A method for improving tryptophan synthase activity by constructing a nucleic acid scaffold

By fusing the tag dCE to the tryptophan synthase β subunit gene and constructing a nucleic acid scaffold, the activity and stability of tryptophan synthase were improved, solving the problems of high cost and time consumption of traditional methods, and achieving efficient L-Trp production and simplified industrial processes.

CN115896143BActive Publication Date: 2025-10-10HUBEI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210564775.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-23
Publication Date
2025-10-10
Estimated Expiration
2042-05-23

AI Technical Summary

Technical Problem

In the existing technology, traditional non-standard amino acid synthesis methods require complicated protecting groups, high synthesis costs and long time, and the activity and expression of tryptophan synthase need to be further improved.

Method used

By fusing the tag dCE to the tryptophan synthase β subunit gene, a nucleic acid scaffold was constructed to enhance the activity of tryptophan synthase. The fusion tag was used to promote the expression of tryptophan synthase, and the tryptophan synthase was expressed and purified in Escherichia coli using the pET23a expression vector.

Benefits of technology

The catalytic activity and stability of tryptophan synthase were improved, the industrial production process was simplified, the production cost was reduced, and efficient L-Trp production was achieved. The fusion tag can be used without removal, and the enzyme activity was increased to more than 1.5 times that of the wild type.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115896143B_ABST
    Figure CN115896143B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and discloses a method for improving tryptophan synthetase activity by constructing a nucleic acid scaffold, wherein a fusion tag dCE is fused to a tryptophan synthetase beta subunit gene, the base sequence of the tryptophan synthetase gene is SEQ ID NO:1, the base sequence of the dCE gene is SEQ ID NO:2-SEQ ID NO:5, and the tryptophan synthetase gene is derived from Escherichia coli. The fusion tag dCE is fused to the tryptophan synthetase gene of the Escherichia coli, and the results of heterologous expression with and without the fusion tag are compared. The fusion tag dCE has a soluble expression promoting effect on the protein. The soluble expression promoting effect of the tag ultimately obtains an engineered enzyme capable of catalyzing the substrate L-Ser, and forms a nucleic acid scaffold to improve the catalytic activity of the enzyme, thereby providing a new enzyme for the industrial production of L-Trp and a new way for the heterologous expression of L-Trp.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a method for improving the activity of tryptophan synthase by constructing a nucleic acid scaffold. Background Art

[0002] At present, L-Trp is involved in many aspects of production and life, and plays a very important role in animal husbandry, medicine and other industries. In addition, tryptophan synthase can also generate multiple derivative substances in the process of generating L-Trp, and can be used in many aspects.

[0003] L-Trp can be used clinically to treat depression. In animal husbandry, tryptophan is an important feed additive that can increase the lean meat content of livestock products. Non-standard amino acids (ncAAs) also play an important role in biological research. Among all ncAA synthesis methods, the most promising is the method that utilizes the uniqueness of enzymes and the associated high-precision conversion effect. This method does not require complex protecting groups, so tryptophan synthase is also widely used in the production of this substance. At the same time, tryptamine, as a common biologically active tryptophan derivative in the body, can participate in multiple important physiological activities in organisms, thus reflecting their importance to biological research.

[0004] Therefore, it is of great significance to further improve the activity of tryptophan synthase, further promote the expression of tryptophan synthase, and ensure its activity and function.

[0005] Through the above analysis, the problems and defects of the existing technology are: the traditional synthesis method of non-standard amino acids requires complicated protecting groups, the synthesis cost is high, and it takes a long time. Summary of the Invention

[0006] In response to the problems existing in the prior art, the present invention provides a method that can promote dissolution and form a nucleic acid scaffold to enhance the activity of tryptophan synthase, that is, a method for enhancing the activity of tryptophan synthase by constructing a nucleic acid scaffold, and more particularly relates to a method and application of promoting the expression of tryptophan synthase based on a fusion tag and forming a nucleic acid scaffold by the fusion tag to enhance the activity of recombinant tryptophan synthase.

[0007] The present invention is achieved by a method for enhancing tryptophan synthase activity by constructing a nucleic acid scaffold, comprising:

[0008] The tag dCE was fused to the tryptophan synthase β subunit gene.

[0009] Furthermore, the base sequence of the tryptophan synthase gene is SEQ ID NO: 1.

[0010] Furthermore, the base sequence of the dCE gene is SEQ ID NO: 2 to SEQ ID NO: 5.

[0011] Furthermore, the tryptophan synthase gene is derived from Escherichia coli.

[0012] Furthermore, the method for enhancing tryptophan synthase activity by constructing a nucleic acid scaffold comprises the following steps:

[0013] Step 1: amplify the sequence containing tryptophan synthase and fusion tag;

[0014] Step 2: cloning the amplified sequence into an expression vector to construct a recombinant vector;

[0015] Step three: Transform the recombinant vector into Escherichia coli to induce the target protein tryptophan synthase.

[0016] Furthermore, the expression vector is a pET23a expression vector;

[0017] The amplified sequence containing tryptophan synthase and a fusion tag also includes a purification tag sequence;

[0018] The purification tag sequence is 6*HIS;

[0019] The Escherichia coli expression strain is BL21 (DE3).

[0020] Furthermore, the method of inducing Escherichia coli containing the recombinant vector to express the target protein is:

[0021] Inoculate the transformant and culture at 37°C until OD 600 When the concentration of IPTG was 0.8, the cells were induced with 0.5-1 mM IPTG at 18°C ​​for 12-16 h.

