A method for effectively reducing the abortion rate of chrysanthemum hybrid embryos

Abstract

The present invention discloses a method for efficiently reducing the embryo abortion rate of chrysanthemum hybridization, comprising the following steps: (1) constructing an interference expression vector of the CmERF12 gene; (2) transferring the constructed interference expression vector into chrysanthemum to screen a CmERF12 transgenic chrysanthemum interference strain with low CmERF12 gene expression; (3) using the screened CmERF12 transgenic chrysanthemum interference strain as a parent and performing artificial hybridization with other chrysanthemum parents to reduce the embryo abortion rate of chrysanthemum hybridization. The present invention provides a method for reducing the embryo abortion rate of chrysanthemum distant hybridization by using gene regulation technology, and the method can significantly improve the fruit setting rate of chrysanthemum distant hybridization, the fruit setting rate of the ♀Cm×♂Cn hybrid combination is 1.07%, and after adopting the method, the fruit setting rate of the ♀CmERF12‑RNAi‑Cm×♂Cn hybrid combination is significantly increased, with the highest proportion being about 5.07%. The method can significantly overcome the reproductive developmental obstacles of distant hybridization, thereby improving the breeding efficiency and accelerating the breeding process.

Description

Technical Field

[0001] The invention belongs to the research field of chrysanthemum reproductive biology and hybrid breeding, and relates to a method for efficiently reducing the abortion rate of chrysanthemum hybrid embryos, and specifically to a method for improving the fruiting rate of chrysanthemum distant hybridization. The method obtains CmERF12-RNAi transgenic chrysanthemums by Agrobacterium-mediated leaf disc infection; extracts leaf DNA from the obtained positive strains by SDS method, detects whether the plant expression vector is integrated into the plant genome, extracts leaf RNA at the same time, reverses and performs PCR with specific primers to detect the expression of CmERF12 in the transgenic strains; then, RNAi transgenic chrysanthemum strains amiR-6, amiR-7, and amiR-12 with low CmERF12 expression are used as maternal parents, and hybridized with the male parent wild-type tetraploid C. nankingense; observes the normal embryo ratio of transgenic and non-transgenic plants under a stereo microscope at different times after artificial pollination, and samples and fixes the embryos respectively, and then compares and studies the internal cell structure of the embryos after pollination by transmission electron microscopy technology. Technical Background

[0002] Normal development of plant embryos is the key to obtaining seeds through hybrid breeding and the prerequisite for producing plants with excellent traits. Chrysanthemum (Chrysanthemum morifolium) is one of the top ten famous flowers in my country and one of the four major cut flowers in the world. It has a wide variety of varieties and high ornamental and economic value, but there are serious problems in its production: most cultivars with excellent ornamental traits have poor resistance, which leads to high production costs and limits its large-scale promotion. At present, distant hybridization of cultivated chrysanthemums with chrysanthemums and their closely related species is one of the most important means of chrysanthemum breeding, but distant hybridization often has embryo abortion, which seriously affects the utilization of excellent germplasm resources and breeding efficiency. Therefore, the molecular mechanism of embryo abortion in plants is crucial to improving the efficiency of plant hybrid breeding. Improving the fruiting rate of hybrid breeding and then cultivating more new chrysanthemum varieties has a very important market application prospect.

[0003] Plant distant hybridization reproductive barriers are a common phenomenon that seriously affects the efficiency of plant genetic breeding and the yield of seeds or fruits. There are many reasons for hybridization reproductive barriers, mainly divided into two aspects: incompatibility before fertilization and embryo abortion after fertilization. The traditional methods to overcome distant hybridization reproductive barriers mainly include reasonable selection of parents and reciprocal crosses, selection of appropriate pollination methods, pollen and stigma pretreatment, chromosome doubling, and young embryo rescue. At present, the application of transgenic breeding, molecular marker-assisted selection breeding, and molecular design breeding can, to a certain extent, partially overcome distant hybridization reproductive development barriers, break the original interspecific reproductive isolation, improve breeding efficiency, and accelerate the breeding process. Summary of the invention

[0004] The purpose of the present invention is to provide an application of CmERF12 gene in efficiently reducing the abortion rate of chrysanthemum hybrid embryos.

[0005] Another object of the present invention is to provide a method for efficiently reducing the abortion rate of chrysanthemum hybrid embryos, so as to improve the fruit set rate of chrysanthemum distant hybridization through transgenic breeding technology, accelerate the breeding process, obtain more chrysanthemum varieties with excellent traits, and better apply them to the cut flower market and landscaping.

