A Bacillus thuringiensis using methanol as a carbon source and its application

By introducing specific enzyme systems into Bacillus thuringiensis and optimizing promoter expression, the problem of low methanol utilization efficiency was solved, and the effect of efficient methanol utilization was achieved, which enhanced its application potential in agriculture and food fields.

CN115725486BActive Publication Date: 2025-07-22JIANGNAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210994809.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-18
Publication Date
2025-07-22
Estimated Expiration
2042-08-18

AI Technical Summary

Technical Problem

The prior art has not yet developed Bacillus thuringiensis, which can utilize methanol as a carbon source, limiting its application potential in agriculture and food fields.

Method used

The methanol dehydrogenase MdH, MdH activation protein AcT, 3-hexanulose-6-phosphate synthase HpS, 6-phosphate-3-hexanone isomerase PhI and NADH dehydrogenase NdH were introduced into Bacillus thuringiensis, and their expression was optimized through metabolic engineering, especially the replacement of the Pveg promoter to improve gene expression levels.

Benefits of technology

The efficient utilization of methanol by Bacillus thuringiensis was achieved, and the consumption volume increased from 0.71g/L to 8.3g/L, significantly improving the consumption capacity of methanol.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115725486B_ABST
    Figure CN115725486B_ABST
Patent Text Reader

Abstract

The present invention discloses a Bacillus thuringiensis using methanol as a carbon source and its application. By introducing methanol dehydrogenase MdH, MdH activator protein AcT, 3-hexulose-6-phosphate synthase HpS, 6-phosphate-3-hexulose isomerase PhI and NADH dehydrogenase NdH into wild-type Bacillus thuringiensis, the present invention first enables Bacillus thuringiensis to consume 0.71 g / L of methanol. Further, by replacing the Pveg promoter with a mutated Pveg promoter, the methanol consumption is increased by 11.7 times to reach 8.3 g / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a Bacillus thuringiensis using methanol as a carbon source and its application, belonging to the field of bioengineering technology. Background Art

[0002] As a Gram-positive microorganism, Bacillus thuringiensis has played a huge role in pest control. It is the most deeply studied, rapidly developed, and widely used microbial insecticide in recent years. The principle of pest control by Bacillus thuringiensis is that its strains can produce two types of toxins, endotoxin (parasporal crystal) and exotoxin, which cause pests to stop feeding, and the pests all die due to hunger, blood deterioration, and nerve poisoning, and it is widely used as a biological pesticide in agriculture. In addition, as a generally recognized safe microorganism, it has a fast growth rate and has great potential in the application of synthetic biology, and is suitable as a host for protein expression and metabolic engineering. Methanol, as a potential renewable carbon source for microorganisms, has many advantages, such as low price, easy availability, and environmental protection. However, there is currently no developed Bacillus thuringiensis that can utilize methanol as a carbon source. Summary of the Invention

[0003] To solve the above technical problems, the present invention provides a Bacillus thuringiensis that can utilize methanol as a carbon source, and improves its utilization efficiency of methanol through metabolic engineering means.

[0004] The first object of the present invention is to provide a Bacillus thuringiensis using methanol as a carbon source, and the Bacillus thuringiensis heterologously expresses methanol dehydrogenase MdH, MdH activation protein AcT, 3-hexulose-6-phosphate synthase HpS, 6-phosphate-3-hexulose isomerase PhI, and NADH dehydrogenase NdH in a host.

[0005] Further, the amino acid sequence of the methanol dehydrogenase MdH is as shown in SEQ ID NO.1, and the amino acid sequence of the MdH activation protein AcT is as described in SEQ ID NO.2.

[0006] Further, the amino acid sequence of the 3-hexulose-6-phosphate synthase HpS is as shown in SEQ ID NO.3, and the amino acid sequence of the 6-phosphate-3-hexulose isomerase PhI is as shown in SEQ ID NO.4.

[0007] Further, the amino acid sequence of the NADH dehydrogenase NdH is as shown in SEQ ID NO.5.

[0008] The methanol dehydrogenase MdH and MdH activating protein AcT of the present invention are from Methanosarcina barkeri MGA3, and the 3-hexulose-6-phosphate synthase HpS, 6-phospho-3-hexulose isomerase PhI, and NADH dehydrogenase NdH are from Bacillus subtilis.

