A method of screening wheat for different rates of grout

Abstract

The application discloses a method for screening wheat with different grouting rates. The method comprises the following steps: detecting whether the genotype of AX-110942203 site of the wheat to be tested is CC homozygous or TT homozygous, and the grouting rate of the wheat with the genotype of CC homozygous based on the AX-110942203 site is greater than the grouting rate of the wheat with the genotype of TT homozygous based on the AX-110942203 site; and the AX-110942203 site is the nucleotide at the 36th position from the 5' end of SEQ ID NO:1 in the wheat genome. Experiments prove that the grouting rate of wheat can be screened by detecting the genotype of AX-110942203 site of the wheat to be tested. The application has important application value in wheat breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to a method for screening wheat with different grain-filling rates. Background Technology

[0002] Wheat is the world's most widely cultivated grain crop and my country's third largest grain crop. With decreasing arable land, increasing population, rising living standards, and the deepening impact of international events on global food production, continuing to increase wheat production is of significant practical importance to ensuring my country's food security. Over the past 20 years, the increase in my country's wheat production has mainly been due to improved yield per unit area. Therefore, improving yield per unit area through genetic improvement is one of the most effective measures to increase wheat production.

[0003] The Huang-Huai wheat region is my country's most important wheat-producing area, accounting for over 60% of the country's sown area and total output, playing a crucial role in ensuring national food security. Wheat yield is influenced by three factors: the number of ears per unit area, the number of grains per ear, and the thousand-grain weight. Coordinating the relationship among these three factors is key to achieving high wheat yields. The annual genetic gain of wheat yield in the Huang-Huai wheat region is approximately 0.48%-1.05%, with the annual genetic gain of thousand-grain weight being the largest component, at 0.35%-0.51%. Although the genetic gain of yield has slowed in the past 15 years, grain weight has continued to increase, indicating that grain weight improvement is a key factor in significantly increasing yield. Grain weight is mainly controlled by genotype and significantly influenced by the environment, exhibiting the highest heritability among yield components. During the grain-filling period, winter wheat in the Huang-Huai region frequently encounters adverse environmental conditions such as high temperatures, drought, hot and dry winds, and rainfall, resulting in incomplete grain filling, reduced grain weight, and yield losses. Numerous studies have shown that grain weight mainly depends on the rate and duration of grain filling. For the Huang-Huai main wheat-producing area, where the grain-filling period is relatively short, the grain-filling rate is the decisive factor for grain weight, mainly controlled by genotype; while the contribution of the grain-filling duration to grain weight is relatively small, mainly determined by the climate and cultivation system of specific regions. Therefore, improving the grain-filling rate is one of the key focuses of current wheat breeding work. Given the importance of the grain-filling rate to grain weight, and considering the cumbersome nature of measuring the grain-filling rate, while grain weight and average grain-filling rate are significantly positively correlated (r = 0.90, P < 0.001), the average grain-filling rate can be calculated by recording parameters such as flowering period, maturity period, and thousand-grain weight, and recording the number of days from flowering to maturity as the grain-filling duration. The average grain-filling rate can then be obtained based on the ratio of thousand-grain weight to grain-filling duration.

[0004] Single nucleotide polymorphisms (SNPs) are widely distributed in the genome, possessing advantages such as extremely high density, broad coverage, and high-throughput detection. They have been increasingly applied in high-density genetic mapping, quantitative trait gene localization, and germplasm genotyping, effectively accelerating the molecular breeding process. In recent years, LGC Genomics has developed a SNP genotyping detection scheme based on KASP (Kompetitive Allele-Specific PCR) technology. This scheme uses universal fluorescent probes instead of site-specific fluorescent probes, effectively saving costs and is increasingly being used in crop MAS breeding research. Based on parental or natural populations, gene chips are used to detect SNP genotypes and discover target trait genetic loci. KASP markers are then developed and used to detect breeding materials, enabling efficient, accurate, and low-cost MAS breeding of complex agronomic traits in wheat.

