164] [a15] An immune inducer according to any one of [a1] to [a14], wherein the spacer comprises a repeating unit as shown in the following formula.
[0165]
[0166] In the above formula,
[0167] X represents an oxygen atom or a sulfur atom (here, each X can be chosen to be the same or different).
[0168] R represents (CH2) p O, (CH2) q NH and (CH2CH2O) m Any of the following (m, p, and q independently represent natural numbers less than 10).
[0169] n represents a natural number less than 10.
[0170] [a16] An immune inducer according to any one of [a1] to [a15], wherein the spacer group has a structure shown in any of the following formulas.
[0171]
[0172] [a17] The immune inducer according to any one of [a1] to [a16] further comprises a substance having immune-activating activity as an adjuvant.
[0173] [a18] A pharmaceutical composition comprising any one of [a1] to [a17] of the immune inducer.
[0174] [a19] The pharmaceutical composition according to [a18] is used to treat tumors.
[0175] The effects of the invention
[0176] According to the present invention, a wide range of antigenic peptides can be used in the preparation of immune inducers capable of inducing CTL activity. Attached Figure Description
[0177] Figure 1 This is a chromatogram showing the HPLC analysis of CpG30(S)a-mTRP2pep9 (compound 1) in Example 1.
[0178] Figure 2To show the mass spectrum of CpG30(S)a-mTRP2pep9 (compound 1) in Example 1 during mass spectrometry analysis.
[0179] Figure 3 A graph showing the flow cytometry results in Example 2(2).
[0180] Figure 4 A graph showing the flow cytometry results in Example 2 (3).
[0181] Figure 5 A graph showing the flow cytometry results in Example 2 (4).
[0182] Figure 6 A graph showing the flow cytometry results in Example 2 (5).
[0183] Figure 7 A graph showing the flow cytometry results in Example 3.
[0184] Figure 8 A graph showing the flow cytometry results in Example 4.
[0185] Figure 9 A graph showing the flow cytometry results in Example 4.
[0186] Figure 10 A graph showing the flow cytometry results in Reference Example 1.
[0187] Figure 11 A graph showing the flow cytometry results in Reference Example 2.
[0188] Figure 12 A graph showing the flow cytometry results in Example 5.
[0189] Figure 13 A graph showing the flow cytometry results in Example 6.
[0190] Figure 14 A graph showing the flow cytometry results in Example 7.
[0191] Figure 15 To illustrate CD4 in Example 9 and Reference Example 3 + A graph showing the results of IFN-γ secretion assays by T cells.
[0192] Figure 16 A graph showing the flow cytometry results in Reference Example 3.
[0193] Figure 17 To illustrate CD4 in Example 9 and Reference Example 3 +A graph showing the results of IFN-γ secretion assays by T cells.
[0194] Figure 18 A graph showing the flow cytometry results in Example 10. Detailed Implementation
[0195] This invention provides an immune inducer comprising a polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof as the active ingredient (hereinafter also referred to as the immune inducer of this invention).
[0196] The polynucleotide-peptide conjugate in the immune inducer of the present invention is composed of a single-chain polynucleotide or polynucleotide derivative containing a CpG motif, a peptide, and a spacer, wherein the spacer is covalently bonded to the polynucleotide or polynucleotide derivative at one end and to the peptide at the other end.
[0197] "Single-stranded polynucleotides or polynucleotide derivatives containing CpG motifs" can be used without particular restriction as long as they contain one or more (preferably more, such as 2, 3, 4, 5, or 6) CpG motifs, and can have any base sequence and number of bases. Specific examples of CpG motifs include AGCGTT, GACGTT, GACGTC, GTCGTT, etc. Multiple CpG motifs with different sequences can be included. The number of CpG motifs contained in the polynucleotide is not particularly limited, but it is preferred to contain 1 to 6 CpG motifs, and more preferably 2 to 4 CpG motifs. The above-mentioned polynucleotides or polynucleotide derivatives are preferably polydeoxyribonucleotides (DNA) containing 2 or more CpG motifs or DNA derivatives modified with phosphate thioesters, and may also partially contain RNA or RNA derivatives. When RNA or RNA derivatives are included, their content is preferably less than 20% in terms of base percentage (specifically less than 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%).
[0198] The polynucleotide or polynucleotide derivative preferably contains 15 to 40 bases (specifically 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40), more preferably 20 to 30 (specifically 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30). Specific examples of preferred polynucleotide or polynucleotide derivative base sequences are shown in Table 1 below. In Table 1, the underlined sequences represent CpG motifs.
[0199] [Table 1-1]
[0200]
[0201] [Table 1-2]
[0202] DNA containing CpG motifs (5'→3') Serial Number 1018ISS TGACTGTGAACGTTCGAGATGA 43 1018ISS_30 <![CDATA[TGAACGTTCGACTGTG AACGTT CGAGATGA]]> 44 1018ISS_40 <![CDATA[TG AACGTT CGTG AACGTT CGACTGTG AACGTT CGAGATGA]]> 45
[0203] Polynucleotides are readily degraded by nucleases in vivo. Therefore, to improve their stability in vivo, polynucleotide derivatives can be used instead of polynucleotides. Polynucleotide derivatives can be any modified substance containing modifications known in the art for increasing nuclease resistance and thus improving stability in vivo. Examples of polynucleotide derivatives include polynucleotides in which all or part of the 2' hydroxyl group of a ribonucleotide is replaced by a fluorine or methoxy group, and polynucleotides in which all or part of the phosphodiester bond of a polyribonucleotide (RNA) or polydeoxyribonucleotide (DNA) is replaced by a thiophosphate bond. When a portion of the phosphodiester bonds of a polyribonucleotide or polydeoxyribonucleotide is replaced by a thiophosphate bond, preferably more than 50% (specifically 50, 60, 70, 80, or 90%) of the phosphodiester bonds are replaced by thiophosphate bonds, more preferably more than 90% (specifically 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%), and substantially all of them can be replaced by thiophosphate bonds. The phosphodiester bonds can be completely replaced by thiophosphate bonds. The position of the phosphodiester bonds replaced by thiophosphate bonds is not particularly limited; multiple consecutive phosphodiester bonds can be replaced, or they can be replaced in a manner where the thiophosphate bonds are not adjacent to each other.
[0204] The position of the polynucleotide or polynucleotide derivative bonded to the spacer group is not particularly limited; for example, it can be at the 5' end or the 3' end. In the covalent bonding of the polynucleotide or polynucleotide derivative to the spacer group, functional groups present in the polynucleotide or polynucleotide derivative can be used directly or activated through chemical modification. Preferably, the spacer group is bonded to the oxygen atom of the hydroxyl group at the 5' or 3' end of the polynucleotide or polynucleotide derivative.
[0205] Polynucleotides or polynucleotide derivatives can be synthesized using known chemical synthesis methods (e.g., phosphotriester method, phosphoramide method, H-phosphonate method, etc.). They can also be synthesized using commercially available nucleic acid synthesizers and reagents for DNA / RNA synthesis.
[0206] The "peptide" in the immune inducer of the present invention is a peptide in which one or more consecutive amino acids at the N-terminus of an MHC-binding peptide are replaced with amino acids having reactive functional groups for forming covalent bonds with the aforementioned spacer groups. Here, the aforementioned one or more consecutive amino acids do not include anchor residues for binding MHC.
[0207] In this invention, "MHC-binding peptide" refers to a peptide that can bind to MHC molecules (i.e., the major histocompatibility gene complex) and be presented as an antigen to T cells without additional processing such as trimming. MHC molecules include MHC-1 molecules (also known as MHC class I molecules) and MHC-2 molecules (also known as MHC class II molecules). Furthermore, the human MHC-1 molecule is called an HLA molecule and has multiple alleles. The MHC-binding peptide is preferably any one of a peptide that presents antigens from MHC-1 molecules (i.e., MHC-1-binding peptide) and a peptide that presents antigens from MHC-2 molecules (i.e., MHC-2-binding peptide), more preferably an MHC-1-binding peptide, and even more preferably a peptide that presents antigens from HLA-A molecules (i.e., HLA-A-binding peptide) or a peptide that presents antigens from HLA-B molecules (i.e., HLA-B-binding peptide).
[0208] MHC-binding peptides can be proteins that cause allergic reactions such as food allergies, pathogens such as bacteria and viruses, or proteins originating from tumor cells. Examples of MHC-binding peptides include, but are not limited to, peptides listed in the public database SYFPEITHI (see http: / / www.syfpeithi.de / 0-Home.htm; Immunogenetics (1999) 50:213-219) and peptides listed in the tables of Immunogenetics (1995) 41:178-228.
[0209] Specific examples of MHC-1 binding peptides include OVA peptide 1 (the peptide consisting of amino acid sequences from positions 258 to 265 of ovalbumin (OVA; GenBank accession number: CAA23716.1), SIINFEKL (accession number 41)), TRP2-9 (the peptide consisting of amino acid sequences from positions 180 to 188 of mTRP2 (GenBank accession number: CAA44951.1), and hGP100-9 (the peptide consisting of amino acid sequences from positions 25 to 33 of hGP100 (GenBank accession number: AAC60634.1)).
[0210] Specific examples of MHC-2 binding peptides include OVA peptide 2 (a peptide composed of amino acid sequences from position 324 to 340 of OVA, ISQAVHAAHAEINEAGR (sequence number 42)), etc.
[0211] In MHC molecules, there are sites called pockets within the peptide-binding groove that directly interact with the MHC-binding peptide. Specific residues in the MHC-binding peptide that interact with this pocket are called anchor residues or anchor amino acids, and their positions vary depending on the type of MHC molecule being bound. The anchor residue positions and universal motifs for each type of MHC molecule can be identified, for example, using the public database MHC Motif Viewer (see http: / / www.cbs.dtu.dk / biotools / MHCMotifViewer / Home.html; Immunogenetics (2008) 60:759-765). For example, in the case of human MHC-1, i.e., HLA-A and HLA-B, the amino acids at positions 2 and 9 from the N-terminus are known to be anchor residues.
[0212] In addition to naturally occurring peptides (wild-type peptides) as described above, MHC-binding peptides also include, for example, non-naturally occurring peptides containing non-natural amino acids. Examples of such peptides include, for instance, modified peptides (called heteroclitic peptides) whose anchor sites are replaced with other amino acids (including non-natural amino acids) to enhance their binding to MHC molecules (see Front. Immunol. 6:377 (2015) and J Immunol. 174(8):4812-4820 (2005)).
[0213] The amino acid length of the MHC-binding peptide is not particularly limited and can vary depending on the type of MHC molecule; for example, it can be 5 or more and 30 or less. The length of the peptide binding to the MHC-1 molecule is relatively fixed, typically 8 to 11 amino acids long. Therefore, in this invention, when the MHC-binding peptide is an MHC-1 binding peptide, its amino acid length is preferably 8 or more and 11 or less, more preferably 8, 9, or 10, and even more preferably 9 or 10.
[0214] The inventors have discovered that adding amino acids such as cysteine to the N-terminus of an MHC-binding peptide for conjugation sometimes prevents it from binding to MHC molecules (Example 3). Endoplasmic reticulum aminopeptidase (ERAP) is known to participate in the presentation of antigenic peptides from MHC-1 molecules. The antigenic peptide precursor is typically pruned by ERAP from the N-terminus to a length suitable for MHC-1 binding. However, peptides generated from polynucleotide-peptide conjugates are considered unsuitable for such pruning and may not form the original peptide structure that binds to the peptide-binding groove of the MHC molecule. In contrast, peptides that retain anchor residues and have one or more consecutive amino acids at the N-terminus of the MHC-binding peptide replaced with amino acids having reactive functional groups for forming covalent bonds with the aforementioned spacer groups are able to bind to MHC-1 molecules. Furthermore, polynucleotide-peptide conjugates prepared using these peptides exhibit sufficient CTL induction ability.
[0215] The number of amino acids at the N-terminus of the MHC-binding peptide that are substituted with amino acids having reactive functional groups is not particularly limited, as long as the anchor residue for binding MHC is not included, and can be appropriately set according to the type of MHC molecule. For example, in the case of MHC-1 molecules, the number of substituted amino acids can be 4 or less (4, 3, 2 or 1), preferably 1. In one embodiment, when the MHC-binding peptide is an HLA-A-binding peptide or an HLA-B-binding peptide, the anchor residue is located at the second position from the N-terminus, so the number of substituted amino acids can be 1.
[0216] "Amino acids having reactive functional groups for forming covalent bonds with the aforementioned spacer groups" refers to amino acids having reactive functional groups capable of forming covalent bonds such as ester bonds, amide bonds, and phosphate ester bonds with the spacer groups, and can be any of natural and non-natural amino acids. The covalent bonds of the spacer groups are preferably covalent bonds that can be broken in the biological environment. Examples of such covalent bonds include disulfide bonds, which can be broken in a reducing environment within cells. Furthermore, examples include ester bonds, amide bonds (e.g., amide bonds with cathepsin-sensitive peptides), and phosphodiester bonds, which can be specifically broken by intracellular enzymes such as esterases, peptidases (e.g., cathepsins), and nucleases. A more preferred embodiment may be a disulfide bond with a thiol group as the reactive functional group. In this case, "amino acids having reactive functional groups for forming covalent bonds with the aforementioned spacer groups" can be cysteine or cysteine analogs with thiol groups. Cysteine analogs with thiol groups refer to amino acids with thiol side chains, and the structure of the side chains is not particularly limited. Examples of cysteine analogs with thiol groups include homocysteine (CAS No: 6027-13-0), penicillamine (β,β-dimethylcysteine; CAS No: 1113-41-3), β-methylcysteine (CAS No: 29768-80-7), and 4-mercapto-valine (CAS No: 2351397-00-5).
