A CD4 helper t cell epitope fusion peptide and vaccine thereof

Abstract

The present application provides a CD4 helper T cell epitope fusion peptide, its encoding nucleic acid and an immune composition comprising the same. The epitope fusion peptide comprises a cytomegalovirus epitope. The epitope fusion peptide provided by the present application can greatly improve the cellular immune response level of the target immunogen, especially a weak immunogen, and is an effective means to overcome the immune system's immune tolerance to antigens, especially tumor antigens or infection-related antigens, and is suitable for efficiently enhancing the efficacy of vaccines.

Description

[0001] This application is a divisional application of the patent application with the title of "A CD4 helper T cell epitope fusion peptide and vaccine thereof", application number 201811138035.6, filed on September 28, 2018. TECHNICAL FIELD

[0002] The present application belongs to the field of molecular biology and immunology. In particular, the present application relates to a CD4 helper T cell epitope fusion peptide, and especially to a vaccine comprising the epitope fusion peptide and the use thereof. BACKGROUND

[0003] T helper cells (Th cells) are a type of T cell that play an important role in the immune system, particularly in the adaptive immune system. They help the activity of other immune cells by releasing T cell cytokines. These cells help to suppress or regulate the immune response. They are essential in the maximization of B cell antibody class switching, activation and growth of cytotoxic T cells, and the bactericidal activity of phagocytes such as macrophages.

[0004] Mature Th cells express the protein CD4, known as CD4 + T cells. Such CD4 + T cells are typically handled as helper T cells within the immune system. For example, when an antigen-presenting cell expresses an antigen on class II MHC, the CD4 + T cells will help these cells through a combination of cell-to-cell interactions (such as CD40 (a protein) and CD40L) and cytokines.

[0005] The importance of helper T cells can be seen from HIV, a virus that primarily infects CD4 + T cells. In the late stages of HIV infection, the loss of functional CD4 + T cells leads to a stage of the infection known as acquired immune deficiency syndrome (AIDS). When HIV virus is found early in the blood or other body fluids, continuous treatment can delay the time when this happens. If AIDS occurs, treatment can also better manage the course of AIDS. There are other rare diseases, such as lymphocytopenia, which result in the loss or dysfunction of CD4 + T cells. These diseases produce similar symptoms, many of which are fatal.

[0006] An antigenic epitope, simply "epitope", also known as "antigenic determinant", is a chemical group on the surface of an antigen that determines its specificity. An epitope can be recognized by the immune system, especially by antibodies, B cells or T cells. The region of an antibody that recognizes an epitope is called "paratope" or "antibody determinant". Although an epitope usually refers to a part of a foreign protein or the like, an epitope that can be recognized by the immune system of the body is also included in the epitope.

[0007] Epitopes of protein antigens are classified into two types, conformational epitopes and linear epitopes, according to their structure and interaction with paratopes. Conformational epitopes are composed of non-contiguous parts of the antigenic amino acid sequence, and thus the interaction between paratopes and antigenic epitopes is based on the three-dimensional features and shapes of the surface, or the tertiary structure of the antigen. Most antigenic epitopes belong to conformational epitopes. In contrast, linear epitopes are composed of a continuous antigenic amino acid sequence, and the interaction with the antigen is based on the primary structure thereof.

[0008] A T cell epitope is mainly composed of a short peptide of 8 to 17 amino acids, which is present on an antigen-presenting cell (APC), and this antigenic epitope forms a complex with a major histocompatibility complex (MHC) and binds to a corresponding T cell epitope receptor, thereby activating T cells and producing a corresponding cellular immune response (Shimonkevitz et al., 1984; Babbitt et al., 1985; Buus et al., 1986; Townsend and Bodmer, 1989). The MHCs that bind to epitopes are mainly two types of molecules, and the T cell antigen epitopes presented by class I major histocompatibility complex are usually composed of polypeptides of 8 to 11 amino acids in length, and the T cell antigen epitopes presented by class II major histocompatibility complex are relatively longer, composed of 13 to 17 amino acids.

[0009] A helper T cell epitope (Th epitope) refers to a class of T cell epitopes in which the complex formed by the binding of the MHC molecule can be recognized by the CD4 helper T cell receptor. Th epitopes are mainly combined with molecules present on the surface of antigen-presenting cells (APC) encoded by the class II genes of the major histocompatibility complex (MHC). Then, the complex of class II molecules and peptide epitopes is recognized by specific T cell receptors (TCR) on the surface of T helper lymphocytes. In this way, T cells presenting antigen epitopes in the environment of MHC molecules can be activated and provide the necessary signal for B lymphocyte differentiation. Traditionally, the source of helper T cell epitopes of peptide immunogens is a carrier protein covalently coupled with the peptide, but this coupling process can introduce other problems, such as modification of antigenic determinants in the coupling process and induction of antibodies against the carrier at the expense of antibodies against the peptide (Schutze, M. P., Leclerc, C. Jolivet, M. Audibert, F. Chedid, L. Carrier-induced epitopic suppression, a major issue for future synthetic vaccines. J Immunol. 1985, 135, 2319-2322; DiJohn, D., Torrese, J. R. Murillo, J. Herrington, D. A. et al. Effect of priming with carrier on response to conjugate vaccine. The Lancet. 1989, 2, 1415-1416). In addition, the use of unrelated proteins in preparation introduces quality control problems. The selection of a suitable carrier protein is very important in the design of a peptide vaccine, and its selection is limited by factors such as its toxicity and feasibility for large-scale production. This method also has other limitations, including the size of the loadable peptide and the dose of the carrier that can be safely administered (Audibert, F. a. C., L. 1984. Modern approaches to vaccines. Molecular and chemical basis of virus virulence and immunogenicity., Cold Spring Harbor Laboratory, New York.).While carrier molecules allow induction of strong immune responses, they are also associated with adverse effects, such as suppression of anti-peptide antibody responses (Herzenberg, L. A. and Tokuhisa, T. 1980. Carrier-priming leads to hapten-specific suppression. Nature 285:664; Schutze, M. P., Leclerc, C, Jolivet, M., Audibert, F., and Chedid, L. 1985. Carrier-induced epitopic suppression, a major issue for future synthetic vaccines. J Immunol 135:2319; Etlinger, H. M., Felix, A. M., Gillessen, D., Heimer, E. P., Just, M., Pink, J. R., Sinigaglia, F., Sturchler, D., Takacs, B., Trzeciak, A., and et al., 1988. Assessment in humans of a synthetic peptide-based vaccine against the sporozoite stage of the human malaria parasite, Plasmodium falciparum. J Immunol 140:626).

[0010] Generally, an immunogen must contain helper T cell epitopes in addition to the epitope to be recognized by surface Ig or the receptor present on cytotoxic T cells. It should be appreciated that these types of epitopes can be quite different. For B cell epitopes, conformation is important because the B cell receptor binds directly to the native immunogen. In contrast, epitopes recognized by T cells do not depend on the conformational integrity of the epitope and consist of short sequences of about 9 amino acids for CTLs and somewhat longer sequences for helper T cells (with less restriction on length). The only requirement for these epitopes is that they can fit into the binding cleft of class I or class II molecules, respectively, and then the complex is able to bind to the T cell receptor. The binding site of class II molecules is open at both ends, allowing for a greater variation in the length of the peptide that can bind to the reported epitope of as short as 8 amino acid residues (Fahrer, A. M., Geysen, H. M., White, D. O., Jackson, D. C. and Brown, L. E. Analysis of the requirements for class II-restricted T-cell recognition of a single determinant reveals considerable diversity in the T-cell response and degeneracy of peptide binding to HLA-DJ. Immunol. 1995. 155: 2849-2857) (Brown, J. H., T. S. Jardetzky, J. C. Gorga, L. J. Stern, R. G. Urban, J. L. Strominger and D. C. Wiley. 1993. Three-dimensional structure of the human class II histocompatibility antigen HLA-DRl. Nature 364: 33).