[0022] Another object of the present invention is to provide an engineered Escherichia coli bacterium, wherein the engineered Escherichia coli bacterium is based on the recombinant vector and the engineered Escherichia coli bacterium into which the recombinant vector is transferred.

[0023] Another object of the present invention is to provide a tryptophan synthase prepared by implementing the method of enhancing the activity of tryptophan synthase by constructing a nucleic acid scaffold.

[0024] Another object of the present invention is to provide an application of the tryptophan synthase in L-Trp production, and the application method of the tryptophan synthase in L-Trp production comprises:

[0025] When preparing L-Trp, the substrates are L-Ser and indole, the optimal pH is 9.0, and the optimal reaction temperature is 50°C. In combination with the above technical solutions and the technical problems solved, please analyze the advantages and positive effects of the technical solutions to be protected by the present invention from the following aspects:

[0026] First, in view of the technical problems existing in the above-mentioned prior art and the difficulty of solving these problems, this paper closely combines the technical solutions to be protected by the present invention and the results and data during the research and development process, and analyzes in detail and in depth how the technical solutions of the present invention solve the technical problems and some creative technical effects brought about by solving the problems. The specific description is as follows:

[0027] The present invention fuses a fusion tag dCE to the tryptophan synthase gene of Escherichia coli. By comparing the results of heterologous expression with and without the fusion tag, it is concluded that the fusion tag dCE promotes soluble expression of the protein. Through the solubility-promoting effect of the tag, an engineered enzyme that can catalyze the substrate L-Ser is ultimately obtained. At the same time, the tag dCE is also a nucleic acid-binding protein. By fusing the tag dCE, a nucleic acid scaffold can be formed to improve the catalytic activity of the tryptophan synthase. A new enzyme is provided for the industrial production of L-Trp, and a new approach for the heterologous expression of L-Trp is also provided. The present invention purifies the target protein using a nickel column, and through enzyme activity detection, it is found that both the enzyme with the fusion tag and the enzyme without the fusion tag are active, indicating that the fusion tag has a guiding effect on the correct folding of the enzyme, and the activity of the enzyme is improved to a certain extent after the fusion tag is fused. In industrial production, the fusion tag can be omitted and the enzyme can be directly used in the enzymatic reaction, facilitating the widespread application of the enzyme in large-scale industrial production. The enzyme properties of the purified tryptophan synthase were tested and it was found that the optimum pH of the enzyme was 9.0, the optimum reaction temperature was 50℃, and the Cu 2+ 、Fe 2+ The enzyme has a significant inhibitory effect on the enzymatic reaction of the enzyme, and its stability remains stable at high temperatures. After being placed at 60°C for 30 minutes, it still has more than 90% enzyme activity. After the enzyme with a fusion tag catalyzes the substrate L-Ser, after a reaction of 1 hour, liquid chromatography detection results show that the enzyme's substrate catalytic activity increases when the fusion tag is not removed.

[0028] The present invention has found through experiments that, when the fusion tag is not removed, both the enzyme and the bacteria can catalyze the substrate L-Ser to produce L-Trp. At the same time, because the solubility of indole is not high and the saturated solubility is quickly reached, while the product L-Trp is relatively high, during the reaction, excess L-Ser and indole are added to the reaction solution. As the substrate is consumed and the product is produced, the solubility of the substrate L-Ser and indole in the solution decreases. The substrate L-Ser and indole that cannot be dissolved in the reaction solution can mostly autoly dissolve to maintain the substrate concentration. Therefore, the enzymatic reaction described in the present application is also a product enrichment process, which can achieve a very high substrate concentration and does not require pH adjustment during the reaction process.

[0029] Second, considering the technical solution as a whole or from the perspective of the product, the technical effects and advantages of the technical solution to be protected by the present invention are described in detail as follows:

[0030] The present invention provides a method for enhancing the activity of tryptophan synthase by constructing a nucleic acid scaffold based on a fusion tag. The tag dCE is fused to the tryptophan synthase gene, and experiments have confirmed that the dCE tag has a soluble expression-promoting effect on the protein. The present invention also found that after introducing the tag on the β subunit of tryptophan synthase, the reaction result under whole-cell catalytic reaction conditions can be increased to more than 1.5 times that of the wild type. Under pure enzyme conditions, it was found that after the introduction of the tag, the activity of the recombinant tryptophan synthase was greatly improved, and it also performed better under heat resistance and long-term reaction conditions. Therefore, in subsequent industrial production applications, the fusion tag can be directly reacted without removal, which is simple in process and more active and durable.

[0031] Third, as auxiliary evidence for the inventiveness of the claims of the present invention, it is also reflected in the following important aspects:

[0032] (1) The expected benefits and commercial value of the technical solution of the present invention after transformation are as follows: tryptophan, as a protein amino acid, participates in various activities of living organisms and has the efficacy of treating anxiety, substance addiction and depression. At the same time, it can also be used as a common precursor substance for many primary or secondary metabolites in multiple life domains in an organism. At present, most commercialized tryptophan is mainly synthesized by chemical synthesis, which has caused great damage to the environment. The various environmental advantages of enzyme-catalyzed reactions are also increasingly demanded by enterprises. It not only realizes the reuse of production waste and minimizes environmental pollution, but also greatly reduces the production cost of L-tryptophan, and has a good prospect in future production.