[0217] The peptides in the immune inducer of the present invention can be prepared using any known method such as peptide synthesis.
[0218] The "spacer group" in the immune inducer of the present invention can be any structure capable of covalently bonding with a single-chain polynucleotide or polynucleotide derivative containing a CpG motif, or a peptide, such as alkylene groups, polyethylene glycol (PEG), etc. The spacer group may contain repeating units containing a phosphodiester structure or a thiophosphate structure as shown in the following formula.
[0219]
[0220] In the above formula, X represents an oxygen atom or a sulfur atom (here, each X can be chosen to be the same or different), and R represents (CH2). p O, (CH2) q NH, (CH2CH2O) m In the set of numbers, any of the elements (m, p, and q independently represent natural numbers less than 10), and n represents a natural number less than 10.
[0221] These repeating units are not hydrolyzed by nucleases, so even if X is an oxygen atom, its stability in organisms is not significantly reduced. For example, when R is (CH2)3O, the size of the repeating unit is almost equal to the size of a ribonucleotide or deoxyribonucleotide, so a reduction in production costs can be expected by replacing a portion of a polynucleotide or polynucleotide derivative with this spacer group. Specific examples of spacers are given below.
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230] As a more preferred example of a spacer base, spacer bases having any of the following structures can be listed.
[0231]
[0232] In another approach, as a more preferred example of a spacer base, a spacer base having any of the following structures can be listed.
[0233]
[0234] Examples of combinations of reactive functional groups used when the spacer group forms bonds with polynucleotides or polynucleotide derivatives, and when the spacer group forms bonds with peptides, include combinations of reactive functional groups that form ester bonds, amide bonds, phosphate ester bonds, etc., as well as combinations of reactive functional groups used to immobilize biomolecules on the surface of a biochip. More specifically, the combinations shown below can be listed.
[0235] (a) Alkynes and azides
[0236] Alkynes and azides (azides) form 1,2,3-triazole rings via an addition cyclization reaction (Huisgen reaction) as shown below. Both are stable functional groups that can be introduced into many organic compounds, including biomolecules. They react rapidly and almost quantitatively in aqueous solvents, with almost no side reactions and no excess waste. Therefore, they are widely used in biochemistry as the core reaction of so-called "click chemistry." Alkyne derivatives and azides can be introduced into antigenic peptides, polynucleotides, or polynucleotide derivatives using any known method. As alkyne derivatives, alkyne derivatives with reactive functional groups such as propynyl alcohol and propynylamine can be readily obtained. These can be introduced into alkyne derivatives through the formation of amide, ester, or urethane bonds by reacting them directly with reactive functional groups such as carboxyl or hydroxyl groups, or by reacting them with carbonyl diimidazoles. Similarly, azides can also be introduced into antigenic peptides, polynucleotides, or polynucleotide derivatives using any known method. It should be noted that the Huisgen reaction proceeds in the presence of a copper catalyst. However, in antigenic peptides and polynucleotide derivatives where sulfur-containing functional groups such as thiophosphate bonds have replaced phosphodiester bonds, there is a concern that the catalytic activity of copper may be reduced due to the presence of sulfur atoms coordinated with copper ions. To improve the reaction rate, it is preferable to add an excess of copper.
[0237]
[0238] (b) Maleimide or vinyl sulfone with thiol group
[0239] As shown below, maleimides or vinyl sulfones having a double bond adjacent to an electron-withdrawing carbonyl or sulfone group can generate stable thioether derivatives at near-neutral pH via an addition reaction (Michael addition) with a thiol group. Maleimide and vinyl sulfone derivatives with suitable spacer groups are commercially available, making it easy to incorporate these functional groups into antigenic peptides, polynucleotides, or polynucleotide derivatives. When incorporating a thiol group into an antigenic peptide, in the case of an antigenic peptide containing cysteine, the thiol group on the side chain of the cysteine residue can be utilized. Since cysteine is a relatively rare amino acid, peptides with cysteine incorporated into the N-terminal side of the antigenic peptide are used. As polynucleotides or polynucleotide derivatives containing thiol groups, thiolated polynucleotides that convert the 5'-terminal hydroxyl groups of these polynucleotides into thiol groups can be used.
[0240]
[0241] (c) Thiol groups of peptides and thiol groups of thiolated polynucleotides
[0242] As described above, the thiol group introduced into the N-terminus of the peptide reacts with the thiol group of the thiolized polynucleotide to form a disulfide group. Disulfide bonds break in the presence of a reducing agent, and therefore are less stable than the two methods mentioned above, but have the advantage of breaking in the reducing environment of the organism. The introduction of the thiol group into the polynucleotide or polynucleotide derivative can be carried out using any known method. As a specific example, the reaction of the amino-modified polynucleotide or polynucleotide derivative with the N-succinimide ester of ω-(2-pyridyldithio) fatty acid can be cited.
[0243]
[0244] One or both of the covalent bonds between the spacer group and the polynucleotide or polynucleotide derivative, and the covalent bonds between the spacer group and the peptide, are covalent bonds that can be broken in a biological environment. Preferably, at least the covalent bond between the spacer group and the peptide is a covalent bond that can be broken in a biological environment. Therefore, in (a) to (c) above, a disulfide bond based on a combination of the thiol group of the peptide and the thiol group of the thiolized polynucleotide, which is easily broken in vivo, is preferred. In this case, the disulfide bond is a covalent bond between the spacer group and the peptide.
[0245] Specific examples of polynucleotide-peptide conjugates in the immune inducers of the present invention include CpG30(S)a-mTRP2pep9 (compound 1), CpG20(S)a-mTRP2pep9 (compound 2), and CpG30(S)a-hGP100pep9 (compound 3) described in Example 1 below, as well as the compounds described below. It should be noted that the portion represented by the base sequence in the following formulas indicates a DNA derivative in which the phosphodiester bond is replaced by a thiophosphate bond.
[0246]
[0247] In addition, specific examples of the polynucleotide-peptide conjugates in the immune inducers of the present invention include ISS1018-mTRP2pep9, ODN2006-mTRP2pep9 and ODN1826-mTRP2pep9 described in Example 5, CpG30(S)a2-OVApep8 and CpG30(S)a2-mTRP2pep9 described in Example 6, and CpG30(S)a2-OVA2-15 described in Example 9.
[0248] In one embodiment, one polynucleotide or polynucleotide derivative contained in the immune inducer of the present invention may be bonded to two or more peptides. That is, the immune inducer of the present invention may contain one polynucleotide or polynucleotide derivative and two or more peptides.
[0249] A polynucleotide or polynucleotide derivative can be bonded to two or more peptides via spacer groups. For example, a polynucleotide or polynucleotide derivative can be bonded to two or more peptides separately using different spacer groups. A polynucleotide or polynucleotide derivative can be bonded to two or more peptides via a branched spacer group. A single polynucleotide or polynucleotide derivative can be bonded to three or more peptides through a combination of these bonding methods. The position of the polynucleotide or polynucleotide derivative portion bonded to the spacer group is not particularly limited; for example, it can be selected from the 5' end and the 3' end.
[0250] Two or more peptides can be the same peptide or different peptides, preferably all the same. There is no particular limitation on the number of peptides bonded to a single polynucleotide or polynucleotide derivative, and it can be, for example, two, three, four, five or more.
[0251] In one embodiment, the immune inducer of the present invention may form a double strand at its polynucleotide or polynucleotide derivative portion with a polynucleotide or polynucleotide derivative having a complementary base sequence having the base sequence contained in that portion (hereinafter also referred to as a complementary chain polynucleotide or polynucleotide derivative).
[0252] The complementary polynucleotide or polynucleotide derivative can be synthesized by the same method as the polynucleotide or polynucleotide derivative portion of the immune inducer of the present invention. The complementary polynucleotide or polynucleotide derivative can be modified to improve properties such as stability, toxicity, and pharmacokinetics in vivo. Examples of such modifications include lipid modification (see WO2017 / 057540). Compounds with lipid modifications at one or both ends of the 5' or 3' terminus can be synthesized by the method described in Example 8.
[0253] The polynucleotide or polynucleotide derivative portion of the immune inducer of the present invention can be annealed using conventional methods to form a double strand with the complementary polynucleotide or polynucleotide derivative. For example, a polynucleotide-peptide conjugate and a complementary polynucleotide or polynucleotide derivative can be mixed, heated to form a single strand, and then naturally cooled to room temperature to form a double strand.
[0254] Pharmaceutically acceptable salts of polynucleotide-peptide conjugates used as the active ingredient in the immune inducer of the present invention include, for example, alkali metal (potassium, sodium, lithium, etc.) salts, alkaline earth metal (calcium, magnesium, etc.) salts, ammonium salts (including tetramethylammonium salt, tetrabutylammonium salt, etc.), organic amine (triethylamine, methylamine, dimethylamine, cyclopentylamine, benzylamine, phenethylamine, piperidine, monoethanolamine, diethanolamine, tri(hydroxymethyl)methylamine, lysine, arginine, N-methyl-D-glucosamine, etc.) salts, and acid addition salts (including inorganic acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate, phosphate, nitrate, etc.; and organic acid salts such as acetate, trifluoroacetate, lactate, tartrate, oxalate, fumarate, maleate, benzoate, citrate, mesylate, ethanesulfonate, benzenesulfonate, toluenesulfonate, hydroxyethanesulfonate, glucuronide, gluconate, etc.).
[0255] The polynucleotide-peptide conjugate or its pharmaceutically acceptable salt, which is the active ingredient of the immune inducer used in this invention, may exist in the form of a solvate (including a hydrate). There are no particular limitations on the solvate, as long as it is pharmaceutically acceptable; examples include hydrates, ethanolates, etc.
[0256] The immune inducer of the present invention may contain a substance with immune-activating activity as an adjuvant. The adjuvant is not limited and is a substance that activates innate immunity. The adjuvant is preferably an agonist of innate immune receptors. Examples of innate immune receptor agonists include TLR agonists (e.g., TLR2 agonists, TLR3 agonists, TLR4 agonists, TLR7 agonists, TLR8 agonists, TLR9 agonists), retinoic acid-inducible gene I (RIG-1)-like receptors agonists, interferon gene stimulator (STING) agonists, nucleotide-binding oligomerization domain (NOD)-like receptors agonists, and C-typelectin receptor (CLR) agonists. Examples of TLR agonists include lipopeptides, polyIC RNA, imiquimod, ralsimod, monophospholipid A (MPL), and CpG-ODN. Examples of RLR agonists include pppRNA and polyIC RNA; examples of STING agonists include cGAMP, c-di-AMP, and c-di-GMP; examples of NLR agonists include iE-DAP, FK565, MDP, and moradine; and examples of CLR agonists include β-glucan and trehalose dimethicone. The adjuvant is preferably a TLR agonist, more preferably a TLR4 agonist, TLR7 agonist, or TLR9 agonist, and even more preferably imiquimod, ralsimod, MPL, or CpG-ODN. In one embodiment, the adjuvant is imiquimod, MPL, or CpG-ODN. As an adjuvant, it can be appropriately selected according to the peptide introduced in the polynucleotide-peptide conjugate, such as CpG DNA, or the polynucleotide / β-1,3-glucan complex described in International Publication No. 2015 / 118789.
[0257] The immune inducer of the present invention can be manufactured by the following method, which includes the following steps:
[0258] (1) Prepare single-stranded polynucleotides or polynucleotide derivatives containing CpG motifs;
[0259] (2) A peptide in which one or more consecutive amino acids at the N-terminus of an MHC-binding peptide are replaced with amino acids having reactive functional groups for forming covalent bonds with the aforementioned spacer groups, wherein the aforementioned one or more consecutive amino acids do not include anchor residues; and
[0260] (3) The polynucleotide or polynucleotide derivative of (1) is linked to the peptide of (2) by means of a spacer, wherein the spacer is covalently bonded to the polynucleotide or polynucleotide derivative at one end and to the peptide at the other end.
[0261] Therefore, in one embodiment, the present invention provides a method for manufacturing the immune inducer of the present invention, including the steps (1) to (3) described above. The terms used in this embodiment are explained based on the terminology described in this specification. Using this method, a wide range of antigenic peptides can be used to manufacture immune inducers capable of inducing CTL activity.
[0262] Furthermore, the present invention provides polynucleotide-peptide conjugates or pharmaceutically acceptable salts thereof. The terms used in this specification are to be interpreted based on the terminology described herein. These polynucleotide-peptide conjugates or pharmaceutically acceptable salts thereof can be used as the active ingredient in the immune inducers of the present invention.
[0263] Furthermore, the polynucleotide-peptide conjugate or its pharmaceutically acceptable salt can be manufactured by steps (1) to (3) of the method for manufacturing the immune inducer of the present invention described above. Therefore, in one embodiment, the present invention provides a method for manufacturing a polynucleotide-peptide conjugate or its pharmaceutically acceptable salt, including steps (1) to (3) described above. The terms used in this embodiment are explained based on the terminology described in this specification. Using this method, a wide range of antigenic peptides can be used to manufacture polynucleotide-peptide conjugates or their pharmaceutically acceptable salts, which can serve as effective components of immune inducers capable of inducing CTL activity.