[0006] The purpose of the present invention can be achieved by the following technical solutions:

[0007] The application of CmERF12 gene in effectively reducing the abortion rate of chrysanthemum hybrid embryos. The CmERF12 gene has a nucleotide sequence as shown in SEQ ID NO.1.

[0008] The above application is to interfere with or inhibit the expression of CmERF12 gene in chrysanthemum hybrid parents to reduce the embryo abortion rate of chrysanthemum hybrid.

[0009] As a preferred technical solution, the above-mentioned application includes the following steps: constructing an interference expression vector of the CmERF12 gene, transferring the constructed interference expression vector into chrysanthemum to screen CmERF12 transgenic chrysanthemum interference strains with low CmERF12 gene expression; using the screened CmERF12 transgenic chrysanthemum interference strains as parents and artificially hybridizing with other chrysanthemum parents to reduce the abortion rate of chrysanthemum hybrid embryos.

[0010] A method for efficiently reducing the abortion rate of chrysanthemum hybrid embryos, the method comprising the following steps:

[0011] (1) Construction of an interference expression vector for the CmERF12 gene;

[0012] (2) The constructed interference expression vector was transferred into chrysanthemum to screen for CmERF12 transgenic chrysanthemum interference strains with low CmERF12 gene expression;

[0013] (3) Artificial hybridization was performed using the selected CmERF12 transgenic chrysanthemum interference strain as a parent and other chrysanthemum parents to reduce the embryo abortion rate of chrysanthemum hybrids.

[0014] As a preferred technical solution, the process of step (1) constructing the CmERF12 gene interference expression vector is: extracting total RNA from chrysanthemum and reverse transcribing it into cDNA, then using cDNA as a template to perform PCR reaction to obtain the full-length sequence of the target gene, and constructing the interference expression vector pMDC32-ami-CmERF12.

[0015] Further preferred: the construction steps of the interference expression vector pMDC32-ami-CmERF12 are as follows: using the miR319a plasmid as a template, two rounds of high-fidelity PCR reactions are performed, and the first round of reactions amplify fragments a, b, and c, wherein when amplifying fragment a, the primers used are Oligo A and IV miR*a, respectively; when amplifying fragment b, primers II miR-a and III miR*s are used; when amplifying fragment c, primers I miR-s and Oligo B are used; then the obtained PCR product is recovered and used for the second round of PCR reaction to generate fragment d, and the product fragment d obtained by the second round of PCR reaction is recovered; finally, the fragment d and the pENTR1A empty vector plasmid are simultaneously subjected to double enzyme digestion, and the pENTR1A-ami-CmERF12 vector is obtained by ligation and transformation, and then the pENTR1A-ami-CmERF12 vector is subjected to LR recombination with the plant expression vector pMDC32 to obtain the interference vector pMDC32-ami-CmERF12;

[0016] The primers used in the PCR reaction are:

[0017] I miR-s: gaTTTTAGAACCACGTAAAGCAGtctctcttttgtattcc

[0018] II miR-a: gaCTGCTTTACGTGGTTCTAAAAtcaaagagaatcaatga

[0019] III miR*s: gaCTACTTTACGTGGATCTAAATtcacaggtcgtgatatg

[0020] IV miR*a: gaATTTAGATCCACGTAAAGTAGtctacatatattattcct

[0021] Oligo A:CTGCAAGGCGATTAAGTTGGGTAAC

[0022] Oligo B: GCGGATAACAATTTCACACAGGAAACAG.

[0023] As a preferred technical solution, in step (2), the interference expression vector is transformed into the cultivated chrysanthemum variety using the Agrobacterium-mediated leaf disc method.

[0024] As a preferred technical solution, the process of screening CmERF12 transgenic chrysanthemum interference strains with low CmERF12 gene expression in step (2) is: screening transgenic resistant plants and verifying transgenic positive seedlings by PCR detection at the genome level; screening CmERF12 transgenic chrysanthemum interference strains with low CmERF12 gene expression by qRT-PCR detection of the relative expression level of the CmERF12 gene in the transgenic positive seedlings.