[0033] (2) The technical solution of the present invention fills the technical gap in the industry at home and abroad:

[0034] With the growing demand for L-tryptophan and increasing environmental protection requirements, research on tryptophan synthase has never ceased. Furthermore, the unique structure of tryptophan synthase is crucial for the catalytic diversity of derivatives, the high efficiency of overall reactions, and the enhanced activity of tryptophan synthase, thereby enabling the production of a variety of desired substances. The dCE protein, a common colicin, possesses a strong ability to bind DNA, and the abundance of nucleic acids within biological cells provides a foundation for the use of nucleic acid scaffolds in engineered bacteria.

[0035] The present invention has completed the mutation of the dCE protein, retaining its ability to bind DNA, and the study of the tryptophan synthase strain in the laboratory after completing the recombination between the two has provided a large amount of feasibility data for the use of nucleic acid scaffolds in production and life, and also has great guiding significance for improving the activity of tryptophan synthase, thereby improving the production level of L-tryptophan in my country.

[0036] (3) Whether the technical solution of the present invention solves the technical problems that people have been eager to solve but have not been able to solve successfully:

[0037] Amino acids and their derivatives play an important role in the physiological and biochemical functions of the human body and are widely used in drug precursors, the chemical industry, and the medical industry. Since enzyme catalysis replaced traditional chemical methods for the preparation of amino acids, issues such as enzyme catalytic specificity, conversion rate, byproducts, whether the reaction process is complicated, whether the enzyme half-life is longer, and whether it is better environmental tolerance have become major concerns for industrialization. The present invention has the following advantages:

[0038] Whole-cell catalytic effect: After the dCE protein tag was fused to the TrapB subunit, the reaction results showed dCE2>dCE9>dCE8>dCE7, and the whole-cell catalytic activity could reach about 1.5 times that of the wild type.

[0039] Fusion of the dCE protein tag also enhanced the activity of the recombinant tryptophan synthase. Combining multiple results, we determined that the recombinant enzyme fused with dCE8 exhibited the best performance relative to the wild-type. Overall, the recombinant tryptophan synthase exhibited an optimal temperature of 50°C and an optimal pH of approximately 9.0, maintaining robust activity even after prolonged temperature treatment.

[0040] In terms of metal ion preference, the fusion tag is more similar to the wild type. The activity is improved in the presence of common monovalent metal ions, but the activity is basically inhibited in the presence of divalent metal ions.

[0041] After the endogenous nucleic acid is treated with a heparin column, the addition of exogenous nucleic acid increases the enzyme activity again, reaching up to more than three times that of the enzyme without the addition of exogenous nucleic acid.

[0042] In summary, the recombinant tryptophan synthase constructed by fusion of dCE protein has the advantages of stronger heat resistance and higher activity. It also confirms the feasibility of nucleic acid scaffolds and provides new ideas for the modification of other enzymes with similar structures.

[0043] (4) Whether the technical solution of the present invention overcomes technical prejudice:

[0044] As a common colicin, dCE protein possesses a strong ability to bind DNA, and biological cells naturally contain a large amount of nucleic acids. Based on this, the present invention modified the dCE protein, eliminating its DNase activity while retaining its DNA binding ability. Subsequent experiments revealed that the fusion of the two proteins had an unexpected effect, increasing the conversion rate of L-tryptophan by 16.7%. The enzyme-catalyzed reaction time was reduced by approximately 50%, indicating that the folding conformation of tryptophan synthase undergoes a series of changes after the fusion of the mutant dCE protein, leading to the unexpected effect. Serine is a byproduct of many amino acid production companies. This invention not only enables the reuse of production waste, minimizing environmental pollution, but also significantly reduces the production cost of L-tryptophan, promising promising future production.

[0045] This study fuses a DNA-binding protein to tryptophan synthetase, marking the first attempt to fuse a nucleic acid-binding protein to a non-nucleic acid catalytic protein and achieving unexpected results. The specific reaction mechanism awaits further confirmation in subsequent research. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0047] Figure 1 This is a flow chart of a method for increasing tryptophan synthase activity by constructing a nucleic acid scaffold provided in an embodiment of the present invention;

[0048] Figure 2 This is a diagram showing the results of liquid phase detection of tryptophan synthase after fusion of dCE series tags provided in an embodiment of the present invention;

[0049] Figure 3is a fusion tag tryptophan synthetase fragment splicing schematic diagram provided by the embodiment of the present application;

[0050] Figure 4 is a thin layer detection fusion tag tryptophan synthetase and wild type tryptophan hydrolysis efficiency schematic diagram provided by the embodiment of the present application;

[0051] Figure 5 is a dCE gene fragment, Ectrp gene fragment and pET23a carrier reverse expansion fragment diagram provided by the embodiment of the present application;

[0052] Figure 6 is a colony PCR gel electrophoresis result provided by the embodiment of the present application, and the colony PCR identification recombinant subgraph is shown in the figure;

[0053] Figure 7 is a pET23a-Ectrp-dCE2 protein purification result diagram provided by the embodiment of the present application;

[0054] Figure 8 is a thin layer chromatography detection whole cell reaction activity diagram provided by the embodiment of the present application. DETAILED DESCRIPTION

[0055] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in combination with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and not to limit the present application.

[0056] In view of the problems existing in the prior art, the present application provides a method for improving the activity of tryptophan synthetase by constructing a nucleic acid scaffold, which is described in detail below in combination with the accompanying drawings.