[0005] Jimai 22 is a high-yielding variety bred by the Crop Research Institute of the Shandong Academy of Agricultural Sciences. It was approved by the state for the Huang-Huai-Bei region in 2006, and its introduction and registration in Anhui and Henan provinces for the Huang-Huai-Nan region were completed in 2010 and 2011 respectively. Its cumulative planting area exceeds 21 million hectares, ranking first in the country for 12 consecutive years, with a current annual planting area of ​​approximately 1 million hectares. Zhongmai 578 is a strong-gluten, high-yielding new wheat variety jointly bred by the Institute of Crop Science and the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. It was approved by the state for the Huang-Huai-Nan and Huang-Huai-Bei regions in 2020 and 2021 respectively, with a current annual planting area of ​​approximately 370,000 hectares. It has become a major promoted variety and an important backbone parent in the Huang-Huai wheat region. Summary of the Invention

[0006] The purpose of this invention is to determine the grain-filling rate of wheat.

[0007] This invention first protects the primer set, which consists of upstream primer F1, upstream primer F2 and downstream primer R;

[0008] The upstream primer F1 consists of fluorescent tag sequence A and the DNA fragment shown in SEQ ID NO:2 from position 22 to 45 from the 5' end;

[0009] The upstream primer F2 consists of fluorescent tag sequence B and the DNA fragment shown in SEQ ID NO:3 from position 22 to 45 from the 5' end;

[0010] The nucleotide sequence of the downstream primer R is shown in SEQ ID NO:4.

[0011] In the primer set described above, the nucleotide sequence of fluorescent tag sequence A is shown as positions 1 to 21 from the 5' end of SEQ ID NO:2. The nucleotide sequence of fluorescent tag sequence B is shown as positions 1 to 21 from the 5' end of SEQ ID NO:3.

[0012] In the above text, the nucleotide sequence shown in SEQ ID NO:2 from position 1 to 21 starting from the 5' end is the FAM fluorescent tag sequence, and the fluorescence signal is specifically blue. The nucleotide sequence shown in SEQ ID NO:3 from position 1 to 21 starting from the 5' end is the HEX fluorescent tag sequence, and the fluorescence signal is specifically red.

[0013] This invention also protects the application of any of the primer sets described above, which may be any of the following b1)-b3):

[0014] b1) To determine the grain-filling rate of the wheat being tested;

[0015] b2) Screening for wheat varieties with high grain-filling rates;

[0016] b3) Wheat breeding.

[0017] This invention also protects the application of the DNA fragment shown in SEQ ID NO:1, which may be any of the following b1)-b4):

[0018] b1) To determine the grain-filling rate of the wheat being tested;

[0019] b2) Screening for wheat varieties with high grain-filling rates;

[0020] b3) Wheat breeding;

[0021] b4) as a molecular marker for identifying the grain-filling rate of wheat under test.

[0022] b4) That is, the present invention also protects the molecular marker shown in SEQ ID NO:1.

[0023] This invention also protects a method for screening wheat with different grain-filling rates, comprising the following steps: detecting whether the genotype of the wheat to be tested based on the AX-110942203 locus is CC homozygous or TT homozygous.

[0024] The grain-filling rate of wheat with a genotype of CC based on the AX-110942203 locus was greater than that of wheat with a genotype of TT based on the AX-110942203 locus.

[0025] The AX-110942203 site is the 36th nucleotide from the 5' end of SEQ ID NO:1 in the wheat genome.

[0026] In the above method, the step of detecting whether the genotype of the wheat to be tested based on the AX-110942203 locus is CC homozygous or TT homozygous is as follows:

[0027] (a1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using any of the primer sets described above to obtain PCR amplification products;

[0028] (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected by an instrument, and the genotype of the wheat to be tested based on the AX-110942203 site is obtained according to the color of the fluorescence signal.

[0029] In the above method, the step of detecting whether the genotype of the wheat to be tested based on the AX-110942203 locus is CC homozygous or TT homozygous is as follows:

[0030] (b1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using any of the primer sets described above to obtain PCR amplification products;

[0031] (b2) Take the PCR amplification product obtained in step (b1) and sequence it;

[0032] (b3) Based on the sequencing results obtained in step (b2), obtain the genotype of the wheat to be tested based on the AX-110942203 locus.

