A diagnostic marker for tuberculosis infection and a diagnostic kit thereof

By detecting the expression level of the LINC01148 gene and using its siRNA, the specificity problem in the diagnosis of pulmonary tuberculosis was solved, enabling rapid diagnosis and effective treatment, and improving the accuracy of diagnosis and treatment outcomes.

CN115772559BActive Publication Date: 2026-03-17REHABILITATION UNIVERSITY QINGDAO CENTRAL HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-06
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

The lack of specific biological indicators in the current technology for the diagnosis of pulmonary tuberculosis makes diagnosis difficult and makes it difficult to identify the source of infection in a timely manner, which affects treatment and prevention of transmission.

Method used

Using primers and siRNA of the LINC01148 gene as diagnostic markers, tuberculosis infection was diagnosed by detecting its expression level. Diagnostic kits and therapeutic drugs were prepared by using siRNA to inhibit the activity of Mycobacterium tuberculosis in macrophages.

Benefits of technology

It enables rapid and effective diagnosis of pulmonary tuberculosis, improves the specificity and sensitivity of diagnosis, and provides an effective treatment method by inhibiting the activity of Mycobacterium tuberculosis by inhibiting the expression of the LINC01148 gene.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115772559B_ABST
    Figure CN115772559B_ABST
Patent Text Reader

Abstract

A diagnosis marker for pulmonary tuberculosis infection and a diagnosis kit thereof belong to the technical field of pulmonary tuberculosis diagnosis and treatment.The marker for detecting pulmonary tuberculosis provided by the present application is a LINC01148 gene, and the LINC01148 gene can be detected by primers to effectively diagnose whether a patient has pulmonary tuberculosis or not; the transcript sequence of the LINC01148 gene is SEQ ID NO.1, and the primer sequences of the LINC01148 gene are SEQ ID NO.2 and SEQ ID NO.3.Meanwhile, it is found that inhibiting the expression of the LINC01148 gene can effectively inhibit the activity of tubercle bacillus in macrophages, so the siRNA of the LINC01148 gene can be used for treating pulmonary tuberculosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pulmonary tuberculosis diagnosis and treatment technology, and particularly relates to the application of a diagnostic marker for pulmonary tuberculosis infection and its diagnostic kit. Background Technology

[0002] Tuberculosis (TB) is a chronic infectious disease with a long history, and a major global public health problem that seriously threatens human health. Therefore, timely and accurate diagnosis of TB not only enables patients to receive targeted treatment as early as possible, thus improving prognosis, but more importantly, it allows for timely and effective identification of the source of infection, preventing the spread of TB. However, due to the diverse clinical manifestations of TB, imaging findings lack sufficient specificity, and laboratory tests lack ideal biological indicators, making the diagnosis of TB a challenge for clinicians to this day.

[0003] Non-coding RNA refers to RNA that does not have the ability to code proteins, including transfer RNA, ribosomal RNA, micronucleolar RNA, and other non-coding RNAs. Non-coding RNAs are widely involved in important biological functions in life activities, such as the development and differentiation of organisms, reproduction, apoptosis, and cell reprogramming, and they are closely related to human diseases.

[0004] Long non-coding RNAs (LUNs) possess a broad tissue expression profile. Compared to protein-coding mRNAs, their expression abundance is generally lower, but they exhibit stronger tissue and cell expression specificity. Therefore, LUNs have the potential to serve as biomarkers. This invention therefore investigates the application of LUNs in the diagnosis of pulmonary tuberculosis. Summary of the Invention

[0005] The purpose of this invention is to provide a diagnostic biomarker for pulmonary tuberculosis infection and a diagnostic kit thereof, so that users can more quickly and effectively diagnose whether a patient has pulmonary tuberculosis and the patient's prognosis.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides the application of primers for detecting LINC01148 gene expression in the preparation of kits for the auxiliary diagnosis of pulmonary tuberculosis infection.

[0008] Preferably, the transcript sequence of the LINC01148 gene is SEQ ID NO.1.

[0009] Preferably, the upstream sequence of the primer is SEQ ID NO.2, and the downstream sequence of the primer is SEQ ID NO.3.

[0010] Secondly, this invention provides the application of primers for detecting LINC01148 gene expression in the preparation of a kit for diagnosing the prognosis of patients with pulmonary tuberculosis infection.

[0011] Preferably, the transcript sequence of the LINC01148 gene is SEQ ID NO.1.