[0264] The present invention further provides pharmaceutical compositions comprising the immune inducer of the present invention (hereinafter also referred to as pharmaceutical compositions of the present invention). In the manufacture of the pharmaceutical compositions of the present invention, any known ingredients (any carrier, excipient, and additive acceptable for pharmaceutical use) and formulation methods may be used, except for the polynucleotide-peptide conjugate or its pharmaceutically acceptable salt as the active ingredient. Substances used in pharmaceutical preparations may include, but are not limited to, the following: amino acids such as glycine, alanine, glutamine, asparagine, arginine, or lysine; antioxidants such as ascorbic acid, sodium sulfate, or sodium bisulfite; buffers such as phosphoric acid, citric acid, borate buffers, sodium bicarbonate, and Tris-hydrochloric acid (Tris-HCl) solution; fillers such as mannitol and glycine; chelating agents such as ethylenediaminetetraacetic acid (EDTA); complexing agents such as caffeine, polyvinylpyrrolidone, β-cyclodextrin, and hydroxypropyl-β-cyclodextrin; expanders such as glucose, mannose, or dextrin; other carbohydrates such as monosaccharides and disaccharides; colorants; flavorings; diluents; emulsifiers; and polyvinylpyrrolidone. Hydrophilic polymers such as ketones, low molecular weight peptides, salt-forming counterions, benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide and other preservatives, glycerin, propylene glycol or polyethylene glycol and other solvents, mannitol or sorbitol and other sugar alcohols, suspending agents, dehydrated sorbitol esters, polysorbate ester 20, polysorbate ester 80 and other polysorbate esters, triton, tromethamine, lecithin or cholesterol and other surfactants, sucrose, sorbitol and other stabilizing and reinforcing agents, sodium chloride, potassium chloride, mannitol, sorbitol and other elasticity-enhancing agents, delivery agents, excipients and / or pharmaceutical adjuvants. Those skilled in the art can appropriately determine the composition of a suitable pharmaceutical composition based on the applicable disease, route of administration, etc.
[0265] The pharmaceutical compositions of the present invention can be provided in dosage forms suitable for oral or non-oral administration. For example, injections, suppositories, etc., can be used. Injections can include intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections, etc. Such injections can be prepared according to known methods. As a method of preparing the injection, for example, it can be prepared by dissolving or suspending the immune inducer of the present invention described above in a sterile aqueous solvent commonly used in injections. Examples of aqueous solvents for injection include distilled water, physiological saline, phosphate buffer, carbonate buffer, Tris buffer, acetate buffer, etc. The pH of such aqueous solvents can be 5 to 10, preferably 6 to 8. The prepared injection solution is preferably filled into suitable ampoules. The injection can also be prepared as a freeze-dried formulation. In addition to injections, dosage forms that can be used include those for transdermal and mucosal absorption (liquid sprays, ointments, gels, lotions, patches), dosage forms for subcutaneous local sustained release (including suspensions of nanogels, biodegradable micro / nanocapsules, etc., and temperature-responsive gels), preparations for skin penetration via transdermal devices (iontophoresis, microneedles), powders, tablets, capsules, syrups, aerosols, dry powders, and other inhalation forms.
[0266] The pharmaceutical compositions of the present invention can be administered to humans or warm-blooded animals (mice, rats, rabbits, sheep, pigs, cattle, horses, chickens, cats, dogs, monkeys, etc.) via any of the oral or non-oral routes. Examples of non-oral routes of administration include subcutaneous, intradermal, and intramuscular injection, intraperitoneal administration, intravenous drip, intravenous administration, administration to the oral mucosa, and spraying to the nasal mucosa or pharynx.
[0267] The dosage of the polynucleotide-peptide conjugate, the active ingredient in the pharmaceutical composition of the present invention, varies depending on the activity, the disease to be treated, the species, weight, sex, age, type of disease, and method of administration of the animal to be administered. For example, in the case of oral administration to a 60 kg adult, the daily dosage is typically about 0.1 to about 100 mg, preferably about 1.0 to about 50 mg, and more preferably about 1.0 to about 20 mg. In the case of non-oral administration, the daily dosage is typically about 0.01 to about 30 mg, preferably about 0.1 to about 20 mg, and more preferably about 0.1 to about 10 mg. When administering the drug to other animals, the above dosage is converted to a dosage per unit body weight, multiplied by the weight of the animal to be administered, and the resulting dosage is used.
[0268] Furthermore, the frequency of administering the pharmaceutical composition of the present invention to the subject can be easily determined by those skilled in the art by considering the species, weight, sex, age, type of disease, and method of administration of the animal to be administered. For example, when administering the composition of the present invention in the form of a vaccine, it can be administered once or several times a day for one day, or multiple times at intervals of one to several weeks, similar to conventional vaccine formulations. It is preferable to administer the medication while observing the progress of the disease; for example, booster immunizations can be performed at intervals of at least about one week. By performing booster immunizations, enhanced effects are expected, resulting in higher levels of infection defense and other benefits.
[0269] By administering the pharmaceutical composition of the present invention to patients with pathogen-borne diseases, cancer patients, or individuals who may have cancer / pathogen-borne diseases, the cytotoxic T cells (CTLs) and helper T cells in the recipient are specifically activated by the antigen, inducing a defensive immune response in warm-blooded animals (preferably humans), thereby enabling the prevention / treatment of the infection or cancer. Furthermore, by administering the pharmaceutical composition of the present invention to patients with allergic diseases, it becomes an antigen-specific immunotherapy that suppresses an excessive immune response against the cause of the disease, i.e., the allergen. That is, the pharmaceutical composition of the present invention is useful as a vaccine for the prevention or treatment of the aforementioned infections, cancers, allergic diseases, etc. In this invention, the terms "tumor" and "cancer" are used interchangeably. Additionally, in this invention, tumors, malignant tumors, cancer, malignant neoplasms, carcinomas, sarcomas, etc., are sometimes collectively referred to as "tumor" or "cancer." Furthermore, the terms "tumor" and "cancer" also include conditions such as myelodysplastic syndromes, which are classified as precancerous stages depending on the circumstances.
[0270] The types of tumors that can be treated or prevented are not particularly limited as long as they are confirmed to be sensitive to the pharmaceutical compositions of the present invention. Examples include breast cancer, colon cancer, prostate cancer, lung cancer (including small cell lung cancer, non-small cell lung cancer, etc.), stomach cancer, ovarian cancer, cervical cancer, endometrial cancer, uterine cancer, kidney cancer, hepatocellular carcinoma, thyroid cancer, esophageal cancer, osteosarcoma, skin cancer (including melanoma, etc.), glioblastoma, neuroblastoma, ovarian cancer, head and neck cancer, testicular cancer, colorectal cancer, hematologic cancers (including leukemia, malignant lymphoma, multiple osteomas, etc.), retinoblastoma, pancreatic cancer, etc.
[0271] The pharmaceutical compositions of the present invention can be used in combination with other antitumor agents. Examples include antitumor antibiotics, antitumor plant components, biological response modifiers (BRMs), hormones, vitamins, antitumor antibodies, molecularly targeted drugs, alkylating agents, metabolic antagonists, and other antitumor agents.
[0272] More specifically, examples of antitumor antibiotics include mitomycin C, bleomycin, pyrethromycin, daunorubicin, aclarubicin, doxorubicin, idarubicin, pirarubicin, THP-doxorubicin, 4'-epirarubicin or epirubicin, chromomycin A3 or actinomycin D, etc.
[0273] Examples of antitumor plant components and their derivatives include, for example, vinca alkaloids such as vincristine, vinblastine, or vinca alkaloids; taxanes such as paclitaxel, docetaxel, and carbazide; or podophyllotoxins such as etoposide or teniposide.
[0274] Examples of BRMs include tumor necrosis factor or indomethacin.
[0275] Examples of hormones include hydrocortisone, dexamethasone, methylprednisolone, dehydrocortisone, prastorone, betamethasone, triamcinolone, oxymetholone, nandrolone, metenolone, phosestrol, ethinylestradiol, chlormadinone, metronidazole, or medroxyprogesterone.
[0276] Examples of vitamins include vitamin C and vitamin A.
[0277] Examples of antitumor antibodies and molecularly targeted drugs include trastuzumab, rituximab, cetuximab, panitumumab, nimotuzumab, denosumab, bevacizumab, infliximab, ipilimumab, nivolumab, pembrolizumab, acitumab, pildizumab, atezolizumab, ramucirumab, imatinib mesylate, dasatinib, sunitinib, lapatinib, dabrafenib, trametinib, cobitinib, pazopanib, palbociclib, palbistat, sorafenib, crizotinib, vemurafenib, quezatinib, bortezomib, carfilzomib, ixazomib, midotulin, and giglitinib.
[0278] Examples of alkylating agents include nitrogen mustard, nitrogen mustard N-oxide, bendamustine or chlorambucil, aziridine alkylating agents such as carbaquinone or thiotepa, epoxide alkylating agents such as dibromomannitol or dibromoeusine, nitrosourea alkylating agents such as carmustine, lomustine, semustine, nimustine hydrochloride, streptozocin, chloramphenicol or ramustine, busulfan, indomethacin toluenesulfonate, temozolomide or dacarbazine, etc.
[0279] Examples of metabolic antagonists include purine metabolism antagonists such as 6-mercaptopurine, 6-thioguanine, or thioinosine; fluorouracil, tegafur, tegafur / uracil, carmoflu, deoxyfluorouridine, bromouridine, cytarabine, or enoxabin; and folic acid metabolism antagonists such as methotrexate or trimethoprim.
[0280] Other antitumor agents include, for example, cisplatin, carboplatin, oxaliplatin, tamoxifen, letrozole, anastrozole, exemestane, toremifene citrate, fulvestrant, bicamid, flutamid, mitotane, leuprorelin, goserelin acetate, camptothecin, ifosfamide, cyclophosphamide, melphalan, L-asparaginase, glucuronolactone, Schizophyllum commune polysaccharide, sapelin, procarbazine, piperobromane, neocarcinomacin, hydroxyurea, ubenimex, thalidomide, lenalidomide, pomalidomide, eribulin, retinoic acid, or trachomatis intracellular polysaccharide.
[0281] Examples of infectious diseases that can be treated or prevented include those caused by pathogens such as viruses, fungi, and bacteria. Examples of viruses include influenza virus, hepatitis virus, human immunodeficiency virus (HIV), RS virus, rubella virus, measles virus, mumps virus, herpes virus, poliovirus, rotavirus, Japanese encephalitis virus, varicella virus, adenovirus, rabies virus, and yellow fever virus. Examples of bacteria include Corynebacterium diphtheriae, Clostridium tetani, Bordetella pertussis, Haemophilus influenzae, Mycobacterium tuberculosis, Streptococcus pneumoniae, Helicobacter pylori, Bacillus anthracis, Salmonella typhi, Neisseria meningitidis, Shigella, and Vibrio cholerae. Examples of fungi include Candida albicans, Histoplasma capsulatum, Cryptococcus, and Aspergillus. The pharmaceutical composition of the present invention can also be used in combination with existing treatments for these infectious diseases.
[0282] Allergic diseases that can be treated or prevented include bronchial asthma, allergic rhinitis, atopic dermatitis, urticaria, food allergies, animal allergies, and anaphylactic shock.
[0283] When the pharmaceutical composition of the present invention is administered in combination with adjuvants or other drugs, it means that the subject takes in both drugs within a certain period of time. A single formulation containing both drugs can be administered, or they can be formulated separately and administered separately. When formulated separately, the timing of administration is not particularly limited; they can be administered simultaneously, at different times, or on different days. When administered separately at different times or on different days, the order of administration is not particularly limited. Typically, each formulation is administered according to its own method of administration, so they can be administered the same or different times. Furthermore, when formulated separately, the methods of administration (routes of administration) for each formulation can be the same or different. Additionally, the two drugs do not need to be present in the body simultaneously; they only need to be taken in within a certain period (e.g., one month, preferably one week, more preferably several days, and even more preferably one day). During any administration, the other active ingredient may have already disappeared from the body.
[0284] In another aspect, the present invention provides a method for treating or preventing a disease, comprising the step of administering a therapeutically or preventively effective amount of the pharmaceutical composition of the present invention to a subject in need of it. Examples of diseases include pathogenic infections, tumors, and allergic diseases, with tumors being preferred.
[0285] In this invention, "effective amount for treatment or prevention" refers to the amount that has a therapeutic or preventive effect on a specific disease or symptom, administration method and route of administration, which can be appropriately determined based on the species of the subject, the type of disease or symptom, symptoms, gender, age, medical history, and other factors.
[0286] This application also provides the following inventions.
[0287] [B1] An immune inducer comprising a polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof as the active ingredient.
[0288] The aforementioned polynucleotide-peptide conjugate is composed of a single-stranded polynucleotide or polynucleotide derivative containing a CpG motif, a peptide, and a spacer group, wherein the spacer group is covalently bonded to the aforementioned polynucleotide or polynucleotide derivative at one end and covalently bonded to the aforementioned peptide at the other end.
[0289] The aforementioned peptide is a peptide in which one or more consecutive amino acids have been removed from the N-terminus and / or C-terminus of the MHC-2 binding peptide, and an amino acid having a reactive functional group for forming a covalent bond with the aforementioned spacer group has been added. Here, the aforementioned one or more consecutive amino acids do not include anchor residues for binding MHC-2.
[0290] [B2] According to the immune inducer described in [B1], one or both of the covalent bonds between the spacer group and the polynucleotide or polynucleotide derivative and the covalent bonds between the spacer group and the peptide are covalent bonds that can be broken in the biological environment.
[0291] [B3] According to the immune inducer described in [B1] or [B2], wherein the amino acid having a reactive functional group for forming a covalent bond with the aforementioned spacer group is cysteine or a cysteine analog having a thiol group.
[0292] [B4] The immune inducer according to any one of [B1] to [B3], wherein the covalent bond between the spacer group and the peptide is a disulfide bond.