[0025] The experimental materials in the specific embodiment of the technical solution of the present invention are selected from the sterile seedlings of the cultivated chrysanthemum variety 'Yuhualuoying' with a seedling age of 30 days, and the chrysanthemum 'Yuhualuoying' is transformed by the leaf disc method mediated by Agrobacterium. However, the experimental materials applicable to the technical solution of the present invention are not limited to this chrysanthemum variety. In this specific embodiment, the CmERF12 transgenic chrysanthemum interference strain is obtained by optimizing the regeneration and genetic transformation system, using the sterile seedlings of 'Yuhualuoying' as materials, and through the processes of obtaining leaf discs, pre-culture, infection, co-culture (dark), delayed culture, and selective subculture, the obtained resistant buds are finally transferred to the hygromycin rooting screening medium for screening, and the albinism, yellowing and plants that cannot grow and root normally are removed, and finally resistant rooting plants are obtained.

[0026] The process of verifying transgenic positive seedlings by PCR detection at the genome level is as follows: two pairs of primers are used to detect whether the resistant seedlings obtained are transgenic positive seedlings. The two pairs of primers are Hyg-F, Hyg-R and 35S, II, wherein the first pair of primers is designed based on the hygromycin resistance sequence on the pMDC32 vector, and the length of the PCR product of this pair of primers is theoretically about 750bp; the second pair of primers is designed with the CaMV35S promoter sequence on the pMDC32 vector as a template for the front primer, and the gene-specific primer II is used as the rear primer. The PCR reaction is performed with the two pairs of primers respectively, and the resistant seedlings that can obtain the target band are transgenic positive seedlings.

[0027] The process of detecting the relative expression level of CmERF12 gene in transgenic positive seedlings by qRT-PCR is as follows: after the positive seedlings determined by ordinary PCR detection are propagated and subcultured for 15 days, leaves of the same leaf position of tissue culture seedlings with the same growth potential are taken, and the total plant RNA is extracted and reverse transcribed into cDNA to quantitatively verify the expression of CmERF12 gene in transgenic positive seedlings.

[0028] As a preferred technical solution, in step (3), artificial hybridization is performed using the screened CmERF12 transgenic chrysanthemum interference strain as the female parent and other chrysanthemum varieties (for example, wild-type tetraploid chrysanthemum brain) as the male parent.

[0029] As a preferred technical solution, the method of artificial hybridization in step (3) is as follows: when the ligulate flowers of the female parent just show color, the petals of the ligulate flowers are cut off until the stigma inside can be seen, but the stigma cannot be touched, and the ligulate flowers are strictly bagged and isolated with a sulfuric acid paper bag; at the same time, the male parent inflorescence that is about to shed pollen is bagged and isolated, and 3-5 days after the female parent is emasculated, the growth of the stigma of the female parent is checked in time, and it can be observed that the stigma extends out of the petals and forks to present a "Y" shape, and a large amount of mucus is secreted on the surface of the stigma to identify with the pollen and promote the germination of the pollen tube. This is the best pollination period; a sunny and windless day is selected, and fresh pollen of the tetraploid chrysanthemum brain is collected with a clean glass dish for pollination and immediately bagged and isolated, and a second pollination is performed the next day.

[0030] The present invention verifies the embryos of CmERF12-RNAi transgenic chrysanthemum strains after distant hybridization by morphological and cytological observation of the embryos. The specific process of the morphological observation of the embryos is: respectively taking chrysanthemum embryos of the experimental chrysanthemum variety (such as 'Yuhualuoying') 12 days and 18 days after pollination, observing the embryo development under a stereo microscope, and counting the normal embryo ratio and ovary fullness rate. At the same time, the embryos are taken out with a dissecting needle, the embryo ovule structure is observed, and a comparative study is performed.

[0031] Cytological observation of embryonic development was achieved by transmission electron microscopy: the sampling time and quantity were the same as those of stereomicroscope, and the samples were fixed with glutaraldehyde (PH=6.8) and stored in a 4°C refrigerator for later use.

[0032] Statistics of the fruit set rate of CmERF12 transgenic interference strains after distant hybridization: 40-60 days after pollination of transgenic chrysanthemums, when the female parent pedicels began to turn yellow and wither, the pollinated inflorescences were removed, and after natural drying, the flower seeds were collected and the hybrid fruit set rate was counted.

[0033] Beneficial effects of the present invention:

[0034] The present invention aims at the technical problem of low fruiting rate in distant hybridization and provides a method for efficiently reducing embryo abortion rate in chrysanthemum hybridization, which can partially overcome embryo abortion caused by distant hybridization, accelerate the breeding process, and obtain more chrysanthemum varieties with excellent traits; it also provides an important theoretical basis and excellent gene reserve for using gene regulation technology to reduce embryo abortion rate in distant hybridization of chrysanthemum and even other plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 CmERF12 gene cloning and sequence alignment;

[0036] Among them, A: PCR product electrophoresis results; M: 2000 DNA Marker; 1: cloned target fragment B: amino acid sequence comparison of CmERF12 and homologous proteins in other plant species.

