A murine lgG monoclonal antibody, a preparation method and application thereof

Abstract

The present application relates to the technical field of immunology, and particularly relates to a murine IgG monoclonal antibody, a preparation method and application thereof. The heavy chain variable region of the monoclonal antibody has an amino acid sequence as shown in SEQ ID NO:1; and the light chain variable region has an amino acid sequence as shown in SEQ ID NO:2. The present application further discloses a DNA molecule encoding the antibody, expression of the antibody, and a eukaryotic host cell transformed by the expression vector. The murine IgG monoclonal antibody provided by the present application is preliminarily verified in a 5L bioreactor, and the expression amount is 5.33g / L. It is identified that the monoclonal antibody is used as a blocking agent for evaluation, and the blocking effect is obvious, and plays an important role in the use of blocking agents.

Description

Technical Field

[0001] This invention relates to the field of immunology technology, and in particular to a murine IgG monoclonal antibody, its preparation method, and its application. Background Technology

[0002] Inhibitors are bioactive agents used in in vitro diagnostic assays to eliminate or reduce interference from immunoassays. Their application in in vitro diagnostics effectively reduces false positives or false negatives caused by immunoassay interference. Therefore, inhibitors are widely used and in high demand in the in vitro diagnostics field. Monoclonal antibodies are often prepared in mouse ascites fluid in in vitro diagnostics; however, for projects with high demand, ascites fluid preparation is limited by space and the number of mice available for injection, making large-scale production difficult.

[0003] With the rapid development of the biopharmaceutical industry over the past 20 years, especially the expanding market share of products based on mammalian cell expression, the in vitro culture of mammals to prepare high-expression monoclonal antibodies has become extremely important. A stable and high-yielding engineered cell line can significantly increase the yield per unit volume and reduce the production cost of the product. Among them, CHO cells have evolved into the most typical mammalian cell line for manufacturing recombinant protein therapeutic drugs, and are widely used in the biotechnology field due to their robustness and relatively high production capacity (from 1 to 10 g / L). Many biopharmaceutical CHO cell lines are derived from CHO-dg44, CHO-DUKX-B11, CHO-S, and CHO-K1 cell lines. The CHO-S cell line is a stable aneuploid cell line that works based on a dihydrofolate reductase (DHFR) selection platform, although this wild-type cell line has a basal level of DHFR activity. A biphasic selection system based on increasing puromycin and MTX levels is used to generate a stable cell pool capable of producing high levels of monoclonal antibodies. However, most current research focuses on human-mouse chimeric antibodies, humanized antibodies, or fully human IgG-like antibodies. Therefore, it is extremely urgent and of great significance for enterprises to construct monoclonal antibodies that highly express mouse IgG using CHO-S cells as the host and to validate them in a 5L reactor. Summary of the Invention

[0004] In view of this, the present invention provides a murine IgG monoclonal antibody, its preparation method, and its applications. This monoclonal antibody exhibits significant blocking effects as an inhibitor, playing a crucial role in inhibitor use. Furthermore, its preparation method is simple and suitable for mass production.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] A murine IgG monoclonal antibody, the amino acid sequence of its heavy chain variable region is shown in SEQ ID NO:1, and the amino acid sequence of its light chain variable region is shown in SEQ ID NO:2.

[0007] The mouse-derived IgG monoclonal antibody of the present invention is characterized in that it further comprises a heavy chain constant region and a light chain constant region, wherein the heavy chain constant region is mouse IgG1 and the light chain constant region is mouse Kappa type.

[0008] The present invention also provides a DNA molecule encoding the aforementioned murine IgG monoclonal antibody.

[0009] The DNA molecule includes a nucleotide encoding the heavy chain variable region as shown in SEQ ID NO:3 or complementary to SEQ ID NO:3, and a nucleotide encoding the light chain variable region as shown in SEQ ID NO:4 or complementary to SEQ ID NO:4.

[0010] The present invention also provides an expression vector containing a DNA molecule encoding the aforementioned murine IgG monoclonal antibody.

[0011] In some specific embodiments, the backbone vector of the expression vector of the present invention is pCHO1.0.

[0012] The present invention also provides a recombinant host containing the aforementioned expression vector. In some specific embodiments, the host cell is a CHO-S cell.

[0013] This invention also provides a method for preparing a murine IgG monoclonal antibody, comprising:

[0014] (1) Construct an expression vector containing the DNA molecule described in this invention;

[0015] (2) Transform the expression vector described in step (1) into host cells;

[0016] (3) Culture the host cells obtained in step (2);

[0017] (4) The monoclonal antibody was obtained by separation and purification.

[0018] The present invention also provides the application of the aforementioned murine IgG monoclonal antibody in the preparation of blocking agents or in vitro diagnostic reagents.

[0019] The present invention also provides an inhibitor comprising the aforementioned murine IgG monoclonal antibody and an acceptable adjuvant.