[0293] [B5] An immune inducer according to any one of [B1] to [B4], wherein the polynucleotide or polynucleotide derivative is a polydeoxyribonucleotide (DNA) or DNA derivative containing two or more CpG motifs.
[0294] [B6] An immune inducer according to any one of [B1] to [B5], wherein the base length of the polynucleotide or polynucleotide derivative is 15 or more and 40 or less.
[0295] [B7] The immune inducer according to [B6], wherein the base length of the above-mentioned polynucleotide or polynucleotide derivative is 20 or more and 30 or less.
[0296] [B8] An immune inducer according to any one of [B1] to [B7], wherein the polynucleotide or polynucleotide derivative is a polynucleotide derivative in which at least a portion of the phosphodiester bond is replaced by a thiophosphate bond.
[0297] [B9] According to the immune inducer described in [B8], in the polynucleotide derivative in which at least a portion of the phosphodiester bonds are replaced with thiophosphate bonds, more than 50% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0298] [B10] According to the immune inducer described in [B9], in the polynucleotide derivative in which at least a portion of the phosphodiester bonds are replaced with thiophosphate bonds, more than 90% of the phosphodiester bonds are replaced by thiophosphate bonds.
[0299] [B11] An immune inducer according to any one of [B1] to [B10], wherein the spacer comprises a repeating unit as shown in the following formula.
[0300]
[0301] In the above formula,
[0302] X represents an oxygen atom or a sulfur atom (here, each X can be chosen to be the same or different).
[0303] R represents (CH2) p O, (CH2) q NH and (CH2CH2O) m Any of the following (m, p, and q independently represent natural numbers less than 10).
[0304] n represents a natural number less than 10.
[0305] [B12] An immune inducer according to any one of [B1] to [B11], wherein the spacer group has a structure shown in any of the following formulas.
[0306]
[0307] [B13] An immune inducer according to any one of [B1] to [B10], wherein the spacer group has a structure shown in any of the following formulas.
[0308]
[0309] [B14] The immune inducer according to any one of [B1] to [B13] further comprises a substance having immune-activating activity as an adjuvant.
[0310] [B15] A pharmaceutical composition comprising any one of the immune inducers described in [B1] to [B14].
[0311] [B16] The pharmaceutical composition according to [B15] is used for the treatment or prevention of infectious diseases, tumors or allergic diseases.
[0312] [B17] A method of treating or preventing an infectious disease, tumor, or allergic disease, comprising the step of administering to a patient the immune inducer described in any one of [B1] to [B14].
[0313] [B18] An immune inducer according to any one of [B1] to [B14], used for the treatment or prevention of infectious diseases, tumors or allergic diseases.
[0314] The use of any one of the immune inducers in [B19][B1] to [B14] in the preparation of pharmaceutical compositions for the treatment or prevention of infectious diseases, tumors or allergic diseases.
[0315] In the following description, the invention described in [B1] to [B19] above is referred to as Invention B. All terms in Invention B shall be interpreted based on the terminology described in this specification, provided they do not contradict the invention using MHC-2 binding peptides.
[0316] In invention B, the peptide contained in the polynucleotide-peptide conjugate is a peptide in which one or more consecutive amino acids have been removed from the N-terminus and / or C-terminus of the MHC-2 binding peptide, and an amino acid having a reactive functional group for forming a covalent bond with the aforementioned spacer group has been added. The number of amino acids removed is not particularly limited as long as it does not contain an anchor residue for binding MHC-2, and can be appropriately set according to the length of the base MHC-2 binding peptide and the position of the anchor residue. The amino acid having a reactive functional group for forming a covalent bond with the aforementioned spacer group can be added to the N-terminus or C-terminus.
[0317] In this invention B, the amino acid length of the peptide contained in the polynucleotide-peptide conjugate is not particularly limited, for example, it can be 8 or more and 30 or less.
[0318] Specific examples of immune inducers of the present invention B include, for example, CpG30(S)a2-OVA2-15, as described in Example 9 below.
[0319] According to invention B, polynucleotide-peptide conjugates can be prepared using shorter peptides, thus providing pharmaceutical compositions with superior physical properties and / or economic efficiency.
[0320] Example
[0321] The following describes embodiments performed to confirm the effects of the present invention. It should be noted that in this embodiment, "CpG DNA(S)" refers to a DNA derivative (an example of a polynucleotide derivative) having a base sequence containing a CpG motif and in which phosphodiester bonds are replaced by thiophosphate bonds. In the embodiments, polynucleotide derivatives are represented by a single-letter base sequence with the left side being the 5' end (the right side being the 3' end), and peptides are represented by a single-letter representation with the left side being the N-terminus (the right side being the C-terminus). In the polynucleotide derivative represented by the single-letter base sequence, all phosphodiester bonds are replaced by thiophosphate bonds. Furthermore, when a spacer is attached, the terminal structure extends to the oxygen atom of the 5' or 3' hydroxyl group of the terminal nucleoside; when no spacer is attached, the terminal structure extends to the 5' or 3' hydroxyl group of the terminal nucleoside (up to the hydrogen atom). Additionally, the CpG DNA(S)-peptide conjugate in this embodiment is prepared by addition of a salt of triethylamine and acetic acid.
[0322] Example 1: Preparation of CpG DNA(S)-peptide conjugates
[0323] (1) Synthesis of CpG DNA(S) derivatives
[0324] The synthesis of CpG DNA(S) was performed using the phosphoramide method (e.g., Nucleic Acids Research, 12, 4539 (1984)). The synthesis of amino-modified CpG DNA(S) was performed using the ssH Amino Linker (Bioorg. Med. Chem., 16, 941-949 (2008)). These synthesis utilized a contract synthesis service (GeneDesign Inc.).
[0325] The base sequence of the synthesized CpG DNA(S) is shown below.
[0326] CpG30a: 5'-GAGCGTTCTCATCGACTCTCGAGCGTTCTC-3' (K3-30(a) in Table 1; Serial No. 6)
[0327] CpG20a: 5'-ATCGACTCTCGAGCGTTCTC-3' (K3 in Table 1; Serial No. 1)
[0328] The obtained amino-modified CpG DNA(S) has the structure shown below at the 5' end. Hereinafter, the CpG DNA(S) derivatives with the structure shown below at the 5' end, those with sequence number 6 are referred to as "CpG30(S)a", and those with sequence number 1 are referred to as "CpG20(S)a".
[0329]
[0330] Subsequently, amino-modified CpG DNA(S) was mixed with succinimide-6-[3'-(2-pyridyldithio)-propionamide]hexanoate (LC-SPDP) at a molar ratio of 1:30 in phosphate buffer (pH 8.0), and after standing at 40°C for 3 hours, SPDP-modified CpG DNA(S) was purified using a NAP-5 column.
[0331] It should be noted that the structure shown in the following formula will be referred to as the "ssH amino linker".
[0332]
[0333] (2) Synthesis of N-terminal modified peptides
[0334] The peptides were synthesized using a contract synthesis service (GeneDesign Inc.).
[0335] The amino acid sequence of the synthesized peptide is shown below.
[0336] C-OVA8: CSIINFEKL (Serial Number 30)
[0337] C-TRP2-9: CSVYDFFVWL (Serial Number 31)
[0338] C-TRP2-8: CVYDFFVWL (Serial Number 32)
[0339] C-gp100-9: CKVPRNQDWL (Serial Number 33)
[0340] C-gp100-8: CVPRNQDWL (Serial Number 34)
[0341] CM-TRP2-9: CMSVYDFFVWL (Serial Number 35)
[0342] C-TRP2-13: CFANASVYDFFVWL (Serial Number 36)
[0343] C-TRP2-11: CNASVYDFFVWL (Serial Number 37)
[0344] C-OVA8 is a peptide with a cysteine residue added to the N-terminus of a peptide consisting of amino acid sequences 258–265 of ovalbumin (OVA; GenBank accession number: CAA23716.1) (hereinafter also referred to as OVA peptide 1).
[0345] C-TRP2-9 is a peptide (hereinafter also referred to as TRP2-9) consisting of amino acid sequences from positions 180 to 188 of mTRP2 (mouse tyrosinase-associated protein 2; GenBank accession number: CAA44951.1), known as a melanoma-associated antigen, with a cysteine residue added to the N-terminus.
[0346] C-TRP2-8 is a peptide composed of a sequence in which a cysteine residue is added to the N-terminus of the amino acid sequence at positions 181-188 of mTRP2.
[0347] C-gp100-9 is a peptide (hereinafter also referred to as hGP100-9) consisting of amino acid sequences from positions 25 to 33 of hGP100 (human glycoprotein 100; GenBank accession number: AAC60634.1), a melanoma-associated antigen, with a cysteine residue added to the N-terminus.
[0348] C-gp100-8 is a peptide in which a cysteine residue is added to the N-terminus of the peptide consisting of amino acid sequences at positions 26-33 of hGP100.
[0349] CM-TRP2-9 is a peptide composed of amino acids from positions 180 to 188 of mTRP2, with cysteine and methionine added to the N-terminus.
[0350] C-TRP2-13 is a peptide in which a cysteine residue is added to the N-terminus of a peptide consisting of amino acid sequences from position 176 to 188 of mTRP2.
[0351] C-TRP2-11 is a peptide in which a cysteine residue is added to the N-terminus of a peptide consisting of amino acid sequences from position 178 to 188 of mTRP2.
[0352] (3) Synthesis of CpG DNA(S)-peptide conjugates
[0353] 1 mol of SPDP-modified CpG DNA(S) synthesized in (1) and 25 mol of peptide synthesized in (2) were mixed in a 30% N,N-dimethylformamide (DMF) aqueous solution and allowed to stand at 40°C for 3 hours. The CpG DNA(S)-peptide conjugates were then separated by HPLC using any of the conditions in (A) to (C) below. The HPLC conditions and retention times used for the separation of each conjugate are shown in Table 2.
[0354] <HPLC Conditions (A)>
[0355] Following the gradient conditions below, solution A was prepared with 0.1 M hexafluoroisopropanol and 8 mM triethylamine (TEA), and solution B was prepared with methanol. The chromatographic column used was an X-Bridge C18 2.5 μm 4.6 μm column. * HPLC was performed using a 75mm (Waters Corporation) column at a temperature of 60°C and a flow rate of 1 mL / min.
[0356] 0 minutes A: 95% B: 5%
[0357] ~20 minutes A: 70% B: 30%
[0358] <HPLC Conditions (B)>
[0359] Following the gradient conditions below, solution A was prepared with 0.1 M hexafluoroisopropanol and 8 mM triethylamine (TEA), and solution B was prepared with methanol. The chromatographic column used was an X-Bridge C18 2.5 μm 4.6 μm column. * HPLC was performed using a 75mm (Waters Corporation) column at a temperature of 60°C and a flow rate of 1 mL / min.
[0360] 0 minutes A: 95% B: 5%
[0361] ~25 minutes A: 60% B: 40%
[0362] <HPLC conditions (C)>
[0363] The following gradient conditions were used: solution A was set to 0.1M triethylammonium acetate (TEAA; pH 7.0), solution B was set to acetonitrile, and a ZORBAX Eclipse Plus C18 column (Agilent Technologies) was used for HPLC at a column temperature of 40°C and a flow rate of 1 mL / min.
[0364] 0 minutes A: 90% B: 10%
[0365] ~25 minutes A: 70% B: 30%
[0366] ~30 minutes A: 0% B: 100%
[0367] <HPLC Conditions (D)>
[0368] Following the gradient conditions below, solution A was prepared with 0.1 M hexafluoroisopropanol and 8 mM triethylamine (TEA), and solution B was prepared with methanol. The chromatographic column used was an X-Bridge C18 2.5 μm 4.6 μm column. *HPLC was performed using a 75mm (Waters Corporation) column at a temperature of 60°C and a flow rate of 1 mL / min.
[0369] 0 minutes A: 95% B: 5%
[0370] ~25 minutes A: 50% B: 50%
[0371] In the separation of the solution following the reaction of SPDP-modified CpG DNA(S) with the peptide using HPLC, detection was performed by measuring the absorbance at 260 nm. It was confirmed that the elution time of the separated CpG DNA(S)-peptide conjugate was later than that of the SPDP-modified CpG DNA(S). This is attributed to the slower elution time due to binding to the hydrophobic peptide. Furthermore, no peak of unreacted SPDP-modified CpG DNA(S) was found in the separated chromatogram; only the peak of the CpG DNA(S)-peptide conjugate was detected, thus confirming that the target CpG DNA(S)-peptide conjugate was obtained with high purity. This is one example of the HPLC analysis results. Figure 1 The chromatogram of CpG30(S)a-mTRP2pep9 (compound 1) under the above conditions (B) is shown.
[0372] The structure of the obtained CpG DNA(S)-peptide conjugate is shown below. In the formula, “CpG DNA” represents the base sequence portion of CpG30(S)a or CpG20(S)a, and “petide” represents the portion of the peptide synthesized in (2) above, excluding the N-terminal cysteine.
[0373]
[0374] The synthesized CpG DNA(S)-peptide conjugate is shown below.
[0375] [Table 2]
[0376]
[0377] in addition, Figure 2 The following is an example of the mass spectrometry analysis results for CpG30(S)a-mTRP2pep9 (compound 1), shown as a MALDI-TOF mass spectrometry result. Peaks at 11248.28 (monovalent anion) and 5622.53 (divalent anion) were detected, confirming the presence of peaks related to CpG30(S)a-mTRP2pep9 (theoretical most abundant mass for C). 369 H 480 N 116 O 174 P 30 S31 (11246.56) equivalent mass spectrometry.