[0037] Figure 2 The results of DNA level identification of pMDC32-amiR-CmERF12 resistant seedlings;

[0038] Among them, A: detection results using hygromycin primers; B: detection results using 35S and II primers; M: 2000DNAMarker; 1-15: partial transformation of pMDC32-ami-CmERF12 resistant seedlings; CK1: clean water control; CK2: WT negative control; CK3: recombinant plasmid positive control.

[0039] Figure 3 Quantitative verification results of pMDC32-amiR-CmERF12 positive seedlings;

[0040] Among them, WT: wild type; 1-14: CmERF12 interference strain.

[0041] Figure 4 Morphological characteristics and transmission electron microscopy of chrysanthemum ovaries of ♀Cm×♂Cn and ♀CmERF12-RNAi-Cm×♂Cn.

[0042] Figure 5 The percentage of normal ovaries or seeds at different stages after pollination in the hybrid combinations of ♀Cm×♂Cn and ♀CmERF12-RNAi-Cm×♂Cn. DETAILED DESCRIPTION

[0043] The present invention is further described in detail below in conjunction with specific implementations.

[0044] 1. Cloning of the gene CmERF12 related to embryonic development

[0045] Firstly, the total RNA of Chrysanthemum 'Yuhualuoying' was extracted by Trizol method. Then, according to the gene sequence in the transcriptome of 'Yuhualuoying', full-length primers were designed by Primer 5.0 software (Table 1). The cDNA obtained by reverse transcription was used as a template for ordinary PCR reaction. All amplified products were used for agarose gel electrophoresis detection and gel excision recovery. The recovered products were ligated to pEASY-Blunt Zero Cloning Vector and transformed into Escherichia coli DH5a competent cells. After steps such as recombinant screening and sequencing, the full-length sequence of the target gene was obtained.

[0046] Table 1 Primers for interference vector construction and quantitative verification

[0047]

[0048] 2. Explant disinfection to obtain sterile seedlings

[0049] In the field, stem segments with terminal buds and young lateral buds of Chrysanthemum 'Yuhualuoying' were taken as explants, and rinsed for about 1-2 hours. All subsequent operations were carried out in a clean bench: first, the rinsed explants were soaked in 75% alcohol for 30 seconds, then rinsed with sterilized dd H2O for 2-3 times, then soaked and disinfected with 0.1% HgCl2 solution for 5 minutes, and rinsed with sterile water for 3-4 times. The stem segments were placed on sterile filter paper, and the surface moisture of the stem segments was blown dry with sterile air. Finally, they were cut into small segments with axillary buds, each with a size of 0.5-1.0 cm, and inoculated on ordinary MS culture medium. The germination of axillary buds and the contamination of stem segments were observed at any time. If there was contamination, it should be handled in time. After about 15 days, the sterile seedlings were cut into 2-3 segments with axillary buds, inoculated on new MS culture medium for expansion and culture, and subcultured every 30 days to obtain tissue culture seedlings required for subsequent experiments.

[0050] 3. Construction of pMDC32-ami-CmERF12 interference vector

[0051] The primer information for constructing the interference vector was obtained from the WMD3 (Web miRNA Designer) website (Table 1), and the CmERF12 interference vector was constructed according to the designed primers; the vector construction steps were as follows: using the miR319a plasmid as a template, two rounds of high-fidelity PCR reactions were performed. The first round of reaction amplified fragments a, b, and c. When amplifying fragment a, the primers used were Oligo A and IV miR*a (specific sequences are shown in Table 1); when amplifying fragment b, primers II miR-a and III miR*s were used; when amplifying fragment c, primers I miR-s and Oligo B were used. The reaction program was 95℃ pre-denaturation for 2min, 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 40s, 34 cycles; finally, 72℃ extension for 7min, and storage at 4℃. Then the obtained PCR products were respectively detected by 2% agarose gel electrophoresis, and the bands that met the detection requirements were cut and recovered, and the concentration was measured for the second round of PCR reaction to generate fragment d. In the second round, the addition amounts of a, b, and c should be kept equal. The obtained product d was subjected to 1% agarose gel electrophoresis, and the gel was cut and purified. Finally, the d fragment and the pENTR1A empty vector plasmid were double-digested at the same time, connected for transformation, recombinant detection, and sequencing to obtain the pENTR1A-ami-CmERF12 vector, which was then LR-recombined with the plant expression vector pMDC32 to obtain the interference vector pMDC32-ami-CmERF12, and then transformed into Agrobacterium by freeze-thaw method, and the pMDC32-ami-CmERF12 plant expression vector was introduced into the Agrobacterium strain EHA105.