[0011] Th epitopes stimulate and activate helper T cells, which in turn, promote CD8 T cell and B cell activation, ultimately increasing the immune response. In essence, Th epitopes can effectively help the immune response to other antigens or epitopes associated with it, in addition to activating the immune response to itself. Thus, a strong Th epitope from a heterologous source can be fused to a desired immunogen, whereby the immunogenicity of the desired immunogen can be increased. A synthetic strong Th epitope known as "PADRE (pan HLA DR-binding Epitope)" has been used in the fusion construct of several vaccines to increase the level of immune response to the relevant immunogen (del Guercio et al., Vaccine, 1997, 15:441.; Franke, E. D. et al., Vaccine, 1999, 17:1201; Jeff Alexander et al., J Immunol, 2000, 164(3) 1625-1633; Jeff Alexander et al., Vaccine, 2004, 22:2362.; La Rosa, Corinna et al., The Journal of infectious diseases, 2012, 205:1294-304). In addition, a strong Th epitope from Tetanus toxin (P2) is also commonly used to couple to a desired immunogen to increase immunogenicity (Panina-Bordignon P et al., Eur J Immunol, 1989, 19:2237-42; La Rosa, Corinna et al., The Journal of infectious diseases, 2012, 205:1294-304).

[0012] However, in general, Th epitopes used to improve immunogenicity are usually heterologous, in other words, there is no high level of immune response against the Th epitope itself in the vaccine subject. Therefore, when a vaccine subject is vaccinated with a strong Th epitope as described above, it is likely that the immune system of the vaccine subject is first exposed to such Th epitope, the activation of the immune system of the recipient against the epitope of such Th epitope and the immunogen of interest is essentially simultaneous, the generation time and number of T cells against such Th epitope is similar to the immunogen of interest, so that the effect of helping the immunogen of interest is thus limited. In particular, for weak immunogenic tumor antigens, the helper effect of such Th epitopes is more difficult to play. In fact, although the use of a strong Th epitope directly activates the tumor antigen, the level of cellular immune response elicited is still low and cannot meet the needs of tumor vaccines (Ghaffari-Nazari H et al., PLoS ONE, 2015, 10(11): e0142563).

[0013] Therefore, there is a need for new Th epitope strategies to improve the immunogenicity of the immunogen of interest, in particular some weak immunogens, such as tumor antigens. SUMMARY

[0014] The purpose of the present application is to provide a CD4 helper T cell epitope fusion peptide, through which the immunogenicity of the immunogen of interest is improved.

[0015] Further, the present application uses strong Th epitopes derived from cytomegalovirus (CMV) and influenza virus (Flu) to obtain epitope fusion peptides to improve the immunogenicity of the immunogen of interest.

[0016] For the purposes of the present application, the following terms are defined as follows.

[0017] "Epitope fusion peptide" refers to a peptide formed by linking several epitopes together.

[0018] "Immunogen of interest" refers to an immunogen used to achieve a certain immune response, including antigens and other immunologically active substances, preferably proteins.

[0019] Another purpose of the present application is to provide a fusion protein of the epitope fusion peptide and the immunogen of interest.

[0020] To achieve the above purpose, the present application provides a CD4 helper T cell epitope fusion peptide comprising a cytomegalovirus epitope and / or an influenza virus epitope.

[0021] In one embodiment of the application, the epitope fusion peptide comprises one or more of the cytomegalovirus epitopes selected from the group consisting of SEQ ID NOs: 1-10, and / or one or more of the influenza virus epitopes selected from the group consisting of SEQ ID NOs: 11-23.

[0022] In one embodiment of the application, the epitope fusion peptide consists of one or more of the cytomegalovirus epitopes selected from the group consisting of SEQ ID NOs: 1-10, and / or one or more of the influenza virus epitopes selected from the group consisting of SEQ ID NOs: 11-23. Preferably, the epitope fusion peptide consists of 5 or 10 cytomegalovirus epitopes and / or consists of 8 or 13 influenza virus epitopes, such as the epitope fusion peptide of SEQ ID NO: 34 or 44. Most preferably, the epitope fusion peptide consists of 13 influenza virus epitopes, such as the epitope fusion peptide of SEQ ID NO: 48.

[0023] Preferably, the epitope fusion peptide induces a humoral or cellular immune response.

[0024] The application also provides a fusion protein of the epitope fusion peptide and an immunogen of interest.

[0025] The application also provides a polynucleotide encoding the epitope fusion peptide and / or the fusion protein.

[0026] In one embodiment of the application, the immunogen of interest is any one or more immunogens. Preferably, the immunogen of interest is a peptide, an antigen, a hapten, a carbohydrate, a protein, a nucleic acid, an allergen, a virus or a part of a virus, a bacterium, a parasite or another whole microorganism.

[0027] In one embodiment of the application, the antigen is a tumor antigen or an infection-related antigen.

[0028] In one embodiment of the application, the tumor antigen is selected from one or more of a lung cancer antigen, a testicular cancer antigen, a melanoma antigen, a liver cancer antigen, a breast cancer antigen or a prostate cancer antigen.

[0029] In one embodiment of the present application, the tumor antigen is selected from one or more of LAGE antigen, MAGE antigen or NY-ESO-1 antigen. Preferably, the LAGE antigen is LAGE-1 and the MAGE antigen is MAGE-A3. Further preferably, the tumor antigen comprises LAGE-1, MAGE-A3 and NY-ESO-1. Preferably, the amino acid sequence of the LAGE-1 is set forth in SEQ ID NO: 24, the amino acid sequence of the MAGE-A3 is set forth in SEQ ID NO: 25, and the amino acid sequence of the NY-ESO-1 is set forth in SEQ ID NO: 26.

[0030] In one embodiment of the present application, the infection-related antigen is selected from one or more of HIV antigen, influenza virus antigen or HBV antigen.

[0031] Preferably, the fusion protein is set forth in one of SEQ ID NOs: 55-58.

[0032] Another object of the present application is to provide an immunological composition comprising a therapeutically effective amount of the epitope fusion peptide, fusion protein and / or polynucleotide according to the present application, and a pharmaceutically acceptable carrier. Preferably, the immunological composition is a vaccine.

[0033] Another object of the present application is to provide a kit comprising the epitope fusion peptide, fusion protein, polynucleotide and / or immunological composition according to the present application, and instructions for use thereof.

[0034] The present application also provides use of the epitope fusion peptide, fusion protein, polynucleotide and / or immunological composition according to the present application in the manufacture of a medicament or vaccine for enhancing the immunogenicity of a target immunogen.

[0035] The present application also provides a method for enhancing the immunogenicity of a target immunogen using the epitope fusion peptide according to the present application, comprising a fusion protein formed by fusing a CD4 helper T cell epitope in a vaccine subject or a human population with a stronger immune response to a target immunogen. The method is specifically as follows:

[0036] (1) selecting one or more CD4 helper T cell epitopes, which can be recognized by CD4 helper T cell receptors in the form of a complex with MHC molecules, and before vaccination, a T cell immune response has been generated in the vaccine subject against at least one of the epitopes;

[0037] (2) the epitope fusion peptide is fused with the immunogen to form a fusion protein, and the fusion protein is expressed to form a vaccine, which can be in the form of a DNA vaccine vector, a protein vaccine vector or a viral vaccine vector;

[0038] (3) the vaccine is inoculated into a vaccine subject, and an appropriate adjuvant such as incomplete Freund's adjuvant, complete Freund's adjuvant, aluminum hydroxide adjuvant, etc. can be selected.

[0039] Further, step (1) of the use method further comprises a step of checking the MHC phenotype of the vaccine subject. Preferably, checking the MHC phenotype of the vaccine subject comprises checking the MHC class II gene subtype type of the vaccine subject.

[0040] The present application also provides a method for treating or preventing a disease in a subject in need thereof, which comprises administering a therapeutically effective amount of the epitope fusion peptide, the fusion protein, the immunological composition and / or the polynucleotide of the present application. Preferably, the disease is selected from one or more of malignant tumors, bacterial and viral chronic infections. Preferably, the malignant tumor is breast cancer or colon cancer. Preferably, in the method, the priming is performed using a DNA vaccine vector, and the boosting is performed using a protein vaccine vector, more preferably, the priming is performed using a pVKD1.0-CI-LMNB DNA vaccine, and the boosting is performed using a LMNB-I13 protein.