[0033] This invention also protects a kit for identifying wheat grain-filling rate, comprising a substance for detecting the genotype of the wheat sample based on the AX-110942203 locus;

[0034] The AX-110942203 site is the 36th nucleotide from the 5' end of SEQ ID NO:1 in the wheat genome.

[0035] The kit may specifically consist of substances that detect the genotype of the wheat to be tested based on the AX-110942203 locus.

[0036] In the above kit, the substance used to detect the genotype of the wheat to be tested based on the AX-110942203 locus can be any of the primer sets described above.

[0037] The preparation method of the kit is also within the scope of protection of this invention. The preparation method of the kit includes the step of individually packaging each primer from any of the primer sets described above.

[0038] This invention also protects the application of any of the above-described reagent kits, which may be any of the following b1)-b3):

[0039] b1) To determine the grain-filling rate of the wheat being tested;

[0040] b2) Screening for wheat varieties with high grain-filling rates;

[0041] b3) Wheat breeding.

[0042] In the above text, the ">" can specifically refer to the statistical definition of ">". The "high grouting rate" can specifically refer to a statistically significant high grouting rate.

[0043] Experiments have shown that, using the method provided by this invention to detect whether the genotype of the wheat under test based on the AX-110942203 locus is CC homozygous or TT homozygous, the grain-filling rate of wheat with the genotype CC based on the AX-110942203 locus is greater than that of wheat with the genotype TT based on the AX-110942203 locus.

[0044] The AX-110942203 locus is the 36th nucleotide from the 5' end of SEQ ID NO:1 in the wheat genome. Therefore, by detecting the genotype of the wheat sample based on the AX-110942203 locus, the grain-filling rate trait can be screened. This invention has significant application value in marker-assisted breeding of wheat. Attached Figure Description

[0045] Figure 1 Genetic linkage map constructed from SNP markers in a 50K chip.

[0046] Figure 2 This is a partial detection result of the F5RIL population of 262 Zhongmai 578 / Jimai 22 in step five of Example 1.

[0047] Figure 3 The results are part of the test results for 109 wheat varieties from the Huang-Huai wheat region in Example 2. Detailed Implementation

[0048] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0049] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0050] Jimai 22 (described in the following literature: High-yielding, stable-yielding, disease-resistant, and widely adaptable new wheat variety - Jimai 22. Li Haosheng, Liu Jianjun, Song Jianmin, Liu Aifeng, Cheng Dungong, Zhao Zhendong. Journal of Triticeae Crops, 2007(04): 744) is a wheat variety bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences in 1994 through hybridization using its self-bred line 935024 as the female parent and 35106 as the male parent, and selected through pedigree selection. Jimai 22 has the characteristics of good comprehensive agronomic traits, high yield potential, good yield stability, and wide adaptability, and is a high-quality medium-gluten wheat variety.

[0051] Zhongmai 578 (described in the following literature: Planting performance and cultivation techniques of Zhongmai 578 in Zhumadian area. Wang Haifeng, Zhao Weiqin, Ran Wuling, Wu Changcheng, Wang Jiarun, Wang Zijun, Wang Fang, China Seed Industry. 2020(10): 99-101.) is a high-quality, strong-gluten, and high-yield wheat variety jointly developed by the Institute of Crop Science and the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. It has the advantages of early maturity and good yellowing, high quality and strong gluten, high and stable yield, lodging resistance and wide adaptability, high and stable thousand-grain weight, and good grain marketability. It is a new generation variety for the production of high-quality strong-gluten wheat in Zhumadian area of ​​Henan Province.

[0052] The grain-filling duration is the number of days from flowering to maturity. Grain-filling rate = thousand-grain weight / grain-filling duration (g / day). The grain-filling rate plays a decisive role in grain plumpness and weight.

[0053] Example 1: Discovery of the AX-110942203 locus of the grain-filling rate control gene and acquisition of primer sets for identifying wheat grain-filling rate.