[0052] 4. Genetic transformation of transgenic chrysanthemum with pMDC32-ami-CmERF12

[0053] The 2nd to 4th leaves from the top of the tissue culture seedlings with a seedling age of 30 days, good growth and bright green leaves were cut into 0.5 cm × 0.5 cm leaf discs, and the leaf discs were placed on the optimal differentiation medium (MS + 6-BA 1.5 mg / L + NAA 0.8 mg / L) for pre-culture with the adaxial side facing down; the Agrobacterium was activated and shake-cultured at 28 ° C to an OD600 of about 0.6 to enrich the bacteria, and the infection solution was prepared by resuspending in MS liquid, and the pre-cultured leaf discs were infected. During the infection process, the leaf disc should be completely immersed in the infection solution; after the infection is completed, the infection solution is absorbed with sterile filter paper, and the leaf disc is placed on a new differentiation medium, and the leaf disc is co-cultured with Agrobacterium tumefaciens under dark conditions; after co-culture, the leaf disc is transferred to a decarboxylation medium with carbenicillin for delayed culture; then the leaf disc is placed in a screening medium with carbenicillin and hygromycin for culture; every 15 days, the leaf is subcultured to a new medium and cultured until resistant buds are formed, and the resistant adventitious buds are transferred to a rooting medium with hygromycin (MS+Hyg11mg / L) for rooting screening.

[0054] 5. PCR detection of pMDC32-ami-CmERF12 transgenic plants (DNA level)

[0055] Two pairs of primers were used to detect whether the resistant seedlings were transgenic positive seedlings. The two pairs of primers were Hyg-F, Hyg-R and 35S, II miR-a. The first pair of primers was designed based on the hygromycin resistance sequence on the pMDC32 vector. The theoretical length of the PCR product of this pair of primers was about 750bp. The second pair of primers was designed with the CaMV35S promoter sequence on the pMDC32 vector as a template for the front primer, and the gene-specific primer II miR-a was used as the rear primer. The PCR reaction was performed with the two pairs of primers respectively. The resistant seedlings with the target bands were transgenic positive seedlings.

[0056] The resistant buds obtained on the screening medium were subcultured onto the rooting medium, and their rooting was observed after 2 weeks. The resistant seedlings that successfully rooted on the rooting screening medium were used to extract plant DNA using the CTAB method, and two pairs of primers were used to detect whether these resistant seedlings were transgenic positive seedlings (primer sequences are shown in Table 1).

[0057] 6. qRT-PCR verification of the relative expression of CmERF12 gene (RNA level)

[0058] After the positive seedlings confirmed by ordinary PCR detection were propagated and subcultured for 15 days, leaves from the same leaf position of the tissue culture seedlings with the same growth were taken to extract the total plant RNA, which was reverse transcribed into cDNA to quantitatively verify the expression of the CmERF12 gene in the transgenic positive seedlings. The quantitative primer sequences are shown in Table 1.

[0059] 7. Distant hybridization of CmERF12-RNAi chrysanthemum interference strains

[0060] The selected RNAi transgenic chrysanthemum lines amiR-6, amiR-7, and amiR-12 with low CmERF12 expression were used as female parents and artificially hybridized with the male parent wild-type tetraploid C. nankingense. The method of artificial hybridization was as follows: when the ligulate flowers of the female parent just showed color, the petals of the ligulate flowers were cut off until the stigma inside could be seen, but the stigma could not be touched, and the ligulate flowers were strictly bagged and isolated with sulfuric acid paper bags. At the same time, the male inflorescence that was about to shed pollen was bagged and isolated. 3-5 days after the female parent was emasculated, the growth of the female parent stigma was checked in time. It can be observed that the stigma stretched out of the petals and forked to present a "Y" shape. A large amount of mucus was secreted on the surface of the stigma, which recognized the pollen and promoted the germination of pollen tubes. This was the best pollination period. A sunny day with plenty of sunshine and no wind was selected, and fresh pollen of the tetraploid C. nankingense was collected with a clean glass dish for pollination and immediately bagged for isolation, and a second pollination was carried out the next day.

[0061] 7. Histological observation of embryonic development after distant hybridization of CmERF12-RNAi chrysanthemum interference strains

[0062] The embryos of CmERF12-RNAi transgenic chrysanthemum lines after distant hybridization were verified by embryo morphology and cytology observations.