[0009] Furthermore, the expression of the 3-hexulose-6-phosphate synthase HpS, 6-phospho-3-hexulose isomerase PhI, and NADH dehydrogenase NdH is initiated by the Pveg promoter, and the expression of the methanol dehydrogenase MdH and MdH activating protein AcT is initiated by the P566 promoter.

[0010] Furthermore, the nucleotide sequence of the Pveg promoter is as shown in SEQ ID NO.6, SEQ ID NO.10, or SEQ ID NO.11.

[0011] Furthermore, the nucleotide sequence of the P566 promoter is as shown in SEQ ID NO.7.

[0012] Furthermore, the host is wild-type Bacillus thuringiensis HD-1 (GenBank accession number: CP001903).

[0013] The second object of the present invention is to provide the application of the Bacillus thuringiensis in agriculture and food.

[0014] Furthermore, the application is to use Bacillus thuringiensis to ferment and produce the target product with methanol as the carbon source.

[0015] The beneficial effects of the present invention are as follows:

[0016] By introducing methanol dehydrogenase MdH, MdH activating protein AcT, 3-hexulose-6-phosphate synthase HpS, 6-phospho-3-hexulose isomerase PhI, and NADH dehydrogenase NdH into wild-type Bacillus thuringiensis, the present invention first enables Bacillus thuringiensis to consume 0.71 g / L of methanol. Further, by replacing the Pveg promoter with the mutated Pveg promoter, the methanol consumption is increased to 11.7 times, reaching 8.3 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The methanol assimilation pathway introduced into Bacillus thuringiensis. DETAILED DESCRIPTION OF THE INVENTION

[0018] The following is a further description of the present invention with reference to specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the specific embodiments cited are not intended to limit the present invention.

[0019] Materials and methods involved:

[0020] Strain: Wild-type Bacillus thuringiensis HD-1 (GenBank accession number: CP001903).

[0021] Inorganic salt medium: 5 g / L glucose, 10 g / L methanol, 1 g / L tryptone, 0.5 g / L yeast extract, 1 g / L NaCl, 17 g / L Na2HPO4, 3 g / L KH2PO4, 0.6 g / L NH4Cl, 0.21 g / L citric acid monohydrate, 0.015 g / L CaCl2·H2O, 2.5 g / L MgSO4·7H2O, 0.1 mg / L CoCl2·H2O, 0.1 mg / L CuSO4·5H2O, 13.5 mg / L FeCl3·6H2O, 0.33 mg / L MnSO4·H2O, 3.8 mg / L ZnSO4·7H2O. Adjust the pH to 7.0 with ammonia water.

[0022] LB medium (g / L): Tryptone 10, Yeast extract 5, NaCl 10

[0023] SG buffer: Containing 93.1 g of sucrose and 150 mL of glycerol per liter

[0024] 0.1 M PBS: Containing 1.4 g of K2HPO4 and 0.52 g of KH2PO4 per 100 mL

[0025] 1 M MgCl2: Containing 20.33 g of MgCl2·6H2O per 100 mL

[0026] EP buffer: Containing 1 L of SG buffer, 5 mL of 0.1 M PBS, and 500 μL of 1.0 M MgCl2 per liter.

[0027] Example 1: Electroporation of Bacillus thuringiensis

[0028] Competent cell preparation: First, pick a single colony and inoculate it into 5 mL of LB medium, and incubate it overnight at 30 °C for activation. Then transfer it to fresh LB medium at an inoculation ratio of 1 / 100, and culture it at 30 °C and 220 r / min until OD600 is approximately equal to 1.0 - 1.3 (about 2 h), and then cool it in an ice bath for 10 - 30 min. The entire process of competent cell preparation and transformation should be carried out under low-temperature conditions. After cooling, centrifuge the bacterial solution at 5000 r / min and 4 °C for 5 min to collect the cells and discard the supernatant. Then wash the cells twice with pre-cooled EP buffer and once with pre-cooled SG buffer under the same conditions. Finally, resuspend the cells in SG buffer (about 1.5 mL is added) to make the OD600 of the competent cells approximately 50 - 70; aliquot 50 μL of the competent cells per tube into centrifuge tubes and store them at -80 °C for later use, or aliquot 500 μL of the competent cells per tube into centrifuge tubes and aliquot them for immediate use.