[0041] The epitope fusion peptide provided by the present application can greatly improve the cellular immune response level of the target immunogen, especially the weak immunogen, and is an effective means to overcome the immune tolerance of the immune system to antigens, especially the immune tolerance to tumor antigens or infection-related antigens, and is suitable for efficiently enhancing the efficacy of a vaccine. BRIEF DESCRIPTION OF DRAWINGS

[0042] Hereinafter, embodiments of the present application will be described in detail with reference to the accompanying drawings, in which:

[0043] Figure 1 and Figure 2 are, respectively, the plasmid map and double enzyme digestion identification map of the DNA vaccine vector pVKD1.0-hLMN with LAGE-1, MAGE-A3 and NY-ESO-1 antigen coding sequences.

[0044] Figure 3 and Figure 4 are, respectively, the plasmid map and double enzyme digestion identification map of the DNA vaccine vector pVKD1.0-hLMN-CTB with LAGE-1, MAGE-A3 and NY-ESO-1 antigens and cholera toxin B subunit coding sequences.

[0045] Figure 5 andFigure 6 Plasmid map and restriction enzyme identification map of DNA vaccine vector pVKDl.0-CI with CMV and influenza virus CD4 epitope encoding sequences, respectively.

[0046] Figure 7 and Figure 8 Plasmid map and restriction enzyme identification map of DNA vaccine vector pVKDl.0-CI-LMNB with LAGE-1, MAGE-A3 and NY-ESO-1 antigens and cholera toxin B subunit, and CMV and influenza virus CD4 epitope encoding sequences, respectively.

[0047] Figure 9 and Figure 10 Plasmid map and restriction enzyme identification map of prokaryotic vector pET-30a(+)-LMN with LAGE-1, MAGE-A3 and NY-ESO-1 antigen encoding sequences, respectively.

[0048] Figure 11 and Figure 12 Plasmid map and restriction enzyme identification map of prokaryotic vector pET-30a(+)-LMN-CTB with LAGE-1, MAGE-A3 and NY-ESO-1 antigen and cholera toxin B subunit encoding sequences, respectively.

[0049] Figure 13 and Figure 14 Plasmid map and restriction enzyme identification map of prokaryotic vector pET-30a(+)-CMV Th with CMV epitope encoding sequences, respectively.

[0050] Figure 15 and Figure 16 Plasmid map and restriction enzyme identification map of prokaryotic vector pET-30a(+)-CMV10-LMNB with CMV epitope and LAGE-1, MAGE-A3 and NY-ESO-1 antigen and cholera toxin B subunit encoding sequences, respectively.

[0051] Figure 17 and Figure 18 Plasmid map and restriction enzyme identification map of prokaryotic vector pET-30a(+)-Influ Th with influenza virus epitope encoding sequences, respectively.

[0052] Figure 19 and Figure 20 Plasmid map and restriction enzyme identification map of prokaryotic vector pET-30a(+)-Influ8-LMNB with influenza virus epitope and LAGE-1, MAGE-A3 and NY-ESO-1 antigen and cholera toxin B subunit encoding sequences, respectively.

[0053] Figure 21 and Figure 22 are the plasmid map and double enzyme digestion identification map of prokaryotic vector pET-30a(+)-CMV5-LMNB with CMV epitope and LAGE-1, MAGE-A3 and NY-ESO-1 antigen and cholera toxin B subunit coding sequence, respectively.

[0054] Figure 23 are the results of cell immune response detection in animal immunization experiment.

[0055] Figure 24 and Figure 25 are the plasmid map and double enzyme digestion identification map of prokaryotic vector pET-30a(+)-CMV5-LMNB with CMV epitope and LAGE-1, MAGE-A3 and NY-ESO-1 antigen and cholera toxin B subunit coding sequence, respectively.

[0056] Figure 26 are the results of cell immune response detection in animal immunization experiment.

[0057] Figure 27 are the results of cell immune response detection in animal immunization experiment.

[0058] Figure 28 and Figure 29 are the results of cell immune response detection in animal immunization experiment.

[0059] Figure 30 are the results of cell immune response detection in animal immunization experiment.

[0060] Figure 31 are the results of cell immune response detection in animal immunization experiment. DETAILED DESCRIPTION

[0061] The present application will be further described in conjunction with specific embodiments, and the examples given are only for illustrating the present application, but not for limiting the scope of the present application.

[0062] Example 1 Construction of DNA vaccine pVKD1.0-hLMN

[0063] The amino acid sequences of LAGE-1, MAGE-A3 and NY-ESO-1 are shown in SEQ ID NOs: 24-26, respectively. The amino acid sequences of the above antigens were optimized into nucleotide sequences with the preference of mammalian codon usage by online codon optimization software (http: / / www.jcat.de / ), which are shown in SEQ ID NOs: 27-29, respectively. After synthesized by Shanghai Jingye Biotechnology Co., Ltd., the nucleotide sequences were cloned into the multiple cloning site between Sal I and BamH I of DNA vaccine vector pVKD1.0 (provided by Suzhou Weikeda Biotechnology Co., Ltd.) by methods well known in the art, to construct DNA vaccine vector pVKD1.0-hLMN (plasmid map is shown in Figure 1 ), which was banked after correct identification by sequencing. The vector pVKD1.0-hLMN was identified by restriction endonuclease Sal I and BamH I (enzyme digestion system is shown in Table 1), and the enzyme digestion verification map is shown in Figure 2 .

[0064] Table 1: Enzyme digestion identification system of plasmid pVKD1.0-hLMN (37°C enzyme digestion for 2 hours)

[0065] Enzyme digestion system Volume Plasmid pVKD1.0-hLMN 3 μL, about 1 μg Sal I (Bao Biological, item number 1080A) 1 μL BamH I (Bao Biological, item number 1010A) 1 μL Enzyme digestion buffer 1 μL ddH2O Supplemented to 10 μL

[0066] Example 2 Construction of DNA vaccine pVKD1.0-hLMN-CTB

[0067] The mammalian codon-optimized sequence of the amino acid sequence of cholera toxin subunit B (CTB) (SEQ ID NO: 30) (SEQ ID NO: 31) and its eukaryotic expression vector pVKD1.0-CTB were provided by Suzhou Weikeda Biotechnology Co., Ltd. The primer (see Table 2) was designed based on pVKD1.0-CTB as a template, and the CTB gene fragment was amplified by PCR, and then the corresponding fragment was gel recovered, and the CTB fragment was inserted into the linearized vector pVKD1.0-hLMN at the corresponding position by homologous recombination, to construct DNA vaccine vector pVKD1.0-hLMN-CTB (plasmid map is shown in Figure 3 ), which was banked after correct identification by sequencing. The vector pVKD1.0-hLMN-CTB was identified by restriction endonuclease Sal I and BamH I (enzyme digestion system is shown in Table 3), and the enzyme digestion verification map is shown in Figure 4 .

[0068] Table 2: Primers in Example 2

[0069]

[0070] Table 3: Restriction enzyme identification system of plasmid pVKD1.0-hLMN-CTB (37℃ enzyme digestion for 2 hours)

[0071] Enzyme digestion system Volume Plasmid pVKD1.0-hLMN-CTB 3 μL, about 1 μg Sal I (Bao Biological, item number 1080A) 1 μL BamH I (Bao Biological, item number 1010A) 1 μL Enzyme digestion buffer 1 μL ddH2O Supplemented to 10 μL

[0072] Example 3 Construction of DNA vaccine pVKD1.0-CI-LMNB

[0073] Strong Th epitopes derived from Cytomegalovirus (CMV) and Influvirus (Flu) were obtained from the Immunogenic Epitope Database (IEDB, http: / / www.iedb.org), wherein the strong Th epitopes of CMV include pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104; the strong Th epitopes of Flu include HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, NP221, HA434, HA440, NP324, M1-127 and M1-210. The epitopes selected in Table 4 cover most of the subtypes of MHC class II molecules in human population, and also cover mouse MHC II subtype molecules. Then the selected epitopes pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, NP221 were concatenated together to form a fusion peptide of CMV virus and Flu virus epitopes, the amino acid sequence of which is shown as SEQ ID NO: 34, and the nucleic acid sequence of which is shown as SEQ ID NO: 35 after the fusion peptide is optimized for mammalian codons. The nucleic acid sequence was synthesized by Suzhou Hongxun Biotechnology Co., Ltd., and then inserted into the DNA vaccine vector pVKD1.0 (Suzhou Weikeda Biotechnology Co., Ltd.) by the molecular biology methods well known in the art to form the vector pVKD1.0-CI (plasmid map as shown in Figure 5 ), which was sequenced and identified to be correct before being banked. The vector pVKD1.0-CI was identified by restriction endonucleases Pst I and Bgl II (enzyme digestion system as shown in Table 5), and the enzyme digestion verification spectrum is shown in Figure 6 .

