Antibodies that specifically bind cd47, recombinant oncolytic viruses thereof, and uses thereof

Abstract

The application provides an antibody or an antigen-binding fragment thereof capable of specifically binding to CD47. The application also provides a recombinant oncolytic virus, which is operatively inserted or comprises a gene coding sequence of an anti-CD47 antibody or a CD47 ligand. According to the application, the anti-CD47 antibody comprises an Fc mutant with A330L / I332E mutation (ALIE antibody), that is, the anti-CD47 antibody is alphaCD47-Fc (ALIE). The application provides a preparation method of the recombinant oncolytic virus. The application also provides a use of the recombinant oncolytic virus for preparing an anti-tumor drug. The application combines the gene therapy of tumors with the oncolytic effect, and prepares a vaccinia virus Tianlu strain capable of efficiently expressing an alphaCD47-Fc (ALIE) gene, thereby significantly improving the effect of tumor immunotherapy.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and relates to an antibody or antigen binding fragment capable of specifically binding to CD47. The present application also relates to a recombinant oncolytic virus, and provides a preparation method of the antibody or antigen binding fragment and the oncolytic virus and application thereof in anti-tumor. BACKGROUND

[0002] CD47 was first discovered as a tumor antigen of ovarian cancer in the 1980s, and since then, CD47 has been found to be expressed on a variety of human tumors, including acute myeloid leukemia (AML), chronic myeloid leukemia, acute lymphoblastic leukemia (ALL), non-Hodgkin's lymphoma (NHL), multiple myeloma (MM), bladder cancer and other solid tumors. CD47, also known as integrin-associated protein (IAP), is a transmembrane protein encoded by the CD47 gene in the human body. It belongs to the immunoglobulin superfamily and can interact with integrin, thrombospondin (TSP-1) and signal regulatory protein alpha (SIRPα). CD47, as a signal molecule that prevents phagocytosis by macrophages, is widely expressed in human cells and is overexpressed in a variety of different cancer cells, and has the potential to serve as a therapeutic target for some cancers.

[0003] SIRPα (signal regulatory protein alpha) is also a transmembrane protein mainly expressed on the surface of macrophages, dendritic cells and nerve cells. The high expression of CD47 on the surface of tumor cells releases a "don't eat me" signal by binding to SIRPα on the surface of macrophages, resulting in macrophages in the tumor tissue infiltration area not only coexisting with tumor cells, but also inhibiting the function of effector T cells by promoting tumor vascular proliferation, promoting tumor cell expansion and growth. Therefore, by blocking the inhibitory signal pathway transmitted by the binding of CD47 on the surface of tumor cells to SIRPα, the phagocytic function of macrophages on tumor cells is restored or enhanced, which can promote macrophage-mediated cellular immune response, thereby providing a new theory and method for tumor immunotherapy.

[0004] In recent years, various therapeutic approaches targeting the CD47 / SIRPa signaling pathway have been extensively studied, such as anti-CD47 antibodies, anti-SIRPa antibodies, recombinant SIRPa proteins, and bispecific antibodies. Among them, CD47-blocking antibodies are considered the most promising tumor treatment. The effectiveness of human CD47-blocking monoclonal antibodies has been confirmed in various preclinical models, such as lymphoma, bladder cancer, colon cancer, glioblastoma, breast cancer, acute lymphoblastic leukemia, and acute myeloid leukemia. Related studies have also confirmed that the use of anti-CD47 monoclonal antibodies can effectively bind to CD47 proteins highly expressed on the surface of tumor cells in vivo, effectively relieve the inhibition of immune cells by tumor cells, restore the function of immune cells in the body, and achieve the effect of inhibiting tumor growth.

[0005] Since the discovery of CD47 as a new generation of tumor immunotherapy target, drug development targeting this target has never stopped. However, in the development of CD47-targeted drugs, CD47 antibodies can easily cause significant anemia, hyperbilirubinemia, and thrombocytopenia, and other side effects, which has caused many studies to hit a brick wall and stopped related research experiments. This is because CD47 is also widely expressed on the surface of red blood cells, and the combination of CD47 antibody drugs or SIRPa-Fc fusion proteins with red blood cells causes red blood cell agglutination and then causes red blood cell rupture; at the same time, the Fc segment-mediated cytotoxicity further causes red blood cell lysis, ultimately leading to anemia. In addition to the obvious side effects of anemia, CD47 antibodies still have problems in antibody affinity, immunogenicity, anti-tumor effect, and other aspects, therefore, the development of a better candidate antibody for this target is urgently needed.

[0006] In recent years, oncolytic virus therapy for tumors has gained great attention in the field. Because oncolytic viruses themselves or after genetic modification have good targeting to tumors, they can infect and lyse tumor cells locally. In addition, oncolytic viruses can act on multiple cellular pathways to reduce tumor resistance and induce different forms of cell death. At the same time, it breaks the immune tolerance of the tumor microenvironment and induces long-term tumor-specific immune responses. With the help of oncolytic viruses, CD47 antibody proteins are transported to tumor tissues to exert the anti-tumor biological effects of CD47 antibodies, which can effectively avoid the risk of anemia caused by the combination of CD47 antibodies with peripheral red blood cells, increasing the safety of tumor immunotherapy. It can also combine with oncolytic viruses to exert multiple anti-tumor effects, thereby significantly improving the effectiveness of tumor immunotherapy.

[0007] Research on oncolytic viruses for tumor treatment has received great attention in the field. Its advantages are: oncolytic viruses can kill tumor cells through multiple mechanisms to reduce tumor resistance; they can play an immunomodulatory role to break the immune tolerance of the tumor microenvironment and induce a long-term tumor-specific immune response; and they can transport therapeutic proteins into tumor tissues and increase their expression level in malignant tumor cells as the virus replicates.

[0008] Clinical research and treatment with oncolytic viruses experienced a brief surge in the 1950s and 1970s. Initially, wild-type oncolytic viruses were used. While clinical trials showed some anti-tumor effects, they also induced excessively strong immune responses and complications, leading to a near-complete halt in oncolytic virus research. The development of genetic engineering technology in the 1990s accelerated the genetic modification and optimization of oncolytic viruses, greatly improving the specificity, efficacy, and safety of oncolytic virus therapy for tumors, and this therapy once again gained widespread attention from researchers. Currently, the main types of oncolytic viruses include adenovirus, herpes simplex virus-1, Newcastle disease virus, measles virus, reovirus, and vaccinia virus, among which adenovirus, herpes simplex virus, and vaccinia virus are the most widely used in clinical practice.

[0009] In 2006, oncolytic adenovirus product (oncorine) was used clinically in China for the treatment of nasopharyngeal carcinoma and other cancers. This oncolytic virus deletes the E1B-55kD gene of human adenovirus type 5, allowing it to replicate and proliferate in cancer cells with p53 gene mutations and kill host cells, thus producing an oncolytic therapeutic effect. Simultaneously, the deletion of the E3 region allows tumor antigen information to be transmitted through dendritic cells, activating T-cell immunity. However, clinical data show that compared to radiotherapy, the therapeutic effect of oncolytic virus oncorine combined with chemotherapy is weaker for nasopharyngeal carcinoma patients.

[0010] In 2015, Amgen's oncolytic herpes simplex virus (talimogene laherparepvec, T-VEC) received FDA approval in the United States for the treatment of melanoma. In December of the same year, it also received EU approval for the local treatment of unresectable skin, subcutaneous, and lymph node lesions in patients with recurrent melanoma after initial surgery. Clinical research results for T-VEC have greatly advanced the development of oncolytic viruses in the field of cancer treatment. However, intratumoral administration limits the types of tumors that can be treated, only applicable to tumors close to the body surface that are easy to operate on. For many non-superficial solid tumors and metastatic tumors, there are difficulties in administration and incomplete treatment. If intravenous administration can be proven to have good cancer treatment effects, its clinical application value will be greatly enhanced. Due to the limitations of the oncolytic activity of herpesvirus itself, it is not completely effective in clearing large and / or metastatic tumors, so it is necessary to combine it with other treatment methods to enhance its anti-tumor effect.