[0057] I. Explanation of the embodiment. In order to enable those skilled in the art to fully understand how the present application is specifically implemented, this part is an explanation of the embodiment of the technical scheme of the claims.

[0058] The method for improving the activity of tryptophan synthetase by constructing a nucleic acid scaffold provided by the embodiment of the present application is: fusing a tag dCE on the tryptophan synthetase beta subunit gene; wherein the base sequence of the tryptophan synthetase gene is SEQ ID NO: 1, and the base sequence of the dCE gene is SEQ ID NO: 2-SEQ ID NO: 5.

[0059] The gene sequence of SEQ ID NO: 1 is:

[0060]

[0061] SEQ ID NO:2如:

[0062] Agcaaacgtaacaaaccgggtaaagcaaccggtaaaggtaaaccggttggtgataaatggctggatgatgcaggtaaagatagtggtgcaccgattccggatcgtattgcagataaactgcgtgataaagaatttaagaacttcgacgacttccgcaagaaattttgggaagaagttagcaaagatccggacctgagcaaacagtttaaaggtagcaataaaaccaacatccagaaaggcaaagcaccgtttgcacgtaaaaaggatcaggttggtggtcgtgaacgttttgaactgaatcatgataaaccgattagccaggatggtggtgtttatgatatgaataacattcgtgtgaccacgccgaaacgcaacattgatattgaacgtggtaaa。

[0063] SEQ ID NO:3如:

[0064] Agcaaacgtaacaaaccgggtaaagcaaccggtaaaggtaaaccggttaataacaaatggctgaacaatgcaggtaaagacctgggtagtccggttccggatcgtattgcaaataaactgcgtgataaagaatttaagagcttcgatgacttccgcaagaaattttgggaagaagttagcaaagatcccgaactgagcaaacagtttagccgcaataacaatgatcgtatgaaagttggtaaagcaccgaaaacacgtacccaggatgttagcggtaaacgtacctcatttgaactgaatcatgaaaaaccgattagccagaatggtggcgtttatgatatggataacattagcgttgttaccccgaaacgcaacattgatattgaacgtggtaaa。

[0065] SEQ ID NO:4如:

[0066] Agcaaacgtaacaaaccgggtaaagcaaccggtaaaggtaaaccggttggtgataaatggctggatgatgcaggtaaagatagtggtgcaccgattccg gatcgtattgcagataaactgcgtgacaaagaattcaagaacttcgatgatttccgtcgcaaattttgggaagaagttagcaaagatccggaactgagc aaacagtttaatccgggtaataagaaacgtctgagccaaggtctggcaccgcgtgcacgtaataaagataccgttggtggtcgtcgttcatttgaactg aatcatgataaaccgattagccaggatggtggtgtttatgatatggataatctgcgtattaccacgccgaaacgcaacattgatattgaacgtggtcag.

[0067] SEQ ID NO: 5 is as follows:

[0068] Agcaaacgtaacaaaccgggtaaagcaaccggtaaaggtaaaccggttggtgataaatggctggatgatgcaggtaaagatagtggtgcaccgattccg gatcgtattgcagataaactgcgtgataaagaatttaagagcttcgacgattttcgcaaagcagtttgggaagaagttagcaaagatccggaactgagc aaaaatctgaatccgagcaataaaagcagcgtgagcaaaggttatagcccgtttacaccgaaaaatcagcaggttggtggtcgtaaagtttatgaactg aatcacgataaaccgattagccaaggtggtgaagtgtatgatatggataatattcgtgtgaccacgccgaaacgcaacattgatattgaacgtggtaaa.

[0069] like Figure 1 As shown, the method for increasing the activity of tryptophan synthase by constructing a nucleic acid scaffold provided in an embodiment of the present invention comprises the following steps:

[0070] S101, amplification of the sequence containing tryptophan synthase and fusion tag;

[0071] S102, cloning the amplified sequence into an expression vector to construct a recombinant vector;

[0072] S103, transforming the recombinant vector into Escherichia coli to induce the target protein tryptophan synthase.

[0073] The tryptophan synthase gene provided in the embodiment of the present invention is derived from Escherichia coli; the expression vector is a pET23a expression vector; the amplified sequence containing tryptophan synthase and a fusion tag also includes a purification tag sequence; the purification tag sequence is 6*HIS; and the Escherichia coli expression strain is BL21(DE3).

[0074] The method for inducing Escherichia coli containing a recombinant vector to express a target protein provided by the embodiment of the present invention is as follows: inoculating the transformant, culturing at 37°C until OD 600 When the concentration of IPTG was 0.8, the cells were induced with 0.5-1 mM IPTG at 18°C ​​for 12-16 h.

[0075] The application method of the tryptophan synthase obtained by the preparation method based on the fusion tag to promote the expression of tryptophan synthase provided in the embodiment of the present invention in the production of L-Trp is as follows: when preparing L-Trp, the substrates used are L-Ser and indole, the optimal pH is 9.0, and the optimal reaction temperature is 50°C.

[0076] The results of the liquid phase detection of tryptophan synthase after fusion of dCE series tags provided in the embodiment of the present invention are shown in FIG. Figure 2 shown.

[0077] The technical solution of the present invention is further described below with reference to specific embodiments.

[0078] Sources of biological materials:

[0079] Escherichia coli BL21 (DE3) was purchased from Novagen;

[0080] The primer sequences used were synthesized by Wuhan Jinkairui Bioengineering Co., Ltd.;

[0081] The vector pET23a used was purchased from Novagen.