[0074] Table 4: Th epitopes in Example 3

[0075] Epitope name Source Amino acid sequence pp65-11 CMV LLQTGIHVRVSQPSL (SEQ ID NO: 1) pp65-71 CMV IIKPGKISHIMLDVA (SEQ ID NO: 2) pp65-92 CMV EHPTFTSQYRIQGKL (SEQ ID NO: 3) pp65-123 CMV AGILARNLVPMVATV (SEQ ID NO: 4) pp65-128 CMV KYQEFFWDANDIYRI (SEQ ID NO: 5) pp65-57 CMV KVYLESFCEDVPSGK (SEQ ID NO: 6) pp65-62 CMV TLGSDVEEDLTMTRN (SEQ ID NO: 7) pp65-30 CMV PLKMLNIPSINVHHY (SEQ ID NO: 8) pp65-112 CMV ACTSGVMTRGRLKAE (SEQ ID NO: 9) pp65-104 CMV TERKTPRVTGGGAMA (SEQ ID NO: 10) HA203 Influ NQRALYHTENAYVSVVS (SEQ ID NO: 11) NP438 Influ SDMRAEIIKMMESARPE (SEQ ID NO: 12) NS1-84 Influ ALASRYLTDMTIEEMSR (SEQ ID NO: 13) M1-181 Influ LASTTAKAMEQMAGSSE (SEQ ID NO: 14) HA375 Influ SGYAADQKSTQNAINGITNKVN (SEQ ID NO: 15) NP24 Influ EIRASVGKMIDGIGRFYI (SEQ ID NO: 16) NP95 Influ PIYRRVDGKWMRELVLY (SEQ ID NO: 17) NP221 Influ RMCNILKGKFQTAAQRAM (SEQ ID NO: 18) HA434 Influ IWTYNAELLVLLENERT (SEQ ID NO: 19) HA440 Influ ELLVLLENERTLDFHDS (SEQ ID NO: 20) NP324 Influ HKSQLVWMACNSAAFED (SEQ ID NO: 21) M1-127 Influ CMGLIYNRMGAVTTESA (SEQ ID NO: 22) M1-210 Influ RQMVQAMRAIGTHPSSSTGLKND (SEQ ID NO: 23)

[0076] Table 5: Restriction enzyme identification system of plasmid pVKD1.0-CI (37°C for 2 hours)

[0077] Enzyme digestion system Volume Plasmid pVKD1.0-CI 3 μL, about 1 μg Pst I (Bao Bioengineering, item number 1073A) 1 μL Bgl II (Bao Bioengineering, item number 1021A) 1 μL Enzyme digestion buffer 1 μL ddH2O Supplemented to 10 μL

[0078] Finally, the vector pVKD1.0-hLMN-CTB in Example 2 was used as a template to design primers (see Table 6), and the hLMN-CTB gene fragment was amplified by PCR, and then inserted into the pVKD1.0-CI vector between the Not I and Bam HI restriction enzyme sites by the molecular biology methods well known in the art to construct the DNA vaccine vector pVKD1.0-CI-LMNB (plasmid map as shown in Figure 7 ), which was sequenced and identified correctly and then banked. The vector pVKD1.0-CI-LMNB was identified by restriction endonuclease Bam HI and EcoR V (enzyme digestion system as shown in Table 7), and the enzyme digestion verification map is shown in Figure 8

[0079] Table 6: Primers in Example 3

[0080]

[0081] Table 7: Restriction enzyme identification system of plasmid pVKD1.0-CI-LMNB (37°C for 2 hours)

[0082] Enzyme digestion system Volume Plasmid pVKD1.0-CI-LMNB 3 μL, about 1 μg Bam HI (Bao Bioengineering, item number 1010A) 1 μL EcoR V (Bao Bioengineering, item number 1042A) 1 μL Enzyme digestion buffer 1 μL ddH2O Supplemented to 10 μL

[0083] Example 4 LMN prokaryotic expression vector construction

[0084] The amino acid sequences of LAGE-1, MAGE-A3 and NY-ESO-1 are shown in SEQ ID NOs: 24-26, respectively. The antigen amino acid sequences were optimized into nucleotide sequences preferred by the codon usage of E. coli by online codon optimization software (http: / / www.jcat.de / ), which are shown in SEQ ID NOs: 38-40, respectively. After synthesis by Suzhou Hongxun Biotechnology Co., Ltd., the nucleotide sequences were inserted into the prokaryotic expression vector pET-30a(+) (Novagen, item number 69909) between the Nco I and Xho I multiple cloning sites by the molecular biology methods well known in the art to construct the prokaryotic expression construct pET-30a(+)-LMN (plasmid map as shown in Figure 9 ), which was sequenced and identified correctly and then banked. The vector pET-30a(+)-LMN was identified by restriction endonuclease Nco I and Xho I (enzyme digestion system as shown in Table 8), and the enzyme digestion verification map is shown in Figure 10

[0085] ​​Table 8: Enzyme digestion identification system of plasmid pET-30a(+)-LMN (37℃ enzyme digestion overnight)

[0086] Enzyme digestion system Volume Plasmid pET-30a(+)-LMN 3 μL, about 1 μg Nco I (Bao Bioengineering, item number 1160A) 1 μL Xho I (Bao Bioengineering, item number 1094A) 1 μL Enzyme digestion buffer 1 μL ddH2O Supplemented to 10 μL

[0087] Example 5 LMN-CTB prokaryotic expression vector construction

[0088] The amino acid sequence of cholera toxin B subunit CTB (SEQ ID NO: 30) and its prokaryotic codon-optimized nucleic acid sequence (SEQ ID NO: 41) were provided by Suzhou Industrial Park UICAR Biotechnology Co., Ltd. Primers (see Table 9) were designed, and the nucleic acid fragment containing the CTB coding sequence was amplified by PCR method using pET-30a(+)-CTB (Suzhou Industrial Park UICAR Biotechnology Co., Ltd.) as the template. For details, refer to the Ex Taq enzyme (Bao Biological, product number RR001B) reagent instruction manual. Then, the nucleic acid fragment was inserted into the pET-30a(+)-LMN vector by homologous recombination to construct the pET-30a(+)-LMN-CTB vector (plasmid map as shown in Figure 11 ), which was sequenced and identified correctly before being stored in the library. The vector pET-30a(+)-LMN-CTB was identified by restriction endonuclease Nco I and Xho I (enzyme digestion system as shown in Table 10), and the enzyme digestion verification map is shown in Figure 12 .

[0089] Table 9: Primers in Example 5

[0090]

[0091] Table 10: Enzyme digestion identification system in Example 5 (37℃ enzyme digestion overnight)

[0092] Enzyme digestion system Volume Plasmid pET-30a(+)-LMN-CTB 3 μL, about 1 μg Nco I (Bao Bioengineering, item number 1160A) 1 μL Xho I (Bao Bioengineering, item number 1094A) 1 μL Enzyme digestion buffer 1 μL ddH2O Supplemented to 10 μL

[0093] Example 6 Construction of prokaryotic expression vector containing LMN-CTB and CMV Th epitope fusion protein

[0094] Ten Th epitopes from CMV, pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104, were selected from Table 4 and concatenated together, the amino acid sequence of which is shown as SEQ ID NO: 44. In SEQ ID NO: 44, a sequence "EFELRRQ" is due to the introduction of a restriction enzyme site, which is a common technique for fusion construction. The Th epitope amino acid sequence was optimized into a nucleotide sequence preferred by the codon usage of E. coli by an online codon optimization software (http: / / www.jcat.de / ), and the resulting nucleotide sequence (SEQ ID NO: 45) was synthesized by Shanghai Jingye Biotechnology Co., Ltd. The nucleotide sequence was inserted between the Nco I and Xho I sites of the multiple cloning site of the prokaryotic expression vector pET-30a(+) (Novagen, Cat# 69909) by the molecular biology methods well known in the art, to construct a prokaryotic expression construct pET-30a(+)-CMV Th capable of expressing a fusion protein antigen (the plasmid map is shown as Figure 13 ), which was sequenced and identified to be correct before being banked. The vector pET-30a(+)-CMV Th was identified by restriction endonuclease Mlu I and Xho I (the enzyme digestion system is shown in Table 11), and the enzyme digestion verification map is shown in Figure 14 .