[0011] Vaccinia virus (VV) has a relatively clear biological profile and pathogenic mechanism, playing a crucial role in the eradication of smallpox, and its safety in humans has been fully demonstrated. Based on pathogenicity, host range, and other characteristics, vaccinia viruses can be classified into WR (Western reserve) strains, Wyeth strains, Copenhagen strains, Lister strains, and TianTan strains. Due to its broad host range, high conservation, good safety, and large capacity for exogenous genes, vaccinia virus is used as a vector for multiple recombinant vaccines, including influenza virus and human immunodeficiency virus. As for oncolytic viruses, most are currently in the preclinical research stage, with only a few entering clinical trials.

[0012] Research on using vaccinia virus as an oncolytic virus for tumor treatment is currently most advanced, with Pexa-Vec (JX-594) developed by Jennerex in the United States. JX-594 is based on the Wyeth strain virus, with the hGM-CSF and LacZ genes inserted into the TK region. Due to the absence of the thymkinase gene, JX-594 can be expressed and replicated in cancer cells that highly express thymkinase, but without affecting normal cells. Simultaneously, because of the inserted GM-CSF gene, JX-594 can express GM-CSF in tumor cells, activating the body's anti-tumor immune response. Clinical trials of JX-594 on various tumor types have demonstrated good tolerability, whether administered intratumorally or intravenously. The combination of Pexa-Vec and sorafenib showed better efficacy than the monotherapy group. Interim analysis results indicate that its potential to prolong patient survival is not high. Originally planned for market launch in 2020, Pexa-Vec's Phase III clinical trial was terminated early.

[0013] GL-ONC1 (also known as GLV-1h68), an oncolytic virus developed by Genelux, Inc. in the United States, is based on vaccinia virus (Lister strain). The F14.5L, TK (encoding thymidine kinase), and HA (encoding hemagglutinin) genes were deleted to enhance tumor targeting. Furthermore, luciferase-GFP fusion protein, β-galactosidase, and β-glucuronidase were inserted for vaccinia virus screening and production. A completed Phase I clinical trial of GL-ONC1 via intravenous administration showed good safety and efficacy, with no dose-limiting toxicities, no reaching the maximum tolerated dose, and all patients exhibiting neutralization responses to GL-ONC1. GL-ONC1 is currently undergoing a scale-up trial for intravenous administration.

[0014] Clinical trial evidence suggests that vaccinia virus has shown initial advantages in cancer treatment. Most existing oncolytic virus designs utilizing vaccinia virus have high safety profiles, but their clinical efficacy requires further observation. However, further optimization is needed in terms of immune modulation and precise tumor targeting. How to utilize oncolytic viruses to reconstruct the tumor microenvironment, enhance the immune response, and increase the killing power against tumor cells, thus achieving monotherapy with oncolytic viruses, remains a pressing issue in oncolytic virus development. Maximizing the effectiveness of the CD47 target in killing tumor cells while minimizing damage to erythrocytes has always been a key challenge in developing CD47-targeted drugs. Existing strategies include screening for SIRPα molecules that bind only to CD47 on the surface of tumor cells, such as the Fc fusion protein drug IMM01. The IgG1 antibody, screened by Yiming Onco and completely non-binding to human erythrocytes, was approved for clinical trials in China in May 2019 for the treatment of hematological malignancies and is currently underway.

[0015] Another strategy is to replace the IgG1 Fc segment with the IgG4 Fc segment, such as the antibody drug Hu5F9-G4. This strategy, employing low-dose induction followed by effective-dose maintenance combined with rituximab, reduces the side effect of anemia and has shown good efficacy in clinical studies of patients with aggressive and indolent lymphoma. However, the risk of anemia caused by the binding of CD47 antibodies to CD47 on the surface of erythrocytes in peripheral blood remains, and Hu5F9-G4 alone has minimal effect.

[0016] Directly delivering CD47 antibodies to tumor cells via viral vectors may prevent anemia. Studies have explored constructing recombinant vaccinia virus-expressed CD47 antibody-conjugated single-chain antibodies (scFv) to recognize the CD47 antigen on tumor cells, thereby achieving a more precise oncolytic effect. Simultaneously, the blocking effect of CD47 enhances the phagocytic activity of macrophages against tumors. Clinical studies have shown that recombinant oncolytic vaccinia virus (OVVscFvCD47) exhibits good anti-lymphoma effects. Since the prerequisite for highly effective anti-tumor effects of CD47-targeting antibody drugs is the full activation of macrophages, two basic conditions must be met: 1) blocking the interaction between CD47 and SIRPα-Fc to remove the inhibitory signal; 2) binding of the Fc terminus of antibody IgG1 to the Fcγ receptor on the macrophage membrane surface, leading to a conformational change in the macrophage membrane cytoskeleton to increase phagocytic activity. Otherwise, macrophages can only be partially activated. Furthermore, due to the absence of the Fc segment and therefore lack of ADCC activity, monotherapy with scFv is unlikely to yield good therapeutic results and must be used in combination with other antibody drugs. In particular, the short in vivo half-life of scFv significantly weakens its anti-tumor effect.

[0017] Based on the above, there is no CD47 antibody in the existing technology that is particularly suitable for recombinant oncolytic viruses. There is currently a demand for CD47 antibodies with better tumor cell killing power and oncolytic viruses that can be used alone. Summary of the Invention

[0018] Therefore, the purpose of this invention is to address the shortcomings of existing technologies by providing an antibody that specifically binds to CD47. The anti-CD47 antibody provided by this invention exhibits high specificity, high affinity, low immunogenicity, and good stability, making it suitable for cancer prevention or treatment and possessing broad application prospects. This invention also provides a novel recombinant oncolytic virus. This oncolytic virus contains the gene coding sequence of an anti-CD47 antibody or a CD47 ligand, enabling it to replicate extensively within tumor cells and ultimately destroy them. Specifically, the recombinant oncolytic virus provided by this invention contains the gene coding sequence of an anti-CD47 antibody. The gene sequence of this anti-CD47 antibody contains a mutated Fc segment, exhibiting high cytotoxic activity. Utilizing antibody-mediated strong ADCC, it can significantly enhance the anti-tumor effect.

[0019] The objective of this invention is achieved through the following technical solution:

[0020] On one hand, the present invention provides an antibody or antigen-binding fragment thereof capable of specifically binding to CD47, said antibody or antigen-binding fragment comprising:

[0021] (a) Heavy chain variable regions containing the following three complementary determinant regions:

[0022] (i) VH CDR1, which consists of the following sequence: SEQ ID NO:17, or a sequence having one or more amino acid substitutions, deletions, or additions compared to it.

[0023] (ii) VH CDR2, which consists of the following sequence: SEQ ID NO:18, or a sequence having one or more amino acid substitutions, deletions, or additions compared to it, and

[0024] (iii) VH CDR3, which consists of the following sequence: SEQ ID NO:19, or a sequence having one or more amino acid substitutions, deletions or additions compared to it;

[0025] and / or

[0026] (b) Light chain variable regions containing the following three complementary determinant regions:

[0027] (iv) VL CDR1, which consists of the following sequence: any one of SEQ ID NO:11, SEQ ID NO:14 or SEQ ID NO:22, or a sequence having one or more amino acid substitutions, deletions or additions compared to it.