[0378] Example 2: Evaluation of cytotoxic T cell induction using CpG DNA(S)-peptide conjugates (evaluation using mTRP2 antigen)
[0379] (1) Evaluation methods for cytotoxic T cell induction
[0380] The CpG DNA(S)-peptide conjugate, serving as the antigen, was administered intradermally to mice (C57BL / 6 mice (male, 7 weeks old)). The dosage of the CpG DNA(S)-peptide conjugate was 50, 200, or 1000 ng per mouse (equivalent to approximately 0.4, 1.7, or 8.5 μg of CpG30(S)). One week after administration, spleen cells were harvested from untreated individuals in the same strain and divided into 2.0 × 10⁻⁶ cells. 7 Two groups were prepared at 10 μg / mL of cells / ml. One group received 10 μg / mL of peptide as the antigen and was incubated for 90 minutes to prepare antigen-maintaining spleen cells. Spleen cells without peptide were designated as antigen-unmaintained spleen cells. Both groups were fluorescently modified with 5,6-carboxyfluorescein succinimide (CFSE). The fluorescence intensity of antigen-maintaining spleen cells (CFSE: 1 μM) was adjusted to be higher than that of antigen-unmaintained spleen cells (CFSE: 0.1 μM) by varying the CFSE concentration. Equal amounts of antigen-maintaining and antigen-unmaintained spleen cells were mixed. For mice administered the CpG DNA(S)-peptide conjugate as the antigen, a concentration of 3.0 × 10⁻⁶ cells / ml was applied one week after administration. 6 The number of cells was determined by tail vein administration.
[0381] Twenty-four hours after the above-mentioned tail vein administration, spleen cells were harvested from mice. The reduction in antigen-maintaining spleen cells was evaluated by quantifying the ratio of antigen-non-maintaining spleen cells using flow cytometry, thereby assessing the induced activity of antigen-specific cytotoxic T cells. For comparison, mice administered PBS (phosphate-buffered saline) instead of the CpG DNA(S)-peptide conjugate were used as a control group and measured under the same conditions.
[0382] (2) Evaluation of the cytotoxic T cell induction ability of CpG30(S)a-mTRP2pep10
[0383] In a prior application (PCT / JP2019 / 038090), experiments using antigenic peptides derived from OVA demonstrated that CpG DNA(S)-peptide conjugates exhibited high cytotoxic T cell (CTL) induction capacity. However, it has been found that when preparing the same CpG DNA(S)-peptide conjugates for other antigenic peptides, sometimes sufficient CTL induction capacity cannot be obtained. Figure 3 ).
[0384] Specifically, the CTL-inducing ability of CpG30(S)a-OVApep9 was evaluated using a peptide consisting of amino acid sequences from positions 258 to 265 of ovalbumin (OVA), known as an antigenic peptide (OVA peptide 1). The results showed that antigen-preserving splenocytes disappeared at a dose equivalent to 20 ng per mouse, confirming strong CTL activity. In contrast, the CTL-inducing ability of CpG30(S)a-mTRP2pep10 (a conjugate prepared using a peptide with a cysteine residue added to the N-terminus of TRP2-9) was evaluated using a peptide consisting of amino acid sequences from positions 180 to 188 (9 amino acids), known as a melanoma-associated antigen (TRP2-9). No CTL activity was observed at a dose equivalent to 200 ng per mouse.
[0385] (3) Evaluation of the cytotoxic T cell induction ability of CpG30(S)a-mTRP2pep9
[0386] To induce CTL activity, CpG DNA(S)-peptide conjugates require the peptide moiety to dissociate from the polynucleotide and spacer moiety and bind to MHC molecules after being taken up by antigen-presenting cells. Based on the above results, it can be concluded that the C-TRP2-9 (10 amino acids) used in the preparation of CpG30(S)a-mTRP2pep10 is formed by adding one amino acid to the N-terminus of the original antigenic peptide, and therefore may not be able to bind to MHC molecules or, even if it does, may not be recognized by T cell receptors.
[0387] Therefore, CpG DNA(S)-peptide conjugate CpG30(S)a-mTRP2pep9 was prepared by removing one residue (serine) from the N-terminus of TRP2-9, which consists of 9 amino acids, and adding cysteine (C-TRP2-8), to evaluate its ability to induce cytotoxic T cells. TRP2-9 was used as the antigen for preparing antigen-preserving spleen cells.
[0388] The results of flow cytometry measurements are shown in Figure 4In the case of CpG30(S)a-mTRP2pep9, a significant reduction in antigen-retaining splenocytes was observed at a dose equivalent to 200 ng per mouse, confirming the induction of high CTL activity. In contrast, no reduction in antigen-retaining splenocytes was observed in the case of CpG30(S)a-mTRP2pep10.
[0389] (4) Dosage dependence
[0390] The dosage of CpG30(S)a-mTRP2pep9 was set at 50, 200, or 1000 ng per animal (converted to peptides) to evaluate its ability to induce cytotoxic T cells. TRP2-9 was used as the antigen for preparing antigen-preserving spleen cells.
[0391] The results of flow cytometry measurements are shown in Figure 5 The CTL induction ability of CpG30(S)a-mTRP2pep9 did not show a dose-dependent effect. Strong CTL activity was induced at a dose of 200 ng.
[0392] (5) Base length dependence of CpG DNA
[0393] A CpGDNA(S)-peptide conjugate, CpG20(S)a-mTRP2pep9, was prepared by replacing the polynucleotide moiety of CpG30(S)a-mTRP2pep9 with a 20-base-long CpG20(S)a, and its ability to induce cytotoxic T cells was evaluated. TRP2-9 was used as the antigen for preparing antigen-preserving spleen cells.
[0394] The results of flow cytometry measurements are shown in Figure 6 The results show that CpG20(S)a-mTRP2pep9, like CpG30(S)a-mTRP2pep9, has a high CTL induction capacity.
[0395] Example 3: Evaluation of MHC-1 binding of the peptides used in the CpG-peptide conjugates of the present invention (competitive inhibition evaluation of MHC-1 binding with OVA peptide 1 in DC2.4 cells)
[0396] After separating mouse dendritic cell line DC2.4 cells from the culture dish, they were spliced at 1.5 × 10⁻⁶. 5One cell per 200 mL PBS was suspended in a 1.5 mL tube. OVA peptide 1 was added at a rate of 0.25 μg / mL, and a TRP2-derived peptide (TRP2-9, C-TRP2-9, or C-TRP2-8) was added at a peptide conversion rate of 2.5 μg / mL. The tube was incubated on ice for 30 minutes. Then, an antibody specific to the molecular complex of OVA peptide 1 and MHC-1 (fluorescently labeled with phycoerythrin (PE): PE-labeled anti-mouse OVA) was added. 257-264 (SIINFEKL) peptide bound to H-2Kb antibody (ThermoFisherSCIENTIFIC) (hereinafter referred to as "PE labelled H-2Kb / FIINFEKL") was used to quantify the OVA peptide 1-MHC-1 complex bound to the above antibody on DC2.4 cells by flow cytometry, and to evaluate the competitive inhibitory activity of MHC-1 binding induced by the TRP2-derived peptide.
[0397] The results of flow cytometry measurements are shown in Figure 7 The addition of TRP2-9 resulted in a 38% decrease in average fluorescence intensity, indicating that TRP2-9 inhibits the binding of OVA peptide 1 to MHC class I molecules, meaning it can bind to MHC class I molecules. Furthermore, the addition of C-TRP2-8, which has a different N-terminal amino acid but the same amino acid length as TRP2-9, resulted in a 23% decrease in average fluorescence intensity, confirming its inhibitory effect on the binding of OVA peptide 1 to MHC class I molecules. On the other hand, no inhibitory effect was observed with C-TRP2-9, which contains one more amino acid than TRP2-9.
[0398] This indicates that C-TRP2-9 has lost its binding affinity to MHC-1, while C-TRP2-8 has maintained its binding affinity to MHC-1.
[0399] Example 4: Evaluation of cytotoxic T cell induction using CpG DNA(S)-peptide conjugates (evaluation using hGP100)
[0400] The ability to induce cytotoxic T cells was evaluated in the same manner as in Example 2, using CpG30(S)a-hGP100pep10 or CpG30(S)a-hGP100pep9. As the antigen used to prepare antigen-preserving spleen cells, a peptide (hGP100-9) consisting of the amino acid sequence (9 amino acids) from positions 25 to 33 of hGP100, known as a melanoma-associated antigen, was used.
[0401] The results of flow cytometry measurements are shown in Figure 8 and9 Similar to the evaluation using mTRP2, in the case of CpG30(S)a-hGP100pep9, a reduction in antigen-retaining splenocytes was observed at a dose equivalent to 200 ng per peptide, confirming the induction of CTL activity, while in the case of CpG30(S)a-hGP100pep10, almost no reduction in antigen-retaining splenocytes was observed. Figure 8 Furthermore, regarding the CTL induction ability of CpG30(S)a-hGP100pep9, a dose-dependent effect was observed, showing that a dose of 200 ng could induce strong CTL activity. Figure 9 ).
[0402] Example 1: Evaluation of cytotoxic T cell induction using CpG30(S)a-CMTRP2-9
[0403] During MHC-1 presentation of antigenic peptides, endoplasmic reticulum aminopeptidase (ERAP) is also involved. The antigenic peptide precursor is pruned by ERAP from the N-terminus to a length suitable for MHC-1 binding. Regarding this process, it has been reported that in antigenic peptide precursors with a cysteine residue at the N-terminus, the insertion of alanine, leucine, or methionine at the C-terminus of the cysteine residue makes them more susceptible to ERAP pruning (WO2014 / 157704). Figure 3 The results suggest that for CpG30(S)a-mTRP2pep10, inserting alanine, leucine, or methionine on the C-terminal side of the cysteine residue at the N-terminus of C-TRP2-9 would make it more susceptible to ERAP pruning, potentially improving CTL induction ability.
[0404] Therefore, CpG DNA(S)-peptide conjugate CpG30(S)a-CMTRP2-9 was prepared using CM-TRP2-9 with a methionine residue inserted at the C-terminus of the N-terminal cysteine residue, and its CTL induction ability was evaluated. TRP2-9 was used as the antigen for preparing antigen-holding splenocytes.
[0405] The results of flow cytometry measurements are shown in Figure 10 No significant reduction in antigen-preserving splenocytes was observed at a dose equivalent to 1000 ng of peptide, and almost no reduction was observed at a dose of 200 ng. This indicates that although readily cleavable by ERAP was obtained in in vitro evaluations using the peptide (CM-TRP2-9), it does not adequately enhance CTL induction capacity in vivo.
[0406] Example 2: Evaluation of cytotoxic T cell induction using CpG30(S)a-mTRP2-14 and CpG30(S)a-mTRP2-12
[0407] It has been reported that the ease of ERAP pruning varies depending on the peptide chain length, with peptides of 9–16 amino acid length being the preferred substrates for ERAP (Proc Natl Acad Sci US A.102(47):17107-12(2005)).
[0408] Therefore, CpG DNA(S)-peptide conjugates CpG30(S)a-TRP2-12 and CpG30(S)a-TRP2-14 were prepared using sequences C-TRP2-11 and C-TRP2-13, which have 2 or 4 more amino acids on the N-terminal side than the TRP2-derived sequence in C-TRP2-9, and their CTL induction ability was evaluated. TRP2-9 was used as the antigen for preparing antigen-holding splenocytes.
[0409] The results of flow cytometry measurements are shown in Figure 11 No reduction in antigen-retaining splenocytes was observed with any of the CpG DNA(S)-peptide conjugates. Although in vitro evaluations using the peptides (C-TRP2-11 or C-TRP2-13) showed readily ERAP cleavage, in vivo evaluations using the conjugates indicated that they did not adequately enhance CTL induction.
[0410] Example 5: Synthesis of CpG DNA (S)-peptide conjugates containing CpG motifs other than those derived from K3 and evaluation of their ability to induce cytotoxic T cells.
[0411] (1) Synthesis method
[0412] CpGDNA(S)-peptide conjugates containing CpG motifs other than those derived from K3 were synthesized using the same method as in Example 1. The synthesized compounds are shown in the following formula and Table 3. It should be noted that C-TRP2-8 (refer to (2) of Example 1) was used as the N-terminal modified peptide.
[0413]
[0414] [Table 3]
[0415]
[0416] (2) Test methods
[0417] The cytotoxic T-cell induction capabilities of ISS1018-mTRP2pep9, ODN2006-mTRP2pep9, and ODN1826-mTRP2pep9 were evaluated using the same method as in Example 2. The dosage was set at 200 ng per peptide. As a control, CpG30(S)a-mTRP2pep9 (a conjugate containing a K3-derived CpG motif; see Example 1) was used.
[0418] The results are shown in Figure 12 This indicates that any compound synthesized in (1) has the same cytotoxic T cell induction ability as conjugates containing a K3-derived CpG motif.
[0419] Example 6: Synthesis of conjugates with ssH amino linker moieties having phosphate groups replaced by thiophosphate groups and evaluation of their cytotoxic T cell induction ability.
[0420] (1) Synthesis method
[0421] Conjugates with ssH amino linker moieties where phosphate groups are replaced by thiophosphate groups were synthesized by the following method. The synthesized compounds are shown in the following formula and Table 4.
[0422]
[0423] [Table 4]
[0424]
[0425] (1-1) Synthesis of CpG DNA(S) derivatives
[0426] The synthesis of CpG DNA(S) was performed using the phosphoramide method (e.g., Nucleic Acids Research, 12, 4539 (1984)). The synthesis of amino-modified CpG DNA(S) was performed using ssH Amino Linker (Bioorg. Med. Chem., 16, 941-949 (2008)) with phosphate groups replaced by thiophosphate groups. These syntheses were performed using a contract synthesis service (GeneDesign Inc.).