[0095] As shown in Figure 13 , CMV Th1 contains five Th epitopes from CMV, which are concatenated from pp65-11, pp65-71, pp65-92, pp65-123 and pp65-128, and CMV Th2 contains five Th epitopes from CMV, which are composed of pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104, and three restriction enzyme digestion sites, EcoR I, Sac I and Sal I, were introduced between CMV Th1 and CMV Th2.

[0096] Table 11: Enzyme digestion identification system of plasmid pET-30a(+)-CMV Th (37°C enzyme digestion overnight)

[0097]

[0098]

[0099] Primers were designed (see Table 12). Using pET-30a(+)-LMN-CTB from Example 5 as a template, a nucleic acid fragment containing the LMN-CTB coding sequence was amplified by PCR. Specific methods are described in the Ex Taq enzyme (Takara Bio, catalog number RR001B) reagent instructions. Then, using molecular biology methods well-known in the art, this nucleic acid fragment was inserted between Not I and Xho I on the pET-30a(+)-CMV Th vector from Example 6 to construct the pET-30a(+)-CMV10-LMNB vector (plasmid map shown). Figure 15 After successful sequencing and verification, the data were added to the library. The vector pET-30a(+)-CMV10-LMNB was identified using restriction endonucleases BamHI and XhoI (enzyme digestion system shown in Table 13), and its enzyme digestion verification pattern is shown below. Figure 16 As shown. Figure 15 As shown, pET-30a(+)-CMV10-LMNB contains CMV Th1 and CMV Th2 fragments, meaning that this vector contains all 10 CMV Th epitopes listed in Table 4. These epitopes are pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, pp65-57, pp65-62, pp65-30, pp65-112, and pp65-104.

[0100] Table 12: Primer Design in Example 6

[0101] Primer Sequence 6F (SEQ ID NO: 46) GCGCGGCCGCGACGACAAGGCCATGGCT 6R (SEQ ID NO: 47) GCCTCGAGGTTAGCCATAGAGATAGC

[0102] Table 13: Enzyme digestion identification system for pET-30a(+)-CMV10-LMNB (enzyme digestion overnight at 37℃)

[0103] Enzyme digestion system Volume Plasmid pET-30a(+)-CMV10-LMNB 3 μL, about 1 μg BamH I (Bao Bioengineering, item number 1010A) 1 μL Xho I (Bao Bioengineering, item number 1094A) 1 μL Enzyme digestion buffer 1 μL ddH2O Supplemented to 10 μL

[0104] Example 7 Construction of a prokaryotic expression vector containing the LMN-CTB and Influ Th epitope fusion protein

[0105] Thirteen Th epitopes derived from influenza virus, namely HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, NP221, HA434, HA440, NP324, M1-127, and M1-210, were selected from Table 4 and tandemly linked together to form the amino acid sequence shown in SEQ ID NO:48.

[0106] The amino acid sequence containing the influenza virus Th epitopes was optimized into a nucleotide sequence preferred by the codon usage of E. coli by online codon optimization software (http: / / www.jcat.de / ), and synthesized by Shanghai Jierui Biotechnology Co., Ltd. After being inserted into the multiple cloning site between Nco I and Xho I of the prokaryotic expression vector pET-30a(+) (Novagen, item number 69909) by the molecular biology methods well known in the art, a prokaryotic expression construct pET-30a(+)-Influ Th capable of expressing a fusion protein antigen was constructed (the plasmid map is shown in Figure 17 ), and after being identified as correct by sequencing, it was banked. The vector pET-30a(+)-Influ Th was identified by restriction endonuclease Nco I and Xho I (the enzyme digestion system is shown in Table 14), and the enzyme digestion verification map is shown in Figure 18 .

[0107] As shown in Figure 17 , Influ Th1 contains 8 Th epitopes of influenza virus, which are formed by HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95 and NP221 in series, Influ Th2 contains 5 Th epitopes of influenza virus, which are composed of HA434, HA440, NP324, M1-127 and M1-210, and 3 restriction enzyme digestion sites of EcoR I, Sac I and Sal I are introduced between Influ Th1 and Influ Th2.

[0108] Table 14: Enzyme digestion identification system in Example 7 (37°C enzyme digestion overnight)

[0109] Enzyme digestion system Volume Plasmid pET-30a(+)-Influ Th 3 μL, about 1 μg Nco I (Bao Bioengineering, item number 1160A) 1 μL Xho I (Bao Bioengineering, item number 1094A) 1 μL Enzyme digestion buffer 1 μL ddH2O Supplemented to 10 μL

[0110] The primer was designed (see Table 15), and the nucleic acid fragment containing the coding sequence of LMN-CTB was amplified by PCR method with pET-30a(+)-LMN-CTB in Example 5 as the template, and the specific method referred to the Ex Taq enzyme (Bao Biology, item number RR001B) reagent instruction. Then the nucleic acid fragment was inserted into the Not I and Sal I of the pET-30a(+)-Influ Th vector in Example 7 by the molecular biology methods well known in the art, and a pET-30a(+)-Influ8-LMNB vector (containing 8 Th epitopes of influenza virus, the plasmid map is shown in Figure 19 ) was constructed, and after being identified as correct by sequencing, it was banked. The vector pET-30a(+)-Influ8-LMNB was identified by restriction endonuclease BamH I and Xho I (the enzyme digestion system is shown in Table 16), and the enzyme digestion verification map is shown in Figure 20 .

[0111] As shown in Figure 19 Figure 1, the pET-30a(+)-Influ8-LMNB vector contains the Influ Thl fragment, i.e., contains eight influenza virus Th epitopes including HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95 and NP221 in Table 4.

[0112] Table 15: Primers in Example 7

[0113] Primer Sequence 7F1 (SEQ ID NO: 50) GCGCGGCCGCGTTAGCCATAGAGATAGC 7R1 (SEQ ID NO: 51) GCGTCGACAAGACGACAAGGCCATGGCTATGC

[0114] Table 16: Enzyme digestion system for identification of plasmid pET-30a(+)-Influ8-LMNB (37°C enzyme digestion overnight)

[0115]

[0116]

[0117] Primers (see Table 17) were designed to amplify the nucleic acid fragment containing the LMN-CTB coding sequence by PCR method using pET-30a(+)-LMN-CTB in Example 5 as template, according to the reagent instruction of Ex Taq enzyme (Bio Basic, item number RR001B). Then the nucleic acid fragment was inserted into the pET-30a(+)-Influ Th vector in Example 6 between Not I and Xho I by the molecular biology methods well known in the art, to construct the pET-30a(+)-Influ13-LMNB vector (containing 13 influenza virus Th epitopes, plasmid map as shown in Figure 21 ), which was banked after being identified correctly by sequencing. The vector pET-30a(+)-CMV10-LMNB was identified by restriction endonuclease BamH I and Xho I (enzyme digestion system as shown in Table 18), and the enzyme digestion verification map is shown in Figure 22 .

[0118] As shown in Figure 21 Figure 1, the pET-30a(+)-Influ8-LMNB vector contains the Influ Thl fragment, i.e., contains eight influenza virus Th epitopes including HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95 and NP221 in Table 4.