[0012] Preferably, the upstream sequence of the primer is SEQ ID NO.2, and the downstream sequence of the primer is SEQ ID NO.3.

[0013] Secondly, this invention provides the application of siRNA of the LINC01148 gene in the preparation of drugs for the treatment of pulmonary tuberculosis.

[0014] Preferably, the transcript sequence of the LINC01148 gene is SEQ ID NO.1;

[0015] The sequence of the sense strand of the siRNA is SEQ ID NO.4; the sequence of the antisense strand of the siRNA is SEQ ID NO.5.

[0016] Preferably, the drug treats pulmonary tuberculosis by inhibiting the survival of Mycobacterium tuberculosis in macrophages;

[0017] Preferably, the macrophages are THP-1 cells;

[0018] Preferably, the tuberculosis bacillus is Mycobacterium tuberculosis H37Rv.

[0019] Secondly, this invention provides the application of siRNA of the LINC01148 gene in the preparation of drugs that inhibit the survival of Mycobacterium tuberculosis in macrophages.

[0020] Preferably, the transcript sequence of the LINC01148 gene is SEQ ID NO.1;

[0021] The sequence of the sense strand of the siRNA is SEQ ID NO.4; the sequence of the antisense strand of the siRNA is SEQ ID NO.5.

[0022] The beneficial effects of this invention are:

[0023] This invention, by comparing the expression differences of the LINC01148 gene in peripheral blood mononuclear cells of healthy controls and tuberculosis patients, found that the expression level of the LINC01148 gene is increased in tuberculosis patients. Furthermore, this invention found that the expression level of the LINC01148 gene in peripheral blood mononuclear cells of cured patients was lower than that of untreated patients, and these differences showed excellent specificity and sensitivity. Therefore, the LINC01148 gene can be used for the diagnosis of tuberculosis and the prognosis of tuberculosis patients.

[0024] Meanwhile, this invention found that the expression level of the LINC01148 gene was also upregulated after Mycobacterium tuberculosis infected macrophages, and inhibiting the expression of the LINC01148 gene can effectively inhibit the activity of Mycobacterium tuberculosis in macrophages. Therefore, the inhibitor of the LINC01148 gene can be used to treat pulmonary tuberculosis. Attached Figure Description

[0025] Figure 1 The difference in relative expression levels of the LINC01148 gene among different groups;

[0026] Figure 2 ROC curves between the healthy treatment group and the untreated group;

[0027] Figure 3 The ROC curves are shown between the untreated group and the initial treatment group.

[0028] Figure 4 The ROC curve is shown between the untreated group and the cured group;

[0029] Figure 5 The difference in LINC01148 expression level after THP-1 cells were infected with Mycobacterium tuberculosis;

[0030] Figure 6 The present invention describes the inhibitory effect of LINC01148-siRNA on the expression level of LINC01148 in THP-1 cells.

[0031] Figure 7 To investigate the survival of Mycobacterium tuberculosis in THP-1 cells after inhibiting LINC01148. Detailed Implementation

[0032] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0033] Research subjects

[0034] Patients with pulmonary tuberculosis admitted to Qingdao Central Hospital were selected and divided into three groups: an untreated group (n=42), a preliminary treatment group (n=30, treated for 3 months) and a cured group (n=25). Forty healthy controls were also included. There were no significant differences in age or gender among the groups.

[0035] Patients diagnosed with pulmonary tuberculosis were included in the diagnostic criteria for pulmonary tuberculosis, while those with chronic hepatitis, HIV, hypertension, diabetes, tumors, or other diseases were excluded.

[0036] Example 1

[0037] cDNA extracted from each group

[0038] (1) Collect 5 ml of peripheral blood from the subjects in the morning on an empty stomach and put it into a heparin sodium anticoagulant tube, mix well and set aside;

[0039] (2) Using Ficoll lymphocyte separation medium, mononuclear cells were separated by density gradient centrifugation and washed three times with PBS;

[0040] (3) Add 1 ml of Trizol reagent to the mononuclear cells, mix well by pipetting, and let stand for 5 min;

[0041] (4) Add 200 μl of chloroform, mix by inverting, let stand at room temperature for 5 min, and centrifuge at 12000 rpm for 15 min;

[0042] (5) Carefully transfer the upper aqueous phase to a new enzyme-free centrifuge tube, add an equal volume of isopropanol, mix well, and place on ice for 10 min.