[0054] I. Field phenotypic data analysis and discovery of new grain-filling rate QTLs

[0055] 1. In the 2019-2020 crop year, the F5 RIL populations of Zhongmai 578, Jimai 22, and 262 F5 RIL populations of Zhongmai 578 / Jimai 22 were planted in Xinxiang, Henan (34°53′N, 113°23′E; E1). In the 2020-2021 crop year, the F5 RIL populations of Zhongmai 578, Jimai 22, and 262 F5 RIL populations of Zhongmai 578 / Jimai 22 were planted in Xinxiang (E2), Shangqiu (33°43′N, 114°49′E; E3), Luoyang (34°32′N, 112°16E; E4), and Gaoyi, Hebei (37°33′N, 114°26′E; E5), respectively, for a total of five environments. All environments adopted a completely randomized block design with three replicates, 1m row length, 30 grains / row, and 20cm row spacing. Other field management practices were carried out in accordance with local wheat field management standards. Record the flowering period, maturity period, and grain weight of wheat, and further analyze the grain-filling duration and rate. The average value of three replicates is the grain-filling rate of wheat.

[0056] 2. After completing step 1, use the internationally recognized SAS statistical software PROC CORR model to calculate the Pearson correlation coefficient of the grouting rate and the PROC MIXED command to perform analysis of variance.

[0057] Analysis of variance showed that there were significant differences in granulation rate among different genes at the 0.01 level, and the correlation coefficients of the five environments ranged from 0.41 to 0.74, indicating good correlation and thus clarifying the accuracy of the phenotypic data.

[0058] 3. Construction of genetic linkage maps

[0059] Genotyping of the F5RIL populations of Zhongmai 578, Jimai 22, and 262 Zhongmai 578 / Jimai 22 was performed using the wheat 50K microarray (Boao). The wheat 50K microarray contains 55,224 SNP markers, evenly distributed across 21 chromosomes. Before constructing the genetic linkage map, markers without parental polymorphism were removed, as were markers with a deletion rate greater than 20% and a minimum allele frequency less than 0.3. The remaining 9,354 high-quality polymorphic markers were then analyzed. After removing redundant markers using the BIN function of Icimapping 4.2, 1,501 markers remained. Linkage analysis was performed using JoinMap 4.0 software, and the linkage map was constructed using MapChart 2.32.

[0060] The genetic linkage map constructed from SNP markers in the 50K chip is shown below. Figure 1 .

[0061] 4. QTL positioning

[0062] QTL analysis was performed using the Complete Interval Mapping (ICIM) method in IciMapping 4.2 software. The mapping parameters were set to a scan step size of 0.1 cM, a stepwise regression marker entry probability (PIN) of 0.001, and a LOD (Logarithm of the odds) critical value calculated using 1000 permutation tests (P < 0.05). QTLs with a phenotypic variance greater than 10% were considered major-effect QTLs, while those repeatedly localized in three or more environments were considered stable QTLs. QTLs were named according to the International Genetic Nomenclature Convention.

[0063] Ultimately, a grouting rate QTL, QGfr.caas-7A, was identified that remained stable under five environmental conditions and the expected mean; QTLQGfr.caas-7A is the new grouting rate QTL.

[0064] II. Discovery of the AX-110942203 site

[0065] The inventors of this invention conducted extensive sequence analysis, alignment, and preliminary experiments, discovering that the AX-110942203 SNP site upstream of QGfr.caas-7A is not only physically close but also exhibits numerous differential sites among the three homologous chromosomes. The AX-110942203 SNP site is referred to simply as the AX-110942203 site.

[0066] The AX-110942203 locus corresponds to the 36th nucleotide from the 5' end of SEQ ID NO:1 in the wheat genome, and the genotypes are CC homozygous, TT homozygous, and CT heterozygous. SEQ ID NO:1:

[0067] ATGTCGTCAGCTCTTTTACGCTACACCCTGACGGAYGGATGCATGTAAGTAAGTAAGCATTTTGTCATTTT (Y is C / T).