[0082] Example 1: Preparation of positive E. coli clones containing tags

[0083] The dCE2 sequence (see SEQ ID NO: 2), dCE7 sequence (see SEQ ID NO: 3), dCE8 sequence (see SEQ ID NO: 4), and dCE9 sequence (see SEQ ID NO: 5) were synthesized by Wuhan Jinkairui Biotechnology Co., Ltd., and 6 histidines were added to the C-terminus as tags. The OVERLAPPING strategy (see Figure 3 ) and the primers shown in Table 1, concatenate the fusion tag and tryptophan synthetase. Using the first and last primers (5-10 mM) as primers, add several extended fragments with homology regions as templates, add a small amount (1-2 mM) of the middle primer, and anneal and extend again. Repeat this process, and ultimately confirm the DNA of the correct size as suspected correct DNA by agarose gel analysis. The DNA of the correct size is recovered from the gel, inserted into the pMD18T vector, and sequenced to verify gene accuracy. The primers required for vector construction are shown in Table 1 (homology arms are underlined).

[0084] Table 1 Primer sequences required for the experiment

[0085]

[0086] The specific operation steps are as follows: using primers F: pET23a-dCE2-F (see SEQ ID NO: 6) and primers R: pET23a-dCE2-R (see SEQ ID NO: 7) with the synthetic dCE2 gene vector as a template to obtain the dCE2 gene (see SEQ ID NO: 2); using primers F: pET23a-dCE7-F (see SEQ ID NO: 8) and primers R: pET23a-dCE7-R (see SEQ ID NO: 9) with the synthetic dCE7 gene vector as a template to obtain the dCE7 gene (see SEQ ID NO: 3); using primers F: pET23a-dCE8-F (see SEQ ID NO: 10) and primers R: pET23a-dCE8-R (see SEQ ID NO: 11) with the synthetic dCE8 gene vector as a template to obtain the dCE8 gene (see SEQ ID NO: NO: 4); using primers F: pET23a-dCE9-F (see SEQ ID NO: 12) and primer R: pET23a-dCE9-R (see SEQ ID NO: 13) with the synthesized dCE9 gene vector as a template, the dCE9 gene (see SEQ ID NO: 5) was obtained; using primers F: pET23a-Ectrp-F (see SEQ ID NO: 14) and R: 23a-Ectrp-R (see SEQ ID NO: 15) with the pET23a-Ectrp (see SEQ ID NO: 1) sequence as a template, PCR amplification was performed to obtain the Ectrp-6*his sequence.

[0087] After obtaining the amplified fragment, the vector pET-23a was digested with the restriction endonuclease BamHI, and the mixture of the fragment and the vector was treated on ice with T5 endonuclease. After 5 to 10 seconds, E. coli DH5α competent cells were conventionally transformed with E. coli. After culturing at 37°C for 18 hours, the monoclonal colonies on the screening plate were picked and the plasmid was extracted. The primers at both ends of the spliced ​​fragment were used as primers and the plasmid was used as a template. The recombinant was verified by PCR and the correctness of the recombinant plasmid was confirmed by sequencing to obtain the vector pET23a-dCE2-Ectrp. The correctness of the alkaline linker of the above plasmid was verified by sequencing and stored at -20°C for use.

[0088] The above recombinant vectors were transformed into Escherichia coli BL21 (DE3) competent cells, and positive clones were obtained by sequencing verification.

[0089] Example 2: Preparation of tag-free E. coli positive clones

[0090] Tryptophan synthase (Ectrp) from Escherichia coli was fused to the Escherichia coli vector pET-23a and conventionally transformed into Escherichia coli competent cells BL21 (DE3).

[0091] The specific steps are as follows:

[0092] Using primers F: pET23a-Ectrp-F (see SEQ ID NO: 14) and R: pET23a-Ectrp-R (see SEQ ID NO: 15), the Ectrp gene sequence (see SEQ ID NO: 1) was obtained using a synthetic tryptophan synthase gene vector as a template. The correctly sized fragment was recovered from an agarose gel. The pET-23a vector was digested with BamHI to recover the vector backbone. The fragment and vector mixture was treated with T5 endonuclease on ice for 5-10 seconds. After 5-10 seconds, the fragment was transformed into E. coli DH5α competent cells using conventional methods. After incubation at 37°C for 18 hours, single colonies were picked from screening plates, plasmids were extracted, and positive clones were verified by sequencing.

[0093] Example 3: SDS-PAGE detection of the expression of recombinant tryptophan synthase

[0094] The positive clones obtained in Example 2 of the present invention were inoculated into LB medium, cultured at 37°C, 200 rpm overnight, transferred to the same Erlenmeyer flask and cultured for 4-5 hours until the OD 600 When the pH value is ≈0.8, induce with 0.5-1 mM IPTG at 18°C ​​for 12-16 h (induced at 18°C), collect the bacteria, wash the bacteria and disrupt them by ultrasonication.

[0095] The positive clones obtained in Example 1 of the present invention were inoculated into LB medium, cultured overnight at 37°C and 200 rpm, transferred to the same Erlenmeyer flask and cultured for 4-5 hours. When OD600 was ≈ 0.8, they were induced with 0.5-1 mM IPTG at 18°C ​​for 12-16 hours. The cells were collected, washed, and subjected to whole-cell catalytic reaction, followed by bacterial lysis and purification.