[0043] (6) Centrifuge at 12000 rpm for 10 min, discard the supernatant, add 500 μl of pre-cooled 70% ethanol to dissolve the precipitate, centrifuge at 8000 rpm for 5 min, discard the supernatant, dry at room temperature for 5-10 min, add 30 μL of DEPC water to obtain RNA.

[0044] (7) The gDNA removal reaction system was prepared according to the Tiangen Biotech reverse transcription kit as follows:

[0045] Composition Usage 5×g DNA Buffer 2 μL TotaL RNA 2 μg RNase-Free ddH2O To bring the volume up to 10 μL

[0046] The reaction conditions for gDNA were: 42℃ for 3 min, followed by incubation at 4℃.

[0047] (8) Reverse transcription reaction system

[0048] Composition Usage 10×King RT Buffer 2 μL FastKing RT Enzyme Mix 1 μL FQ-RT Primer Mix 2 μL Step (7) Reaction solution 10 μL RNase-Free ddH2O 5μL

[0049] The reaction conditions for reverse transcription were: incubation at 42℃ for 15 min, incubation at 95℃ for 3 min, and storage at 4℃.

[0050] Example 2

[0051] Detecting the expression differences of the LINC01148 gene in different groups

[0052] 1. Design upstream and downstream primers for the LOC1053773056 gene based on the transcript sequence (SEQ ID NO.1) of LINC01148:

[0053] Upstream primer for LINC01148: CCTTGTCACCCAAGCTGGAG, SEQ ID NO.2;

[0054] Downstream primer for LINC01148: GGTGCATGCCTGTAGTTCCA, SEQ ID NO.3;

[0055] 2. Configure the following reaction system.

[0056] reagents Usage <![CDATA[Hieff ® qPCR SYBR Green Master Mix (Low Rox Plus)]]> 10 μL Template DNA 1 μL Forward Primer 0.5 μL Reverse Primer 0.5 μL Sterile ultrapure water 8 μL

[0057] Set up the following reaction steps:

[0058] Pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 10 s; annealing / extending at 60℃ for 30 s, for 40 cycles.

[0059] 3. Use 2 -△△Ct The method processes real-time quantitative PCR data, calculates the expression changes of LINC01104, and the experimental results are as follows: Figure 1 As shown.

[0060] The results of the experiment are presented in Figure 1 In the untreated group, the relative expression level was 2.988±1.034, which was significantly higher than that in the healthy control group (P<0.05).

[0061] The relative expression level in the initial treatment group was 1.840±0.783, which was lower than that in the untreated group (P<0.05), indicating a statistically significant difference.

[0062] The relative expression level in the cured group was 1.089±0.582, which was further reduced, and P<0.05, indicating a statistically significant difference.

[0063] The above results indicate that the expression level of the LINC01104 gene in peripheral blood mononuclear cells of patients with pulmonary tuberculosis is significantly higher than that of healthy individuals, while the expression level of the LINC01104 gene in mononuclear cells decreased significantly after treatment.

[0064] Example 3

[0065] Plot the ROC curves between each group.

[0066] 1. ROC curves of the healthy control group and the untreated group are as follows: Figure 2As shown, its AUC value was 0.966, its confidence interval was 0.936-0.997, its cut-off value was 1.958, its sensitivity was 83.3%, and its specificity was 97.5%. The above results indicate that using LINC01148 as a biomarker to diagnose whether a patient is infected with pulmonary tuberculosis has excellent diagnostic value.

[0067] 2. ROC curves of the untreated group and the initial treatment group are as follows: Figure 3 As shown, its AUC value is 0.820, its my confidence interval is 0.718-0.922, its cut-off value is 1.820, its sensitivity is 73.3%, and its specificity is 85.7%.

[0068] 3. ROC curves of the untreated group and the cured group are as follows: Figure 4 As shown, its AUC value was 0.955, its confidence interval was 0.913-0.997, its cut-off value was 2.013, its sensitivity was 95.5%, and its specificity was 83.3%. The above results indicate that LINC01148 has excellent diagnostic value when used as a biomarker to diagnose the prognosis of patients with pulmonary tuberculosis.

[0069] Example 4

[0070] The effect of Mycobacterium tuberculosis infection on LINC01148 gene expression in macrophages

[0071] (1) Select THP-1 cells that are in good condition, have regular shape, and are translucent spherical and seed them in a culture plate. Use 100 ng / ml PMA to induce them to become macrophages and make the cells adhere to the plate.

