A fluorescent dye and its preparation method and use

Abstract

A fluorescent dye represented by formula (I), a preparation method and use thereof, wherein the fluorescent dye comprises an electron donor part D, a conjugated system E and an electron acceptor part A. The fluorescent dye has the ability of long-wavelength emission, low background fluorescence, good water solubility, sensitive viscosity response and adjustable wavelength.

Description

Technical Field

[0001] The invention relates to the technical field of fluorescent dyes, and in particular to a fluorescent dye with low background fluorescence, good water solubility, high viscosity sensitivity and adjustable molecular structure, and a preparation method and application thereof. Background Art

[0002] Cell viscosity is one of the important parameters that affect the diffusion rate of substances. By affecting the mobility of substances, it has a great influence on the transport, signal transduction, recognition and interaction of biomacromolecules. At the same time, changes in intracellular viscosity are related to the occurrence of atherosclerosis, diabetes, Alzheimer's disease and tumors, and are potential indicators of these diseases. Therefore, it is of great significance to detect intracellular viscosity. Fluorescence methods are an important means of testing intracellular microscopic viscosity due to their unique advantages such as sensitivity, instantaneous, in situ and visualization. Unlike the determination of the viscosity of macroscopic large-volume viscous fluids, which can be measured using instruments such as rotor viscometers and falling ball viscometers, the determination of intracellular viscosity generally uses fluorescent probes based on molecular rotors. Molecular rotors are a special type of fluorescent molecules, and the energy lost in the non-radiative transition of the excited state changes with the change of viscosity. The increase in viscosity or surrounding rigidity will hinder the distortion of the molecular rotor, and the energy lost in the non-radiative transition of the molecular rotor will decrease, which is specifically manifested as an increase in the fluorescence intensity of the molecular rotor. Therefore, the fluorescence intensity of the molecular rotor can directly reflect the viscosity of the intracellular microenvironment.

[0003] In addition to detecting microviscosity in cells, viscosity-responsive molecular rotor fluorescent molecules are often used in the design of fluorescence-activated light-up probes (fluorogenic probes). This is mainly because when molecular rotor fluorescent molecules bind to proteins, nucleic acids or other biological molecules, their twisting and rotation are restricted (equivalent to an increase in viscosity), the fluorescence is lit, and the unbound molecules are in a twisted state and do not fluoresce, thus achieving low background and high specificity fluorescence lighting for biological molecules. For fluorescent imaging of low-abundance biological molecules in organisms, a lower background is required while ensuring a high signal-to-noise ratio. For example, the widely used thiazole orange dye has a good signal-to-noise ratio when labeling large molecular proteins and tRNA, but it also shows a relatively strong background fluorescence, which is severely limited when labeling some small biological molecules with low abundance. Therefore, it is extremely important to develop fluorescent dye molecules with low background, sensitive viscosity response, and high signal-to-noise ratio, which will have more extensive applications in more fields.

[0004] The main reasons for the high background of various fluorescent probes are: First, the fluorescent probes of the always-on type cannot quench their own fluorescence, resulting in a strong fluorescence background. For example, traditional fluorescent dyes such as coumarin, fluorescein, and rhodamine emit bright fluorescence in water. When they bind to the target substance, they must be washed before imaging, but they often cause strong background fluorescence because they cannot be thoroughly washed. Second, the quenched fluorescent probes cause background fluorescence due to incomplete quenching. For example, rhodamine uses a typical quenching group to quench the fluorescence using PET and FRET, and then images RNA, which causes strong background fluorescence due to incomplete quenching. Third, the environmentally responsive fluorescent probes cause background fluorescence due to poor water solubility and lipophilicity. Environmentally responsive fluorescent molecules do not fluoresce in water themselves. When they bind to the target, the fluorescence is lit up. However, if the water solubility of the fluorescent probe is too poor, it will bind to the cell membrane structure due to the principle of similar compatibility, thereby activating some fluorescence and causing background problems. Therefore, as a viscosity-responsive fluorescent probe, to solve the problem of background fluorescence, improving the water solubility of the probe is a key factor.

[0005] The biggest advantage of fluorescent dyes as fluorescent probes over fluorescent proteins is that the structure of small molecule fluorescent dyes is adjustable, so the wavelength can be adjusted to achieve different color labeling of biological molecules. Although the structure of small molecule fluorescent probes is adjustable, many of them require many steps in organic synthesis, and the synthesis yield of many molecules is not high, so a relatively high price is paid. In addition, as fluorescent dyes, long wavelengths have obvious advantages, but in the structure of existing dyes, long-wavelength molecules generally have relatively large conjugation, and large conjugation generally means that the water solubility of the compound is relatively poor, which will lead to background fluorescence problems. If only one chemical element on the dye molecule is changed, the wavelength can be significantly changed, and the wavelength can be moved to a long wavelength, then the structure of the fluorescent molecule can be kept small while the wavelength can be made longer, which can ensure the water solubility of the dye molecule while achieving the long wavelength of the dye molecule, which will be of great significance for biological imaging. Summary of the invention

[0006] The object of the present invention is to provide a fluorescent dye with low background fluorescence, good water solubility, sensitive viscosity response and adjustable wavelength.

[0007] In one aspect of the present invention, a fluorescent dye is provided, comprising an electron donor portion D, a conjugated system E and an electron acceptor portion A, wherein the fluorescent dye is as shown in formula (I):

[0008]

[0009] The electron donor part -D is (X1)(X2)N-, X1 and X2 are independently selected from hydrogen, alkyl, or modified alkyl, and X1 and X2 are optionally connected to each other to form an aliphatic heterocycle together with the N atom;

[0010] The conjugated system E is formed by conjugating at least one selected from a sub-aromatic ring and a sub-aromatic heterocyclic ring, wherein each hydrogen atom contained in the conjugated system E is optionally independently substituted by an alkyl group;

[0011] X1 and X2 in the electron donor part D- optionally independently form an aliphatic heterocycle together with the N atom and the conjugated system E;

[0012] The electron acceptor portion optionally forms a cyclic structure of the following formula (I-1):

[0013]

[0014] in,

[0015] R1 is independently selected from -O-, -S-, and -(NR a )-, where R a is selected from hydrogen, or alkyl;

[0016] R2 is independently selected from =O, =S, and =NH;

[0017] R3 is independently selected from =O, =S, =NH;

[0018] X is independently selected from hydrogen, alkyl or modified alkyl;

[0019] Wherein, the "alkyl" is C1-C 30 A straight or branched alkyl group; preferably, C1-C 10 Straight or branched alkyl; preferably, C1-C7 straight or branched alkyl; preferably, C1-C5 straight or branched alkyl; preferably, selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl ... hexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, 2-ethylbutyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, 2,2-dimethylpentyl, 3,3-dimethylpentyl, 2,3-dimethylpentyl, 2,4-dimethylpentyl, 3-ethylpentyl or 2,2,3-trimethylbutyl;

[0020] The "modified alkyl" is a group obtained by replacing any carbon atom of an alkyl group with at least one group selected from a halogen atom, -O-, -OH, -CO-, -SO2-, -(S=O)-, a primary amino group, a secondary amino group, a tertiary amino group, and the modified alkyl group has 1 to 30 carbon atoms (optionally, the modified alkyl group has 1 to 12 carbon atoms; alternatively, the modified alkyl group has 1 to 10 carbon atoms; alternatively, the modified alkyl group has 1 to 8 carbon atoms; alternatively, the modified alkyl group has 1 to 5 carbon atoms; alternatively, the modified alkyl group has 1 to 2 carbon atoms),

[0021] The carbon atom is replaced, which means that the carbon atom or the carbon atom together with the hydrogen atoms thereon are replaced by the corresponding group;

[0022] The "aliphatic heterocycle" is a saturated or unsaturated 4-10-membered monocyclic or polycyclic aliphatic heterocycle containing at least one heteroatom selected from N, O, or S on the ring. When the aliphatic heterocycle contains an S atom, it is -S-, -SO-, or -SO2-; the aliphatic heterocycle is optionally substituted by an alkyl group;

[0023] The "sub-aromatic ring" is a 6- to 13-membered monocyclic or fused bicyclic or fused polycyclic sub-aromatic group;

[0024] The “heteroaromatic heterocycle” is a 5-12-membered monocyclic or fused bicyclic or fused polycyclic heteroaromatic group containing at least one heteroatom selected from N, O, S or Si in the ring;

[0025] The "halogen atoms" are each independently selected from F, Cl, Br, I;

[0026] The "primary amine group" is a RNH2 group;

[0027] The "secondary amine group" is a RNHR' group;

[0028] The "tertiary amine group" is a RNR'R" group;

[0029] Each R, R', and R" are independently a single bond, an alkyl group, an alkylene group, a modified alkyl group, or a modified alkylene group;