[0119] Table 17: Primer design in Example 7

[0120] Primer Sequence 7F2 (SEQ ID NO: 52) GCCTCGAGGTTAGCCATAGAGATAGCA 7R2 (SEQ ID NO: 53) GCGCGGCCGCGACGACAAGGCCATGGCTATG

[0121] Table 18: Enzymatic cleavage identification system in Example 7 (37°C enzyme cleavage overnight)

[0122] Enzyme digestion system Volume Plasmid pET-30a(+)-Influ13-LMNB 3 μL, about 1 μg BamH I (Bao Biology, item number 1010A) 1 μL Xho I (Bao Biology, item number 1094A) 1 μL Enzyme digestion buffer 1 μL ddH2O Supplemented to 10 μL

[0123] Example 8 Expression and purification of fusion proteins

[0124] The prokaryotic expression vectors pET-30a(+)-LMN constructed in Example 4, the prokaryotic expression vector pET-30a(+)-LMN-CTB constructed in Example 5, the prokaryotic expression vectors pET-30a(+)-CMV5-LMNB and pET-30a(+)-CMV10-LMNB constructed in Example 6, and the prokaryotic expression vectors pET-30a(+)-Influ8-LMNB and pET-30a(+)-Influ13-LMNB constructed in Example 7 were respectively transformed into BL21(DE3) competent cells (Tiangen Biotech (Beijing) Co., Ltd., item number CB105, transformation method see the instruction for the competent cells), and the recombinant proteins LMN (the amino acid sequence of which is shown as SEQ ID NO: 59), LMNB (the amino acid sequence of which is shown as SEQ ID NO: 54), LMNB-C10 (the amino acid sequence of which is shown as SEQ ID NO: 58), LMNB-I8 (the amino acid sequence of which is shown as SEQ ID NO: 55), and LMNB-13 (the amino acid sequence of which is shown as SEQ ID NO: 56) were respectively prepared according to the “pET System Manual” (TB055 8th Edition 02 / 99, Novagen), and the prepared proteins were stored at -80°C after being divided into portions.

[0125] The concentration of the prepared recombinant proteins was 1 mg / mL as detected by the BCA method (Bi Yun Tian Biotechnology Institute, item number P0009), and the detection method was referred to the instruction for the detection kit. The endotoxin content of the prepared recombinant proteins was <1 EU / mg as detected by the gel method (Xiamen Limulus Reagent Factory Co., Ltd., item number G011000), which met the requirements for animal experiments, and the detection method was referred to the instruction for the limulus reagent.

[0126] Example 9 Animal immunization experiment

[0127] The vaccine information prepared in Examples 2, 3 and 8 is shown in Table 19. The DNA vaccine vector pVKD1.0 was provided by Suzhou Unikomics Co., Ltd., the DNA vaccine pVKD1.0-NP (expressing influenza antigen NP (NCBI reference sequence: YP_009118476.1) derived from strain A / Shanghai / 02 / 2013 (H7N9)) was provided by Suzhou Unikomics Co., Ltd., and the protein vaccine VP1 (enterovirus 71 VP1 protein, see Chinese patent application 201310088364.5) was provided by Suzhou Unikomics Co., Ltd.

[0128] Sixteen 6-8 week old female BALB / c mice were purchased from the Animal Experimental Center of Suzhou University and were raised in the SPF animal room of the Animal Experimental Center of Suzhou University. The experimental animal grouping and vaccination plan are shown in Table 20. All DNA vaccines were injected into the tibialis anterior muscle of the lower leg, 100 μg per mouse. All protein vaccines were injected subcutaneously on the back after being fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA), 10 μg per mouse. Two weeks after the last immunization, the mice were sacrificed, and the serum and spleen cells were collected for enzyme-linked immunospot assay (ELISPOT) and enzyme-linked immunoassay (ELISA), respectively.

[0129] The mouse IFN-γ ELISPOT kit was purchased from BD Company (item number: 551083), and the method is described in the BD Company IFN-γ ELISPOT kit instruction manual. The stimulating peptide was NY-ESO-1 41# peptide (WITQCFLPVFLAQPP), which was synthesized by Shanghai Key Pep Biotech Co., Ltd., and the final concentration of the stimulating peptide was 10 μg / mL. Phorbol-12-myristate-13-acetate (PMA) and inomysin were purchased from Sigma Company.

[0130] The ELISA method is well known to those skilled in the art and is briefly described below. 96-well microplates were purchased from Jianghai Glass Instrument Factory. Recombinant LMN and NY-ESO-1 were both provided by Suzhou Industrial Park Weikeda Biotechnology Co., Ltd. Proteins were coated with NaHCO3 buffer (pH 9.6) and incubated overnight at 4°C to a coating concentration of 10 μg / mL. The antibody was blocked with phosphate-buffered saline (PBS) containing 0.1% bovine serum albumin (BSA) at 37°C for 30 minutes, then washed five times with PBST containing 0.5% Tween 20. Mouse serum was then incubated at room temperature for 1 hour at an initial dilution of 1:100. After washing five times with PBST, goat anti-mouse HRP secondary antibody (Santacruz, USA) was incubated at a dilution of 1:5000 at 37°C for 30 minutes. After washing five times with PBST, the antibody was developed with 3,3,5,5-tetraamthyl benzidine (TMB) at 37°C for 15 minutes. The reaction was stopped with 2M dilute sulfuric acid, and the absorbance (A) value was read at 450 nm using a microplate reader (Thermo Scientific, USA). A value greater than 2.1 times that of the negative control was considered positive. The reciprocal of the highest dilution among the positive values ​​was defined as the serum antibody titer. When the titer is less than the initial dilution of 1:100, its titer is defined as 50.

[0131] Table 19: Vaccine Information

[0132]

[0133] Table 20: Grouping and Immunization Program

[0134]

[0135]

[0136] Cellular immune response test results as follows Figure 23 As shown in the figure, the primary immunization with the pVKD1.0-CI-LMNB DNA vaccine, with the LMNB-I13 protein booster (i.e., group D in Example 8), showed the best immune effect, significantly higher than its parallel control (group B) and the LMNB-I8 booster group (group C). Furthermore, the cellular immune response level in the LMNB-I13 protein booster group was nearly three times higher than that in the parallel control group (group B). This indicates that the 13 Th epitopes of the influenza virus (group D) can significantly enhance the cellular immune response level to a weak immunogen.

[0137] Example 10 Construction of a prokaryotic expression vector containing the fusion protein of LMN-CTB and CMV Th epitopes

[0138] The primer (see Table 21) was designed to amplify the nucleic acid fragment containing the LMN-CTB coding sequence by PCR method using pET-30a(+)-LMN-CTB in Example 5 as template, the method was referred to the reagent instruction of Ex Taq enzyme (Bio Basic Inc., item number RR001B). Then the nucleic acid fragment was inserted into the vector pET-30a(+)-CMV Th in Example 6 between Not I and Sal I by the molecular biology method well known in the art to construct the vector pET-30a(+)-CMV5-LMNB (the plasmid map was shown in Figure 24 ), which was banked after being identified correctly by sequencing. The vector pET-30a(+)-CMV5-LMNB was identified by restriction endonuclease BamH I and Xho I (the enzyme digestion system was shown in Table 22), and the enzyme digestion verification map was shown in Figure 25 . As shown in Figure 24 , the pET-30a(+)-CMV5-LMNB contained the CMV Th1 fragment, i.e. the vector contained the first 5 CMV Th epitopes in Table 4. The epitopes were pp65-11, pp65-71, pp65-92, pp65-123 and pp65-128.

[0139] Table 21: primer design in Example 10

[0140] Primer Sequence 7F1 (SEQ ID NO: 50) GCGCGGCCGCGTTAGCCATAGAGATAGC 7R1 (SEQ ID NO: 51) GCGTCGACAAGACGACAAGGCCATGGCTATGC

[0141] Table 22: enzyme digestion identification system of pET-30a(+)-CMV10-LMNB (37℃ enzyme digestion overnight)

[0142] Enzyme digestion system Volume Plasmid pET-30a(+)-CMV10-LMNB 3 μL, about 1 μg BamH I (Bao Biology, item number 1010A) 1 μL Xho I (Bao Biology, item number 1094A) 1 μL Enzyme digestion buffer 1 μL ddH2O Supplemented to 10 μL

[0143] Example 11 Expression and purification of fusion protein

[0144] The prokaryotic expression vector pET-30a(+)-CMV5-LMNB constructed in Example 10 was transformed into BL21(DE3) competent cells (Tiangen Biotech (Beijing) Co., Ltd., item number CB105, the transformation method was referred to the instruction of competent cells) as described in Example 8, and the recombinant protein LMNB-C5 (the amino acid sequence was shown in SEQ ID NO: 57) was prepared according to the manual of pET system (TB055 8th Edition 02 / 99, Novagen). The prepared protein was divided into aliquots and stored at -80℃.