[0028] (v)VL CDR2, which consists of the following sequence: any one of SEQ ID NO:12, SEQ ID NO:15, or SEQ ID NO:23, or a sequence having one or more amino acid substitutions, deletions, or additions compared to it, and

[0029] (vi)VL CDR3, which consists of the following sequence: any one of SEQ ID NO:13, SEQ ID NO:16 or SEQ ID NO:24, or a sequence having one or more amino acid substitutions, deletions or additions compared to it;

[0030] Preferably, the substitution described in any one of (i)-(vi) is a conservative substitution;

[0031] Preferably, the VH of the antibody or its antigen-binding fragment comprises: VH CDR1 as shown in SEQ ID NO:17, VH CDR2 as shown in SEQ ID NO:18, and VH CDR3 as shown in SEQ ID NO:19; and the VL of the antibody or its antigen-binding fragment comprises: VL CDR1 as shown in SEQ ID NO:11, VL CDR2 as shown in SEQ ID NO:12, and VL CDR3 as shown in SEQ ID NO:13; or the VL of the antibody or its antigen-binding fragment comprises: VL CDR1 as shown in SEQ ID NO:14, VL CDR2 as shown in SEQ ID NO:15, and VL CDR3 as shown in SEQ ID NO:16; or the VL of the antibody or its antigen-binding fragment comprises: VL CDR1 as shown in SEQ ID NO:22, VL CDR2 as shown in SEQ ID NO:23, and VL CDR3 as shown in SEQ ID NO:24.

[0032] This invention provides an antibody or antigen-binding fragment thereof capable of specifically binding to CD47, wherein the antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein,

[0033] The heavy chain variable region includes the three CDRs contained in the heavy chain variable region shown in SEQ ID NO:9; and the light chain variable region includes the three CDRs contained in the light chain variable region shown in SEQ ID NO:5, 7 or 25.

[0034] Preferably, the three CDRs contained in the heavy chain variable region and / or the three CDRs contained in the light chain variable region are defined by the Kabat, Chothia or IMGT numbering system.

[0035] The antibody or antigen-binding fragment thereof according to the present invention, wherein the antibody or antigen-binding fragment thereof comprises:

[0036] (a) Heavy chain variable region, which contains an amino acid sequence selected from the following:

[0037] (i) The sequence shown in SEQ ID NO:9;

[0038] (ii) A sequence having one or more amino acid substitutions, deletions, or additions compared to the sequence shown in SEQ ID NO:9; or

[0039] (iii) A sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the sequence shown in SEQ ID NO:9;

[0040] And / or,

[0041] (b) Light chain variable region, which contains an amino acid sequence selected from the following:

[0042] (iv) The sequence shown in any one of SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:25;

[0043] (v) A sequence having one or more amino acid substitutions, deletions, or additions compared to the sequence shown in any of SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:25; or

[0044] (vi) A sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with any of the sequences shown in SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:25;

[0045] Preferably, the substitution described in (ii) or (v) is a conservative substitution;

[0046] Preferably, the antibody or its antigen-binding fragment comprises: a VH having a sequence as shown in SEQ ID NO:9 and a VL having a sequence as shown in any one of SEQ ID NO:5, 7 or 25.

[0047] The antibody or antigen-binding fragment thereof according to the present invention, wherein the antibody or antigen-binding fragment thereof further comprises:

[0048] (a) The heavy chain constant region of a human immunoglobulin or a variant thereof, said variant having one or more amino acid substitutions, deletions, or additions compared to the sequence from which it is derived; and

[0049] (b) The light chain constant region of a human immunoglobulin or a variant thereof, the variant having a conserved substitution of up to 20 amino acids compared to the sequence from which it is derived;

[0050] Preferably, the heavy chain constant region is the IgG heavy chain constant region, more preferably the IgG1, IgG2, IgG3 or IgG4 heavy chain constant region, and even more preferably, it is the human IgG1 or human IgG4 heavy chain constant region.

[0051] Preferably, the light chain constant region is the κ light chain constant region.

[0052] According to the present invention, the antibody or its antigen-binding fragment is selected from Fab, Fab', (Fab')2, Fv, disulfide-linked Fv, scFv, bispecific antibodies and single-domain antibodies; and / or, the antibody is a murine antibody, a chimeric antibody, a humanized antibody, a bispecific antibody or a multispecific antibody; more preferably, the antibody is a fully human antibody.

[0053] On the other hand, the present invention provides a chimeric antigen receptor T cell comprising the antibody or antigen-binding fragment thereof described in the present invention;

[0054] Preferably, the heavy chain variable region and the light chain variable region in the antibody or its antigen-binding fragment are in a tandem combination or a parallel combination.

[0055] The present invention also provides an isolated nucleic acid molecule that encodes an antibody or antigen-binding fragment thereof capable of specifically binding to CD47, or a variable region of the heavy chain and / or a variable region of the light chain thereof.

[0056] Preferably, the nucleic acid molecule comprises the nucleic acid sequence shown in any one of SEQ ID NO: 6, 8, 10 or 26.

[0057] The present invention also provides a carrier comprising the isolated nucleic acid molecules described herein;

[0058] Preferably, the vector is a cloning vector or an expression vector;

[0059] More preferably, the vector is a virus;

[0060] More preferably, the vector is a cloning vector AbVec-hIgKappa or a cloning vector AbVec-hIgG1.

[0061] The present invention also provides a host cell comprising the isolated nucleic acid molecule or the vector described herein;

[0062] Preferably, the host cell is prokaryotic or eukaryotic; more preferably, the host cell is selected from Escherichia coli cells, yeast cells, mammalian cells, or other cells suitable for preparing antibodies or antigen-binding fragments, multispecific antibodies; even more preferably, the host cell is a mammalian cell; even more preferably, the host cell is a human, mouse, sheep, horse, dog, or cat cell; most preferably, the host cell is a 293 cell or a CHO cell.

[0063] In another aspect, the present invention provides a method for preparing the antibody or antigen-binding fragment thereof described herein, comprising culturing the host cells under conditions that allow expression of the antibody or antigen-binding fragment thereof described herein, and recovering the antibody or antigen-binding fragment thereof from the cultured host cell culture.

[0064] In another aspect, the present invention provides bispecific or multispecific molecules comprising the antibodies or antigen-binding fragments described herein;

[0065] Preferably, the bispecific or multispecific molecule specifically binds to CD47 and additionally specifically binds to one or more other targets;

[0066] Preferably, the bispecific or multispecific molecule further comprises at least one molecule (e.g., a second antibody) having a second binding specificity against a second target;

[0067] Preferably, the bispecific or multispecific molecule further comprises other antibodies or antigen-binding fragments that specifically bind to the CD47 epitope.

[0068] In another aspect, the present invention provides an immune conjugate comprising the antibody or antigen-binding fragment thereof described in the present invention and a therapeutic agent attached to the antibody or antigen-binding fragment thereof;

[0069] Preferably, the therapeutic agent is selected from cytotoxic agents;

[0070] Preferably, the therapeutic agent is selected from alkylating agents, mitotic inhibitors, antitumor antibiotics, antimetabolites, topoisomerase inhibitors, tyrosine kinase inhibitors, radioactive nuclides, and any combination thereof;

[0071] Preferably, the immunoconjugate is an antibody-drug conjugate (ADC).

[0072] In another aspect, the present invention provides a pharmaceutical composition comprising the antibody or antigen-binding fragment thereof, a bispecific or multispecific molecule or an immunoconjugate as described in the present invention, and a pharmaceutically acceptable carrier and / or excipient.

[0073] Preferably, the pharmaceutical composition further comprises additional pharmaceutically active agents;

[0074] Preferably, the other pharmaceutically active agent is a drug with antitumor activity, such as an alkylating agent, mitotic inhibitor, antitumor antibiotic, antimetabolite, topoisomerase inhibitor, tyrosine kinase inhibitor, radionuclide agent, radiosensitizer, antiangiogenic agent, cytokine, molecularly targeted drug, immune checkpoint inhibitor, or oncolytic virus.