[0030] The "alkylene" is C1-C 10 Straight or branched chain alkylene, which may be C1-C6 branched or branched chain alkylene;

[0031] The "modified alkylene" is C1-C 10 (optionally C1-C6) a group obtained by replacing any carbon atom of an alkyl or alkylene group by a group selected from -O-, -OH, -CO-, -CS-, -(S=O)-; the carbon atom being replaced means that the carbon atom or the carbon atom together with the hydrogen atoms on it are replaced by the corresponding group;

[0032] Optionally, the modified alkyl or modified alkylene group is independently a group containing at least one group selected from -OH, -O-, -NH2, ethylene glycol unit (-(CH2CH2O)n-), C1-C8 alkyl, C1-C8 haloalkyl (preferably C2-C6 haloalkyl), C1-C8 alkylcarboxyl (preferably C2-C6 alkylcarboxyl), -SO2-NH-, halogen atom, cyano, nitro, wherein n is 1-30, more preferably 1-10; more preferably 1-2;

[0033] Optionally, the C1-C8 alkyl group is methyl, ethyl, propyl, isopropyl, the C1-C8 alkoxy group is methoxy, ethoxy, propoxy, isopropoxy, the C1-C8 acyloxy group is acetoxy, ethyl, propyl, isopropyl, and the C1-C8 haloalkyl group is trifluoromethyl, chloromethyl, bromomethyl;

[0034] Optionally, the aliphatic heterocycle is selected from morpholine, thiomorpholine, and tetrahydropyridine;

[0035] Optionally, X1 and X2 are each independently substituted by one or more groups selected from hydroxyl, cyano, halogen, carboxyl, 1-10 Straight or branched chain alkyl;

[0036] Optionally, the conjugated system E is selected from the structures in the following formulae (I-2-1) to (I-2-20):

[0037]

[0038]

[0039] Alternatively, the conjugated system E and (X1)(X2)N- form an aliphatic heterocycle as shown in (I-3-1)-(I-3-4):

[0040]

[0041] Optionally, the electron acceptor A part is one selected from the following formulas (I-4-1) to (I-4-43):

[0042]

[0043]

[0044] Optionally, the fluorescent dye formula (I) is selected from the following compounds:

[0045]

[0046]

[0047] The second aspect of the present invention is to provide a method for preparing the above-mentioned fluorescent dye, characterized in that it includes a synthetic reaction step of reacting a compound of formula (a) with a compound of formula (b) to generate a fluorescent dye represented by formula (I):

[0048]

[0049] The third aspect of the present invention is to provide the use of the above-mentioned fluorescent dye in viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

[0050] The fourth aspect of the present invention is to provide the use of the above-mentioned fluorescent dye in the preparation of viscosity test, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection reagents.

[0051] A fifth aspect of the present invention provides a fluorescence-activated light-up type probe, characterized in that it comprises the above-mentioned fluorescent dye.

[0052] The sixth aspect of the present invention provides the use of the above-mentioned fluorescence-activated light-up probe in protein fluorescence labeling, nucleic acid fluorescence labeling, protein quantification or detection, or nucleic acid quantification or detection.

[0053] The seventh aspect of the present invention provides the use of the above-mentioned fluorescence-activated light-up probe in the preparation of protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection reagents.

[0054] The fluorescent dye obtained by the present invention has long-wavelength emission (the longest emission wavelength is 800nm). Its fluorescence intensity increases with the increase of environmental viscosity, the logarithm of the fluorescence intensity and the logarithm of the solvent viscosity have a good linear relationship, the relationship between the fluorescence intensity and the viscosity conforms to the Hoffman equation and has a high slope, and it is sensitive to viscosity, has a high activation multiple and is insensitive to polarity changes.

[0055] The fluorescent dye obtained by the present invention can be used to measure the viscosity of the sample, for example, it is suitable for testing the microscopic viscosity. According to another embodiment, the fluorescent dye obtained can be specifically bound to the corresponding antibody, aptamer or amyloid protein, or bonded to the protein tag or enzyme through a ligand or inhibitor to obtain a series of fluorescence-activated light-up probes for fluorescent labeling, quantification or monitoring of proteins, enzymes or nucleic acids. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 For dye7 (1×10 -5 M) Fluorescence emission intensity diagram under different viscosity conditions;

[0057] Figure 2For dye7 (1×10 -5 M) Linear relationship between viscosity condition and fluorescence intensity;

[0058] Figure 3 For dye9 (1×10 -5 M) Fluorescence emission intensity diagram under different viscosity conditions;

[0059] Figure 4 For dye9 (1×10 -5 M) Linear relationship between viscosity condition and fluorescence intensity;

[0060] Figure 5 For dye dye12 (1×10 -5 M) Fluorescence emission intensity diagram under different viscosity conditions;

[0061] Figure 6 For dye dye12 (1×10 -5 M) Linear relationship between viscosity condition and fluorescence intensity;

[0062] Figure 7 Dye25 (1×10 -5 M) Fluorescence emission intensity diagram under different viscosity conditions;

[0063] Figure 8 Dye25 (1×10 -5 M) Linear relationship between viscosity condition and fluorescence intensity;

[0064] Fig. 9 Dye40 (1×10 -5 M) Fluorescence emission intensity diagram under different viscosity conditions;

[0065] Fig.10 Dye40 (1×10 -5 M) Linear relationship between viscosity condition and fluorescence intensity;

[0066] Fig.11 For dye7 (1×10 -5 M) Fluorescence emission intensity diagram under different polarity conditions;

[0067] Fig.12 For dye9 (1×10 -5 M) Fluorescence emission intensity diagram under different polarity conditions;

[0068] Fig.13 For dye dye12 (1×10 -5 M) Fluorescence emission intensity diagram under different polarity conditions;

[0069] Fig.14Dye25 (1×10 -5 M) Fluorescence emission intensity diagram under different polarity conditions;

[0070] Fig.15 Dye40 (1×10 -5 M) Fluorescence emission intensity diagram under different polarity conditions;

[0071] Fig.16 This is a comparison chart of the emission spectra of dyes dye5 and dye6;

[0072] Fig.17 This is a comparison chart of the emission spectra of dyes dye11, dye12, and dye14;

[0073] Fig.18 This is a comparison chart of the emission spectra of dyes dye12 and dye13;

[0074] Fig.19 is the emission spectrum of dye dye39;

[0075] Fig. 20 is the emission spectrum of dye dye42;

[0076] Fig.21 This is a comparison of the background fluorescence of dyes dye1 and dye48 in PBS solution;

[0077] Fig. 22 This is a comparison of the background fluorescence of dyes dye22 and dye49 in PBS solution;

[0078] Fig.23 This is a comparison of the background fluorescence of dyes dye40 and dye50 in PBS solution;

[0079] Fig.24 This is a comparison of the background fluorescence of dyes dye9, dye10 and dye47 in PBS solution;

[0080] Fig.25 The dyes dye1, dye12, dye25, and dye41 are used to label aptamers in cells;

[0081] Fig.26 This is the flow cytometric graph of dye dye3 combined with RNA aptamer;

[0082] Fig. 27 This is the flow cytometric graph of dye13 binding to RNA aptamer;

[0083] Fig.28 This is the flow cytometric graph of dye dye21 binding to RNA aptamer;

[0084] Fig.29 This is the flow cytometric graph of dye dye34 combined with RNA aptamer;

[0085] Fig.30 This is the flow cytometric graph of dye50 binding to RNA aptamer; DETAILED DESCRIPTION

[0086] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate the present invention and are not used to limit the present invention.

[0087]

[0088] Compound 1

[0089] 5-Bromothiophene-2-carboxaldehyde (0.5 g, 2.6 mmol) and 2-methylaminoethanol (0.78 g, 10.4 mmol) were dissolved in 10 ml of water and heated in an oil bath at 100 °C under Ar protection. The reaction was allowed to proceed overnight. After the reaction was completed, the mixture was cooled to room temperature and extracted with dichloromethane three times. The mixture was washed with saturated brine and dried over anhydrous sodium sulfate. The organic phase was spin-dried and the residue was subjected to column chromatography to obtain 0.4 g of compound 1 with a yield of 84%. 1 H NMR (400MHz, DMSO-d6) δ9.40 (s, 1H), 7.65 (d, J = 4.5Hz, 1H), 6.12 (d, J = 4.5Hz, 1H), 3.62 (q, J = 5.5Hz, 2H), 3.47 (t, J = 5.6Hz, 2H), 3.09 (s, 3H).