[0068] Since genomic DNA is a double-stranded DNA molecule composed of two antisense complementary single-stranded DNA molecules, the DNA molecule encoding proteins is generally named the sense DNA molecule, and the DNA molecule antisense complementary to the sense DNA molecule is named the antisense DNA molecule. The genotypes at the AX-110942203 locus are all sense DNA genotypes.

[0069] III. Obtaining the primer set for identifying wheat grain-filling rate

[0070] Based on the AX-110942203 locus and its preceding and following nucleotide sequences, a primer set suitable for identifying wheat grain-filling rate using allele-competitive specific PCR was designed and synthesized. The primer set consists of three primers: upstream primer F1, upstream primer F2, and downstream primer R3, used to amplify the target sequence including the AX-110942203 locus. The nucleotide sequences of each primer are shown in Table 1.

[0071] Table 1

[0072] Primer name Nucleotide sequence (5'-3') upstream primer F1 GAAGGTGACCAAGTTCATGCTTGCTTACTTACTTACATGCATCCG(SEQ ID NO:2) upstream primer F2 GAAGGTCGGAGTCAACGGATTTGCTTACTTACTTACATGCATCCA(SEQ ID NO:3) Downstream primer R CCGACGAGACACGCTATCTC(SEQ ID NO:4)

[0073] Note: A single underscore indicates a FAM fluorescent tag sequence, and a double underscore indicates a HEX fluorescent tag sequence.

[0074] IV. Establishment of a genotyping method for wheat based on the AX-110942203 locus

[0075] 1. Obtaining genomic DNA from the wheat sample

[0076] Genomic DNA was extracted from the wheat samples using the CTAB method.

[0077] The quality and concentration of the wheat genomic DNA to be tested must meet the requirements of PCR. The standards are as follows: agarose gel electrophoresis shows a single DNA band without obvious diffusion; the A260 / A280 ratio detected by a Nanodrop 2100 (Thermo) spectrophotometer is between 1.8 and 2.0 (DNA sample has no protein contamination), the A260 / A230 ratio is between 1.8 and 2.0 (DNA sample has low salt ion concentration), and there is no obvious light absorption at 270 nm (DNA sample has no phenol contamination); the concentration of the wheat genomic DNA to be tested is 50-200 ng / μL.

[0078] 2. Competitive allele-specific PCR

[0079] (1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer set synthesized in step three to obtain PCR amplification products.

[0080] The reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃-55℃ (using the touch down program, decreasing by 0.6℃ per cycle) for 1 min, amplification for 10 cycles; 94℃ denaturation for 20 s, 55℃ for 1 min, and continued amplification for 26 cycles.

[0081] 3. After completing step 2, when the temperature of the PCR amplification product drops below 40℃, read the fluorescence value by scanning with the FAM and HEX beams of the microplate reader (the FAM fluorescent tag sequence is read at an excitation wavelength of 485nm and an emission wavelength of 520nm, and the HEX fluorescent tag sequence is read at an excitation wavelength of 528nm and an emission wavelength of 560nm). Determine the genotype of the wheat to be tested based on the AX-110942203 locus based on the fluorescence signal color. The specific judgment principles are as follows: If the wheat sample shows a blue fluorescent signal at the AX-110942203 locus, then the genotype of the wheat sample at the AX-110942203 locus is CC homozygous; if the wheat sample shows a red fluorescent signal at the AX-110942203 locus, then the genotype of the wheat sample at the AX-110942203 locus is TT homozygous; if the wheat sample shows a green fluorescent signal at the AX-110942203 locus, then the genotype of the wheat sample at the AX-110942203 locus is CT heterozygous.

[0082] It should be noted that if the fluorescence signal is weak after PCR amplification, affecting data analysis, additional cycles can be added (94℃ denaturation for 20s, 55℃ annealing and extension for 1min, 5 cycles) until the results are satisfactory.

[0083] V. The genotypes of the F5RIL populations of Zhongmai 578, Jimai 22, and 262 Zhongmai 578 / Jimai 22 based on the AX-110942203 locus were detected using the method in step four.