[0145] The prepared recombinant protein concentration was 1 mg / mL by BCA method (Bi Yun Tian Biological Technology Institute, item number P0009), and the detection method was referred to the detection kit instruction. The prepared recombinant protein endotoxin content was <1 EU / mg by gel method (Xiamen Limulus Reagent Factory Co., Ltd., item number G011000), which met the animal experiment requirements, and the detection method was referred to the Limulus reagent instruction.

[0146] Example 12 Animal immunization experiment

[0147] The vaccine information is shown in Table 19. The DNA vaccine pVKD1.0-CI (Example 3) was provided by Suzhou Unikomics Co., Ltd.

[0148] Twenty 6-8 week old female BALB / c mice were purchased from the Animal Experiment Center of Suzhou University and were raised in the SPF animal room of the Animal Experiment Center of Suzhou University. The experimental animal grouping and vaccination plan are shown in Table 23. All DNA vaccines were injected into the tibialis anterior muscle of the lower leg, 100 μg per mouse. All protein vaccines were injected subcutaneously on the back after being fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA), 10 μg per mouse. Two weeks after the last immunization, the mice were sacrificed, and the serum and spleen cells were collected for enzyme-linked immunospot assay (ELISPOT) and enzyme-linked immunoassay (ELISA), respectively.

[0149] The mouse IFN-γ ELISPOT kit was purchased from BD Company (item number: 551083), and the method was referred to the instruction of BD Company IFN-γ ELISPOT kit. The stimulating peptide was NY-ESO-1 41# peptide (WITQCFLPVFLAQPP), which was synthesized by Shanghai Keyepai Biological Technology Co., Ltd., and the final concentration of the stimulating peptide was 10 μg / mL. Phorbol-12-myristate-13-acetate (PMA) and inomysin were purchased from Sigma Company.

[0150] The ELISA method is well known to those skilled in the art and is briefly described below. 96-well microplates were purchased from Jianghai Glass Instrument Factory. Recombinant LMN and NY-ESO-1 were both provided by Suzhou Industrial Park Weikeda Biotechnology Co., Ltd. Proteins were coated with NaHCO3 buffer (pH 9.6) and incubated overnight at 4°C to a coating concentration of 10 μg / mL. The antibody was blocked with phosphate-buffered saline (PBS) containing 0.1% bovine serum albumin (BSA) at 37°C for 30 minutes, then washed five times with PBST containing 0.5% Tween 20. Mouse serum was then incubated at room temperature for 1 hour at an initial dilution of 1:100. After washing five times with PBST, goat anti-mouse HRP secondary antibody (Santacruz, USA) was incubated at a dilution of 1:5000 at 37°C for 30 minutes. After washing five times with PBST, the antibody was developed with 3,3,5,5-tetraamthyl benzidine (TMB) at 37°C for 15 minutes. The reaction was stopped with 2M dilute sulfuric acid, and the absorbance (A) value was read at 450 nm using a microplate reader (Thermo Scientific, USA). A value greater than 2.1 times that of the negative control was considered positive. The reciprocal of the highest dilution among the positive values ​​was defined as the serum antibody titer. When the titer is less than the initial dilution of 1:100, its titer is defined as 50.

[0151] Table 23: Grouping and Immunization Program

[0152]

[0153] Cellular immune response test results as follows Figure 26 As shown in the figure, the primary immunization with pVKD1.0-CI-LMNB DNA vaccine, with LMNB-C5 protein booster (i.e., group C in Example 11) and LMNB-C10 protein booster (i.e., group D in Example 11), showed the best immunization effects, significantly higher than their parallel control (group B). This indicates that both groups carrying 5 Th epitopes of CMV virus (group C) and 10 Th epitopes (group D) can significantly improve the cellular immune response level of weak immunogens.

[0154] Example 13 Animal experiments on tumor prevention

[0155] The vaccine information prepared in Example 2, 3 and Example 8 is shown in Table 19. The DNA vaccine vector pVKD1.0 was provided by Suzhou Unikomics Biotech Co., Ltd., the DNA vaccine pVKD1.0-NP (expressing influenza antigen NP (NCBI reference sequence: YP_009118476.1) derived from strain A / Shanghai / 02 / 2013 (H7N9)) was provided by Suzhou Unikomics Biotech Co., Ltd., and the protein vaccine VP1 (enterovirus 71 VP1 protein, see Chinese patent application 201310088364.5) was provided by Suzhou Unikomics Biotech Co., Ltd.

[0156] Sixty 6-8 week old female BALB / c mice were purchased from the Animal Experimental Center of Suzhou University and raised in the SPF animal room of the Animal Experimental Center of Suzhou University. The grouping of experimental animals and the vaccination plan are shown in Table 24. All DNA vaccines were injected into the tibialis anterior muscle of the lower leg, 100 μg per mouse. All protein vaccines were injected subcutaneously on the back after being fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA), 10 μg per mouse. Two weeks after the last immunization, the mice were subcutaneously inoculated with 4T1-hNY-ESO-1 stably transfected cell lines (provided by Suzhou Unikomics Biotech Co., Ltd.), with a dose of 1 x 10 5 cells per mouse, and the tumor growth was continuously observed and measured after inoculation. The tumor volume was calculated according to the following formula: Tumor volume (mm 3 ) = long x wide 2 / 2. When the tumor volume of the mice exceeded 2000 mm 3 , the mice were sacrificed.

[0157] Table 24: Grouping and immunization plan

[0158]

[0159] The tumor growth of the immunized mice in each group is shown in Table 25. Among them, the mice in the control group (group A) all developed tumors on the 14th day after tumor challenge (i.e., after tumor inoculation) and grew rapidly. The tumor growth of the mice in each immunized group was delayed compared with the control group, among which the mice in the LMNB-I13 booster immunization group (group D) and the LMNB-I13 and LMNB-C10 mixed booster immunization group (group E) had the slowest tumor growth, and therefore, the vaccines in these two groups had the best effect. Figure 27

[0160] In addition, a mouse tumor-free survival analysis was also conducted, and the results are shown in Table 26. Figure 28 ​The median of tumor-free survival (TFS) of the control group A mice was 14 days. The tumor-free survival of each vaccine immunization group was significantly higher than that of the control group. This indicated that all vaccines could improve the tumor-free survival of the mice after immunization. Among them, the D group with I13 epitope fusion peptide, the E group and the F group with I13 and C10 epitope fusion peptide had the best effect, and the highest increase of the tumor-free survival of the mice was doubled. Compared with the conventional vaccine group (B group), the vaccine group with I13 epitope fusion peptide (D group) significantly improved the tumor-free survival, and the tumor-free survival was increased by about 40%. This indicated that the 13 Th epitopes of influenza virus or the 10 CMV Th epitopes could greatly improve the tumor protection effect of the tumor vaccine.

[0161] Finally, the overall survival of the mice was also analyzed, and the results are shown in Table 9. Figure 29 The median of overall survival (OS) of the control group A mice was 35 days. The overall survival of each vaccine immunization group was significantly higher than that of the control group, indicating that all vaccines could improve the survival of the mice after immunization. Among them, the D group with I13 epitope fusion peptide, the E group and the F group with I13 and C10 epitope fusion peptide had the best effect, and the overall survival was increased by 83% at the highest. Compared with the conventional vaccine group (B group), the vaccine group with I13 epitope fusion peptide (D group and F group) significantly increased the tumor-free survival, and the highest increase was 28%, indicating that the 13 Th epitopes of influenza virus or the 10 CMV Th epitopes could greatly improve the tumor protection effect of the tumor vaccine.