[0090] dye1

[0091]

[0092] Compound 1 (0.2 g, 1.08 mmol) and 3-methylthiazolidine-2,4-dione (0.13 g, 1.30 mmol) were dissolved in 50 ml of anhydrous ethanol, and a catalytic amount of piperidine was added. The mixture was heated in an oil bath at 90 ° C under Ar protection conditions and reacted for 3 h. After the reaction was completed, the mixture was cooled to room temperature. A large amount of solid precipitated in the system, which was filtered. The filter cake was washed twice with cold ethanol and dried in vacuum to obtain 10.2 g of yellow compound dye with a yield of 71.4%. 1 H NMR (400MHz, DMSO-d6) δ7.71 (s, 1H), 7.43 (d, J = 4.4Hz, 1H), 6.15 (d, J = 4.4Hz ,1H),3.62(q,J=5.5Hz,2H),3.46(t,J=5.6Hz,2H),3.20(s,3),3.09(s,3H).

[0093] Compound 2

[0094]

[0095] The synthesis steps of compound 2 refer to the synthesis method of compound 1, and the yield is 50%. 1 H NMR (400MHz, DMSO-d6) δ9.70 (s, 1H), 6.82 (s, 1H), 3.62 (q, J = 5.5Hz, 2H), 3.47 (t, J = 5.6Hz, 2H), 3.09 (s, 3H).

[0096] dye2

[0097]

[0098] The synthesis steps of dye2 refer to the synthesis method of dye1, with a yield of 76%. 1 H NMR (400MHz, DMSO-d6) δ9.70(s,1H),6.82(s,1H),4.10(q,J=7.0Hz 4H),3.62(q,J=5.5Hz,2H),3.47(t,J=5.6Hz,2H),3.09(s,3H),1.2(t,J=7.1Hz 3H).

[0099] Compound 3

[0100]

[0101] Benzomorpholine (0.30 g, 2 mmol) was dissolved in 20 mL DMF, and cesium carbonate (0.78 g, 2.4 mmol) and iodomethane (0.31 g, 2.2 mmol) were added. The mixture was heated in an oil bath at 65 °C under Ar protection for 4 h. After the reaction was completed, the mixture was cooled to room temperature and poured into 50 mL of water. The mixture was extracted with dichloromethane 3 times × 50 mL. The organic phases were combined and the solvent was evaporated by rotary evaporation. The product was separated by column chromatography to obtain 0.290 g of the product with a yield of 90.6%. 1 H NMR (400MHz, DMSO-d6) δ6.98-6.94(m,1H),6.94-6.88(m,1H),6.67(dd,J=8.1,1.2Hz ,1H),6.57(td,J=7.5,1.2Hz,1H),3.38-3.32(m,2H),3.05-2.80(m,2H),2.69(s,3H).

[0102] 10 ml of DMF was added to a three-necked flask and placed in an ice bath to cool for 5 min. 0.2 ml of phosphorus oxychloride was added dropwise and stirred for 1 h under ice bath conditions. The above compound was dissolved in DMF and added dropwise to the system. It was stirred for 0.5 h under Ar protection and ice bath conditions. The system was slowly warmed to room temperature and stirred for 5 h. After the reaction was completed, saturated sodium carbonate solution was added to adjust the pH to 10.0. The mixture was stirred overnight at room temperature. The organic phase was separated the next day, and the aqueous phase was extracted three times with 50 ml of dichloromethane. The organic phases were combined and washed twice with saturated brine. The organic phase was dried over anhydrous sodium sulfate, and the solvent was evaporated by rotary evaporation. The residue was separated by column chromatography to obtain 0.25 g of a yellow solid with a yield of 74%. 1 H NMR(400MHz,DMSO-d6)δ10.26(s,1H)6.98-6.94(m,1H),6.94-6.88(m,1H),6. 57(td,J=7.5,1.2Hz,1H),3.38-3.32(m,2H),3.05-2.80(m,2H),2.69(s,3H).

[0103] dye3

[0104]

[0105] dye3

[0106] The synthesis steps of dye3 refer to the synthesis method of dye1, with a yield of 82%. 1 H NMR(400MHz,DMSO-d6)δ11.71(s,1H),11.56(s,1H),6.98-6.94(m,1H),6.94-6.88(m,1H),6 .65(s,1H),6.57(td,J=7.5,1.2Hz,1H),3.38-3.32(m,2H),3.05-2.80(m,2H),2.69(s,3H).

[0107] dye4

[0108]

[0109] The synthesis method of dye4 refers to the synthesis steps of dye1, with a yield of 70%. 1 H NMR(400MHz,DMSO-d6)δ13.81(s,1H),6.98-6.94(m,1H),6.94-6.88(m,1H),6.65(s, 1H),6.57(td,J=7.5,1.2Hz,1H),3.38-3.32(m,2H),3.05-2.80(m,2H),2.69(s,3H).

[0110] Compound 4

[0111]

[0112] The synthesis method of compound 4 refers to the synthesis method of compound 3, with a yield of 56%. 1 H NMR(400MHz,DMSO-d6)δ10.11(s,1H)6.98-6.94(m,1H),6.94-6.88(m,1H),6. 57(td,J=7.5,1.2Hz,1H),3.57-3.42(m,2H),3.13-3.00(m,2H),2.87(s,3H).

[0113] dye5

[0114]

[0115] Dye5 was synthesized according to the method of dye1, with a yield of 65.8%. 1 H NMR (400MHz, DMSO-d6) δ11.75(s,1H),7.42(s,1H),7.38-7.15(m,2H),6.82(d,J=8.7Hz,1H),3.76-3.57(m,2H),3.13-3.05(m,2H),3.03(s,3H).

[0116] dye6

[0117]

[0118] Dye 6 was synthesized according to the method of dye 1, with a yield of 75.8%. 1 H NMR (400MHz, DMSO-d6) δ13.15(s,1H),7.42(s,1H),7.38-7.15(m,2H),6.82(d,J=8.7Hz,1H),3.76-3.57(m,2H),3.13-3.05(m,2H),3.03(s,3H).

[0119]

[0120] Compound 5 was synthesized by referring to the method of compound 3, with a yield of 65.7%. 1H NMR (400MHz, DMSO-d6) δ10.21(s,1H),7.33(dd,J=8.8,2.2Hz,1H),7.15(d,J=2.2Hz,1H),6. 63(d,J=8.8Hz,1H),5.47(d,J=1.5Hz,1H),2.87(s,3H),1.96(d,J=1.4Hz,3H),1.34(s,6H).

[0121]

[0122] The dye was synthesized according to the method of dye1, with a yield of 84.2%. 1 H NMR (400MHz, DMSO-d6) δ13.86(s,1H),7.41(s,1H),7.33(dd,J=8.8,2.2Hz,1H),7.15(d,J=2.2Hz, 1H), 6.63 (d, J = 8.8Hz, 1H), 5.47 (d, J = 1.5Hz, 1H), 2.87 (s, 3H), 1.96 (d, J = 1.4Hz, 3H), 1.34 (s, 6H).

[0123] dye8

[0124]

[0125] Dye8 was synthesized according to the method of dye1, with a yield of 80.3%. 1 H NMR (400MHz, DMSO-d6) δ7.41(s,1H),7.33(dd,J=8.8,2.2Hz,1H),7.15(d,J=2.2Hz,1H),6.63(d,J=8.8H z,1H),5.47(d,J=1.5Hz,1H),4.40(m,2H),2.87(s,3H),2.61(m,2H)1.96(d,J=1.4Hz,3H),1.34(s,6H).

[0126] Compound 6

[0127]

[0128] Compound 6 was synthesized by referring to the method of compound 3, with a yield of 60.7%. 1 H NMR (400MHz, DMSO-d6) δ10.25(s,1H),6.95(s,2H),3.25(dd,J=6.6,4.9Hz,4H),2.68(t,J=6.3Hz,4H),2.05-1.57(m,4H).

[0129] dye9

[0130]

[0131] Dye9 was synthesized according to the method of dye1, with a yield of 88.6%. 1 H NMR (400MHz, DMSO-d6) δ12.21(s,1H),7.31(s,1H),6.95(s,2H),3.25(dd,J=6.6,4.9Hz,4H),2.68(t,J=6.3Hz,4H),2.05-1.57(m,4H).

[0132] dye10

[0133]

[0134] Dye10 was synthesized according to the method of dye1, with a yield of 82.4%. 1 H NMR (400MHz, DMSO-d6) δ19.21(s,1H),7.31(s,1H),6.95(s,2H),3.25(dd,J=6.6,4.9Hz,4H),2.68(t,J=6.3Hz,4H),2.05-1.57(m,4H).