[0075] Preferably, the antibody or its antigen-binding fragment, bispecific or multispecific molecule or immunoconjugate is provided as a separate component or as a component of the same composition with the additional pharmaceutically active agent.

[0076] In another aspect, the present invention provides a kit containing the antibody or antigen-binding fragment thereof described in the present invention;

[0077] Preferably, the antibody or its antigen-binding fragment carries a detectable label, such as an enzyme (e.g., horseradish peroxidase), a radionuclide, a fluorescent dye, a luminescent substance (e.g., a chemiluminescent substance), or biotin.

[0078] Preferably, the kit further includes a second antibody that specifically recognizes the antibody or its antigen-binding fragment described in this invention;

[0079] Preferably, the second antibody further includes a detectable label, such as an enzyme (e.g., horseradish peroxidase), a radionuclide, a fluorescent dye, a luminescent substance (e.g., a chemiluminescent substance), or biotin.

[0080] In another aspect, the present invention provides a chimeric antigen receptor comprising the antigen-binding domain of the antibody or its antigen-binding fragment described in the present invention;

[0081] Preferably, the antigen-binding domain comprises the heavy chain variable region and the light chain variable region of the antibody or its antigen-binding fragment described in this invention;

[0082] Preferably, the antigen-binding domain is scFv;

[0083] Preferably, the antigen-binding receptor comprises the antigen-binding fragment of the antibody described in this invention;

[0084] Preferably, the antigen-binding receptor is expressed by immune effector cells (e.g., T cells).

[0085] In another aspect, the present invention provides an isolated nucleic acid molecule that encodes the chimeric antigen receptor.

[0086] In another aspect, the present invention provides a carrier comprising an isolated nucleic acid molecule encoding the chimeric antigen receptor; preferably, it is used to prepare chimeric antigen receptor T cells.

[0087] In another aspect, the present invention provides a host cell comprising an isolated nucleic acid molecule or vector encoding the chimeric antigen receptor described above;

[0088] Preferably, the host cell is an immune effector cell (e.g., a T cell or an NK cell);

[0089] Preferably, the host cell is a chimeric antigen receptor T cell (CAR-T).

[0090] The present invention also provides a method for inhibiting tumor cell growth and / or killing said tumor cells, comprising contacting said tumor cells with an effective amount of the antibody or antigen-binding fragment thereof described in the present invention, or a bispecific or multispecific molecule, or an immune conjugate, or a pharmaceutical composition, or a chimeric antigen receptor, or a host cell.

[0091] The present invention also provides a method for preventing and / or treating tumors in a subject (e.g., a human), the method comprising administering to a subject in need an effective amount of an antibody or antigen-binding fragment thereof described in the present invention, or a bispecific or multispecific molecule, or an immune conjugate, or a pharmaceutical composition, or a chimeric antigen receptor, or a host cell;

[0092] Preferably, the tumor is selected from B-cell lymphoma, T-cell lymphoma, melanoma, prostate cancer, renal cell carcinoma, sarcoma, glioma such as high-grade glioma, blastoma such as neuroblastoma, osteosarcoma, plasmacytoma, histiocytoma, pancreatic cancer, breast cancer, lung cancer such as small cell lung cancer and non-small cell lung cancer, gastric cancer, liver cancer, colon cancer, rectal cancer, esophageal cancer, colorectal cancer, hematopoietic system cancer, testicular cancer, cervical cancer, ovarian cancer, bladder cancer, squamous cell carcinoma, adenocarcinoma, AIDS-related lymphoma, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, head and neck squamous cell carcinoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, or hematologic malignancies.

[0093] Preferably, the subject is a mammal, such as a human;

[0094] Preferably, the method further includes administering additional drugs with antitumor activity, such as alkylating agents, mitotic inhibitors, antitumor antibiotics, antimetabolites, topoisomerase inhibitors, tyrosine kinase inhibitors, radioactive nuclides, radiosensitizers, antiangiogenic agents, cytokines, molecularly targeted drugs, immune checkpoint inhibitors, or oncolytic viruses.

[0095] Preferably, the method further includes administering additional antitumor therapies, such as surgery, chemotherapy, radiotherapy, targeted therapy, immunotherapy, hormone therapy, gene therapy, or palliative therapy.

[0096] The present invention also provides the use of the antibody or antigen-binding fragment thereof, or bispecific or multispecific molecule, or immune conjugate, or pharmaceutical composition, or chimeric antigen receptor, or host cell described herein, in the preparation of a medicament for the prevention and / or treatment of tumors in a subject (e.g., a human).

[0097] Preferably, the drug further comprises additional pharmaceutically active agents;

[0098] Preferably, the other pharmaceutically active agent is a drug with antitumor activity, such as an alkylating agent, mitotic inhibitor, antitumor antibiotic, antimetabolite, topoisomerase inhibitor, tyrosine kinase inhibitor, radionuclide agent, radiosensitizer, antiangiogenic agent, cytokine, molecularly targeted drug, immune checkpoint inhibitor, or oncolytic virus.

[0099] Preferably, the tumor is selected from B-cell lymphoma, T-cell lymphoma, melanoma, prostate cancer, renal cell carcinoma, sarcoma, glioma such as high-grade glioma, blastoma such as neuroblastoma, osteosarcoma, plasmacytoma, histiocytoma, pancreatic cancer, breast cancer, lung cancer such as small cell lung cancer and non-small cell lung cancer, gastric cancer, liver cancer, colon cancer, rectal cancer, esophageal cancer, colorectal cancer, hematopoietic system cancer, testicular cancer, cervical cancer, ovarian cancer, bladder cancer, squamous cell carcinoma, adenocarcinoma, AIDS-related lymphoma, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, head and neck squamous cell carcinoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, or hematologic malignancies.

[0100] Preferably, the subject is a mammal, such as a human.

[0101] On the other hand, the present invention provides a recombinant oncolytic virus, wherein the oncolytic virus is operatively inserted into or contains a gene coding sequence of an anti-CD47 antibody or a CD47 ligand.

[0102] Preferably, the gene coding sequence is located in the thymidine kinase (TK) region of the recombinant oncolytic virus.

[0103] Preferably, the gene coding sequence of the anti-CD47 antibody or CD47 ligand can be expressed alone or fused with other genes or fragments; more preferably, other genes or fragments used for fusion expression include, but are not limited to, one or more of the following: Fc fragment, chemokines CXCL9, CXCL10, CXCL11, CXCL12, CCL20 or CX3CL1, or cholera toxin CTA or CTB.

[0104] Preferably, the recombinant oncolytic virus further comprises gene coding sequences of other immunomodulatory factors; more preferably, the other immunomodulatory factors include, but are not limited to, IL-1, IL-2, IL-3, IL-7, IL-11, IL-12, IL-15, IL-17, IL-18, IL-21, IL-33, IL-35, IL-37, GM-CSF, IFN-α, IFN-β, IFN-γ, anti-PD-1 / PD-L1 antibody, anti-CTLA-4 antibody, anti-Lag-3 antibody, anti-TIGIT antibody, or anti-Tim-3 antibody; or

[0105] The recombinant oncolytic virus also contains gene coding sequences for proteins associated with apoptosis and pyroptosis, including but not limited to apoptosis-associated factor 1 (Apaf-1), interleukin-1β converting enzyme (ICE), Bcl-2 protein, Fas / APO-1, p53, myc, ataxia-telangiectasia mutant gene (ATM), gasdermin D, and gasdermin E; or

[0106] The recombinant oncolytic virus also contains small RNAs of immunomodulatory genes, apoptosis genes, and pyroptosis genes.

[0107] According to the recombinant oncolytic virus of the present invention, the anti-CD47 antibody comprises the above-mentioned antibody or its antigen-binding fragment; preferably, the anti-CD47 antibody comprises an Fc mutant (ALIE antibody) with an A330L / I332E mutation, that is, the anti-CD47 antibody is αCD47-Fc (ALIE).