[0020] This invention also provides the application of the aforementioned mouse-derived IgG monoclonal antibody and the aforementioned blocking agent in the preparation of in vitro diagnostic reagents.

[0021] The murine IgG monoclonal antibody provided by this invention was initially validated in a 5L bioreactor, with an expression level of 5.33 g / L. Identification showed that this monoclonal antibody, when used as an inhibitor, exhibited significant blocking efficacy and plays a crucial role in the application of inhibitors. Attached Figure Description

[0022] Figure 1 The image shows the plasmid restriction enzyme digestion verification. a and b represent A-pCHO1.0, XmaJI / BstZ17I restriction enzyme digestion identification and EcoRV / PacI restriction enzyme digestion identification, respectively.

[0023] Figure 2 Expression levels in single-clonal fed-batch samples;

[0024] Figure 3 For SDS-PAGE and HPLC analysis; (A) 1: Reduced band (treated with β-mercaptoethanol / DTT); 2: Non-reduced band; (B): Blue peak: Marker sizes from left to right are: 1340 kDa, 670 kDa, 300 kDa, 150 kDa, 45 kDa, 17 kDa, 1 kDa; Red peak: HPLC chromatographic analysis of the target protein;

[0025] Figure 4 To compare the correlation between the blocking monoclonal antibody and the control ascites antibody in the magnetic microparticle G17 project. Detailed Implementation

[0026] This invention provides a murine IgG monoclonal antibody, its preparation method, and its applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0027] The test materials used in this invention are all common commercial products and can be purchased on the market.

[0028] The present invention will be further illustrated below with reference to the embodiments:

[0029] Example 1: Construction of expression vector

[0030] The target gene was retrieved from laboratory hybridoma cell lines using a 5'-Full RACE kit. The heavy chain variable region had the amino acid sequence shown in SEQ ID NO:1 and the nucleotide sequence shown in SEQ ID NO:3, while the light chain variable region had the amino acid sequence shown in SEQ ID NO:2 and the nucleotide sequence shown in SEQ ID NO:4. Using reverse-transcribed cDNA as a template, the upstream primer used was the retrieved heavy / light chain target gene upstream primer H1 / L1, and the downstream primer used was the mouse IgG1 constant region downstream primer H2 / L2 to amplify the full-length heavy / light chain target gene sequence. The selected signal peptide nucleotide sequence was:

[0031] The sequence ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTC CAGGTTCCACTGGCGCC (SEQ ID NO:5) and the corresponding amino acid sequence of the signal peptide are: METDTLLLWVLLLWVPGSTGA (SEQ ID NO:6). Subsequently, the full-length heavy and light chain genes were constructed into the laboratory pCHO1.0 vector using XmaJI / BstZ17I and EcoRV / PacI restriction sites, respectively, and named A-pCH01.0. The primers used in this construction process are as follows:

[0032] H1: 5'-cgCCTAGGGCCGCCACCATGGAGACAGACACACTCCT-3' (SEQ ID NO: 7);

[0033] H2: 5'-cgGTATACTTATTTACCAGGAGAGTGGGAG-3' (SEQ ID NO: 8);

[0034] L1: 5'-cgGATATCGCCGCCACCATGGAGACAGACACACTCCT-3' (SEQ ID NO: 9);

[0035] L1: 5'-ccTTAATTAATTAGCACTCATTCCTGTTGAAG-3' (SEQ ID NO: 10).

[0036] The constructed plasmids were extracted using an endotoxin-free plasmid extraction kit. 100 μg of plasmid was linearized using RruI enzyme, specifically by digestion at 37°C for 2 hours, followed by the addition of 1 / 10 volume of 3M CH3COONa (pH 5.2), mixing, centrifugation with 3 volumes of anhydrous ethanol, removal of the supernatant, and finally washing the precipitate with 1 mL of 75% ethanol, repeating the washing process 6 times. After drying at room temperature, the precipitate was dissolved in sterile water.

[0037] Finally, the A-pCHO1.0 plasmid was digested with XmaJI / BstZ17I and EcoRV / PacI, respectively, and the heavy chain fragment was approximately 1400 bp in size, while the light chain fragment was 700 bp in size. Figure 1 ).