[0427] The base sequence of the synthesized CpG DNA(S) is the same as that of CpG30a described in Example 1(1).
[0428] The obtained amino-modified CpG DNA(S) has the structure shown below at the 5' end. The CpG DNA(S) derivative with the structure shown below at the 5' end, hereinafter referred to as "CpG30(S)a2" is a derivative containing sequence number 6.
[0429]
[0430] Subsequently, 1 mol of amino-modified CpG DNA(S) and 30 mol of succinimide-6-[3'-(2-pyridyldithio)-propionamide]hexanoate (LC-SPDP) were mixed in phosphate buffer (pH 8.0), and after standing at 40°C for 3 hours, the SPDP-modified CpG DNA(S) was purified using a NAP-5 column.
[0431] It should be noted that the obtained SPDP-modified CpG DNA(S) has the structure shown in the following formula.
[0432]
[0433] (1-2) Synthesis of N-terminal modified peptides
[0434] The peptides were synthesized using a contract synthesis service (GeneDesign Inc.).
[0435] The amino acid sequence of the synthesized peptide is shown below.
[0436] C-OVA7: CIINFEKL (Serial Number 46)
[0437] C-TRP2-8: CVYDFFVWL (Serial Number 32)
[0438] C-OVA7 is a peptide with a cysteine residue added to the N-terminus of the peptide consisting of amino acid sequences 259–265 of ovalbumin (OVA; GenBank accession number: CAA23716.1). C-OVA7 is a peptide with one residue removed from the N-terminus of OVA peptide 1 (the peptide consisting of amino acid sequence 41), which is an MHC-1 binding peptide, and a cysteine residue added to the N-terminus.
[0439] C-TRP2-8, as described in Example 1, is a peptide in which one residue is removed from the N-terminus of TRP2-9, which is an MHC-1 binding peptide, and a cysteine residue is added to the N-terminus.
[0440] (1-3) Synthesis of CpG DNA(S)-peptide conjugates
[0441] For the SPDP-modified CpG DNA(S) synthesized in (1-1), 5 to 10 molar equivalents of the peptide synthesized in (1-2) were mixed in a 50% dimethyl sulfoxide (DMSO) aqueous solution and reacted at 40°C for 2 hours. After the reaction, the CpG DNA(S)-peptide conjugate was purified by HPLC under the following conditions.
[0442] <HPLC conditions (E)>
[0443] The following gradient conditions were used: solution A was set to 0.1 M hexafluoroisopropanol (HFIP) and 8 mM triethylamine (TEA), and solution B was set to methanol. The chromatographic column used was an XBridge BEH C18 (4.6 × 75 mm Column XP) (Waters Corporation), and HPLC was performed at a column temperature of 40 °C and a flow rate of 1 mL / min.
[0444] 0 minutes A: 80% B: 20%
[0445] ~10 minutes A: 50% B: 50%
[0446] The HPLC conditions and retention times used in the separation of each conjugate are shown in Table 4.
[0447] (2) Test methods
[0448] The cytotoxic T-cell induction abilities of CpG30(S)a2-OVApep8 and CpG30(S)a2-mTRP2pep9 were evaluated using the same method as in Example 2. The dosage of CpG30(S)a2-OVApep8 was set at 20 ng per peptide. The dosage of CpG30(S)a2-mTRP2pep9 was set at 200 ng per peptide. The difference in dosage between the two conjugates reflected the difference in the antigenic length of the original peptides.
[0449] The results are shown in Figure 13 This indicates that both CpG30(S)a2-OVApep8 and CpG30(S)a2-mTRP2pep9 synthesized in (1) have high T-cell cytotoxicity induction capabilities.
[0450] Example 7: Evaluation of cytotoxic T cell induction using CpG DNA(S)-peptide conjugates (activity after 2 doses)
[0451] The cytotoxic T-cell induction capacity of CpG30(S)a-mTRP2pep9 administered twice was evaluated using the same method as in Example 2. The second administration was performed 10 days after the first administration. The dosage was set at 200 ng per animal (converted to peptide).
[0452] The results are shown in Figure 14 This indicates that administering the CpG DNA(S)-peptide conjugate twice increases CTL activity compared to a single administration.
[0453] Example 8: Synthesis of double-stranded CpG DNA (S)-peptide conjugates
[0454] A double-stranded complex (double-stranded CpG DNA(S)-peptide conjugate) was prepared by annealing a CpG DNA(S)-peptide conjugate (CpG30(S)a-mTRP2pep9; see Example 1) with a DNA derivative having a sequence complementary to the base sequence of its CpG DNA(S) moiety.
[0455] (1) Synthesis of CpG complementary strand DNA derivatives
[0456] The synthesis of CpG complementary DNA was performed using the same phosphoramidite method as CpG DNA(S). The synthesis of complementary DNA with lipid-modified 5' ends was performed by using lipid-modified phosphoramidite (synthesized using the same method as M22-12 phosphoramidite in reference (WO2017 / 057540)) as shown in the final coupling of the complementary DNA sequence synthesis.
[0457]
[0458] The synthesis of complementary DNA strands with lipid modifications at the 3' end is carried out as follows.
[0459] The complementary DNA sequence was synthesized after initial coupling using Asymmetric Doubler (Lev) Phosphoramidite (Glen Research, 10-1981) on a universal solid-phase support (Glen UnySupport 500 (Glen Research, 20-5040)). Subsequently, after detriphenylmethylation and acetyl protection on the solid-phase support, the levulinic acid unit was deprotected according to the manufacturer's specifications. The lipid-modified phosphorous amide was then reacted with the generated hydroxyl groups to synthesize the target compound.
[0460] The synthesis of complementary DNA strands with lipid modifications at the 3' and 5' ends is carried out as follows.
[0461] The complementary DNA sequence was synthesized on a universal solid-phase support (Glen UnySupport 500 (Glen Research, 20-5040)) using Asymmetric Doubler (Lev) Phosphoramidite (Glen Research, 10-1981). Subsequently, after detrimethylation on the solid-phase support, the levulinic acid unit was deprotected according to the manufacturer's specifications. The lipid-modified phosphoramidite was then reacted with the generated 3' and 5'-terminal hydroxyl groups to generate the target compound.
[0462] The structure of the synthesized DNA derivative complementary to CpG is shown below. It should be noted that the DNA sequence (compK3: sequence number 47) in the following derivative is complementary to the base sequence of K3 (sequence number 1).
[0463] 5'-Lipo-compK3:5'-Lipo^G^A^G^AACGCTCGAGA^G^T-3'
[0464] 3'-Lipo-compK3: 5'-G^A^G^AACGCTCGAGA^G^T^Lipo-3'
[0465] 5',3'-di-Lipo-compK3:5'-Lipo^G^A^G^AACGCTCGAGA^G^T^Lipo-3'
[0466] In the above structures, "^" represents a phosphate thioester bond between nucleosides. Additionally, "Lipo^G" and "T^Lipo" represent the following structures.
[0467]
[0468] DNA derivatives complementary to CpG were separated by HPLC under the following conditions. The results are shown in Table 5.
[0469] <HPLC Conditions (F)>
[0470] The following gradient conditions were used: solution A was set to 0.1 M hexafluoroisopropanol (HFIP) and 8 mM triethylamine (TEA), and solution B was set to methanol. The chromatographic column used was a Clarity 2.6 μm Oligo-MS 100A (LC-Column 50 × 2.1 mm) (Phenomenex Inc). HPLC was performed at a column temperature of 60 °C and a flow rate of 0.5 mL / min.
[0471] 0 minutes A: 90% B: 10%
[0472] ~7 minutes A: 10% B: 90%
[0473] [Table 5]
[0474]
[0475] (2) Forms a double-stranded complex with CpG DNA(S)-peptide conjugates.
[0476] The PBS solution of CpG30(S)a-mTRP2pep9 and the PBS solution of lipid-modified compK3 synthesized in (1) above were mixed in 1.5 mL tubes to a final concentration of 3.4 μM. The mixture was then heated in a 90 °C hot water bath and left overnight to gradually return to room temperature (double strands formed during this cooling process). 50 μL of this solution was administered to mice, equivalent to 200 ng of peptide.
[0477] Five double-chain complexes, as shown in Table 6 below, were obtained. The formation of the double-chain complexes can be confirmed by electrophoresis using polyacrylamide gel electrophoresis, liquid chromatography such as size exclusion chromatography, melting temperature determination using ultraviolet spectrophotometry, and molecular weight determination of the associated complexes using static light scattering.
[0478] [Table 6]
[0479] CpG DNA(S)-peptide conjugate complementary strand DNA derivatives 1 CpG30(S)a-mTRP2pep9 5'-Lipo-compK3 2 CpG30(S)a-mTRP2pep9 3'-Lipo-compK3 3 CpG30(S)a-mTRP2pep9 5',3'-di-Lipo-compK3 4 CpG20(S)a-mTRP2pep9 5'-Lipo-compK3 5 CpG20(S)a-mTRP2pep9 3'-Lipo-compK3
[0480] Example 9: Synthesis of CpG DNA(S)-peptide conjugates using MHC-2 binding peptides and utilization of their CD4+ + Evaluation of T cell activation
[0481] (1) Synthesis method
[0482] Two conjugates, CpG30(S)a2-OVA2-15 and CpG30(S)a2-OVA2-17, containing the CpG DNA(S) moiety derived from the MHC-2 binding peptide, were synthesized by the following method. The synthesized compounds are shown in the following formulas and Table 7.
[0483]
[0484] [Table 7]
[0485]
[0486] (1-1) Synthesis of CpG DNA(S) derivatives
[0487] CpG30(S)a2 and its SPDP-modified form were synthesized using the same method as in Example 6.
[0488] (1-2) Synthesis of N-terminal modified peptides
[0489] N-terminal cysteine-modified peptides were synthesized using the conventional Fmoc solid-phase peptide synthesis method. The amino acid sequence of the synthesized peptides is shown below.
[0490] The amino acid sequence of the synthesized peptide is shown below.
[0491] C-OVA2-14: CSQAVHAAHAEINEA (Serial Number 48)
[0492] C-OVA2-16: CSQAVHAAHAEINEAGR (Serial Number 51)
[0493] C-OVA2-14 is a peptide with a cysteine residue added to the N-terminus of a peptide consisting of amino acid sequences 325–338 of ovalbumin (OVA; GenBank accession number: CAA23716.1). C-OVA2-14 is a peptide with one residue removed from the N-terminus and two residues removed from the C-terminus of OVA peptide 2 (a peptide consisting of amino acid sequence number 42, containing the mouse I-Ab / I-Ad binding sequence), and a cysteine residue added to the N-terminus.
[0494] C-OVA2-16 is a peptide with a cysteine residue added to the N-terminus of the peptide consisting of amino acid sequences 325-340 of the above-mentioned ovalbumin. C-OVA2-16 is a peptide with one residue removed from the N-terminus of the above-mentioned OVA peptide 2 and a cysteine residue added to the N-terminus.
[0495] (1-3) Synthesis of CpG DNA(S)-peptide conjugates
[0496] Using the SPDP-modified CpG DNA(S) synthesized in (1-1) and the peptide synthesized in (1-2), the CpG DNA(S)-peptide conjugate was synthesized by the same method as in (1-3) of Example 6.
[0497] (2) Experimental method (CD4 immunization with CpG-MHC2 peptide conjugate by IFN-γ secretion activity assay) + Evaluation of T cell activation
[0498] The CpG DNA(S)-peptide conjugate, serving as the antigen, was administered intradermally to mice (C57BL / 6 mice (male, 7 weeks old)). The dosage of the CpG DNA(S)-peptide conjugate was set at 1000 ng per mouse (converted to peptide). One week after administration, spleen cells were harvested and analyzed at 1.0 × 10⁻⁶ ng / mL. 6 100 μL of cells were seeded per 100 μL in 96-well culture dishes (medium; RPMI 1640), and OVA-derived MHC-2-binding antigenic peptides (OVA) were added at 10 μg / mL. 324-340ISQAVHAAHAEINEAGR (Sequence No. 42)). Twenty-four hours later, interferon-γ (IFN-γ) in the culture medium was quantified using the IFN gamma Mouse ELISA Kit (Invitrogen, IFN gamma 'Femto-HS' High Sensitivity Mouse Uncoated ELISA Kit). In mice immunized by administration of a CpG DNA(S)-peptide conjugate, antigen-specific CD4+ in splenocytes was stimulated by the antigen peptide added to the culture medium. + T cells are activated and secrete IFN-γ.
[0499] The results are shown in Figure 15 and Figure 17 .
[0500] High IFN-γ secretion activity was observed in mouse spleen cells treated with CpG30(S)a2-OVA2-15 and CpG30(S)a2-OVA2-17, respectively. Figure 15 and 17 Regarding CpG30(S)a2-OVA2-18, refer to Reference Example 3. This demonstrates that the C-terminal peptide can be removed when preparing conjugates using MHC-2 binding peptides.
[0501] Reference Example 3: Synthesis of CpG DNA(S)-peptide conjugates using MHC-2 binding peptides and utilization of their CD4+ + Evaluation of T cell activation
[0502] (1) Synthesis method
[0503] Two conjugates, CpG30(S)a2-OVA2-18 and CpG30(S)a2-OVA2-18c, containing the CpG DNA(S) moiety derived from the MHC-2 binding peptide, were synthesized using the following method. The synthesized compounds are shown in the following formula and Table 8.