[0029] Electroporation process: Take one tube of competent cells and place them on ice, add 3 - 5 μL of plasmid DNA (the plasmid concentration is above 100 ng / μL, and Escherichia coli JM110 must be used as the cloning host, otherwise the plasmid will be restrictively cleaved and the transformation will fail), gently mix by shaking, and after incubating on ice for 10 - 30 min, add it to a pre-cooled 1 mm electroporation cuvette. After electroporation at 1.25 kV, quickly add 500 μL of LB medium preheated to 37 °C; recover and culture at 37 °C and 220 r / min for 2 h, then spread it on a resistant plate and culture it overnight in a 37 °C incubator.

[0030] Example 2: Construction of Bacillus thuringiensis Utilizing Methanol

[0031] First, the auxiliary plasmid pBMB-ESC (sequence is SEQ ID NO.8) was constructed to achieve efficient recombination of Bacillus thuringiensis HD-1. A linear plasmid (sequence is SEQ ID NO.9) expressing the methanol utilization gene cluster was constructed by fusion PCR for its integration cassette. The specific operation is as follows: First, recombination cassettes with homologous arms of 500-1000 bp in length were designed. The left arm was amplified using primers HD-Meth-1F: tggagcaggctttatacatgcgaagg and HD-Meth-1R: gaaattgttatccgctccgtcacacgtgtgtcattttggac. The spectinomycin resistance protein expression cassette was amplified using primers HD-Meth-2F: cacgtgtgacggagcggataacaatttcacacaggaaacagc and HD-Meth-2R: gcaagctgtaattccatttttatcacctcctttCACTACATTTATTGTACAACACG. The 3-hexulose-6-phosphate synthase HpS and 6-phosphate-3-hexulose isomerase PhI expression cassettes were amplified using primers HD-Meth-3F: GTGaaaggaggtgataaaaatggaattacagcttgcattagacctcgtc and HD-Meth-3R: ccgtcctttatatcctattcaaggtttgcgtggtgagtgaac. The NdH expression cassette was amplified using primers HD-Meth-4F: ccacgcaaaccttgaataggatataaaggacggaggatatacgatgtcaaaac and HD-Meth-4R: cacgaaccggaaaggaatgcttttggcaatgcc. The erythromycin resistance protein expression cassette was amplified using primers HD-Meth-5F: ccaaaagcattcctttccggttcgtgttcgtgctgacttgc and HD-Meth-5R: ggccgttttttgtctagggacctctttagctccttgg. The MdH expression cassette was amplified using primers HD-Meth-6F: ctaaagaggtccctagacaaaaaacggcctctcgaaatagagggttg and HD-Meth-6R: CAGTTTGCCCATTTTTCTCACCTCCTTTCTATAATTCATTACATCGCGTTTTTGATAATTTGGATCACThe AcT expression cassette was amplified using primers HD-Meth-7F: GAAAGGAGGTGAGAAAAATGGGCAAACTGTTTGAAGAAAAAACGATC and HD-Meth-7R: gcccagcgtgaTCATTATTTATGTTTCAGCGCTTCTTGCAGC, and the right arm was amplified using primers HD-Meth-8F: CGCTGAAACATAAATAATGAtcacgctgggcataactactttgtg and HD-Meth-8R: caattacggcttgtgcttcctctcg. After purification of the obtained DNA fragments, the corresponding linear plasmid / genomic integration operation was as follows:

[0032] First, competent cells of the strain containing the pBMB-ESC plasmid were prepared. When the OD600 of the bacterial solution was approximately 0.5, xylose with a final concentration of 3% was added, and the culture was continued until the OD600 was approximately equal to 1.0 - 1.3. The remaining operations were the same as those for electrotransforming plasmids. During electrotransformation, the DNA fragment needed to be relatively single. 5 μL of the DNA fragment with a concentration of more than 200 ng / μL was added, and then the culture was continued for 3 h. The remaining operations were the same as those for electrotransforming plasmids. Finally, the DNA integration cassette achieved recombinant editing of the prophage GIL16 genome, and Bacillus thuringiensis containing a complete methanol utilization pathway was obtained.