[0084] Following the method in step four, the wheat samples to be tested were replaced with Zhongmai 578, Jimai 22, and 262 F5RIL populations of Zhongmai 578 / Jimai 22, respectively. All other steps remained unchanged, resulting in the genotypes of the F5RIL populations of Zhongmai 578, Jimai 22, and 262 Zhongmai 578 / Jimai 22 based on the AX-110942203 locus. Some test results are shown below. Figure 2 (NTC stands for blank control, i.e., no template).

[0085] The genotyping results were compared with those of the Zhongmai 578, Jimai 22, and 262 F5RIL populations of Zhongmai 578 / Jimai 22 in the wheat 50K chip. The results showed that the genotypes of wheat based on the AX-110942203 locus detected using the method provided in step four were completely consistent with the genotyping results in the wheat 50K chip. Therefore, the method provided in step four has high accuracy in detecting the genotypes of wheat based on the AX-110942203 locus.

[0086] Example 2: Correlation analysis and verification of the primer set synthesized in Example 1 for identifying wheat grain-filling rate and wheat grain-filling rate.

[0087] The wheat tested consisted of 109 varieties from the Huang-Huai wheat region, and their names are shown in column 1 of Table 2. All 109 wheat varieties from the Huang-Huai wheat region shown in column 1 of Table 2 are common varieties.

[0088] Table 2

[0089]

[0090]

[0091]

[0092]

[0093] Note: CC is the CC homozygous type, and TT is the TT homozygous type.

[0094] 1. Genotyping of 109 wheat varieties from the Huang-Huai wheat region based on the AX-110942203 locus.

[0095] Following the method in step four of Example 1, the wheat samples to be tested were replaced with 109 wheat varieties from the Huang-Huai wheat region, with all other steps remaining unchanged. This yielded the genotypes of the 109 wheat varieties from the Huang-Huai wheat region based on the AX-110942203 locus. Some test results are shown below. Figure 3 (NTC stands for blank control, i.e., no template).

[0096] The test results are shown in column 2 of Table 2.

[0097] 2. Grouting rate detection

[0098] In the 2012-2013 and 2013-2014 seasons, 109 wheat varieties from the Huang-Huai wheat region were planted in Anyang, Henan Province, and Suixi, Anhui Province, respectively. In the 2014-2015 season, the same 109 varieties were planted in Shijiazhuang, Hebei Province. All environments used a completely randomized block design with three replicates, single-row plots, row length 1.5m, row width 0.2m, and 50 grains / row. Other field management practices followed local wheat field management standards. Flowering date, maturity date, and grain weight were recorded. Grain filling duration and rate were further statistically analyzed. The average of the three replicates was taken as the grain filling rate for each wheat variety.

[0099] The statistical results of grain filling rates for various wheat varieties in five environments are shown in columns 3-7 of Table 2.

[0100] The average grain-filling rate of each wheat variety in five environments was calculated, which is the grain-filling rate of each wheat variety. The statistical results of the grain-filling rate of each wheat variety are shown in column 8 of Table 2.

[0101] 3. Correlation Analysis

[0102] The grain-filling rates of wheat varieties with two different genotypes were statistically analyzed, and t-tests were performed using the PROC TTEST model in the internationally recognized SAS 9.2 statistical software. The statistical results are shown in Table 3.

[0103] The results showed that in a population of 109 wheat varieties from the Huang-Huai wheat region, the grain-filling rate of the CC homozygous wheat variety was greater than that of the TT homozygous wheat variety; the ">" signifies statistical significance (i.e., significantly higher at the 0.05 level). Therefore, the CC homozygous type is a superior genotype for improving wheat grain-filling rate.

[0104] Table 3

[0105]

[0106] Note: * indicates P<0.05; ** indicates P<0.01; *** indicates P<0.001; CC indicates CC homozygous type, TT indicates TT homozygous type.

[0107] The above results indicate that the grain-filling rate trait of wheat can be screened by detecting the genotype of the wheat based on the AX-110942203 locus, which has important application value in the process of molecular marker-assisted breeding of wheat.