[0135] Compounds 7, 8

[0136]

[0137] Compound 7:

[0138] 2-Bromodithiophene (0.438 g, 2 mmol) was dissolved in 15 mL of N-methyl-N-hydroxyethylamine, and copper powder (6.4 mg, 0.01 mmol), cuprous iodide (19 mg, 0.01 mmol), and tripotassium phosphate (0.850 g, 4 mmol) were added. The mixture was heated in an oil bath at 80 ° C overnight under Ar protection. After the reaction was completed, the mixture was cooled to room temperature and poured into 50 mL of water. The mixture was extracted with dichloromethane 3 times × 50 mL. The organic phases were combined and the solvent was evaporated by rotary evaporation. 0.362 g of a yellow product was obtained by column chromatography with a yield of 85%. 1 H-NMR (400MHz, CDCl3): δ=7.92 (s, 1H), 7.63 (d, 1H, J=5.2Hz), 7.31 (d, 1H, J=5.2Hz), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.10 (s, 3H).

[0139] Compound 8:

[0140] Compound 8 (0.426 g, 2 mmol) was dissolved in 50 ml of anhydrous dichloromethane, 1 ml of triethylamine was added, and acetic anhydride (0.3 ml, 3 mmol) was slowly added dropwise under ice bath conditions. After the addition was completed, the system was slowly warmed to room temperature and stirred for 3 h. After the reaction was completed, 100 ml of water was added, the organic phase was separated, and the aqueous phase was extracted twice with 50 ml of dichloromethane. The organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was evaporated in a rotary evaporator. The residue did not need further purification and was directly used in the next step.

[0141] The above residue was dissolved in 50 ml of dichloromethane, 5 ml of dimethylformamide was added, 2 ml of phosphorus oxychloride was added under ice bath condition, and the mixture was stirred for 0.5 h under Ar protection condition. The system was slowly warmed to room temperature and continued to be stirred for 5 h. After the reaction was completed, a saturated sodium carbonate solution was added to adjust the pH to 10.0, and the mixture was stirred overnight at room temperature. The organic phase was separated the next day, and the aqueous phase was extracted three times with 50 ml of dichloromethane. The organic phases were combined and washed twice with saturated brine. The organic phase was dried over anhydrous sodium sulfate, and the solvent was evaporated by rotary evaporation. The residue was separated by column chromatography to obtain 0.285 g of a yellow solid with a yield of 59%. 1 H-NMR (400MHz, CDCl3): δ=10.01 (s, 1H), 7.92 (s, 1H), 7.63 (s, 1H), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.10 (s, 3H).

[0142] dye11

[0143]

[0144] Dye11 was synthesized according to the method of dye1, with a yield of 78.4%. 1 H-NMR (400MHz, CDCl3): δ=12.01 (s, 1H), 7.57 (s, 1H), 7.92 (s, 1H), 7.63 (s, 1H), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.10 (s, 3H).

[0145]

[0146] Dye12 was synthesized according to the method of dye1, with a yield of 78.3%. 1 H-NMR (400MHz, CDCl3): δ=13.25 (s, 1H), 7.57 (s, 1H), 7.92 (s, 1H), 7.63 (s, 1H), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.10 (s, 3H).

[0147] dye13

[0148]

[0149] Dye13 was synthesized according to the method of dye1, with a yield of 87.1%. 1 H-NMR (400MHz, CDCl3): δ=11.35(s, 1H), 11.25(s, 1H), 7.87(s, 1H), 7.92(s , 1H), 7.63 (s, 1H), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.10 (s, 3H).

[0150] dye14

[0151]

[0152] Dye14 was synthesized according to the method of dye1, with a yield of 87.1%. 1 H-NMR (400MHz, CDCl3): δ=18.35 (s, 1H), 6.87 (s, 1H), 7.92 (s, 1H), 7.63 (s, 1H), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.10 (s, 3H).

[0153] dye15

[0154]

[0155] Dye15 was synthesized according to the method of dye1, with a yield of 84.7%. 1 H-NMR (400MHz, CDCl3): δ=7.42 (s, 1H), 7.92 (s, 1H), 7.63 (s, 1H), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.34 (s, 3H), 3.10 (s, 3H).

[0156] dye16

[0157]

[0158] Dye16 was synthesized according to the method of dye1, with a yield of 82.1%. 1 H-NMR (400MHz, CDCl3): δ=6.72 (s, 1H), 7.92 (s, 1H), 7.63 (s, 1H), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.52 (s, 3H), 3.10 (s, 3H).

[0159] dye17

[0160]

[0161] Dye17 was synthesized according to the method of dye1, with a yield of 82.7%. 1 H-NMR (400MHz, CDCl3): δ = 12.03 (s, 1H), 11.41 (s, 1H), 6.72 (s, 1H), 7.92 (s, 1H), 7.63 (s, 1H), 4. 40 (m, 2H), 3.85 (t, 2H, J = 5.6Hz), 3.60 (t, 2H, J = 5.6Hz), 3.52 (s, 3H), 3.10 (s, 3H), 2.62 (m, 2H).

[0162] dye18

[0163]

[0164] Compound 9

[0165] Compound 9 was synthesized according to the synthesis method of Organic & Biomolecular Chemistry, 7(1), 142-154; 2009. 1H-NMR (400 MHz, CDCl3): δ=10.05 (s, 1H), 7.57 (s, 1H), 7.92 (s, 1H), 3.95 (m, 4H), 3.45 (m, 8H), 3.10 (s, 3H).

[0166] The dye was synthesized according to the method of dye 1, with a yield of 52.3%. 1H-NMR (400 MHz, CDCl3): δ = 8.02 (s, 1H), 7.57 (s, 1H), 7.92 (s, 1H), 3.95 (m, 4H), 3.45 (m, 8H), 3.25 (s, 3H), 3.10 (s, 3H).

[0167] dye19

[0168]

[0169] Compound 10

[0170] Compound 10 was synthesized with reference to the method of the literature (Journal of Organic Chemistry, 83 (15), 8533-8542; 2018) with a yield of 52.1%. 1H-NMR (400 MHz, CDCl3): δ = 10.15 (s, 1H), 7.57 (s, 1H), 7.92 (s, 1H), 3.10 (s, 3H) 3.08 (m, 2H), 1.58-1.43 (m, 18H).

[0171] Dye 19 was synthesized by referring to the method for synthesizing dye 1, with a yield of 88.9%. 1 H-NMR (400MHz, CDCl3): δ=8.23 (s, 1H), 7.57 (s, 1H), 7.92 (s, 1H), 3.25 (s, 3H), 3.10 (s, 3H), 3.08 (m, 2H), 1.58-1.43 (m, 18H).

[0172] Compounds 11, 12, and 13

[0173]

[0174] Compound 11

[0175] Thieno[3,2-b]thiophene (10 g, 71.31 mmol) was added to a 250 ml three-necked flask, 120 ml of anhydrous tetrahydrofuran was added to dissolve, and the mixture was cooled at -78°C. 49 ml of 1.6 M n-butyl lithium was added dropwise to the system, and the temperature was kept at -78°C for 2 hours. The refrigeration was turned off, and the mixture was slowly returned to room temperature and stirred overnight. After the reaction was completed, 40 ml of water was added under an ice bath to quench the reaction, and the system was poured into 200 ml of dichloromethane for extraction. The aqueous phase was extracted three times with dichloromethane, and the organic phase was dried with anhydrous sodium sulfate. The solvent was spin-dried, and the residue was separated by column chromatography to obtain 10.7 g of compound. The yield was 90%. 1 H NMR (400MHz, Chloroform-d) δ9.97 (s, 1H), 7.94 (s, 1H), 7.70 (d, J = 5.3Hz, 1H), 7.33 (d, J = 5.3Hz, 1H).

[0176] Compound 12

[0177] Compound 11 (10 g, 59.5 mmol) was dissolved in 120 ml of a mixed solvent of dry DMF and acetic acid (1:1), and NBS (11.66 g, 65.5 mmol) was added. The mixture was heated in an oil bath at 120°C under Ar protection and refluxed overnight. After the reaction was completed, the mixture was extracted three times with ethyl acetate and water. The organic phases were combined and dried, the solvent was spin-dried, and the residue was subjected to column chromatography to obtain 11.2 g of the product with a yield of 78%. 1 H NMR (400MHz, Chloroform-d) δ10.01 (s, 1H), 7.70 (d, J = 5.3Hz, 1H), 7.33 (d, J = 5.3Hz, 1H).

[0178] Compound 13

[0179] Referring to the synthesis method of compound 1, the yield is 85%. 1H NMR (400MHz, DMSO-d6) δ10.15 (s, 1H), 7.87 (s, 1H), 6.39 (s, 1H), 3.85 (t, 4H, J = 5.6Hz), 3.60 (t, 4H, J = 5.6Hz).

[0180] dye20

[0181]

[0182] Dye 20 was synthesized according to the method of dye 1, with a yield of 81.2%. 1 H NMR (400MHz, DMSO-d6) δ11.15(s,1H),7.64(s,1H),7.57(s,1H),6.59(s,1H),3.85(t,4H,J=5.6Hz), 3.60(t,4H,J=5.6Hz).