[0072] (2) H37Rv cells were infected at MOI=10:1. After 4 hours of bacterial infection, the supernatant was discarded, and the cells were washed 3 times with PBS and the medium was changed. At this time, the infection was recorded as 0 hours.

[0073] (3) RNA was extracted from cells infected for 0 h and 24 h, respectively. The RNA extraction method, reverse transcription, and quantitative fluorescence detection steps were the same as in Examples 1 and 2. Five replicates were set up for each group. The results are as follows: Figure 5 As shown.

[0074] The results of the experiment are presented in Figure 5 As can be seen, 24 hours after infection, the relative expression level of the LINC01148 gene in macrophage THP-1 cells was significantly increased (relative expression level was 5.52±0.0512), and the difference was statistically significant.

[0075] Example 5

[0076] Design and detection of siRNAs that inhibit the LINC01148 gene

[0077] (1) Based on the transcript sequence of LINC01148, siRNA was designed. The designed siRNA (LINC01148-siRNA) is as follows:

[0078] Chain of Justice: GGAAGAACUGAUAUAUUUACA, SEQ ID NO.4;

[0079] Antonym chain: UAAAUAUAUCAGUUCUUCCUG, SEQ ID NO.5;

[0080] NC-siRNA was provided by Shanghai Gemma Company;

[0081] (2) THP-1 cells were seeded in culture plates and induced to adhere to the plates with 100 ng / ml PMA for 24 h.

[0082] (3) Use lip3000 to transfect LINC01148-siRNA and NC-siRNA, and set up a control group with empty lip3000 transfection;

[0083] (4) 48 h after transfection, RNA was extracted and the relative expression level of LINC01148 was detected.

[0084] The results of the experiment are presented in Figure 6 As can be seen from the data, the LINC01148-siRNA provided by this invention can effectively inhibit the expression of LINC01148 in THP-1 cells, with an inhibition rate of 84.7%.

[0085] Example 6

[0086] The effect of inhibiting the LINC01148 gene on the survival and proliferation of Mycobacterium tuberculosis in macrophages

[0087] (1) THP-1 cells were seeded in culture plates and induced to adhere to the plates for 24 hours with 100 ng / ml PMA.

[0088] (2) LINC01148-siRNA and NC-siRNA were transfected using lip3000;

[0089] (3) 48 h after transfection, H37Rv was used to infect cells at MOI=10:1. After adding bacteria for 4 h, the supernatant was discarded, and the cells were washed 3 times with PBS and the medium was changed. At this time, it was recorded as 0 h of infection.

[0090] (4) Cells infected with 0.05% SDS were lysed at 0h and 24h respectively. After 10-fold serial dilution, the cells were seeded on 7H10 agar plates containing 10% OADC and incubated at 37°C for 3 weeks to count CFU.

[0091] The results of the experiment are presented in Figure 7 As can be seen, compared with the control group, the number of Mycobacterium tuberculosis in THP-1 cells transfected with LINC01148-siRNA was significantly reduced, indicating that the use of LINC01148-siRNA can effectively inhibit the survival of Mycobacterium tuberculosis in macrophages.

[0092] Example 7: Diagnostic kit for detecting pulmonary tuberculosis infection

[0093] This invention provides a diagnostic kit for detecting pulmonary tuberculosis infection, which includes primers for detecting the expression level of LINC01148, SYBR Green dye, sterile water, and dNTPs.

[0094] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. Application of primers for detecting LINC01148 gene expression in preparation of a kit for assisting diagnosis of pulmonary tuberculosis infection.

2. Use according to claim 1, characterized in that, The transcript sequence of the LINC01148 gene is SEQ ID NO.

1.

3. Use according to claim 1, characterized in that, The upstream sequence of the primer is SEQ ID NO. 2, and the downstream sequence of the primer is SEQ ID NO.

3.

4. Application of siRNA of LINC01148 gene in preparation of a drug for treating tuberculosis, characterized in that, The transcript sequence of the LINC01148 gene is SEQ ID NO. 1; The sequence of the sense strand of the siRNA is SEQ ID NO. 4, and the sequence of the antisense strand of the siRNA is SEQ ID NO. 5.

Citation Information

Patent Citations

  • Application of peripheral blood mononuclear cells hsa-miR-8774-3p as marker of active tuberculosis

    CN110643697A

  • Pulmonary tuberculosis specific marker, application and kit

    CN112608995A