[0108] According to the recombinant oncolytic virus of the present invention, the anti-CD47 antibody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence described in SEQ ID NO:2.

[0109] Preferably, the amino acid sequence of the anti-CD47 antibody is shown in SEQ ID NO:2.

[0110] According to the recombinant oncolytic virus of the present invention, the oncolytic virus comprises a gene coding sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence described in SEQ ID NO:1.

[0111] Preferably, the oncolytic virus comprises a gene coding sequence as shown in SEQ ID NO:1;

[0112] According to the recombinant oncolytic virus of the present invention, wherein the CD47 ligand is a SIRPα extracellular domain, a functional fragment thereof, or a variant thereof;

[0113] Preferably, the antiCD47 ligand has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence described in SEQ ID NO:4.

[0114] Preferably, the amino acid sequence of the anti-CD47 ligand is shown in SEQ ID NO:4.

[0115] According to the recombinant oncolytic virus of the present invention, the oncolytic virus comprises a gene coding sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence described in SEQ ID NO:3.

[0116] Preferably, the oncolytic virus contains a gene coding sequence as shown in SEQ ID NO:3.

[0117] According to the recombinant oncolytic virus of the present invention, the viral backbone of the oncolytic virus is derived from modified or engineered vaccinia virus strains such as Tian Tan, New York, Copenhagen, Canary, and Ankara, adenovirus, adeno-associated virus, herpes simplex virus, varicella-zoster virus (VZV), respiratory syncytial virus (RSV), and Semliki forest virus. Virus (SFV), Epstein-Barr virus, Cytomegalovirus, Human Herpesvirus 6, Smallpox virus, Vaccine virus, Molluscum contagiosum virus, Sheep stomatitis virus, Reovirus, Rotavirus, Enterovirus, Seneca virus, Poliovirus, Coxsackie virus, Rhinovirus, Hepatitis A virus, Foot-and-mouth disease virus, Clonorchisin virus, A virus, Semleeki Forest virus, Eastern equine encephalitis virus, Sindbis virus, Rubella virus, Coronavirus, Flavivirosis virus, Hepatitis C virus, Japanese encephalitis virus, St. Louis encephalitis virus, Murray Valley fever virus, Yellow fever virus, West Nile virus, Zika virus, Dengue virus, Ebola virus, Horse Irburgh virus, Arena virus, Lassa fever virus, Lymphocytic choriomeningitis virus, Pichend virus, Junin virus, Machupo virus, Hantavirus, Rift Valley fever virus, Paramyxovirus, Human parainfluenza virus, Mumps virus, Simian virus 5, Measles virus, Vesicular stomatitis virus, Rabies virus, Orthomyxovirus, Influenza A virus, Influenza B virus, Influenza C virus, Hepatitis D virus, Simian immunodeficiency virus, Human immunodeficiency virus type 1 and Human immunodeficiency virus type 2, Raul's sarcoma virus, Human T-cell leukemia virus type 1, Simian foam virus, Hepatitis B virus, Hepatitis E virus, Human papillomavirus or polyomavirus.

[0118] Preferably, the oncolytic virus backbone is an intracellular mature virus, an intracellular packaged virus, a cell-associated packaged virus, or an extracellular packaged virus.

[0119] According to the recombinant oncolytic virus of the present invention, the oncolytic virus is a recombinant vaccinia virus strain Tiantan containing the gene coding sequence shown in SEQ ID NO:1, named rTV-αCD47-Fc(ALIE), with accession number CCTCC NO:V202080, accession date of January 2, 2021, and accession address of China Center for Type Culture Collection.

[0120] Furthermore, the present invention provides a method for preparing the recombinant oncolytic virus, comprising the following steps:

[0121] 1) Synthesize gene coding sequences containing anti-CD47 antibodies or CD47 ligands;

[0122] 2) The coding sequence obtained in step 1) is cloned into the shuttle plasmid of oncolytic virus to construct a recombinant plasmid vector;

[0123] 3) Transfect the recombinant plasmid vector obtained in step 2) into the oncolytic virus, and obtain the recombinant oncolytic virus by screening.

[0124] Optionally, the recombinant oncolytic virus obtained is cultured.

[0125] In one specific embodiment, the present invention provides a method for preparing recombinant vaccinia virus strain Tian Tan strain, comprising the following steps:

[0126] 1) Synthesize the human gene αCD47-Fc(ALIE), the sequence of which is shown in SEQ ID NO: 1;

[0127] Or it may contain a nucleic acid sequence shown in any of SEQ ID NO:6, 8, 10 or 26;

[0128] Alternatively, the human gene SIRPα-Fc(ALIE) can be synthesized, the sequence of which is shown in SEQ ID NO: 3;

[0129] 2) Subclone the synthesized αCD47-Fc(ALIE) gene or SIRPα-Fc(ALIE) gene into the TK region of the vaccinia virus shuttle plasmid (pSC65) to construct the recombinant plasmid pSC65-αCD47-Fc(ALIE) or pSC65-SIRPα-Fc(ALIE).

[0130] 3) Using homologous recombination, the pSC65-αCD47-Fc(ALIE) plasmid or the pSC65-SIRPα-Fc(ALIE) plasmid was transfected into TK143 cells already infected with wild-type vaccinia virus. - In cells, homologous recombination of the two is performed to produce recombinant vaccinia virus rTV-αCD47-Fc(ALIE) or rTV-SIRPα-Fc(ALIE); after screening, recombinant oncolytic vaccinia virus containing the coding sequence of pSC65-αCD47-Fc(ALIE) shown in SEQ ID NO: 1 in the TK region or recombinant oncolytic vaccinia virus containing the coding sequence of pSC65-SIRPα-Fc(ALIE) shown in SEQ ID NO: 3 in the TK region is obtained.

[0131] The αCD47-Fc(ALIE) gene or the SIRPα-Fc(ALIE) gene is controlled by the early / late promoter p7.5 of vaccinia virus.

[0132] Preferably, the specific steps for amplifying recombinant vaccinia virus using VERO cells include: culturing VERO cells to a density close to 100%, replacing the medium with a low concentration of fetal bovine serum, adding oncolytic vaccinia virus (inoculation amount of approximately 0.02 MOI), incubating at 37°C for 48 hours, collecting the virus solution and repeatedly freezing and thawing twice, purifying it by density gradient centrifugation with 36% sucrose solution, and storing it at -80°C.

[0133] Furthermore, the present invention also provides the use of the recombinant oncolytic virus in the preparation of antitumor drugs; wherein the tumor is selected from B-cell lymphoma, T-cell lymphoma, melanoma, prostate cancer, renal cell carcinoma, sarcoma, glioma such as high-grade glioma, blastoma such as neuroblastoma, osteosarcoma, plasmacytoma, histiocytoma, pancreatic cancer, breast cancer, lung cancer such as small cell lung cancer and non-small cell lung cancer, gastric cancer, liver cancer, colon cancer, rectal cancer, esophageal cancer, colorectal cancer, hematopoietic system cancer, testicular cancer, cervical cancer, ovarian cancer, bladder cancer, squamous cell carcinoma, adenocarcinoma, AIDS-related lymphoma, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, head and neck squamous cell carcinoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, or hematologic malignancies.

[0134] On the other hand, the present invention provides a method for treating tumors, the method comprising administering a therapeutically effective amount of recombinant oncolytic virus to a subject in need. According to the method of the present invention, the method further comprises administering additional chemotherapy drugs, radiotherapy, surgical treatment, immunotherapy drugs (including but not limited to CAR-T, NK, NKT, iNKT, CAR-NK, CAR-NKT, CAR-iNKT, etc.), or other oncolytic viruses to the subject in need; preferably, the method is intravenous injection or intratumoral injection.