[0096] The enzyme properties analysis showed that the optimum pH of the enzyme was 9.0, the optimum reaction temperature was 50℃, and the Cu 2+ , Fe 2+ It has a significant inhibitory effect on the enzymatic reaction of the enzyme. It is stable at high temperatures and still has more than 90% enzyme activity when placed at 60°C for 30 minutes. However, high temperature has a significant inhibitory effect on the activity of the enzyme. When the temperature is higher than 80°C and the treatment is carried out for 1 hour, the enzyme activity is reduced by more than 80%.

[0097] Example 4: Analysis of the effect of fusion tags on enzyme activity

[0098] (1) Free enzyme catalyzed reaction

[0099] The bacterial cells obtained after inoculation of the positive clones containing the tag in Example 3 of the present invention were collected separately, the bacterial pellets were resuspended with PBS buffer, the cells were disrupted by ultrasonic disruptor, and the supernatant was collected by centrifugation at 4°C and 12000 rpm for 5 min. The target protein was affinity purified using a Ni Sepharose 6 Fast Flow affinity chromatography column, and the protein elution peak sample was collected and ultrafiltered at 4°C.

[0100] Tryptophan synthase catalyzes the production of L-Trp from the substrates L-Ser and indole, which can be detected by HPLC at an absorbance of 278 nm. Therefore, 100 μL of the reaction solution and 100 μL of the enzyme solution were prepared under optimal reaction conditions for 10 minutes. After cooling to room temperature, an equal volume of acetonitrile was added to terminate the reaction, and the absorbance was measured at 278 nm. Tryptophan synthase is defined as the amount of enzyme required to produce 1 μmol of L-Trp per minute under optimal reaction conditions.

[0101] Under the same reaction conditions, it was found that the fusion tag can promote the expression and solubility of the enzyme, and the activity of the free enzyme fused with the dCE tag is 30-50% higher than that of the free enzyme with the tag removed under the same conditions when the tag is not removed. The activity of the free enzyme fused with the dCE7 tag is only less than 10% higher than that of the free enzyme with the tag removed under the same conditions when the tag is not removed.

[0102] (2) Whole-cell enzymatic reaction

[0103] Take the E. coli engineering strain containing plasmids pET23a-Ectrp-6*his, pET23a-dCE2 Ectrp-6*his, pET23a-dCE7-Ectrp-6*his, pET23a-dCE8-Ectrp-6*his, pET23a-dCE9-Ectrp-6*his, culture them at 37℃, 200rpm overnight, transfer them to the same Erlenmeyer flask and culture them for 4-5h until OD 600 When the pH value is ≈0.8, induce with 0.5-1 mM IPTG at 18°C ​​for 12-16 hours, then harvest the cells. Perform the enzymatic reaction with the same wet weight of cells under the same conditions, and measure the reaction rate using liquid chromatography.

[0104] The bacteria were washed three times with PBS buffer, and 0.1 g of bacteria were reacted under the optimal reaction conditions of the enzyme for 1 h. The L-Trp production detected in the Escherichia coli solution containing the recombinant vector pET23a-dCE2-Ectrp-6*his was more than 1.5 times that of the wild type.

[0105] The experimental results of whole-cell enzymatic reactions show that bacteria containing fusion tags can also carry out enzymatic reactions, and the fusion tags do not affect the substrate catalytic activity of amino acid oxidase. Therefore, the engineered bacteria obtained by this method have simple processes in industrial production, laying the foundation for large-scale industrial production.

[0106] Detection method:

[0107] The methods for detecting the substrate conversion efficiency of bacteria or pure enzymes are thin layer chromatography (qualitative detection) and liquid chromatography (quantitative detection), specifically:

[0108] The thin layer chromatography method is as follows: take a thin layer chromatography plate of appropriate size, draw a parallel line with a pencil 1.5 to 2 cm from the edge of the sample line, and preliminarily mark the sample location. Take 2 μL of the reaction solution with a capillary tube, and spot the sample in small amounts multiple times. Thin layer developing agent: add 70% isopropanol to a concentration of 4g / L ninhydrin. When the developing agent is about 5 cm away from the upper edge of the thin layer, take out the thin layer plate and blow dry it with a hair dryer. The color will appear immediately, and the detection effect is as follows: Figure 4 shown.

[0109] Liquid chromatography detection conditions were: Agilent C18 5μm, 4.6mm×250mm, UV detector. Mobile phase: phosphate buffer containing 10% methanol, flow rate of 1 mL / min, column temperature of 40°C. After 7 minutes, the absorption peak of L-Trp was observed at 278 nm.

[0110] 2. Evidence of the Effects of the Embodiments The embodiments of the present invention have achieved some positive effects during the development or use process, and indeed have great advantages over the prior art. The following content describes them with reference to data, charts, etc. during the test process.