[0183] dye21

[0184]

[0185] Dye21 was synthesized according to the method of dye1, with a yield of 82.5%. 1 H NMR (400MHz, DMSO-d6) δ11.35 (s, 1H), 7.64 (s, 1H), 7.57 (s, 1H), 6.59 (s, 1H), 3.85 (t, 4H, J = 5.6Hz), 3.60 (t, 4H, J = 5.6Hz).

[0186] Compounds 12 and 13

[0187]

[0188] Compounds 14 and 15

[0189] Compounds 14 and 15 were synthesized by referring to the synthesis method of compounds 7 and 8, with a yield of 50.4%. 1 H-NMR (400MHz, CDCl3): δ=9.92 (s, 1H), 7.81 (s, 1H), 7.68 (d, J=9.0Hz, 1H), 6.92 (d, J=2.0Hz , 1H), 6.82 (d, J=9.1, 2.3Hz, 1H), 3.61 (t, J=8.0Hz, 2H), 3.34 (t, J=8.0Hz, 2H), 3.21 (s, 3H).

[0190]

[0191] Dye 22 was synthesized according to the method of dye 1, with a yield of 90.1%.1 H-NMR (400MHz, CDCl3): δ = 12.31 (s, 1H), 7.86 (s, 1H), 7.81 (s, 1H), 7.68 (d, J = 9.0Hz, 1H), 6.92 (d, J =2.0Hz, 1H), 6.82 (d, J=9.1, 2.3Hz, 1H), 3.61 (t, J=8.0Hz, 2H), 3.34 (t, J=8.0Hz, 2H), 3.21 (s, 3H).

[0192] dye23

[0193]

[0194] Compound 16

[0195] Compound 16 was synthesized according to the synthesis method of the literature (Journal of the American Chemical Society, 137 (43), 13768-13771; 2015). 1H-NMR (400 MHz, CDCl3): δ = 10.31 (s, 1H), 7.81 (s, 1H), 7.68 (d, J = 9.0 Hz, 1H), 6.92 (d, J = 2.0 Hz, 1H), 6.82 (d, J = 9.1, 2.3 Hz, 1H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.21 (s, 3H), 2.91 (s, 3H).

[0196] Dye 23 was synthesized according to the method of dye 1, with a yield of 79.5%. 1H-NMR (400 MHz, CDCl3): δ = 8.02 (s, 1H), 7.81 (s, 1H), 7.68 (d, J = 9.0 Hz, 1H), 6.92 (d, J = 2.0 Hz, 1H), 6.82 (d, J = 9.1, 2.3 Hz, 1H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.21 (s, 3H), 2.91 (s, 3H).

[0197] dye24

[0198]

[0199] Compound 17

[0200] Compound 17 was synthesized according to the synthesis method of the literature (Journal of the American Chemical Society, 131 (5), 1766-1774; 2009). 1H-NMR (400 MHz, CDCl3): δ = 10.31 (s, 1H), 7.81 (s, 1H), 7.68 (d, J = 9.0 Hz, 1H), 6.92 (d, J = 2.0 Hz, 1H), 6.82 (d, J = 9.1, 2.3 Hz, 1H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.21 (s, 3H), 2.21 (s, 6H).

[0201] Dye 24 was synthesized according to the method of dye 1, with a yield of 68.5%. 1H-NMR (400 MHz, CDCl3): δ = 12.28 (s, 1H), 8.31 (s, 1H), 7.81 (s, 1H), 7.68 (d, J = 9.0 Hz, 1H), 6.92 (d, J = 2.0 Hz, 1H), 6.82 (d, J = 9.1, 2.3 Hz, 1H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.21 (s, 3H), 2.21 (s, 6H).

[0202] Compound 18

[0203]

[0204] Compound 18

[0205] Compound 18 was synthesized by referring to the method of compound 15. 1H-NMR (400 MHz, CDCl3): δ = 10.58 (s, 1H), 7.81 (s, 1H), 7.68 (d, J = 9.0 Hz, 1H), 6.92 (d, J = 2.0 Hz, 1H), 6.82 (d, J = 9.1, 2.3 Hz, 1H), 2.68 (s, 3H).

[0206] dye25

[0207]

[0208] Dye 25 was synthesized according to the method of dye 1, with a yield of 70.0%. 1H-NMR (400 MHz, CDCl3): δ = 8.58 (s, 1H), 7.81 (s, 1H), 7.68 (d, J = 9.0 Hz, 1H), 6.92 (d, J = 2.0 Hz, 1H), 6.82 (d, J = 9.1, 2.3 Hz, 1H), 3.21 (s, 3H), 2.68 (s, 3H).

[0209] dye26

[0210]

[0211] Compound 19

[0212] Compound 19 was synthesized according to the synthesis method of the reference (Organic Letters, 14 (24), 6366-6369; 2012). 1H-NMR (400 MHz, CDCl3): δ = 10.05 (s, 1H), 7.98 (s, 1H), 7.81 (d, J = 2.0 Hz, 1H), 7.68 (d, J = 9.0 Hz, 1H), 6.92 (d, J = 2.0 Hz, 1H), 6.82 (d, J = 9.1, 2.3 Hz, 1H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.21 (s, 3H).

[0213] Dye 26 was synthesized according to the method of dye 17, with a yield of 70.0%. 1H-NMR (400 MHz, CDCl3): δ = 8.55 (s, 1H), 7.98 (s, 1H), 7.81 (d, J = 2.0 Hz, 1H), 7.68 (d, J = 9.0 Hz, 1H), 6.92 (d, J = 2.0 Hz, 1H), 6.82 (d, J = 9.1, 2.3 Hz, 1H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.21 (s, 3H), 3.10 (s, 1H).

[0214]

[0215] Compound 20

[0216] Compound 20 was synthesized by referring to the synthesis method of compound 8, with a yield of 30.4%. 1 H-NMR (400MHz, CDCl3): δ=9.92 (s, 1H), 7.75 (d, J=9.0Hz, 1H), 6.52 (d, J=2.0Hz, 1H), 6.42 (d, J=9.1, 2.3Hz, 1H), 3.61 (t, J=8.0Hz, 3H), 3.34 (t, J=8.0Hz, 3H), 3.21 (s, 3H).

[0217] dye27

[0218]

[0219] Dye 27 was synthesized according to the method of dye 1, with a yield of 65.9%. 1H-NMR (400MHz, CDCl3): δ=11.28 (s, 1H), 7.84 (s, 1H), 7.75 (d, J=9.0Hz, 1H), 6.52 (d, J=2.0H z, 1H), 6.42 (d, J=9.1, 2.3Hz, 1H), 3.61 (t, J=8.0Hz, 3H), 3.34 (t, J=8.0Hz, 3H), 3.21 (s, 3H).

[0220]

[0221] Compound 21

[0222] Compound 21 was synthesized by referring to the synthesis method of compound 8, with a yield of 30.4%. 1 H-NMR (400MHz, CDCl3): δ=9.92 (s, 1H), 7.21 (s, 1H), 7.68 (d, J=9.0Hz, 1H), 6.92 (d, J=2.0Hz , 1H), 6.82 (d, J=9.1, 2.3Hz, 1H), 3.61 (t, J=8.0Hz, 2H), 3.34 (t, J=8.0Hz, 2H), 3.21 (s, 3H).

[0223] dye28

[0224]

[0225] Dye 28 was synthesized according to the method of dye 1, with a yield of 65.9%. 1 H-NMR (400MHz, CDCl3): δ=7.81 (s, 1H), 7.68 (d, J=9.0Hz, 1H), 6.92 (d, J=2.0Hz, 1H), 6.82 (d, J=9.1, 2.3Hz , 1H), 3.61 (t, J = 8.0Hz, 3H), 3.60 (q, J = 5.5Hz, 2H), 3.34 (t, J = 8.0Hz, 3H), 3.21 (s, 3H), 1.2 (t, J = 7.1Hz 3H).

[0226]

[0227] Compound 22

[0228] Compound 22 was synthesized by referring to the synthesis method of compound 8, with a yield of 30.4%. 1H-NMR (400MHz, CDCl3): δ=9.92 (s, 1H), 7.75 (d, J=9.0Hz, 1H), 6.52 (d, J=2.0Hz, 1H), 6.42 (d, J=9.1, 2.3Hz, 1H), 3.61 (t, J=8.0Hz, 3H), 3.34 (t, J=8.0Hz, 3H), 3.21 (s, 3H).