[0135] The inventive concept of this invention is as follows: The inventors obtained 25 novel CD47-targeting antibodies by screening a natural phage antibody library; further purified and expressed the example antibodies Hu004-65, Hu004-66, Hu004-67, Hu004-68, Hu004-69, Hu004-73, Hu004-74, Hu004-91, Hu004-100, and Hu004-101; and identified the in vitro biological functions of these antibodies. The inventors unexpectedly discovered that Hu004-65 and Hu001-101 exhibited good biological effects, recognizing human CD47 protein with an affinity of 1.46 × 10⁻⁶. -7 M and 3.20×10 -7M. Furthermore, the inventors discovered that antibodies Hu004-65 and Hu004-101 have different recognition epitopes from the control antibody, can effectively recognize and bind to human and mouse CD47, and have good broad-spectrum in vitro anti-tumor efficacy. They can be used to prepare CAR-T therapy for diseases with high CD47 expression or to form conjugates with cytotoxic drugs, radioactive isotopes, drug-metabolizing enzymes, and other anti-tumor drugs, showing great promise.

[0136] Furthermore, the inventors of this invention combined tumor gene therapy with oncolytic effects to prepare a vaccinia virus strain Tian Tan strain oncolytic virus that can efficiently express the αCD47-Fc(ALIE) gene or the SIRPα-Fc(ALIE) gene. When the oncolytic virus is administered to tumor lesions, it expresses CD47 antibodies while simultaneously lysing tumor cells to exert an oncolytic effect, thereby blocking the binding of CD47 to SIRPα, relieving the inhibitory effect of tumor cells on macrophages, and enhancing the phagocytic function of macrophages against tumor cells. Simultaneously, the anti-tumor effect is enhanced by utilizing CD47 antibody-mediated ADCC. Compared to simple antibody therapy or viral therapy, this oncolytic virus significantly enhances the inhibitory ability against malignant tumors, thus significantly improving the efficacy of tumor immunotherapy. At the same time, it effectively avoids the risk of anemia caused by the binding of CD47 antibodies to peripheral blood erythrocytes, increasing the safety of tumor immunotherapy.

[0137] The beneficial effects of this invention are:

[0138] 1. The antibodies Hu004-65 and Hu004-101 provided by this invention have different recognition epitopes from the control antibody, can effectively recognize and bind to human and mouse CD47, and have good in vitro broad-spectrum anti-tumor efficacy. They can be used to prepare CAR-T therapy for diseases with high CD47 expression or to form anti-tumor drugs such as conjugates with cytotoxic drugs, radioactive isotopes, and drug-metabolizing enzymes, and have very good prospects.

[0139] 2. The recombinant oncolytic virus provided by this invention combines tumor gene therapy with oncolytic effects. Specifically, this invention provides a vaccinia virus strain Tian Tan strain oncolytic virus that can efficiently express the αCD47-Fc(ALIE) gene or the SIRPα-Fc(ALIE) gene. When the oncolytic virus is administered to the tumor lesion, it expresses CD47 antibodies while lysing tumor cells to exert an oncolytic effect, thereby blocking the binding of CD47 to SIRPα, relieving the inhibitory effect of tumor cells on macrophages, and enhancing the phagocytic function of macrophages on tumor cells. Simultaneously, it utilizes the ADCC effect mediated by CD47 antibodies to enhance the anti-tumor effect. Compared with simple antibody therapy or viral therapy, the oncolytic virus significantly enhances the inhibitory ability against malignant tumors, thereby significantly improving the efficacy of tumor immunotherapy. At the same time, it effectively avoids the risk of anemia caused by the binding of CD47 antibodies to peripheral blood erythrocytes, increasing the safety of tumor immunotherapy.

[0140] 3. This invention has completed in vitro experimental studies on the treatment of liver cancer and malignant lung cancer with vaccinia virus Tian Tan strain oncolytic virus, achieving good targeting and anti-tumor effects on tumors. It also has a relatively complete virus amplification and quality control system, laying the foundation for further industrialization. This invention has good application prospects.

[0141] 4. The recombinant vaccinia virus strain Tiantan provided by this invention innovatively carries a CD47 antibody gene with strong ADCC activity. It utilizes the CD47 molecule to precisely target tumor cells and superimposes the anti-tumor biological effects of the CD47 antibody. While the oncolytic virus exerts its oncolytic effect and lyses tumor cells, it kills local tumor cells by expressing large amounts of αCD47-Fc (ALIE), exerting multiple anti-tumor effects. Compared with simple gene therapy or viral therapy, it enhances its ability to kill malignant tumors, thus significantly improving the efficacy of tumor immunotherapy. Simultaneously, it effectively avoids the risk of anemia caused by the binding of CD47 antibodies to peripheral blood erythrocytes, increasing the safety of tumor immunotherapy. Attached Figure Description

[0142] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0143] Figure 1 The bar chart shown is based on Example 1 of the present invention, which shows the binding of the supernatant of the ELISA-screened clones to the antigen hCD47-ECD. The results show that 25 candidate antibody clones can specifically bind to hCD47-ECD, among which the monoclonal antibodies Hu004-65 and Hu004-101 of the present invention have high specificity.

[0144] Figure 2 shows the expression vector map of the antibody used in this invention; wherein, Figure 2Ais Cloning vectorAbVec-hIgKappa, Figure 2B It is a cloning vector AbVec-hIgG1;

[0145] Figure 3 The results show that the affinity of the antibodies of the present invention was determined by surface plasmon resonance (SPR) method, and all 10 antibodies showed strong affinity.

[0146] Figure 4 The monoclonal antibodies Hu004-65 and Hu004-101 of the present invention have different recognition epitopes from the control antibody B6H12 (US9017675B2);

[0147] Figure 5 The monoclonal antibody Hu004-73 of the present invention is shown to be able to bind to both human CD47 and mouse CD47 simultaneously.

[0148] Figure 6 illustrates the broad-spectrum antitumor activity mediated in vitro by the monoclonal antibodies Hu004-65 and Hu004-101 of the present invention; wherein, Figure 6A The figure shows the killing activity of the candidate antibodies Hu004-65 and Hu004-101 against the NCI-H292 tumor cell line. As can be seen from the figure, compared with other candidate antibodies, antibodies Hu004-65 and Hu004-101 exhibit stronger in vitro mediated killing activity, comparable to the positive control antibody B6H12. Figure 6B The figure shows the killing activity of candidate antibodies Hu004-65 and Hu004-101 against the SK-OV3 tumor cell line. As can be seen from the figure, the in vitro mediated killing activity of candidate antibodies Hu004-65 and Hu004-101 against the SK-OV3 tumor cell line is higher than that of the positive control antibody B6H12, both reaching twice the killing rate of B6H12 antibody. This indicates that candidate antibodies Hu004-65 and Hu004-101 have broad-spectrum anti-tumor activity mediated in vitro.

[0149] Figure 7 The diagram shows the arrangement of the antibody variable regions;

[0150] Figure 8 illustrates the construction of the vaccinia virus Tian Tan strain shuttle plasmid vector αCD47-Fc(ALIE) according to a specific embodiment of the present invention; wherein, Figure 8A Expression map of pSC65, a vaccinia virus shuttle plasmid integrating the αCD47-Fc(ALIE) gene; Figure 8B The PCR identification results of the inserted fragment αCD47-Fc(ALIE) in the recombinant vaccinia virus rTV-αCD47-Fc(ALIE);

[0151] Figure 9 This invention demonstrates the verification of αCD47-Fc(ALIE) protein expression in the culture supernatant after different strains of vaccinia virus Tian Tan were infected with VERO cells according to embodiments of the present invention.