[0063] The specific process of embryo morphological observation is: take the chrysanthemum embryos of the experimental chrysanthemum variety (such as 'Yuhualuoying') 12 days and 18 days after pollination, observe the embryo development under a stereo microscope, and count the normal embryo ratio and ovary fullness rate. At the same time, use a dissecting needle to remove the embryo, observe the embryo ovule structure, and conduct comparative studies.

[0064] Cytological observation of embryonic development was achieved by transmission electron microscopy: the sampling time and quantity were the same as those of stereomicroscope, and the samples were fixed with glutaraldehyde (PH=6.8) and stored in a 4°C refrigerator for later use.

[0065] TEM (transmission electron microscopy) was used to observe the embryonic development after distant hybridization. First, the ovules were peeled and collected under a stereo microscope with a syringe, and they were immediately immersed in 2.5% (v / v) glutaraldehyde (0.1 mol / L phosphate buffer, pH = 7.2), and then all samples were stored at 4°C. Next, the ovules were washed five times in the same phosphate buffer and fixed in 1.5% osmium tetroxide for 5 h. Then, the ovules were fixed in a gradient PHEM buffer (60 mM·L -1 pipes; 25mM·L -1 Hepes; 10mM·L -1 EGTA; 2mM L-1 Ovules were treated in 1% MgCl2; pH = 7.0) and 100% ethanol and embedded in Epon 812 resin. Sections (80 nm thick) were cut from each sample using an LKB-V ultramicrotome (Bromma, Sweden) and stained with uranyl acetate and lead citrate. Finally, they were imaged under a transmission electron microscope at 80 kV.

[0066] Statistics of the fruit set rate of CmERF12 transgenic interference strains after distant hybridization: 40-60 days after pollination of transgenic chrysanthemums, when the female parent pedicels began to turn yellow and wither, the pollinated inflorescences were removed, and after natural drying, the flower seeds were collected and the hybrid fruit set rate was counted.

[0067] Results Analysis

[0068] 1. CmERF12 gene cloning

[0069] According to the sequence information of CmERF12 in the chrysanthemum transcriptome library (as shown in SEQ ID NO.1), specific primers were designed (see Table 1), and the gene sequence was cloned using the 'Yuhualuoying' cDNA as a template using high-fidelity PCR technology. The agarose gel electrophoresis results showed that the length of the amplified fragment was approximately between 250-500 bp. The sequencing results were uploaded to SMART (http: / / smart.embl-heidelberg.de / ) to analyze its domain structure, and it was found that there was an AP2 conserved domain at 27-90 bp ( Figure 1 ).

[0070] 2. Obtaining CmERF12 transgenic chrysanthemum lines

[0071] The chrysanthemum 'Yuhualuoying' was transformed by Agrobacterium-mediated leaf disc method, and finally resistant rooted plants were obtained. Some resistant seedlings obtained by rooting screening were identified at the DNA level. Hyg-F, Hyg-R and 35S, II were used as two pairs of identification primers (see Table 1); the identification results are shown in Figure 2 As shown. Among the 15 resistant seedlings identified, 10 of them amplified the target bands of the correct size using two pairs of primers in PCR detection, which was consistent with the size of the positive control. This shows that the experimental results are true and reliable. These 10 resistant seedlings are considered to be transgenic positive seedlings.

[0072] Fluorescence quantitative PCR was used to detect the relative expression of transgenic positive seedlings verified at the DNA level. The quantitative results showed that among the 10 positive seedlings, the relative expression levels of strains 3, 6, 7, and 12 were the lowest, which were 0.48 times, 0.48 times, 0.45 times, and 0.45 times of WT, respectively. Strains 1 and 14 were about 0.5 times of WT; strains 5, 8, and 10 were about 0.6 times of WT, indicating that the CmERF12 gene of these 9 strains was significantly inhibited. The expression level of strain 11 did not change significantly ( Figure 3 ).

[0073] 3. Morphological and cytological observation of embryonic development after distant hybridization of CmERF12-RNAi transgenic interference strains

[0074] The morphology of hybrid embryos at different developmental stages was observed under optical microscopy and transmission electron microscopy. The results showed that at 12DAP, the ovaries of the hybrid combinations of ♀Cm×♂Cn and ♀CmERF12-RNAi-Cm×♂Cn were well developed, with complete morphology and full morphology. The hybrid combination of ♀Cm×♂Cn had more abnormal ovaries, shrunken morphology, and abnormal embryos ( Figure 4 ).