[0038] Example 2: Cell transfection and construction of stable cell lines

[0039] One day before transfection, CHO-S cells were loaded with 5 × 10⁻⁶ cells. 5 The cells / mL were seeded into 30 mL of CD FortiCHO + 8 mL of glutamine medium and cultured at 37 °C, 8% CO2, 100 rpm in a shaker. On the day of transfection, 50 mg of linearized plasmid was transfected into 1 × 10 cells / mL using FreeStyle™ MAX transfection reagent. 6 Cells were selected using a pressure screening system with 20 μg / mL Puromycin and 200 nmol / mL LMTX. The flasks were placed in a 37°C, 8% CO2 incubator for static culture. Cell viability was assessed every 3–4 days after 7 days. When cell viability exceeded 30%, cells were cultured at a rate of 3 × 10⁻⁶ cells / mL. 5 Cells were passaged into 125 mL shake flasks at a density of 1000 viable cells / mL. When cell viability was greater than 90%, the second stage of selection began; that is, cells were selected under pressure using a 50 nmol / L Puromycin and 1000 nmol / L MTX selection system at a seeding density of 4 × 10⁻⁶ cells / mL. 5 Cells were placed in an incubator and cultured at a rate of 3 × 10⁶ cells / ml every 3–4 days; 5 Cells / mL passage was performed, and the second round of screening was completed when the cell viability reached or exceeded 90%.

[0040] Subsequently, single-clone screening was performed using the limiting dilution method. Cloning medium was prepared as follows: CD-FortiCHO medium + 1% anti-clumping + 6mM L-glutamine, with the addition of 20μg / mL Luromycin + 200nm / LMTX. 30 cells were seeded into each well of a 96-well plate at a density of 0.5 cells / well, and incubated in a static incubator until cell recovery was achieved (seeding rate exceeding 80%, density not exceeding 5×10⁶ cells / well). 5 Cells / mL) were selected, and the top 150 clones with the highest expression levels were transferred to 24-well plates. The top 50 clones from the 24-well plates were then transferred to 6-well plates. The top 30 clones from the 6-well plates were then evaluated using isodense plating. Finally, the top 15 clones were transferred to 125 mL shake flasks for Fed-bachelor evaluation. That is, according to 4 × 10⁻⁶ cells / mL... 5Inoculate 30 mL of viable cells / mL into 125 mL culture flasks. Feed supplementation (5% Feed A + 0.5% Feed B) is added on days 3, 5, 7, 9, and 11. Glucose levels are measured on days 4, 6, 8, and 10, and glucose is added to maintain a concentration of approximately 5 g / L. Harvest the culture when the survival rate drops below 60%.

[0041] The results showed that after one round of pressurized cell culture for 26 days, the cell viability was 96.53% and the cell density was 26.8 × 10⁻⁶. 5 A second round of pressurization was initiated, and after the second round of pressurization, the cell density reached 22 × 10⁻⁶ on day 9. 5 The viability was 94.73%. In the limiting dilution method for monoclonal screening: 605 clones were grown in 30 96-well plates, with a monoclonal formation rate of 42%. The three monoclonal clones with the highest expression levels were 11H7, 19E7, and 23H11, with expression levels of 2.9 g / L, 2.43 g / L, and 2.3 g / L, respectively. Figure 2 Its highest density reached 3.73 × 10⁻⁶. 7 cells / mL, 2.91 × 10 7 cells / mL and 2.87×10 7 cells / mL.

[0042] Example 3: Bioreactor Expression

[0043] 200M Dynamis medium was used in the seed culture preparation process; cells were seeded into four new 1L shake flasks, each with a culture volume of 200ml. When the cell density reached 2.5 × 10⁻⁶ cells / mL... 6 When the cell count is approximately 100% / mL and the viability is greater than 90%, the cells are inoculated into the bioreactor for further culture. 2L of Dynamis medium is transferred into the reactor vessel. Top aeration is set to 3%, and bottom aeration to 20ccm. After transfer, the pH is adjusted to 7.00±0.3, 1mL of antifoaming agent is added, bottom aeration is turned on, and the stirring speed is maintained at 180rpm for at least 8 hours. The reactor operating parameters are set as follows: stirring speed: 180rpm, temperature: 37℃, pH 7.0±0.3, dissolved oxygen: 40%. After the system parameters stabilize, the dissolved oxygen electrode is calibrated to 100%, and then cell inoculation begins (inoculation density 6×10⁶ cells / mL). 5Cells / mL) were added to a culture medium to reach a total volume of 3.5 L before reactor culture. On day 3, 70 ml of 200 mM glutamine solution was added to bring the glutamine concentration in the culture medium to 4 mM. Culture was continued at 32°C on day 6. Throughout the culture process, the glucose concentration in the reactor was maintained at no less than 5 g / L (supplemented with 300 g / L glucose solution). Feeding was performed at days 3, 6, 9, 11, 13, 15, and 17 using 5% CellBoost 7a and 0.5% CellBoost 7b, respectively. Culture was terminated when cell viability fell below 70%.

[0044] The results showed that the cell number exhibited an exponential growth trend during the first 6 days of culture, and was maintained at 220–230 × 10⁶ cells after cooling. 5 The cell density was 5 days. The cell density began to decrease after 11 days of culture. On the 19th day, the viability was about 70% and the target protein supernatant was harvested. At the beginning of the culture, lactic acid gradually accumulated to about 2 mg / ml and began to be consumed on the 4th day. After the 10th day of culture, the lactic acid level was generally low. The final protein expression level was 5.33 g / L.