[0504]
[0505] [Table 8]
[0506]
[0507] (1-1) Synthesis of CpG DNA(S) derivatives
[0508] CpG30(S)a2 and its SPDP-modified form were synthesized using the same method as in Example 6.
[0509] (1-2) Synthesis of N-terminal modified peptides and C-terminal modified peptides
[0510] N-terminal cysteine-modified peptides and C-terminal cysteine-modified peptides were synthesized using the conventional Fmoc solid-phase peptide synthesis method.
[0511] The amino acid sequence of the synthesized peptide is shown below.
[0512] C-OVA2-17: CISQAVHAAHAEINEAGR (Serial Number 49)
[0513] OVA2-17-C: ISQAVHAAHAEINEAGRC (Serial Number 50)
[0514] C-OVA2-17 is a peptide with a cysteine residue added to the N-terminus of a peptide consisting of amino acid sequences 324-340 of ovalbumin. C-OVA2-17 is a peptide with a cysteine residue added to the N-terminus of the aforementioned OVA peptide 2.
[0515] OVA2-17-C is a peptide in which a cysteine residue is added to the C-terminus of the amino acid sequence 324-340 of ovalbumin. C-OVA2-17 is a peptide in which a cysteine residue is added to the C-terminus of the aforementioned OVA peptide 2.
[0516] (1-3) Synthesis of CpG DNA(S)-peptide conjugates
[0517] Using the SPDP-modified CpG DNA(S) synthesized in (1-1) and the peptide synthesized in (1-2), the CpG DNA(S)-peptide conjugate was synthesized by the same method as in (1-3) of Example 6.
[0518] (2) Experimental method (CD4 immunization with CpG-MHC2 peptide conjugate by IFN-γ secretion activity assay) + Evaluation of T cell activation
[0519] The CpG DNA(S)-peptide conjugate, serving as the antigen, was administered intradermally to mice (C57BL / 6 mice (male, 7 weeks old)). The dosage of the CpG DNA(S)-peptide conjugate was set at 1000 ng per mouse (converted to peptide). One week after administration, spleen cells were harvested and analyzed at 1.0 × 10⁻⁶ ng / mL. 6 100 μL of cells were seeded per 100 μL in 96-well culture dishes (medium; RPMI 1640), and OVA-derived antigen peptides (OVA) were added at a rate of 10 μg / mL. 324-340:ISQAVHAAHAEINEAGR (Sequence No. 42)). 24 hours later, interferon-γ (IFN-γ) in the culture medium was quantified using the IFN gamma Mouse ELISA Kit (Invitrogen, IFN gamma 'Femto-HS' High Sensitivity Mouse Uncoated ELISA Kit). In mice immunized by administration of CpG DNA(S)-peptide conjugate, antigen-specific CD4+ in splenocytes was stimulated by the antigen peptide added to the culture medium. + T cells are activated and secrete IFN-γ.
[0520] The results are shown in Figure 15 and 16 .
[0521] High IFN-γ secretion activity was observed in the spleen cells of mice treated with CpG30(S)a2-OVA2-18. Figure 15 and 16 ).
[0522] Furthermore, in the spleen cells of mice treated with CpG30(S)a2-OVA2-18c, equal or higher activity was observed compared to that of mice treated with CpG30(S)a2-OVA2-18c. Figure 16 This indicates that when using MHC-2 binding peptides to prepare conjugates, CpG DNA (S) can be conjugated to the C-terminus.
[0523] Example 10: Preparation of CpG DNA(S)-peptide conjugates (2) and evaluation of their ability to induce cytotoxic T cells.
[0524] (1) Synthesis method
[0525] (1-1) Synthesis of CpG DNA(S) derivatives
[0526] The synthesis of CpG DNA(S) with a 6-mercaptohexyl group at the 5' end was carried out as follows: after synthesizing the sequence of CpG DNA(S) using the phosphoramidite method, it was reacted with 5'-thiol-modifier C6 (S-triphenylmethyl-6-mercaptohexyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite). These syntheses were performed using a commissioned synthesis service (GeneDesign Inc.).
[0527] The obtained 6-mercaptohexyl-modified CpG DNA(S) has the structure shown below at its 5' end. Hereinafter, the CpG DNA(S) derivative with the structure shown below at its 5' end, which has the sequence number 6, will be referred to as "CpG30(S)a3".
[0528]
[0529] In addition, the synthesis of CpG DNA(S) derivatives having the structure shown below at the 5' end was carried out by purifying the amino-modified CpG DNA(S) synthesized in Example 6 (1-1) with PPC-NHS ester (2,5-dioxopyrrolidone-1-yl 3-(pyridin-2-yl dithio)butyrate) at a molar ratio of 1:30 in phosphate buffer (pH 8.0) at 40°C for 3 hours using a NAP-5 column.
[0530]
[0531] (1-2) Synthesis of N-terminal modified peptides
[0532] C-TRP2-8:CVYDFFVWL (serial number 32) was synthesized in the same manner as in Example 1.
[0533] (1-3) Synthesis of CpG DNA(S)-peptide conjugates
[0534] Relative to the CpG30(S)a3 synthesized in (1-1), 30 molar equivalents of Npys-OMe (CAS: 68118-08-1) were mixed in a 33% dimethyl sulfoxide (DMSO) aqueous solution and reacted overnight. Next, 5 molar equivalents of the peptide synthesized in (1-2) were mixed in a 50% dimethyl sulfoxide (DMSO) aqueous solution and reacted at 40°C for 2 hours. After the reaction, the CpG DNA(S)-peptide conjugate was purified by HPLC to obtain CpG30(S)a3-mTRP2pep9.
[0535] Additionally, for the PPC-NHS ester-modified CpG DNA(S) synthesized in (1-1), 5 molar equivalents of the peptide synthesized in (1-2) were mixed in a 50% dimethyl sulfoxide (DMSO) aqueous solution and reacted at 40°C for 2 hours. After the reaction, the CpG DNA(S)-peptide conjugate was purified by HPLC to obtain CpG30(S)a2-MeS-mTRP2pep9.
[0536] The synthesized compounds are shown in the following formulas and Table 9.
[0537]
[0538] [Table 9]
[0539]
[0540] (2) Test methods
[0541] The cytotoxic T-cell induction capacity of CpG30(S)a3-mTRP2pep9 was evaluated using the same method as in Example 2. The dosage was set at 200 ng per animal (converted to peptide). As a control, CpG30(S)a2-mTRP2pep9 (a conjugate containing a CpG motif derived from K3; see Example 6) was used.
[0542] The results are shown in Figure 18 This indicates that CpG30(S)a3-mTRP2pep9 possesses the same cytotoxic T cell induction ability as CpG30(S)a2-mTRP2pep9, which has a different spacer structure.
[0543] Example 11: Synthesis of CpG DNA(S)-peptide conjugates containing cysteine analogues
[0544] (1) Synthesis method
[0545] CpG DNA(S)-peptide conjugates were synthesized using the same method as in Example 1, with the N-terminus modified with a cysteine analogue instead of cysteine. The synthesized compounds are shown in the following formula and Table 10. It should be noted that, as the N-terminal modified peptide, the following synthetic peptides with non-natural amino acids at the N-terminus were used.
[0546] dC-mTRP2pep8:D-cysteine-VYDFFVWL (Sequence No. 52)
[0547] homoC-mTRP2pep8:L-homocysteine-VYDFFVWL (serial number 53)
[0548] Pen-mTRP2pep8:L-penicillamine-VYDFFVWL (Serial No. 54)
[0549]
[0550] [Table 10]
[0551]
[0552] (2) Test methods
[0553] The cytotoxic T-cell induction capacity of CpG30(S)a2-Pen-mTRP2pep8 was evaluated using the same method as in Example 2. The dosage was set at 200 ng per animal (converted to peptide). As a control, CpG30(S)a2-mTRP2pep9 (a conjugate containing a CpG motif derived from K3; see Example 6) was used.
[0554] The results are shown in Figure 18 This indicates that CpG30(S)a2-Pen-mTRP2pep8, which contains a cysteine analogue, has the same cytotoxic T cell induction ability as CpG30(S)a2-mTRP2pep9.
[0555] Example 12: Synthesis of CpG DNA (S)-peptide conjugates with peptides at the 5' and 3' ends of CpG DNA
[0556] (1) Synthesis method
[0557] CpG DNA(S)-peptide conjugates with peptides at both ends of CpG DNA were synthesized using the methods described in (1-1) to (1-3) below. The synthesized compounds are shown in the following formulas and Table 11. It should be noted that C-TRP2-8 (refer to (2) of Example 1) was used as the N-terminal modified peptide.
[0558]
[0559] [Table 11]
[0560]
[0561] (1-1) Synthesis of CpG DNA(S) derivatives
[0562] The synthesis of CpG DNA(S) with amino linkers bonded to both the 5' and 3' ends was performed as follows: Using the phosphoramidite method, the CpG sequence was synthesized with a 3'-Amino-Modifier C6-dC CPG (Link Technologies Ltd.), followed by reaction of the ssH amino linker with the 5' end. These syntheses were performed using a commissioned synthesis service (GeneDesign Inc.).
[0563] The base sequence of the synthesized CpG DNA(S) is the same as that of CpG30a described in (1) of Example 1.
[0564] The obtained amino-modified CpG DNA(S) has the structure shown in the following formula at the 5' end.
[0565]
[0566] It has the structure shown in the following formula at the 3' end.
[0567]
[0568] Hereinafter, the sequence with sequence number 6 in the CpG DNA(S) derivative having the structure shown in the above formula at the 3' and 5' ends will be referred to as "CpG30(S)a4".
[0569] Subsequently, CpG30(S)a4 and succinimide-6-[3'-(2-pyridyldithio)-propionamide]hexanoate (LC-SPDP) were mixed in phosphate buffer (pH 8.0) at a molar ratio of 1:30. After standing at 40°C for 3 hours, SPDP-modified CpG DNA(S)a4 was purified using a NAP-5 column.
[0570] (1-2) Synthesis of N-terminal modified peptides
[0571] C-TRP2-8:CVYDFFVWL (serial number 32) was synthesized in the same manner as in Example 1.
[0572] (1-3) Synthesis of CpG DNA(S)-peptide conjugates
[0573] For the SPDP-modified CpG DNA(S)a4 synthesized in (1-1), 5 to 10 molar equivalents of the peptide synthesized in (1-2) were mixed in a 50% dimethyl sulfoxide (DMSO) aqueous solution and reacted at 40 °C for 2 h. After the reaction, the CpG DNA(S)-peptide conjugate was isolated by HPLC purification. The HPLC conditions and retention times used in the isolation are shown in Table 11.
[0574] Industrial availability
[0575] According to the present invention, it is possible to provide immune inducers capable of inducing CTL activity and pharmaceutical compositions comprising such inducers for a wide range of antigenic peptides.
[0576] Sequence List Free Text
[0577] Serial Number 1: K3
[0578] Serial Number 2: K3-20(b)
[0579] Serial Number 3: K3-21
[0580] Serial Number 4: K3-24
[0581] Serial Number 5: K3-27
[0582] Serial Number 6: K3-30(a)
[0583] Serial Number 7: K3-30(b)
[0584] Serial Number 8: K3-40
[0585] Serial Number 9: K3-30(c)
[0586] Serial Number 10: K3-30(d)
[0587] Serial Number 11: K3-30(e)
[0588] Serial Number 12: K3-30(f)
[0589] Serial Number 13: K3-26(a)
[0590] Serial Number 14: K3-26(b)
[0591] Serial Number 15: ODN1668
[0592] Serial Number 16: ODN1668-30
[0593] Serial Number 17: ODN1668-40
[0594] Serial Number 18: ODN1826
[0595] Serial Number 19: ODN1826-30
[0596] Serial Number 20: ODN1826-40
[0597] Serial Number 21: ODN2006
[0598] Serial Number 22: ODN2006-30
[0599] Serial Number 23: ODN2006-40
[0600] Serial Number 24: ODN684
[0601] Serial Number 25: ODN684-30
[0602] Serial Number 26: ODN684-40
[0603] Serial Number 27: ODN D-SL01
[0604] Serial Number 28: ODN D-SL01-35
[0605] Serial Number 29: C-CpG#1
[0606] Serial Number 30: C-OVA8
[0607] Serial Number 31: C-TRP2-9
[0608] Serial Number 32: C-TRP2-8
[0609] Serial number 33: C-gp100-9
[0610] Serial Number 34: C-gp100-8
[0611] Serial Number 35: CM-TRP2-9
[0612] Serial Number 36: C-TRP2-13
[0613] Serial Number 37: C-TRP2-11
[0614] Serial Number 38: C-OVA2-17
[0615] Serial Number 39: C-OVA2-14
[0616] Serial Number 40: C-OVA2-11
[0617] Serial number 41: OVA peptide 1
[0618] Serial number 42: OVA peptide 2
[0619] Serial Number 43: 1018ISS
[0620] Serial Number 44: 1018ISS#30
[0621] Serial Number 45: 1018ISS#40
[0622] Serial Number 46: C-OVA7
[0623] Serial number 47: compK3
[0624] Serial Number 48: C-OVA2-14
[0625] Serial Number 49: C-OVA2-17
[0626] Serial Number 50: OVA2-17-C
[0627] Serial Number 51: C-OVA2-16
[0628] Serial number 52: dC-mTRP2pep8; the first amino acid is D-cysteine.
[0629] Serial number 53: homoC-mTRP2pep8; the first amino acid is L-homocysteine.