[0033] The methanol consumption level of this Bacillus thuringiensis was tested: First, a single colony was picked and cultured overnight in 5 mL of LB medium at 37°C. Then, it was transferred to the inorganic salt medium at an inoculation ratio of 1 / 100 and cultured at 37°C and 220 r / min for 24 h, and then the supernatant was obtained by centrifugation. The methanol contents in the blank medium and the fermentation supernatant were measured respectively, and the methanol consumption was calculated. After measurement, Bacillus thuringiensis with a methanol consumption of 0.71 g / L in the inorganic salt medium was obtained.

[0034] Example 3: Construction of Bacillus thuringiensis with high-efficiency methanol utilization

[0035] On the basis of the above-mentioned Bacillus thuringiensis utilizing methanol, the expression levels of the gene cluster containing 3-hexulose-6-phosphate synthase HpS, 6-phospho-3-hexulose isomerase PhI, and NADH dehydrogenase NdH were changed by using a mutated Pveg promoter. The medium-expression-level mutant sequence of the Pveg promoter (SEQ ID NO.10, relative transcriptional intensity is 27.8% of the Pveg promoter) and the low-expression-level mutant sequence (SEQ ID NO.11, relative transcriptional intensity is 3.9% of the Pveg promoter) were used to replace the Pveg promoter respectively. Through the determination of methanol consumption level, it was found that when the medium-expression-level mutant sequence was used, the methanol consumption increased to 2.2 g / L, and when the low-expression-level mutant sequence was used, the methanol consumption increased to 8.3 g / L. After metabolic engineering transformation, the methanol consumption increased to 11.7 times, realizing the efficient utilization of methanol by Bacillus thuringiensis.

[0036] Comparative Example 1: Determination of methanol consumption of wild-type Bacillus thuringiensis

[0037] The methanol consumption level of wild-type Bacillus thuringiensis was tested: First, a single colony was picked into 5 mL of LB medium and cultured overnight at 37 °C. Then, it was transferred to the inorganic salt medium at an inoculation amount of 1 / 100 and cultured at 37 °C and 220 r / min for 24 h, and then the supernatant was taken by centrifugation. The methanol contents in the blank medium and the fermentation supernatant were measured respectively, and the methanol consumption was calculated. After measurement, wild-type Bacillus thuringiensis did not consume methanol in the inorganic salt medium.

[0038] The above-mentioned embodiments are only preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention is subject to the claims.

Claims

1. Bacillus thuringiensis using methanol as a carbon source, characterized in that, The Bacillus thuringiensis heterologously expresses methanol dehydrogenase MdH, MdH activation protein AcT, 3-hexulose-6-phosphate synthase HpS, 6-phosphate-3-hexulose isomerase PhI, and NADH dehydrogenase NdH in a host, and the host is the wild-type Bacillus thuringiensis with the GenBank number CP001903; the expression of 3-hexulose-6-phosphate synthase HpS, 6-phosphate-3-hexulose isomerase PhI, and NADH dehydrogenase NdH is initiated by the Pveg promoter, and the expression of methanol dehydrogenase MdH and MdH activation protein AcT is initiated by the P566 promoter; The nucleotide sequence of the Pveg promoter is as shown in SEQ ID NO.11; the nucleotide sequence of the P566 promoter is as shown in SEQ ID NO.7; The amino acid sequence of the methanol dehydrogenase MdH is as shown in SEQ ID NO.1, and the amino acid sequence of the MdH activation protein AcT is as shown in SEQ ID NO.2; the amino acid sequence of the 3-hexulose-6-phosphate synthase HpS is as shown in SEQ ID NO.3, the amino acid sequence of the 6-phosphate-3-hexulose isomerase PhI is as shown in SEQ ID NO.4; the amino acid sequence of the NADH dehydrogenase NdH is as shown in SEQ ID NO.

5.

2. Use of the Bacillus thuringiensis according to claim 1 in agriculture and food, characterized in that, The application uses methanol as a carbon source and utilizes Bacillus thuringiensis to ferment and produce the target product.

Citation Information

Patent Citations

  • Artificial methylotrophic bacillus subtilis and a construction method thereof

    CN111662857A

  • Bacillus thuringiensis liquid fermentation culture medium and Bacillus thuringiensis fermentation culture method

    CN112501083A