[0152] Figure 10 shows the in vitro anti-hepatocellular carcinoma effect of recombinant vaccinia virus rTV-αCD47-Fc (ALIE); among which, Figure 10A The in vitro killing effects of wild-type vaccinia virus Tian Tan strain (TTV) treatment group, hrCD16 T cell group, recombinant vaccinia virus group of αCD47-Fc (ALIE) (rTV-αCD47-Fc (ALIE)) and rTV-αCD47-Fc (ALIE) combined with hrCD16 T cell treatment group on HepG2 cells. Figure 10B The study compared the in vitro killing effects of wild-type vaccinia virus Tian Tan strain (TTV) treatment group, NK cell group, recombinant vaccinia virus group containing αCD47-Fc(ALIE) (rTV-αCD47-Fc(ALIE)), and the combined treatment group of rTV-αCD47-Fc(ALIE) and NK cells on HepG2 cells. As shown in the figure, the recombinant vaccinia virus rTV-αCD47-Fc(ALIE) exhibited a more significant killing effect on HepG2 cells, and the killing effect increased with increasing viral titer.

[0153] Figure 11 shows the in vitro anti-malignant lung cancer effect of recombinant vaccinia virus rTV-αCD47-Fc (ALIE); among which, Figure 11A The in vitro killing effects of wild-type vaccinia virus Tian Tan strain (TTV) treatment group, hrCD16 T cell group, αCD47-Fc (ALIE) recombinant vaccinia virus group, and rTV-αCD47-Fc (ALIE) combined with hrCD16 T cell treatment group on NCI-H292 tumor cell line were investigated. Figure 11B The study compared the in vitro killing effects of wild-type vaccinia virus Tian Tan strain (TTV) treatment group, NK cell group, recombinant vaccinia virus group containing αCD47-Fc (ALIE), and combined treatment group of rTV-αCD47-Fc (ALIE) and NK cells on the NCI-H292 tumor cell line. As shown in the figure, the recombinant vaccinia virus rTV-αCD47-Fc (ALIE) exhibited a more significant killing effect on the NCI-H292 tumor cell line, and the killing effect increased with increasing viral titer.

[0154] Figure 12 shows the in vitro antitumor activity of SIRPα-Fc(ALIE) of the present invention; wherein, Figure 12AThe study investigated the in vitro killing effects of B6H12-Fc(ALIE) antibody alone, SIRPα-Fc(ALIE) alone, hrCD16 T cell therapy, B6H12-Fc(ALIE) antibody combined with hrCD16 T cell therapy, and SIRPα-Fc(ALIE) combined with hrCD16 T cell therapy on NCI-H292 lung cancer cells. Figure 12B The study compared the in vitro killing effects of B6H12-Fc (ALIE) antibody alone, SIRPα-Fc (ALIE) alone, hrCD16 T cell therapy, a combination of B6H12-Fc (ALIE) antibody and hrCD16 T cell therapy, and a combination of SIRPα-Fc (ALIE) and hrCD16 T cell therapy on SK-OV3 ovarian cancer cells. As shown in the figure, the combination therapy of SIRPα-Fc (ALIE) and hrCD16 T cells exhibited a more significant and enhanced killing effect on SK-OV3 cells.

[0155] Figure 13 shows that the rTV-Hu004-65-Fc(ALIE) poxvirus prepared by clone 65 of the present invention exhibits highly efficient antitumor activity in vitro. Among other things, Figure 13A The study investigated the in vitro killing effects of hrCD16 T cell therapy, wild-type vaccinia virus Tian Tan strain (TTV) combined with hrCD16 T cell therapy, B6H12-Fc (ALIE) recombinant vaccinia virus combined with hrCD16 T cell therapy, and rTV-Hu004-65-Fc (ALIE) combined with hrCD16 T cell therapy on NCI-H292 lung cancer cells. Figure 13B The in vitro killing effects of hrCD16 T cell therapy, wild-type vaccinia virus Tian Tan strain (TTV) combined with hrCD16 T cell therapy, B6H12-Fc (ALIE) recombinant vaccinia virus combined with hrCD16 T cell therapy, and rTV-Hu004-65-Fc (ALIE) combined with hrCD16 T cell therapy on SK-OV3 ovarian cancer cells were investigated. The figures show that the recombinant vaccinia virus rTV-Hu004-65-Fc (ALIE) exhibited potent killing effects on both NCI-H292 lung cancer cells and SK-OV3 ovarian cancer cells, with significantly higher killing effects on SK-OV3 ovarian cancer cells compared to the B6H12-Fc (ALIE) group.

[0156] Deposit Information

[0157] The Tian Tan strain of vaccinia virus, named rTV-αCD47-Fc(ALIE), has the accession number CCTCC NO:V202080, the accession date is January 2, 2021, and the accession address is China Center for Type Culture Collection, Wuhan University, Wuhan, China. Detailed Implementation

[0158] Example 1: Construction and screening of a natural human antibody phage display library

[0159] Preparation of human CD47 extracellular domain (hCD47-ECD) antigen: Recombinant human CD47 protein, composed of Met1-Pro139, consisting of 123 amino acid residues, was purchased from Beijing Sinocare Medical Technology Co., Ltd., catalog number: 12283-H08H.

[0160] The screening of fully human CD47 antibodies was commissioned by Takizan (Shanghai) Biotechnology Co., Ltd. After four rounds of screening, clones obtained in the third round were selected for ELISA screening of positive clones. Ultimately, 25 positive clones capable of binding to the hCD47-ECD protein were identified. After sequencing analysis and ELISA, the sequences of 10 clones were selected to construct full-length antibodies for further experiments. The specific implementation method is as follows:

[0161] 1.1 Sequencing and Analysis of Positive Clones

[0162] After initial screening, 25 positive clones capable of binding to the hCD47-ECD protein were numbered. 2 μL of bacterial culture was transferred to 2 mL of 2×YT medium (Sigma Aldrich, catalog number Y1003-500ML) and incubated overnight at 37°C and 220 rpm. Plasmids were then extracted for next-generation sequencing. The sequencing results were used to integrate, align, and remove non-antibody gene sequences from the original AB1 file using SeqMan, generating an antibody-integrated version of the FASTA file. Subsequently, the DNA sequences were translated into amino acid sequences using MEGA6, and the presence of terminators and non-standard sequences was identified through the amino acid sequences, leading to the export of the amino acid sequence FASTA file.

[0163] 1.2 Affinity of ELISA screening clone supernatant to antigen hCD47-ECD

[0164] First, clones selected from the third round of screening were placed in 96-well deep-well plates containing 300 μL of 2-YT medium and incubated overnight at 37°C. The supernatant contained expressed Fab. This supernatant was then serially diluted and added to ELISA plates coated with 2 μg / mL hCD47-ECD. Horseradish peroxidase (HRP)-labeled goat anti-human Fab (Thermo Fisher Scientific, catalog number 31482) was used as a secondary antibody at a 1:6000 dilution for detection. Higher signal values ​​indicated stronger affinity. Results were as follows: Figure 1 As shown, the results indicate that, in the ELISA assay, the Fab of all 10 antibodies (named Hu004-65, Hu004-66, Hu004-67, Hu004-68, Hu004-69, Hu004-73, Hu004-74, Hu004-91, Hu004-100, and Hu004-101, respectively) exhibited good affinity activity. The positive control was antibody with clone number B6H12 (US9017675B2), and the negative control was human IgG protein.

[0165] Example 2: Construction, expression and purification of full-length antibodies

[0166] In this embodiment, the 10 Fab antibodies obtained in Example 1 that showed good activity in binding to hCD47-ECD were used to construct the human IgG1 subtype, wherein all light chains were κ type and the antibody type was fully human antibody.

[0167] The arrangement of the antibody variable region is as follows: Figure 7 As shown;

[0168] 2.1 Plasmid Construction

[0169] From the antibody-containing strains obtained through screening, the variable regions of the antibody light and heavy chains were amplified by PCR. Through homologous recombination, these regions were constructed into eukaryotic expression vector plasmids Cloning vector AbVec-hIgKappa (GenBank:FJ475056.1) or Cloning vector AbVec-hIgG1 (GenBank:FJ475055.1) containing the constant regions of the light and heavy chains, respectively (Figure 2), to form the complete full-length antibody light and heavy chain genes.