[0045] Example 4: Protein A column purification and purity detection

[0046] The cell supernatant containing mouse IgG1 monoclonal antibody was filtered through a 0.45 μm filter membrane, equilibrated with water and equilibration buffer (0.02 M PBS, pH 7.4) on a Protein A-filled column, and then loaded onto the column. After loading, the column was equilibrated again, and the protein was eluted with dissociation buffer (0.2 M glycine + 0.15 M NaCl, pH 3.0). The dissociation peaks were collected, and the protein expression levels were calculated. The antibody purity was then detected by SDS-PAGE and HPLC. The results showed that the molecular weight of the heavy chain of the target protein antibody was approximately 50 KD, and the molecular weight of the light chain was approximately 25 KD. Figure 3 a) Consistent with expectations; HPLC detection ( Figure 3 b) The antibody purity reached over 98% (approximately 150 kDa). Figure 3 ).

[0047] Example 5: Evaluation and Application of Blocking Performance

[0048] The blocking performance of the magnetic microparticle G17 and magnetic microparticle ProGRP products was detected using chemiluminescence immunoassay. This method used ascites antibody as a control and added a negative control group (without clean antibody). Large-volume false-positive plasma samples and single-vial serum samples from clinical samples were used for testing. The specific steps were as follows: 20 μL of magnetic microparticle suspension was taken from the kit; the test sample was removed from -20°C, and after thawing, it was centrifuged at 4°C and 12000 rpm for 5 min. The supernatant sample concentration was 0.1 mg / mL. 20 μL of the supernatant was transferred to a sample cup, mixed, and incubated (37°C, 15 min). After washing with the reaction solution, 100 μL of enzyme conjugate was dispensed; the reaction solution was then mixed, incubated (37°C, 17 min), and washed. 50 μL of luminescent substrate A and 50 μL of luminescent substrate B were dispensed, and the luminescence intensity was measured after mixing the reaction solution.

[0049] Results showed that the G17 magnetic microparticle product eliminated interference from 23 false positive samples, and the correlation with the control (ascites antibody) reached 98.4%. Figure 4 ).

[0050] Results showed that the ProGRP magnetic microparticle product could eliminate interference from 3 false positive samples, and its blocking performance was slightly better than that of the control (ascites antibody).

[0051] Table 1

[0052]

[0053] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A murine IgG monoclonal antibody, characterized in that, The amino acid sequence of its heavy chain variable region is shown in SEQ ID NO:1, and the amino acid sequence of its light chain variable region is shown in SEQ ID NO:

2.

2. The murine IgG monoclonal antibody according to claim 1, characterized in that, It also includes a heavy chain constant region and a light chain constant region, wherein the heavy chain constant region is mouse IgG1 and the light chain constant region is mouse Kappa type.

3. A DNA molecule encoding the murine IgG monoclonal antibody of claim 1 or 2.

4. The DNA molecule according to claim 3, characterized in that, It includes nucleic acids encoding the heavy chain variable region and nucleic acids encoding the light chain variable region, the nucleic acid sequences being as shown in SEQ ID NO:3 and SEQ ID NO:4, respectively, or their complementary sequences.

5. An expression carrier, characterized in that, Contains the DNA molecule as described in claim 3 or 4.

6. A recombinant host, characterized in that, It contains the expression vector as described in claim 5.

7. The recombinant host according to claim 6, characterized in that, The host cell is a CHO-S cell.

8. The method for preparing the monoclonal antibody according to claim 1, characterized in that, include: (1) Construct an expression vector containing the DNA molecule as described in claim 3 or 4; (2) Transform the expression vector described in step (1) into host cells; (3) Culture the host cells obtained in step (2); (4) Separate and purify to obtain the monoclonal antibody.

9. The use of the murine IgG monoclonal antibody according to claim 1 or 2 in the preparation of an inhibitor to eliminate endogenous interference from in vitro diagnostic reagents; The in vitro diagnostic reagent is a reagent for the in vitro diagnosis of gastrin G17 and / or gastrin-releasing peptide precursor protein.

10. A blocking agent for eliminating endogenous interference from in vitro diagnostic reagents, characterized in that, It includes the murine IgG monoclonal antibody as described in claim 1 or 2 and an acceptable adjuvant; the in vitro diagnostic reagent is a reagent for the in vitro diagnosis of gastrin G17 and / or gastrin-releasing peptide precursor protein.

11. The use of the murine IgG monoclonal antibody according to any one of claims 1 to 2 or the blocking agent according to claim 10 in the preparation of a reagent for the in vitro diagnostic of gastrin G17 and / or gastrin-releasing peptide precursor protein that eliminates endogenous interference.

Images