[0229] dye29

[0230]

[0231] Dye 29 was synthesized according to the method of dye 1, with a yield of 55.1%. 1 H-NMR (400MHz, CDCl3): δ=7.75 (d, J=9.0Hz, 1H), 6.52 (d, J=2.0Hz, 1H), 6.42 (d, J=9. 1, 2.3Hz, 1H), 3.61 (t, J=8.0Hz, 3H), 3.34 (t, J=8.0Hz, 3H), 3.21 (s, 3H), 3.10 (s, 3H).

[0232] Compound 23

[0233]

[0234] Compound 23

[0235] Compound 23 was synthesized by referring to the synthesis method of compound 11, with a yield of 54.2%. 1 H-NMR (400MHz, CDCl3): δ=9.92 (s, 1H), 7.81 (s, 1H), 7.68 (d, J=9.0Hz, 1H), 6.92 (d, J=2.0Hz, 1H), 6.82 (d, J=9.1, 2.3Hz, 1H), 3.21 (s, 6H).

[0236] dye30

[0237]

[0238] Dye30 was synthesized by referring to the synthesis method of compound dye1, with a yield of 45.2%. 1 H-NMR (400MHz, CDCl3): δ=8.01 (s, 1H), 7.81 (s, 1H), 7.68 (d, J=9.0Hz, 1H), 6.92 (d, J=2.0Hz, 1H), 6.82 (d, J=9.1, 2.3Hz, 1H), 3.21 (s, 6H).

[0239] Compound 24

[0240]

[0241] Compound 24

[0242] Compound 24 was synthesized by referring to the synthesis method of compound 11, with a yield of 58.2%. 1 H-NMR (400MHz, CDCl3): δ=9.91 (s, 1H), 7.80 (s, 1H), 7.65 (d, J=9.1Hz, 1H), 6.98 (d, J=2.1Hz, 1H), 6.85 (d, J=9.0, 2.3Hz, 1H), 3.21 (s, 6H).

[0243] dye31

[0244]

[0245] Dye31 was synthesized by referring to the synthesis method of compound dye1, with a yield of 80.2%. 1 H-NMR (400MHz, CDCl3): δ = 8.03 (s, 1H), 7.80 (s, 1H), 7.65 (d, J = 9.0Hz, 1H), 6.98 ( d, J=2.0Hz, 1H), 6.85 (d, J=9.1, 2.3Hz, 1H), 4.44 (m, 2H), 3.21 (s, 6H) 2.62 (m, 2H).

[0246] dye32

[0247]

[0248] The yield was 50.2% according to the synthesis method of compound dye1. 1 H-NMR (400MHz, CDCl3): δ=7.83 (s, 1H), 7.80 (s, 1H), 7.65 (d, J=9.0Hz, 1H), 6.98 (d, J=2.0Hz, 1H), 6.85 (d, J=9.1, 2.3Hz, 1H), 3.21 (s, 6H).

[0249] Compound 25

[0250]

[0251] Compound 25

[0252] Compound 25 was synthesized by referring to the synthesis method of compound 11, with a yield of 45.2%. 1H-NMR (400MHz, CDCl3): δ=7.88 (s, 1H), 7.65 (d, J=9.1Hz, 1H), 6.98 (d, J=2.1Hz, 1H), 6.85 (d, J=9.0, 2.3Hz, 1H), 3.21 (s, 6H).

[0253] dye33

[0254]

[0255] Dye33 was synthesized by referring to the synthesis method of compound dye1, with a yield of 60.2%. 1 H-NMR (400MHz, CDCl3): δ=8.01 (s, 1H), 7.65 (d, J=9.1Hz, 1H), 6.98 (d, J=2.1Hz, 1H), 6.85 (d, J=9.0, 2.3Hz, 1H), 3.21 (s, 6H).

[0256] dye34

[0257]

[0258] Compound 26:

[0259] The product was synthesized according to the method in reference (Chemistry-A European Journal, 22(30), 10627-10637; 2016). 1 H-NMR (400MHz, CDCl3): δ = 9.92 (s, 1H), 7.82 (s, 1H), 7.71 (m, 1H), 7.60 (m, 2H), 6. 78 (s, 2H), 3.82 (t, 2H, J = 5.6Hz), 3.54 (t, 2H, J = 5.6Hz), 3.10 (s, 3H), 1.42 (s, 6H)

[0260] Dye34 was synthesized by referring to the synthesis method of compound dye1, with a yield of 50.8%. 1 H-NMR (400MHz, CDCl3): δ = 11.21 (s, 1H), 7.92 (s, 1H), 7.82 (s, 1H), 7.71 (m, 1H), 7.60 (m, 2H), 6.78 (s, 2H), 3.82 (t, 2H, J=5.6Hz), 3.54 (t, 2H, J=5.6Hz), 3.10 (s, 3H), 1.42 (s, 6H)

[0261] dye35

[0262]

[0263] Dye35 was synthesized by referring to the synthesis method of compound dye1, with a yield of 47.8%. 1 H-NMR (400MHz, CDCl3): δ = 11.28 (s, 1H), 7.84 (s, 1H), 7.82 (s, 1H), 7.71 (m, 1H), 7.60 (m, 2H), 6.78 (s, 2H), 3.82 (t, 2H, J=5.6Hz), 3.54 (t, 2H, J=5.6Hz), 3.10 (s, 3H), 1.42 (s, 6H)

[0264] dye36

[0265]

[0266] Compound 27

[0267] Refer to the method for the synthesis of compound 26. 1 H NMR(400MHz, CDCl3):10.0(s,1H),8.0(s,1H),7.96-7.98(t,1H),7.89-7.90(t,1 H),7.47-7.49(m,1H),3.82(t,2H,J=5.6Hz),3.54(t,2H,J=5.6Hz),3.10(s,3H),

[0268] Dye36 was synthesized by referring to the synthesis method of compound dye1, with a yield of 49.7%. 1 H NMR(400MHz, CDCl3):11.28(s,1H),8.04(s,1H),8.0(s,1H),7.96-7.98(t,1H),7.89-7. 90 (t, 1H), 7.47-7.49 (m, 1H), 3.82 (t, 2H, J = 5.6Hz), 3.54 (t, 2H, J = 5.6Hz), 3.10 (s, 3H),

[0269] dye37

[0270]

[0271] Compound 28

[0272] Refer to the method for the synthesis of compound 26. 1 H-NMR (400MHz, CDCl3): δ=9.92 (s, 1H), 7.82 (s, 1H), 7.71 (s, 1H), 3.82 (t, 2H, J=5.6Hz), 3.54 (t, 2H, J=5.6Hz), 3.10 (s, 3H), 1.50 (s, 6H)

[0273] Dye37 was synthesized by referring to the synthesis method of compound dye1, with a yield of 59.6%. 1 H-NMR (400MHz, CDCl3): δ=10.28(s,1H),8.05(s,1H),7.82(s,1H),7.71(s, 1H), 3.82 (t, 2H, J=5.6Hz), 3.54 (t, 2H, J=5.6Hz), 3.10 (s, 3H), 1.50 (s, 6H).

[0274] dye38

[0275]

[0276] Compound 29

[0277] Refer to the method for the synthesis of compound 26. 1 H-NMR (400MHz, CDCl3): δ = 9.92 (s, 1H), 7.82 (s, 1H), 7.71 (s, 1H), 7.67 (s, 1H), 7. 50 (s, 1H), 3.82 (t, 2H, J = 5.6Hz), 3.54 (t, 2H, J = 5.6Hz), 3.10 (s, 3H), 1.50 (s, 6H)

[0278] Dye38 was synthesized by referring to the synthesis method of compound dye1, with a yield of 49.6%. 1 H-NMR (400MHz, CDCl3): δ = 11.01 (s, 1H), 8.04 (s, 1H), 7.82 (s, 1H), 7.71 (s, 1H), 7.67 (s, 1H), 7.50 (s, 1H), 3.82 (t, 2H, J = 5.6Hz), 3.54 (t, 2H, J = 5.6Hz), 3.10 (s, 3H), 1.50 (s, 6H)

[0279] dye39

[0280]

[0281] Compound 30

[0282] The synthesis method was obtained by referring to the literature (Chemistry of Materials, 31(21), 8810-8819; 2019). 1 H-NMR (400MHz, DMSO-d6): δ = 10.18 (s, 1H), 7.48 (s, 1H), 7.41 (s, 1H), 7.32 (m ,2H), 3.69(t, J=4.9Hz, 2H), 3.12(t, J=4.9Hz, 2H), 3.10(s, 3H), 1.48(s, 6H)

[0283] Dye39 was synthesized by referring to the synthesis method of compound dye1, with a yield of 58.2%. 1 H-NMR (400MHz, DMSO-d6): δ = 14.28 (s, 1H), 7.95 (s, 1H), 7.48 (s, 1H), 7.41 (s, 1H), 7.32 (m, 2H), 3.69 (t, J = 4.9Hz, 2H), 3.12 (t, J = 4.9Hz, 2H), 3.10 (s, 3H), 1.48 (s, 6H)

[0284] dye40

[0285]

[0286] Dye40 was synthesized by referring to the synthesis method of compound dye1, with a yield of 69.2%. 1 H-NMR (400MHz, DMSO-d6): δ = 7.95 (s, 1H), 7.48 (s, 1H), 7.41 (s, 1H), 7.32 (m, 2H), 3 .69(t, J=4.9Hz, 2H), 3.12(t, J=4.9Hz, 2H), 3.21(s, 3H), 3.10(s, 3H), 1.48(s, 6H)

[0287] dye41

[0288]

[0289] Compound 32

[0290] The compound was synthesized according to the method in the literature (Journal of Organic Chemistry, 73(17), 6587-6594; 2008). 1 H-NMR (400MHz, DMSO-d6): δ=10.18 (s, 1H), 7.89 (s, 1H), 7.18 (s, 1H), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.10 (s, 3H), 1.50 (s, 6H).