[0108] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Primer set, consisting of upstream primer F1, upstream primer F2, and downstream primer R; The upstream primer F1 consists of a fluorescent tag sequence and the DNA fragment shown in SEQ ID NO:2 from position 22 to 45 from the 5' end; The upstream primer F2 consists of a fluorescent tag sequence and the DNA fragment shown in SEQ ID NO:3 from position 22 to 45 from the 5' end; The fluorescent tag sequence in upstream primer F1 and the fluorescent tag sequence in upstream primer F2 are two different fluorescent tag sequences, emitting different fluorescent signals; The nucleotide sequence of the downstream primer R is shown in SEQ ID NO:

4.

2. The primer set according to claim 1, characterized in that: The nucleotide sequence of the fluorescent tag sequence in the upstream primer F1 is shown as positions 1 to 21 from the 5' end of SEQ ID NO:2; The nucleotide sequence of the fluorescent tag sequence in the upstream primer F2 is shown as positions 1 to 21 from the 5' end of SEQ ID NO:

3.

3. The application of the primer set according to claim 1 or 2 is any one of the following b1)-b3): b1) To determine the grain-filling rate of the wheat being tested; b2) Screening for wheat varieties with high grain-filling rates; b3) Breeding for wheat grain-filling rate; The application involves PCR amplification using the primer set described in claim 1 or 2 to obtain the wheat sample to be tested. AX-110942203 This is achieved through the genotype at the locus; AX-110942203 The site is the nucleotide at position 36 from the 5' end of SEQ ID NO:1 in the wheat genome; based on AX-110942203 The grain-filling rate of wheat with the CC homozygous genotype at the locus is > based on AX-110942203 Grain filling rate of wheat with TT homozygous genotype at the locus.

4. A method for screening wheat with different grain-filling rates, comprising the following steps: detecting the wheat to be tested based on... AX- 110942203 Whether the genotype at the locus is CC homozygous or TT homozygous, based on the grain-filling rate of wheat with a CC homozygous genotype at the AX-110942203 locus > based on AX-110942203 Grain filling rate of wheat with the TT homozygous genotype at the locus; AX-110942203 The site is the nucleotide at position 36 from the 5' end of SEQ ID NO:1 in the wheat genome.

5. The method according to claim 4, characterized in that: The detection of wheat is based on AX-110942203 The steps to determine whether the genotype at a locus is homozygous (CC) or homozygous (TT) are as follows: (a1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer set described in claim 1 or 2 to obtain the PCR amplification product; (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected using an instrument. The color of the fluorescence signal is used to obtain the wheat sample based on the fluorescence signal. AX-110942203 Genotype at the locus.

6. The method according to claim 4, characterized in that: The detection of wheat is based on AX-110942203 The steps to determine whether the genotype at a locus is homozygous (CC) or homozygous (TT) are as follows: (b1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer set described in claim 1 or 2 to obtain the PCR amplification product; (b2) Take the PCR amplification product obtained in step (b1) and sequence it; (b3) Based on the sequencing results obtained in step (b2), obtain the wheat sample to be tested. AX-110942203 Genotype at the locus.

7. A reagent kit comprising methods for detecting wheat-based... AX-110942203 The substance of the genotype at the locus; AX-110942203 The site is the nucleotide at position 36 from the 5' end of SEQ ID NO:1 in the wheat genome; The detection of wheat is based on AX-110942203 The genotype material at the locus is the primer set described in claim 1 or 2.

8. The application of the kit according to claim 7 is any one of the following b1)-b3): b1) To determine the grain-filling rate of the wheat being tested; b2) Screening for wheat varieties with high grain-filling rates; b3) Breeding for wheat grain-filling rate; The application involves PCR amplification using the primer set described in claim 1 or 2 of the kit to obtain the wheat sample to be tested. AX-110942203 This is achieved through the genotype at the locus; AX-110942203 The site is the nucleotide at position 36 from the 5' end of SEQ ID NO:1 in the wheat genome; based on AX-110942203 The grain-filling rate of wheat with the CC homozygous genotype at the locus is > based on AX-110942203 Grain filling rate of wheat with TT homozygous genotype at the locus.

Images