[0111] In application example 1: Since tryptophan synthetase is mainly composed of α subunit and β subunit combined into an αββα tetramer structure, the gene fragment of tryptophan synthetase is also composed of TrapA gene and TrapB gene connected in series. Therefore, when selecting the dCE tag to be combined with the tryptophan synthetase gene, the problem of gene binding will also be considered. For the amplification of the tryptophan synthetase gene fragment, the pET23a-Ectrp plasmid and pET23a-dCE plasmid preserved in the laboratory were used to amplify them in large quantities using the primers in Table 1, and recovered by gel electrophoresis. The length of the Ectrp fragment is about 2000bp, the length of the dCE fragment is about 396bp, and the length of the pET23a vector reverse amplification fragment is about 3700bp. As shown Figure 5 dCE gene fragment, Ectrp gene fragment and pET23a vector amplified fragment are shown. Figure 5 Middle, M: DL5000 DNA Marker; Lane: 1 pET23a vector reverse amplification fragment, obtained by PCR amplification using pET23a-Kan-F and pET23a-Kan-R as primers; Lanes 2-5: PCR amplification of dCE tag fragments; Lane 6: Ectrp gene amplification fragment, obtained by amplification using Ectrp-F and Ectrp-R as primers.

[0112] In Application Example 2: The target gene fragment and the vector fragment are transformed, and after the bacteria grow, colony PCR is performed to screen the recombinants. For the positive colonies, the bacterial solution is sent to Jinkairui for testing, and the bacteria with the correct combination are screened and the plasmid is extracted. Taking pET23a-Ectrp-dCE2 as an example, the gel electrophoresis results of colony PCR are shown in Colony PCR Identification of Recombinants Figure 6 In the figure, M: DL5000 DNA Marker; lane 1: positive control (amplified using pET28a plasmid as template); lanes 2-10: sample PCR lanes (amplified using bacterial solution as template).

[0113] In Application Example 3, cells loaded with four dCE-tagged tryptophan synthases were induced for expression and then the collected cells were broken and purified. The purified collected liquid was subjected to SDS-PAGE electrophoresis, and the pure collected liquid containing the target band was selected and concentrated by ultrafiltration. Given that the size of TrapA proteins after fusion tags is consistent, the purification results of pET23a-Ectrp-dCE2 are used as an example. The results are shown below. Figure 7The results of pET23a-Ectrp-dCE2 protein purification are shown. Figure 7 M: PageRuler TM Prestained Protein Ladder; Lane 1: pET23a-Ectrp-dCE2 lysis supernatant, Lane 2: pET23a-Ectrp-dCE2 flow-through after nickel beads attachment; Lane 3: 10 mm imidazole eluate; Lane 4: 30 mm imidazole eluate; Lanes 5-6: 100 mm imidazole eluate; Lanes 7-9: 300 mm imidazole eluate.

[0114] In Application Example 4, the E. coli engineered strains containing plasmids pET23a-Ectrp-6*his, pET23a-dCE2 Ectrp-6*his, pET23a-dCE7-Ectrp-6*his, pET23a-dCE8-Ectrp-6*his, and pET23a-dCE9-Ectrp-6*his were cultured overnight at 37°C and 200 rpm, and then transferred to the same Erlenmeyer flask and cultured for 4-5 hours until the OD 600 When the concentration is ≈0.8, induce with 0.5-1mM IPTG at 18℃ for 12-16h and collect the cells. Take cells of the same wet weight and carry out enzymatic reaction under the same conditions. The reaction effect is detected by thin layer chromatography. Figure 8 Whole-cell reactivity was detected by thin-layer chromatography. Figure 8 In the figure, 1: 1% L-Ser standard; 2: pET23a-Ectrp-dCE2 reaction product; 3: pET23a-Ectrp-dCE7 reaction product; 4: pET23a-Ectrp-dCE8 reaction product; 5: pET23a-Ectrp-dCE9 reaction product; 6: 1% L-Trp standard.