[0291] Dye41 was synthesized by referring to the synthesis method of compound dye1, with a yield of 56.6%. 1 H-NMR (400MHz, DMSO-d6): δ = 12.58 (s, 1H), 8.01 (s, 1H), 7.89 (s, 1H), 7.18 (s , 1H), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.10 (s, 3H), 1.50 (s, 6H).

[0292] dye42

[0293]

[0294] Dye42 was synthesized by referring to the synthesis method of compound dye1, with a yield of 38.2%. 1 H-NMR (400MHz, DMSO-d6): δ = 8.01 (s, 1H), 7.89 (s, 1H), 7.18 (s, 1H), 3.85 (t, 2H, J = 5.6Hz), 3.60 (t, 2H, J = 5.6Hz), 3.10 (s, 3H), 1.50 (s, 6H).

[0295] dye43

[0296]

[0297] Compound 33

[0298] Compound 33 was synthesized by referring to the synthesis method of compound 26. 1 H-NMR (400MHz, DMSO-d6): δ = 10.18 (s, 1H), 7.89 (s, 1H), 7.36 (s, 2H), 7.18 (s, 1H), 3.85 (t, 2H, J = 5.6Hz), 3.60 (t, 2H, J = 5.6Hz) 3.10 (s, 1H).

[0299] Dye 43 was synthesized according to the method of compound dye 1, with a yield of 78.2%. 1H-NMR (400 MHz, DMSO-d6): δ = 12.09 (s, 1H), 8.28 (s, 1H), 7.89 (s, 1H), 7.36 (s, 2H), 7.18 (s, 1H), 3.85 (t, 2H, J = 5.6 Hz), 3.60 (t, 2H, J = 5.6 Hz) 3.10 (s, 1H).

[0300] dye44

[0301]

[0302] Compound 34:

[0303] Compound 34 was synthesized according to the synthesis method of Zhu, Linyong et al, PCT Int. Appl., 2019218876, 21Nov 2019. 1H-NMR (400MHz, CDCl3): δ = 9.74 (s, 1H), 7.76 (d, 1H), 7.60 (s, 1H), 7.03 (d, 1 H), 3.85 (t, 2H, J = 5.6Hz), 3.60 (t, 2H, J = 5.6Hz), 3.10 (s, 3H), 1.42 (s, 6H).

[0304] Dye44 was synthesized by referring to the synthesis method of compound dye1. 1 H-NMR (400MHz, CDCl3): δ = 11.24 (s, 1H), 8.02 (s, 1H), 7.76 (d, 1H), 7.60 (s, 1H), 7. 03 (d, 1H), 3.85 (t, 2H, J = 5.6Hz), 3.60 (t, 2H, J = 5.6Hz), 3.10 (s, 3H), 1.42 (s, 6H).

[0305] dye45

[0306]

[0307] Dye45 was synthesized according to the synthesis method of dye1. 1 H-NMR (400MHz, CDCl3): δ = 13.08 (s, 1H), 8.05 (s, 1H), 7.76 (d, 1H), 7.60 (s, 1H), 7. 03 (d, 1H), 3.85 (t, 2H, J = 5.6Hz), 3.60 (t, 2H, J = 5.6Hz), 3.10 (s, 3H), 1.42 (s, 6H).

[0308] dye46

[0309]

[0310] Dye46 was synthesized by referring to the synthesis method of dye1. 1 H-NMR (400MHz, CDCl3): δ = 15.56 (s, 1H), 8.08 (s, 1H), 7.76 (d, 1H), 7.60 (s, 1H), 7. 03 (d, 1H), 3.85 (t, 2H, J = 5.6Hz), 3.60 (t, 2H, J = 5.6Hz), 3.10 (s, 3H), 1.42 (s, 6H).

[0311] Comparative Example

[0312] dye47

[0313]

[0314] Dye 47 was synthesized according to the method in the literature (European Journal of Organic Chemistry, 2011 (25), 4773-4787). 1 H NMR (400MHz, DMSO-d6) δ19.21(s,1H),7.31(s,1H),6.95(s,2H),3.25(dd,J=6.6,4.9Hz,4H),2.68(t,J=6.3Hz,4H),2.05-1.57(m,4H).

[0315] dye48

[0316]

[0317] Dye 48 was synthesized according to the method in the literature (J. Am. Chem. Soc. 2020, 142, 17515-17523). 1 H-NMR (400MHz, Chloroform-d) δ8.07(d,J=8.9Hz,2H),7.11(s,1H),6.70(d,J=8.8Hz,2H),4.29(s,3H),3.05(s,6H),2.31(s,3H).

[0318] dye49

[0319]

[0320] Dye 49 was synthesized according to the method in the literature (J. Am. Chem. Soc. 2020, 142, 17515-17523). 1 H-NMR(400MHz,Chloroform-d)δ8.19(d,J=8.6Hz,2H),7.97(d,J=15.6Hz,1H),7.48(d,J=8.7,2H),7.12(s,1H),6. 75(d,J=8.6,2H),6.70(d,J=8.6,2H),6.42(d,J=15.6Hz,1H),4.45(s,2H),3.07(s,6H),3.05(s,6H),1.49(m,9H).

[0321] dye50

[0322]

[0323] Dye 50 was synthesized according to the method in the literature (Angew. Chem. Int. Ed. 2020, 59, 2-10). 1H-NMR (400MHz, DMSO-d6) δ8.06 (d, J = 8.6 Hz, 2H), 6.79 (d, J = 8.6 Hz, 2H), 3.28 (m, 6H), 1.81 (s, 6H).

[0324] Test Example 1

[0325] The fluorescent dyes (molecular rotors) prepared in Examples dye1-dye42 were dissolved in dimethyl sulfoxide to prepare a concentration of 1×10 -2 M mother liquor, add each mother liquor to glycerol and methanol respectively, mix well, and prepare a final concentration of 1×10 -5 The fluorescence emission spectra of the solutions of M were detected under the same conditions using the maximum excitation wavelength of each fluorescent dye according to different fluorescent dyes. The results are shown in Table 1, indicating that the fluorescent dye of the present invention has long-wavelength fluorescence emission and is sensitive to viscosity changes.

[0326] Table 1

[0327]

[0328]

[0329] Test Example 2

[0330] Dye7, dye9, dye12, dye25, and dye40 were added to the following viscosity 16.4cp (glycerol volume ratio is 0%), 29.8cp (glycerol volume ratio is 20%), 64.5cp (glycerol volume ratio is 40%), 143.5cp (glycerol volume ratio is 60%), 377.0cp (glycerol volume ratio is 80%), 946.0cp (glycerol volume ratio is 100%) of the glycerol and ethylene glycol mixture, respectively, to prepare a final concentration of 1×10 -5 The fluorescence emission spectra of M solutions under different viscosity conditions are as follows Figure 1 , 3 As shown in , 5, 7, and 9, the emission wavelengths of the molecular rotors are 620nm, 576nm, 650nm, 670nm, and 720nm, respectively. The results show that the fluorescence intensity of the fluorescent dye with the same concentration increases with the increase of the environmental viscosity. The relationship between the logarithm of the fluorescence intensity and the logarithm of the solvent viscosity conforms to the Huffman equation, has a good linear relationship, and has a high slope, such as Figure 2 , 4 , 6, 8, and 10, which proves that the above dyes are sensitive to viscosity and can be used for viscosity testing of unknown samples.

[0331] When dyes Dye7, Dye9, Dye12, Dye25, and Dye40 were dissolved in solvents of different polarities (toluene, ethyl acetate, methanol, acetonitrile, and dimethyl sulfoxide) for testing, the fluorescence intensity was very weak and did not change with the polarity of the solvent. Fig.11 , 12 , 13, 14, and 15.