[0630] Serial number 54: Pen-mTRP2pep8; the first amino acid is L-penicillamine. sequence list <110> Public University Corporation Kitakyushu City University (THE UNIVERSITY OF KITAKYUSHU) DAIICHI SANKYO COMPANY, LIMITED <120> Immunomodulators comprising polynucleotide-peptide conjugates and pharmaceutical compositions comprising them <130> FA1511-20313 <150> JP 2020-057249 <151> 2020-03-27 <160> 54 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> K3 <400> 1 atcgactctc gagcgttctc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> K3-20(b) <400> 2 gagcgttctc gagcgttctc 20 <210> 3 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> K3-21 <400> 3 cgagcgttct cgagcgttct c 21 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> K3-24 <400> 4 tctcgagcgt tctcgagcgt tctc 24 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> K3-27 <400> 5 gactctcgag cgttctcgag cgttctc 27 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> K3-30(a) <400> 6 gagcgttctc atcgactctc gagcgttctc 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> K3-30(b) <400> 7 atcgactctc gagcgttctc gagcgttctc 30 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> K3-40 <400> 8 atcgactctc gagcgttctc atcgactctc gagcgttctc <210> 9 <211> 30 <212> DNA <213> Private Sequence (Artificial Sequence) <220> <223> K3‐30(c) <400> 9 30. ctcagcgttc tcagcgttct cagcgttctc <210> 10 <211> 30 <212> DNA <213> Private Sequence (Artificial Sequence) <220> <223> K3‐30(d) <400> 10 tttagcgttt ttagcgtttt tagcgttttt <210> 11 <211> 30 <212> DNA <213> Private Sequence (Artificial Sequence) <220> <223> K3‐30(e) <400> 11 ttagcgttta gcgtttagcg tttagcgttt <210> 12 <211> 30 <212> DNA <213> Private Sequence (Artificial Sequence) <220> <223> K3‐30(f) <400> 12 ttagcgttca gcgttcagcg ttcagcgttt <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> K3-26(a) <400> 13 tcagcgtttc agcgtttcag cgtttc 26 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> K3-26(b) <400> 14 ttagcgtttt agcgttttag cgtttt 26 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ODN1668 <400> 15 tccatgacgt tcctgatgct 20 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ODN1668-30 <400> 16 tgacgttcct tccatgacgt tcctgatgct 30 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> ODN1668-40 <400> 17 tccatgacgt tcctgatgct tccatgacgt tcctgatgct 40 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ODN1826 <400> 18 tccatgacgt tcctgacgtt 20 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ODN1826-30 <400> 19 tgacgttcct tccatgacgt tcctgacgtt 30 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> ODN1826-40 <400> 20 tccatgacgt tcctgacgtt tccatgacgt tcctgacgtt 40 <210> twenty one <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> ODN2006 <400> twenty one tcgtcgtttt gtcgttttgt cgtt 24 <210> twenty two <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ODN2006-30 <400> twenty two gtcgtttcgt cgttttgtcg ttttgtcgtt 30 <210> twenty three <211> 40 <212> DNA <213> Artificial Sequence <220> <223> ODN2006-40 <400> twenty three tcgtcgtttt gtcgtttcgt cgttttgtcg ttttgtcgtt 40 <210> twenty four <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> ODN684 <400> twenty four tcgacgttcg tcgttcgtcg ttc 23 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ODN684-30 <400> 25 tcgtcgttcg acgttcgtcg ttcgtcgttc 30 <210> 26 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> ODN684-40 <400> 26 gttcgtcgtt tcgtcgttcg acgttcgtcg ttcgtcgttc 40 <210> 27 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ODN D‑SL01 <400> 27 tcgcgacgtt cgcccgacgt tcggta 26 <210> 28 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ODN D‑SL01‑35 <400> 28 tcgcgacgtt cgcgacgttc gcccgacgtt cggta 35 <210> 29 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> C‑CpG_1 <400> 29 tcgaacgttc gaacgttcga acgttcgaat 30 <210> 30 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> C‑OVA8 <400> 30 Cys Ser Ile Ile Asn Phe Glu Lys Leu 1 5 <210> 31 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> C-TRP2-9 <400> 31 Cys Ser Val Tyr Asp Phe Phe Val Trp Leu 1 5 10 <210> 32 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> C-TRP2-8 <400> 32 Cys Val Tyr Asp Phe Phe Val Trp Leu 1 5 <210> 33 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> C-gp100-9 <400> 33 Cys Lys Val Pro Arg Asn Gln Asp Trp Leu 1 5 10 <210> 34 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> C-gp100-8 <400> 34 Cys Val Pro Arg Asn Gln Asp Trp Leu 1 5 <210> 35 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> CM-TRP2-9 <400> 35 Cys Met Ser Val Tyr Asp Phe Phe Val Trp Leu 1 5 10 <210> 36 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> C-TRP2-13 <400> 36 Cys Phe Ala Asn Ala Ser Val Tyr Asp Phe Phe Val Trp Leu 1 5 10 <210> 37 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> C-TRP2-11 <400> 37 Cys Asn Ala Ser Val Tyr Asp Phe Phe Val Trp Leu 1 5 10 <210> 38 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> C-OVA2-17 <400> 38 Cys Ile Ser Gln Ala Val His Ala Ala His Ala Glu Ile Asn Glu Ala 1 5 10 15 Gly Arg <210> 39 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> C-OVA2-14 <400> 39 Cys Ser Gln Ala Val His Ala Ala His Ala Glu Ile Asn Glu Ala 1 5 10 15 <210> 40 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> C-OVA2-11 <400> 40 Cys Ala Val His Ala Ala His Ala Glu Ile Asn Glu 1 5 10 <210> 41 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> OVA peptide 1 <400> 41 Ser Ile Ile Asn Phe Glu Lys Leu 1 5 <210> 42 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> OVA peptide 2 <400> 42 Ile Ser Gln Ala Val His Ala Ala His Ala Glu Ile Asn Glu Ala Gly 1 5 10 15 Arg <210> 43 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> 1018ISS <400> 43 tgactgtgaa cgttcgagat ga 22 <210> 44 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 1018ISS_30 <400> 44 tgaacgttcg actgtgaacg ttcgagatga 30 <210> 45 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 1018ISS_40 <400> 45 tgaacgttcg tgaacgttcg actgtgaacg ttcgagatga 40 <210> 46 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> C-OVA7 <400> 46 Cys Ile Ile Asn Phe Glu Lys Leu 1 5 <210> 47 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> compK3 <400> 47 gagaacgctc gagagt 16 <210> 48 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> C-OVA2-14 <400> 48 Cys Ser Gln Ala Val His Ala Ala His Ala Glu Ile Asn Glu Ala 1 5 10 15 <210> 49 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> C-OVA2-17 <400> 49 Cys Ile Ser Gln Ala Val His Ala Ala His Ala Glu Ile Asn Glu Ala 1 5 10 15 Gly Arg <210> 50 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> OVA2-17-C <400> 50 Ile Ser Gln Ala Val His Ala Ala His Ala Glu Ile Asn Glu Ala Gly 1 5 10 15 Arg Cys <210> 51 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> C-OVA2-16 <400> 51 Cys Ser Gln Ala Val His Ala Ala His Ala Glu Ile Asn Glu Ala Gly 1 5 10 15 Arg <210> 52 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> dC-mTRP2pep8 <220> <221> X <222> (1)..(1) <223> D-cysteine <400> 52 Xaa Val Tyr Asp Phe Phe Val Trp Leu 1 5 <210> 53 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> homoC-mTRP2pep8 <220> <221> X <222> (1)..(1) <223> L-homocysteine <400> 53 Xaa Val Tyr Asp Phe Phe Val Trp Leu 1 5 <210> 54 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Pen-mTRP2pep8 <220> <221> X <222> (1)..(1) <223> L-Penicillamine <400> 54 Xaa Val Tyr Asp Phe Phe Val Trp Leu 1 5
Claims
1. An immune inducer comprising a polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof as the active ingredient. The polynucleotide-peptide conjugate comprises a single-chain polynucleotide derivative containing a CpG motif, a peptide, and a spacer, wherein the spacer is covalently bonded to the polynucleotide derivative at one end and to the peptide at the other end. The peptide is a peptide in which one or more consecutive amino acids at the N-terminus of an MHC-binding peptide are replaced with amino acids having reactive functional groups for forming covalent bonds with the spacer group, wherein the one or more consecutive amino acids do not include anchor residues for binding MHC. The MHC-binding peptide is an MHC-1 binding peptide. The MHC-1 binding peptide is either an HLA-A binding peptide or an HLA-B binding peptide. The amino acid length of the MHC-1 binding peptide is 8 or more and 11 or less; in, The amino acid having a reactive functional group for forming a covalent bond with the spacer group is cysteine or an amino acid having a thiol group; The polynucleotide derivative is a polynucleotide derivative in which all phosphodiester bonds are replaced with thiophosphate bonds. The spacer base includes repeating units as shown in the following formula: In the formula, X represents an oxygen atom or a sulfur atom; here, each X can be chosen to be the same or different. R represents (CH2) p O, (CH2) q NH and (CH2CH2O) m In the set of numbers, m, p, and q independently represent natural numbers less than 10. n represents a natural number less than 10.
2. The immune inducer according to claim 1, wherein, One or both of the covalent bonds between the spacer and the polynucleotide derivative and between the spacer and the peptide are covalent bonds that can be broken in a biological environment.
3. The immune inducer according to claim 1 or 2, wherein, The covalent bond between the spacer group and the peptide is a disulfide bond.
4. The immune inducer according to claim 1 or 2, wherein, The polynucleotide derivative is a polydeoxyribonucleotide (DNA) derivative containing two or more CpG motifs.
5. The immune inducer according to claim 1 or 2, wherein, The polynucleotide derivative has a base length of 15 or more and 40 or less.
6. The immune inducer according to claim 5, wherein, The polynucleotide derivative has a base length of 20 or more and 30 or less.
7. The immune inducer according to claim 1 or 2, wherein, The spacer base has a structure shown in any of the following formulas. 。 8. The immune inducer according to claim 1 or 2, wherein, The spacer base has a structure shown in any of the following formulas. 。 9. An immune inducer comprising, as the active ingredient, the polynucleotide-peptide conjugate of claim 1 or a pharmaceutically acceptable salt thereof. The covalent bond between the spacer group and the peptide is a disulfide bond. The polynucleotide derivative is a polydeoxyribonucleotide (DNA) derivative containing two or more CpG motifs. The polynucleotide derivative has a base length of 20 or more but less than 30. The spacer base has a structure shown in any of the following formulas. 。 10. The immune inducer according to any one of claims 1, 2, 6 and 9, further comprising a substance having immune-activating activity as an adjuvant.
11. A pharmaceutical composition comprising the immune inducer according to any one of claims 1 to 10.
12. The use of the immune inducer according to any one of claims 1 to 10 in the manufacture of a medicament for the treatment or prevention of infectious diseases, tumors or allergic diseases.
13. Use of the immune inducer according to any one of claims 1 to 10 in the manufacture of a medicament for treating or preventing tumors.
14. A polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof, The polynucleotide-peptide conjugate comprises a single-chain polynucleotide derivative containing a CpG motif, a peptide, and a spacer, wherein the spacer is covalently bonded to the polynucleotide derivative at one end and to the peptide at the other end. The peptide is an MHC-binding peptide in which one or more consecutive amino acids at the N-terminus are replaced with amino acids having reactive functional groups for forming covalent bonds with the spacer group. Here, the one or more consecutive amino acids do not include anchor residues for binding MHC. The MHC-binding peptide is an MHC-1 binding peptide. The MHC-1 binding peptide is either an HLA-A binding peptide or an HLA-B binding peptide. The amino acid length of the MHC-1 binding peptide is 8 or more and 11 or less; in, The amino acid having a reactive functional group for forming a covalent bond with the spacer group is cysteine or an amino acid having a thiol group; The polynucleotide derivative is a polynucleotide derivative in which all phosphodiester bonds are replaced with thiophosphate bonds. The spacer base includes repeating units as shown in the following formula: In the formula, X represents an oxygen atom or a sulfur atom; here, each X can be chosen to be the same or different. R represents (CH2) p O, (CH2) q NH and (CH2CH2O) m In the set of numbers, m, p, and q independently represent natural numbers less than 10. n represents a natural number less than 10.
15. The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to claim 14, wherein, One or both of the covalent bonds between the spacer and the polynucleotide derivative, and the covalent bonds between the spacer and the peptide, are covalent bonds that can be broken in a biological environment. The polynucleotide derivative is a polydeoxyribonucleotide (DNA) derivative containing two or more CpG motifs.
16. The polynucleotide-peptide conjugate or a pharmaceutically acceptable salt thereof according to claim 14, wherein, The covalent bond between the spacer group and the peptide is a disulfide bond. The polynucleotide derivative is a polydeoxyribonucleotide (DNA) derivative containing two or more CpG motifs. The polynucleotide derivative has a base length of 20 or more but less than 30. The spacer base has a structure shown in any of the following formulas. 。
Citation Information
Patent Citations
Tactile sense presentation device
JP2020057249A
Conjugate vaccine using trimming function of erap1
WO2014157704A1
PEPTIDE / β-1,3-GLUCAN COMPLEX AND PRODUCTION METHOD THEREFOR, AND PHARMACEUTICAL COMPOSITION CONTAINING PEPTIDE / β-1,3-GLUCAN COMPLEX
WO2015118789A1
Nucleic acid derivative having immunostimulatory activity
WO2017057540A1
Cpg-spacer-oligonucleotide-containing complex having immunostimulating activity and use thereof
TW201639583A