[0115] The above description is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with this technical field within the technical scope disclosed by the present invention and within the spirit and principles of the present invention should be covered by the scope of protection of the present invention. <110> Hubei University <120> A method for improving tryptophan synthase activity by constructing a nucleic acid scaffold <160> 15 <210> 1 <211> 1992 <212> DNA <213> Artificial Sequence <400> 1 <210> 2 <211> 396 <212> DNA <213>人工序列(Artificial Sequence) <400> 2 agcaaacgtaaaaccgggtaaagcaaccggtaaaggtaaaccggttggtgataaatggctggatcgtattgcagataactgcgtgataaagaatttaagaacttcgacgacttcgcaagaaatttggagagagacgacgc aaacagtttaaagtagcaataaaccacatccagaaggcaaagcaccgtttgcacgtaaaaaaagatcaggttggtgtgaacgttttgaactgaatcatgataaccgattagccaggatggtggtgttatgatatgaataacattcgtgtgaccacgcgaaaccacgatagatagataggtac <210> 3 <211> 396 <212> DNA <213>人工序列(Artificial Sequence) <400> 3 agcaaacgtaaaaccgggtaaacaaatggctgaacaatgcaggtaaagacctgggtagtccggttccggatcgtattgcaaataactgcgtgataaagaatttaagactcgatcgattcgcaagaaattttggagactcgactcgcgc aaacagtttagccgcaataacaatgatcgtatgaaagttggtaaagcaccgaaacacgtacccaggatgttagcggtaaacgtacctcattgaactgaatcatgaaaaccgattagccagaatggtggcgtttatgatatggataacattagcgttgttacccgaaacgcaacattgaaggtaacgtaaacgta <210> 4 <211> 396 <212> DNA <213>人工序列(Artificial Sequence) <400> 4 agcaaacgtaaaaccgggtaaagcaaccggtaaaggtaaaccggttggtgataaatggctggatcgtattgcagataactgcgtgacaaagaattcaagaacttcgatttcgtcgcaaattttgcaagactgactcgattcgtcgcaaattttggagactcgacgatc aaacgtttaatccgggtaataagaaacgtctgagccaaggtctggcaccggtgcacgtaataaagataccgttggtggtcgttcatttgaactgaatcatgataaccgattagccaggatggtggtgtttatgatatggataatctgcgtattaccacgccgaaacgcaacattgatacgcgt <210> 5 <211> 396 <212> DNA <213> Artificial Sequence <400> 5 agcaaacgtaacaaaccgggtaaagcaaccggtaaaggtaaaccggttggtgataaatggctggatgatgcaggtaaagatagtggtgcaccgattccggatcgtattgcagataaactgcgtgataaagaatttaagagcttcgacgattttcgcaaagcagtttgggaagaagttagcaaagatccggaactgagcaaaaatctgaatccgagcaataaaagcagcgtgagcaaaggttatagcccgtttacaccgaaaaatcagcaggttggtggtcgtaaagtttatgaactgaatcacgataaaccgattagccaaggtggtgaagtgtatgatatggataatattcgtgtgaccacgccgaaacgcaacattgatattgaacgtggtaaa <210> 6 <211> 34 <212> DNA <213> Artificial Sequence <400> 6 catcatcatcatcatagcaaacgtaacaaaccgg <210> 7 <211> 41 <212> DNA <213> Artificial Sequence <400> 7 gttaagtaatgttgttttaccacgttcaatatcaatgttgc <210> 8 <211> 46 <212> DNA <213> Artificial Sequence <400> 8 atatacatgcaccatcatcatcatcatagcaaacgtaacaaaccgg <210> 9 <211> 49 <212> DNA <213> 人工序列(Artificial Sequence) <400> 9 gttgtacttccaccgccgccacctttaccacgttcaatatcaatattgc <210> 10 <211> 46 <212> DNA <213> 人工序列(Artificial Sequence) <400> 10 atatacatgcaccatcatcatcatcatagcaaacgtaacaaaccgg <210> 11 <211> 57 <212> DNA <213> 人工序列(Artificial Sequence) <400> 11 gttaagtaatgttgtacttccaccgccgccaccctgaccacgttcaatatcaatgtt <210> 12 <211> 46 <212> DNA <213> 人工序列(Artificial Sequence) <400> 12 atatacatgcaccatcatcatcatcatagcaaacgtaacaaaccgg <210> 13 <211> 49 <212> DNA <213> 人工序列(Artificial Sequence) <400> 13 gttgtacttccaccgccgccacctttaccacgttcaatatcaatattgc <210> 14 <211> 42 <212> DNA <213> Artificial Sequence <400> 14 aaggagatataccatgacaacattacttaacccctattttgg <210> 15 <211> 45 <212> DNA <213> Artificial Sequence <400> 15 tcaatggtgatggtgatggtgtttaccacgttcaatatcaatgtt

Claims

1. A method for increasing tryptophan synthase activity by constructing a nucleic acid scaffold, characterized in that: The method for increasing the activity of tryptophan synthase by constructing a nucleic acid scaffold is as follows: connecting the fusion tag dCE gene and the tryptophan synthase gene in series, and fusing the tag dCE to the tryptophan synthase β subunit gene; The base sequence of the tryptophan synthase gene is SEQ ID NO: 1, which is derived from Escherichia coli; The base sequence of the dCE gene is SEQ ID NO: 2 or SEQ ID NO:

5.

2. The method for enhancing tryptophan synthase activity by constructing a nucleic acid scaffold according to claim 1, wherein: The method for increasing the activity of tryptophan synthase by constructing a nucleic acid scaffold comprises the following steps: Step 1: amplify the sequence containing tryptophan synthase and fusion tag; Step 2: cloning the amplified sequence into an expression vector to construct a recombinant vector; Step three: transform the recombinant vector into Escherichia coli to induce the target protein tryptophan synthase.

3. The method for enhancing tryptophan synthase activity by constructing a nucleic acid scaffold according to claim 2, wherein: The expression vector is a pET23a expression vector; The amplified sequence containing tryptophan synthase and a fusion tag also includes a purification tag sequence; The purification tag sequence is 6*HIS; The Escherichia coli expression strain is BL21 (DE3).

4. The method for enhancing tryptophan synthase activity by constructing a nucleic acid scaffold according to claim 2, wherein: The method for inducing Escherichia coli containing the recombinant vector to express the target protein is: Inoculate the transformant and culture at 37°C until OD 600 When the concentration of IPTG was 0.8, the cells were induced with 0.5-1 mM IPTG at 18°C ​​for 12-16 h.

5. An engineered Escherichia coli, characterized in that: The engineered Escherichia coli bacteria are based on the recombinant vector as claimed in claim 2 and the engineered Escherichia coli bacteria into which the recombinant vector is transferred.

6. A tryptophan synthase prepared by implementing the method for enhancing the activity of tryptophan synthase by constructing a nucleic acid scaffold as claimed in any one of claims 1 to 4.

7. Use of the tryptophan synthase according to claim 6 in the production of L-Trp, characterized in that: The application method of the tryptophan synthase in L-Trp production comprises: When preparing L-Trp, the substrates are L-Ser and indole, the optimal pH is 9.0, and the optimal reaction temperature is 50°C.

Citation Information

Patent Citations

  • Method for producing ethanol by fermenting cellulose with Pichia pastoris and application

    CN111662934A

  • Protein compound based on Escherichia coli E family DNA enzyme and application of protein compound in artificial protein scaffold

    CN113980141A