[0332] The above results show that the fluorescent dye of the present invention has good specificity for the viscosity environment and can reduce the nonspecific fluorescence caused by polarity response.

[0333] Test Example 3

[0334] Dye5, dye6, dye11, dye12, dye13, dye14, dye39, and dye42 were added to glycerol to prepare a final concentration of 1×10 -5 M solution, use the corresponding maximum excitation wavelength to excite the fluorescent dye, obtain the emission spectrum, and normalize some of the emission spectra. Compare the emission spectra of dye5 and dye6, such as Fig.16 When the oxycarbonyl group of the electron-pulling part becomes thiocarbonyl, the wavelength increases by about 50nm; compare the emission spectra of dyes dye11, dye12, and dye14, such as Fig.17 , indicating that the effect of increasing the wavelength can be superimposed; comparing the emission spectra of dyes dye12 and dye13, such as Fig.18 When the sulfur on the five-membered ring of the electron-withdrawing part is changed to a nitrogen atom, the wavelength is shortened by 20nm. This proves that the emission wavelength of the above dye can be easily achieved by changing one atom in the structure. This can achieve spectral tunability while ensuring that the dye structure does not change much (water solubility and membrane permeability do not change much), and through this wavelength adjustment mechanism, the maximum emission wavelength of the dye can be increased to more than 800nm, such as Fig.19 , 20, which is very advantageous for the use of dyes for in vivo imaging.

[0335] Test Example 4

[0336] Dyes dye1 and dye48; dye22 and dye49; dye40 and dye50; dye9, dye10 and dye47 were added to PBS to a final concentration of 1×10 -5 M solution, using the corresponding maximum excitation wavelength to excite the dye, and detecting their fluorescence intensity in PBS. The maximum fluorescence intensity of each group of samples was normalized as 100, respectively. Fig.21 ,22,23,24, the results show that compared with the fluorescent dyes reported in the literature, the fluorescent dye of the present application has a special electron-withdrawing group structure, which makes the fluorescent dye of the present application have lower background fluorescence.

[0337] Test Example 5

[0338] Stable cell line (293T / 17) expressing RNA aptamer (UUGCCAUGUGUAUGUGGGUUCGCCCACAUAC UCUGAUGAUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCUUCGGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGAUCAUUCAUGGCAA) and control Cells (293T / 17) are grown under conventional mammalian cell culture conditions (37°C, 5% carbon dioxide, 100% relative humidity) until the cell confluence reaches 90%. The cell culture medium containing dyes dye1, dye12, dye25, and dye41 at a final concentration of 2uM is replaced with the original cell culture medium and incubated for 10 minutes (37°C, 5% carbon dioxide, 100% relative humidity). Confocal microscopy is used to observe the corresponding wavelength of the dye. The dye basically does not fluoresce before binding, but the fluorescence is significantly activated after binding. In addition, the compound can also bind to proteins in the cell, such as Fig.25 As shown, cells expressing aptamers emit bright fluorescence, while cells not expressing aptamers have no fluorescence, which indicates that the dye of the present invention has good cell membrane permeability and can be used for labeling aptamers in living cells.

[0339] Test Example 6

[0340] A stable cell line (293T / 17) that continuously expresses the RNA aptamer (UUGCCAUGUGUAUGUGGGUUCGCCCACAUACUCUG AUGAUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCUUCGGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGAUCAUUCAUGGCAA) and a control cell line (293T / 17) were used. After the cells were grown to a confluence of 90%, the cells were digested, centrifuged at 800 rpm, and cultured with 1 μM Resuspend the cells in PBS containing dye3, dye13, dye21, and dye34 molecules and incubate for 5 minutes before flow cytometry detection. The detection results can be seen in the flow cytometry Figure 26-29 As shown in the figure, the background of dyes before dye3, dye13, dye21, and dye34 is very low, and the fluorescence is significantly activated after binding. The dyes can also bind to RNA aptamers in cells to emit bright fluorescence, and there is basically no non-specific fluorescence activation. This shows that the fluorescent dyes of the present invention have very low background fluorescence and very low non-specific fluorescence in cells, and can be used for labeling low-abundance biomacromolecules such as nucleic acids, while dye50 has obvious background fluorescence, as shown in the figure. Fig.30 As shown, it is difficult to be used for labeling low-abundance biomacromolecules such as nucleic acids. Sequence Listing <110> Naying (Shanghai) Biotechnology Co., Ltd. <120> A fluorescent dye and its preparation method and use <130> 072-2012099IP <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 214 <212> RNA <213> Synthetic Sequence <400> 1 60 uaguaggucc gguguaguag guccggugua guagguccuu cgggaccgga agaauugauc 120 180 gaaauuga ucucggccgg aucauucaug gcaa 214

Claims

1. A fluorescent dye comprising an electron donor portion D, a conjugated system E and an electron acceptor portion A, wherein the fluorescent dye is as shown in formula (I): The electron donor part -D is (X1)(X2)N-, X1 and X2 are independently selected from hydrogen, alkyl, or modified alkyl. When X1 and X2 are independently modified alkyl, the "modified alkyl" is a group obtained by replacing any carbon atom of the alkyl with a -OH group, and the modified alkyl has 1 to 8 carbon atoms; The conjugated system E is selected from the following structures (I-2-3)-(I-2-4), (I-2-6)-(I-2-7), (I-2-9), (I-2-11)-(I-2-15), (I-3-1): Alternatively, the conjugated system E and (X1)(X2)N- form an aliphatic heterocycle as shown in (I-3-1): In formula (I-3-1), X1 is selected from: hydrogen or alkyl; The electron acceptor part A has the following cyclic structure: in, R1 is independently selected from -O-, -S-, or -(NR a )-, where R a is hydrogen; R2 is independently selected from =O, or =S; R3 is independently selected from =O, or =S; X is independently selected from hydrogen, or alkyl; The carbon atom is replaced, which means that the carbon atom or the carbon atom together with the hydrogen atoms thereon are replaced by the corresponding group; The "alkyl" is a C1-C7 straight chain or branched chain alkyl.

2. The fluorescent dye according to claim 1, characterized in that When X1 and X2 are independently a modified alkyl group, the modified alkyl group contains a group selected from -OH.

3. The fluorescent dye according to claim 1, characterized in that X1 and X2 are each independently substituted by one or more groups selected from hydroxyl groups. 1-8 Straight chain or branched chain alkyl.

4. The fluorescent dye according to claim 1, characterized in that The modified alkyl group has 1 to 5 carbon atoms.

5. The fluorescent dye according to claim 2, characterized in that The modified alkyl group has 1 to 5 carbon atoms.

6. The fluorescent dye according to claim 1, characterized in that The modified alkyl group has 1 to 2 carbon atoms.

7. The fluorescent dye according to claim 2, characterized in that The modified alkyl group has 1 to 2 carbon atoms.

8. The fluorescent dye according to claim 1, characterized in that The "alkyl" is a C1-C5 straight chain or branched chain alkyl.

9. The fluorescent dye according to claim 1, characterized in that The “alkyl” is selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, isohexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, 2-ethylbutyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, 2,2-dimethylpentyl, 3,3-dimethylpentyl, 2,3-dimethylpentyl, 2,4-dimethylpentyl, 3-ethylpentyl or 2,2,3-trimethylbutyl.

10. The fluorescent dye according to any one of claims 1 to 9, characterized in that: The electron acceptor A part is one selected from the following formulas (I-4-1) to (I-4-43):

11. A fluorescent dye, characterized in that: The fluorescent dye is selected from the following compounds:

12. A method for preparing the fluorescent dye according to any one of claims 1 to 11, characterized in that: The method comprises the steps of reacting a compound of formula (a) with a compound of formula (b) to generate a fluorescent dye of formula (I): The definitions of the groups in formula (a), formula (b) and formula (I) are as described in any one of claims 1 to 11.

13. Use of the fluorescent dye according to any one of claims 1 to 11 in the preparation of nucleic acid fluorescent markers or nucleic acid detection reagents; The nucleic acid is a nucleic acid aptamer, and the nucleic acid aptamer is the following nucleotide sequence: UUGCCAUGUGUAUGUGGGUUCGCCCACAUACUCUGAUGAUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCUUCGGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGAUCAUUCAUGGCAA.

14. A fluorescence activated light-up probe, characterized in that: The invention comprises the fluorescent dye according to any one of claims 1 to 11.

15. Use of the fluorescence-activated light-up probe according to claim 14 in the preparation of nucleic acid fluorescent markers or nucleic acid detection reagents; The nucleic acid is a nucleic acid aptamer, and the nucleic acid aptamer is the following nucleotide sequence: UUGCCAUGUGUAUGUGGGUUCGCCCACAUACUCUGAUGAUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCUUCGGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGAUCAUUCAUGGCAA.

Images