[0075] 4. Statistics of fruiting rate of CmERF12 transgenic interference strains after distant hybridization

[0076] The ratio of normally developed ovaries containing normal embryos at different developmental stages was counted. At 12DAP, 87.0% of the ovaries in the ♀Cm×♂Cn hybrid combination were well-developed and had complete morphology. In contrast, the ratio of normal ovaries in the three ♀CmERF12-RNAi-Cm×♂Cn hybrid combinations was higher than that in the ♀Cm×♂Cn hybrid combination at this time. The ratio of normally developed ovaries was the highest in the ♀CmERF12-RNAi-Cm-7×♂Cn hybrid combination, reaching 91.51% ( Figure 5). At 18DAP, more abnormally developed ovaries were observed. Only 66.79% of the ovaries in the ♀Cm×♂Cn hybrid combination had normal ovary morphology, while all ♀CmERF12-RNAi-Cm×♂Cn hybrid combinations showed a significantly higher proportion of normal ovaries, and the highest proportion was in the ♀CmERF12-RNAi-Cm-12×♂Cn hybrid combination, reaching 77.57%. Finally, at 60DAP, statistics were taken on the full-shaped normal seeds in all hybrid combinations. The results showed that the fruiting rate of the ♀Cm×♂Cn hybrid combination was 1.07%, while the fruiting rate in the ♀CmERF12-RNAi-Cm×♂Cn hybrid combination increased significantly to 3.72%–5.07%.

[0077] Summary: By using CmERF12-RNAi transgenic chrysanthemum as the maternal parent to cross with the wild-type tetraploid C. nankingense as the paternal parent, and counting the proportion of normal embryos at different times after artificial pollination, a method for effectively reducing the embryo abortion rate of chrysanthemum hybrids was obtained, that is, improving the distant hybridization fruiting rate of chrysanthemums through transgenic breeding technology. This can, to a certain extent, break the original interspecific reproductive isolation, improve the distant hybridization fruiting rate of chrysanthemums, obtain more chrysanthemum varieties with excellent traits, and also shorten the traditional hybridization breeding time. Therefore, this invention will provide an important theoretical basis and excellent gene reserve for using gene regulation technology to reduce the embryo abortion rate in distant hybridization of chrysanthemums and even other flowers, and has important scientific significance and application prospects. Sequence Listing <110> Nanjing Agricultural University <120> A method for effectively reducing the abortion rate of chrysanthemum hybrid embryos <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 333 <212> DNA <213> Chrysanthemum (Chrysanthemum morifolium) <400> 1 atggcaataa tctttggaga caccacacca aatgagtcac cagtacaatc acctacgaca 60 ccatcgctaa agcaatttca ttaccgaggc gtacgaaaaa gaccatgggg acgttatgca 120 gcagaaatac gcgatccatg gaagaaaact cgaagatggc taggcacatt tgataccgcg 180 gaagatgctg cacgtgctta cgatgctgct gcgtttgctt tacgtggttc taaagcgaaa 240 atgaattttc ccgcttcgtt ttatccatct gagagcagta ctagtgaccg aaaaataagg 300 atgtttgatt tgaatttgcc tgcgcctatg tgt 333 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <400> 2 atggcaataa tctttggaga cacc 24 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <400> 3 acacataggc gcaggcaa 18 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <400> 4 gattttagaa ccacgtaaag cagtctctct tttgtattcc 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <400> 5 gactgcttta cgtggttcta aaatcaaaga gaatcaatga 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <400> 6 gactacttta cgtggatcta aattcacagg tcgtgatatg 40 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <400> 7 gaatttagat ccacgtaaag tagtctacat atatattcct 40 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <400> 8 ctgcaaggcg attaagttgg gtaac 25 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <400> 9 gcggataaca atttcacaca ggaaacag 28 <210> 10 <211> twenty three <212> DNA <213> Artificial Sequence <400> 10 cttctacaca gccatcggtc cag 23 <210> 11 <211> twenty three <212> DNA <213> Artificial Sequence <400> 11 cggaagtgct tgacattggg gag 23 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 gacgcacaat cccactatcc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 tacgcagcag aaatacgcga 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 cttccgcggt gtcaaatgtg 20

Claims

1. Application of the CmERF12 gene with a nucleotide sequence as shown in SEQ ID NO.1 in effectively reducing the embryo abortion rate of chrysanthemum hybrids, interfering with or inhibiting the expression of the CmERF12 gene in chrysanthemum hybrid parents to reduce the embryo abortion rate of chrysanthemum hybrids.