[0162] Example 14 Tumor treatment experiment

[0163] The vaccines involved are shown in Example 9. Thirty 6-8 week old female BALB / c mice were purchased from the Animal Experiment Center of Suzhou University and fed in the SPF animal room of the Animal Experiment Center of Suzhou University. The experimental animal grouping and vaccination plan are shown in Table 25. All DNA vaccines were injected into the tibialis anterior muscle of the small leg, 100 μg per mouse. All protein vaccines were emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA) and injected subcutaneously on the back, 10 μg per mouse. Two weeks after the last immunization, the mice were inoculated with tumor cells 4T1-hNY-ESO-1 stably transfected cell line (provided by Suzhou Industrial Park Weikeda Biological Technology Co., Ltd.), and the inoculation dose was 1 x 10 5 cells per mouse. The corresponding mice were subcutaneously inoculated with protein vaccines on the 1st day, the 8th day and the 15th day after tumor cell inoculation, respectively. After inoculation, the tumor growth was continuously observed and measured. The tumor volume was calculated according to the following formula: tumor volume (mm 3 ) = length x width 2 / 2. When the tumor volume of the mice exceeded 2000 mm 3 , the mice were sacrificed.

[0164] Table 25: Grouping and immunization schedule

[0165]

[0166] The tumor growth of the immunized mice in each group is shown in Figure 30 Figure 6. Among them, the mice in the control group (group A) all developed tumors at day 14 after tumor challenge (i.e., after tumor inoculation), and the tumors grew rapidly. Compared with the untreated control group (group A), the tumor growth of the LMNB-I13 protein vaccine treated group (group C) mice was the slowest. Moreover, at day 22 after tumor challenge of the mice, the tumor size of the LMNB-I13 protein vaccine treated group mice was significantly smaller than that of the control group (group A), and until day 30, there was still a significant difference in tumor size between the two groups. By day 35, the tumor growth of the mice in group C began to accelerate, which might be related to the stop of LMNB-I13 protein vaccine inoculation. This result indicates that the LMNB-I13 protein vaccine can inhibit the growth of tumors in mice.

[0167] Example 15 Tumor treatment experiment

[0168] The vaccines involved are shown in Example 9. Thirty 6-8 week old female BALB / c mice were purchased from the Animal Experiment Center of Suzhou University and were raised in the SPF animal room of the Animal Experiment Center of Suzhou University. The grouping of experimental animals and the vaccination schedule are shown in Table 26. All DNA vaccines were injected into the tibialis anterior muscle of the lower leg, 100 μg per mouse. All protein vaccines were injected subcutaneously on the back after being fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA), 10 μg per mouse. Two weeks after the last immunization, the mice were inoculated with tumor cells CT26-hLAGE-1 stable transfection cell line (provided by Suzhou Industrial Park Weikeda Biological Technology Co., Ltd.), with a dose of 1 x 10 5 cells per mouse. The corresponding mice were inoculated subcutaneously with protein vaccines at day 1, day 8 and day 15 after tumor cell inoculation, respectively. After inoculation, the tumor growth was observed and measured continuously. The tumor volume was calculated according to the following formula: Tumor volume (mm 3 ) = length x width 2 / 2. When the tumor volume of the mice exceeded 2000 mm 3 , the mice were sacrificed.

[0169] Table 26: Grouping and immunization schedule

[0170]

[0171] The tumor growth of the immunized mice in each group is shown in Figure 31As shown, the parallel vaccine control group (group B) and LMNB-I13 treated group (group C) mice were compared, as the untreated control group (group A) mice failed to successfully inoculate tumor after tumor challenge (i.e. after tumor inoculation). Compared with group B, the tumor growth of group C mice was slower, and the tumor size of LMNB-I13 protein vaccine treated group mice was significantly smaller than the parallel vaccine control group (group B) on day 22 after tumor challenge in mice, and there was still a significant difference in tumor size between the two groups until day 30. Similarly, in the CT26 mouse model, it was also observed that the tumor growth of group C mice began to accelerate at a later stage, which may be related to the cessation of LMNB-I13 protein vaccine inoculation. This result indicates that the LMNB-I13 protein vaccine can inhibit tumor growth in mice.

Claims

1. A CD4 helper T cell epitope fusion peptide, wherein, The epitope fusion peptide is the epitope fusion peptide shown in SEQ ID NO:

44.

2. A fusion protein formed by fusing the epitope fusion peptide of claim 1 with a target immunogen, wherein, The target immunogen is a tumor antigen; The tumor antigen is selected from one or more of LAGE antigen, MAGE antigen, or NY-ESO-1 antigen.

3. The fusion protein according to claim 2, wherein, The LAGE antigen is LAGE-1, and the MAGE antigen is MAGE-A3.

4. The fusion protein according to claim 3, wherein, The amino acid sequence of LAGE-1 is shown in SEQ ID NO: 24, the amino acid sequence of MAGE-A3 is shown in SEQ ID NO: 25, and the amino acid sequence of NY-ESO-1 is shown in SEQ ID NO:

26.

5. The fusion protein according to claim 3, wherein, The tumor antigens include LAGE-1, MAGE-A3, and NY-ESO-1.

6. The fusion protein according to claim 5, wherein, The fusion protein is shown in SEQ ID NO:

58.

7. A polynucleotide encoding the epitope fusion peptide of claim 1 or the fusion protein of any one of claims 2-6.

8. An immune composition comprising a preventive or therapeutically effective amount of the epitope fusion peptide according to claim 1, the fusion protein according to any one of claims 2-6, and / or the polynucleotide according to claim 7, and a pharmaceutically acceptable carrier.

9. The immune composition according to claim 8, wherein it is a vaccine.

10. A kit comprising the epitope fusion peptide of claim 1, the fusion protein of any one of claims 2-6, the polynucleotide of claim 7, and / or the immune composition of claim 8 or 9, and instructions for use thereof.

11. Use of the epitope fusion peptide of claim 1, the fusion protein of any one of claims 2-6, the polynucleotide of claim 7, and / or the immunogenic composition of claim 8 or 9 in the preparation of a medicament for enhancing the immunogenicity of a target immunogen, wherein, The target immunogen is a tumor antigen; The tumor antigen is selected from one or more of LAGE antigen, MAGE antigen, or NY-ESO-1 antigen.

12. The use according to claim 11, wherein, The LAGE antigen is LAGE-1, and the MAGE antigen is MAGE-A3.

13. The use according to claim 12, wherein, The amino acid sequence of LAGE-1 is shown in SEQ ID NO: 24, the amino acid sequence of MAGE-A3 is shown in SEQ ID NO: 25, and the amino acid sequence of NY-ESO-1 is shown in SEQ ID NO:

26.

14. The use according to claim 12, wherein, The tumor antigens include LAGE-1, MAGE-A3, and NY-ESO-1.

15. Use of the epitope fusion peptide of claim 1, the fusion protein of any one of claims 2-6, the polynucleotide of claim 7, and / or the immune composition of claim 8 or 9 in the preparation of a vaccine that enhances the immunogenicity of a target immunogen, wherein, The target immunogen is a tumor antigen; The tumor antigen is selected from one or more of LAGE antigen, MAGE antigen, or NY-ESO-1 antigen.

16. The use according to claim 15, wherein, The LAGE antigen is LAGE-1, and the MAGE antigen is MAGE-A3.

17. The use according to claim 16, wherein, The amino acid sequence of LAGE-1 is shown in SEQ ID NO: 24, the amino acid sequence of MAGE-A3 is shown in SEQ ID NO: 25, and the amino acid sequence of NY-ESO-1 is shown in SEQ ID NO:

26.

18. The use according to claim 16, wherein, The tumor antigens include LAGE-1, MAGE-A3, and NY-ESO-1.

19. Use of the epitope fusion peptide of claim 1, the fusion protein of any one of claims 2-6, the polynucleotide of claim 7, and / or the immune composition of claim 8 or 9 in the preparation of a medicament for treating or preventing a condition in a subject of need, wherein, The condition described is a malignant tumor; The malignant tumor mentioned is breast cancer or colon cancer.

Images