2. The use according to claim 1, Features: The method comprises the following steps: constructing an interference expression vector of the CmERF12 gene, transferring the constructed interference expression vector into chrysanthemum to screen a CmERF12 transgenic chrysanthemum interference strain with low CmERF12 gene expression; and using the screened CmERF12 transgenic chrysanthemum interference strain as a parent to perform artificial hybridization with other chrysanthemum parents to reduce the abortion rate of chrysanthemum hybrid embryos.

3. A method for effectively reducing the abortion rate of chrysanthemum hybrid embryos, Features: The following steps are involved: (1) constructing an interference expression vector of the CmERF12 gene with a nucleotide sequence as shown in SEQ ID NO.1; (2) The constructed interference expression vector was transferred into chrysanthemum to screen for CmERF12 transgenic chrysanthemum interference strains with low CmERF12 gene expression; (3) Artificial hybridization was performed using the selected CmERF12 transgenic chrysanthemum interference strain as a parent and other chrysanthemum parents to reduce the embryo abortion rate of chrysanthemum hybrids.

4. The method according to claim 3, Features: The process of step (1) constructing the CmERF12 gene interference expression vector is as follows: extracting total RNA from chrysanthemum and reverse transcribing it into cDNA, then using the cDNA as a template to perform a PCR reaction to obtain the full-length sequence of the target gene, and constructing the interference expression vector pMDC32-ami-CmERF12.

5. The method according to claim 3, Features: The construction steps of the interference expression vector pMDC32-ami-CmERF12 are as follows: using the miR319a plasmid as a template, two rounds of high-fidelity PCR reactions were performed, and the first round of reactions amplified fragments a, b, and c. When amplifying fragment a, the primers used were OligoA and IV miR*a, respectively; when amplifying fragment b, primers IImiR-a and III miR*s were used; when amplifying fragment c, primers I miR-s and Oligo B were used; then the PCR product was recovered and used for the second round of PCR reaction to generate fragment d, and the product fragment d obtained by the second round of PCR reaction was recovered; finally, fragment d and the pENTR1A empty vector plasmid were double-digested at the same time, and the pENTR1A-ami-CmERF12 vector was obtained by ligation and transformation, and then the pENTR1A-ami-CmERF12 vector was LR-recombined with the plant expression vector pMDC32 to obtain the interference vector pMDC32-ami-CmERF12; The primers used in the PCR reaction are: I miR-s: gaTTTTAGAACCACGTAAAGCAGtctctcttttgtattcc II miR-a: gaCTGCTTTACGTGGTTCTAAAAtcaaagagaatcaatga III miR*s: gaCTACTTTACGTGGATCTAAATtcacaggtcgtgatatg IV miR*a: gaATTTAGATCCACGTAAAGTAGtctacatatattattcct Oligo A:CTGCAAGGCGATTAAGTTGGGTAAC Oligo B: GCGGATAACAATTTCACACAGGAAACAG.

6. The method according to claim 3, Features: In step (2), the interference expression vector is transformed into the cultivated chrysanthemum variety using the Agrobacterium-mediated leaf disc method.

7. The method according to claim 3, Features: The process of screening CmERF12 transgenic chrysanthemum interference strains with low CmERF12 gene expression in step (2) is: screening transgenic resistant plants and verifying transgenic positive seedlings by PCR detection at the genome level; screening CmERF12 transgenic chrysanthemum interference strains with low CmERF12 gene expression by qRT-PCR detection of the relative expression level of the CmERF12 gene in the transgenic positive seedlings.

8. The method according to claim 3, Features: The method of artificial hybridization in step (3) is as follows: when the ligulate flowers of the female parent are just beginning to show color, the petals of the ligulate flowers are cut off until the stigma inside can be seen, but the stigma cannot be touched, and the ligulate flowers are strictly bagged and isolated with a sulfuric acid paper bag; at the same time, the male parent inflorescence that is about to shed pollen is bagged and isolated, and 3-5 days after the female parent is emasculated, the growth of the stigma of the female parent is checked in time, and it can be observed that the stigma extends out of the petals and forks to present a "Y" shape, and a large amount of mucus is secreted on the surface of the stigma to identify with the pollen and promote the germination of the pollen tube. This is the best pollination period; a sunny and windless day is selected, and fresh pollen of the tetraploid chrysanthemum brain is collected with a clean glass dish for pollination and immediately bagged and isolated, and a second pollination is performed the next day.

Images