[0170] The corresponding antibody CDR sequences are shown in Table 1 below.

[0171] Table 1. Sequences of Hu004-65, Hu004-73, and Hu004-101

[0172]

[0173]

[0174] 2.2 Plasmid Preparation The constructed vector containing the full-length antibody light and heavy chain genes was transformed into E. coli TOP10 (Video, catalog number DL1010S) and cultured overnight at 37°C. The plasmids were extracted using an endotoxin-free plasmid extraction kit (OMEGA, catalog number D6950-01) to obtain endotoxin-free antibody light and heavy chain plasmids for eukaryotic expression.

[0175] 2.3 Antibody Expression and Purification

[0176] Candidate antibodies Hu004-65, Hu004-66, Hu004-67, Hu004-68, Hu004-69, Hu004-73, Hu004-74, Hu004-91, Hu004-100, Hu004-101, and control antibody B6H12 (US 9017675B2) were expressed using the Expi293 transient expression system (Thermo Fisher Scientific, catalog number A1435101). The specific method is as follows:

[0177] On the day of transfection, the cell density was confirmed to be 7 × 10⁶. 6 Up to 1×10 7 With approximately 100 viable cells / mL and a cell viability >98%, the cells were adjusted to a final concentration of 6 × 10⁶ cells / mL using fresh Expi293 expression medium pre-warmed at 37°C. 6 Cells / mL. Pre-cooled Expi293 at 4°C TM Dilute the target plasmid with Expression Medium (add 10 μg of plasmid to 1 mL of the medium as described), and simultaneously use Expi293. TM Expression Medium was used to dilute FectoPro (Polyplus, catalog number PT-116-001) transfection reagent, and then the two were mixed in equal volumes and gently blown to prepare Expi293. TM Expression Medium / plasmid DNA mixture was incubated at room temperature for 15 minutes, then slowly added to the prepared cell suspension while gently shaking. The mixture was then placed in a cell culture shaker and cultured at 37°C with 5% CO2. 18-22 hours after transfection, 0.6 μL / mL of FectoPRObooster was added to the culture medium. The shake flask was then incubated at 37°C with 5% CO2. On day 5 post-transfection, the same volume of Expi293 was added. TMExpression medium is added slowly while gently mixing the cell suspension. 7-15 days after transfection, the cell culture supernatant expressing the target protein is centrifuged at 4000g for 10 minutes. The obtained supernatant is purified by affinity using a Protein G agarose column (GE, catalog number 28903134). The purified antibody is dissolved in PBS buffer, and then the target protein is eluted with 100mM sodium acetate (pH 3.0). The solution is then neutralized with 1M Tris-HCl, and finally the obtained protein is transferred to PBS buffer through an ultrafiltration concentrator (Millipore, catalog number UFC901096).

[0178] 2.4 Antibody Concentration Determination

[0179] The relative molecular weight and purity of 10 candidate antibodies (Hu004-65, Hu004-66, Hu004-67, Hu004-68, Hu004-69, Hu004-73, Hu004-74, Hu004-91, Hu004-100, Hu004-101) and control antibody B6H12 were determined by SDS-PAGE. The purified antibody protein was then concentrated using a validated micro-volume spectrophotometer (Thermo Fisher NanoDrop One C). The A280 value divided by the theoretical extinction coefficient of the antibody was used as the antibody concentration value for subsequent studies. After passing quality control, the antibody was aliquoted and stored at -80°C.

[0180] Example 3: Determination of the affinity coefficient of antibodies by ELISA SPR Figure 3

[0181] Affinity was determined by Beijing Yiqiao Shenzhou Technology Co., Ltd. using surface plasmon resonance (SPR), and the results showed... Example 4: Candidate antibodies Hu004-6 and Hu004-101 have different recognition epitopes than B6H12 clone The results showed that the affinity of all 10 candidate antibodies was above the 10 to the power of -7, indicating strong affinity.

[0182] Figure 4 5 Figure 4

[0183] Human non-small cell lung cancer A549 cell line was cultured in DMEM medium (10% FBS, 1% antibiotic) at 37°C and 5% CO2. Cells were collected by digestion with 0.25% trypsin. Cell concentration was determined, and cells were centrifuged at 800g for 3 minutes, discarding the supernatant; cells were resuspended in 1 mL of 2% FBS washing buffer, centrifuged at 800g for 3 minutes, discarding the supernatant; cells were resuspended in 100 μL of 2% FBS washing buffer. Cells were stained with candidate antibodies Hu004-65 and Hu004-101, and control antibody B6H12 as primary antibodies. Incubate at room temperature for 15 minutes; resuspend in 1 mL of 2% FBS washing buffer, centrifuge at 800g for 3 minutes, and discard the supernatant; add secondary antibodies IgG-Fc-PE and IgG-Fc-APC (BioLegend, catalog numbers 409304 and 409306), and incubate at room temperature in the dark for 15 minutes; resuspend in 1 mL of 2% FBS washing buffer, centrifuge at 800g for 3 minutes, and discard the supernatant; resuspend in 200 μL of culture medium and analyze using a Beckman Coulter CytoFLEX Flow Cytometer. Flow cytometry results are shown below. Example 5: Candidate antibody Hu004-7 .Depend on Specific binding test with human and murine CD47 It can be seen that the cell populations of the positive control B6H12 and Hu004-65 dual-channel staining group, the positive control B6H12 and Hu004-101 dual-channel staining group, and the Hu004-101 and Hu004-65 dual-channel staining group were all double positive. This proves that the candidate antibodies Hu004-65 and Hu004-101 have different recognition epitopes from B6H12, and the candidate antibodies Hu004-65 and Hu004-101 also have different recognition epitopes and do not compete with each other.

[0184] Figure 5 3 Figure 5Human lung mucinous epithelioid carcinoma NCI-H292 cell line was cultured in DMEM medium (10% FBS, 1% antibiotic) at 37°C and 5% CO2. B16 melanoma cells (mouse-derived) were cultured in RPMI 1640 medium (10% FBS, 1% antibiotic) at 37°C and 5% CO2. Cells were collected by digestion with 0.25% trypsin. Cell concentration was determined by preparing 1E5 cells per cell line. Cells were centrifuged at 800g for 3 minutes, and the supernatant was discarded. Cells were resuspended in 1 mL of 2% FBS washing buffer, centrifuged at 800g for 3 minutes, and the supernatant was discarded. Cells were resuspended in 100 μL of 2% FBS washing buffer, and primary antibody (Hu004-73) was added. Cells were incubated at room temperature for 15 minutes. Cells were resuspended in 1 mL of 2% FBS washing buffer, centrifuged at 800g for 3 minutes, and the supernatant was discarded. Secondary antibody IgG-Fc-PE (BioLegend, catalog number 409304) was added, and cells were incubated at room temperature in the dark for 15 minutes. Cells were resuspended in 1 mL of 2% FBS washing buffer, centrifuged at 800g for 3 minutes, and the supernatant was discarded. Cells were resuspended in 200 μL of culture medium and analyzed using a Beckman Coulter CytoFLEX FlowCytometer. Results are as follows: Example 6: Test of candidate antibodies Hu004-65 and Hu004-101 for in vitro mediation of broad-spectrum antitumor activity As shown. By Example 7: Construction and expression verification of recombinant vaccinia virus of aCD47-Fc(ALIE) The results showed that the Hu004-73 antibody specifically bound to mouse melanoma cells B16 with a binding rate of 96.5%, and to human lung mucoepithelial carcinoma cells NCI-H292 with a binding rate of 40.2%. This experiment demonstrates that the candidate antibody Hu004-73 can bind to both human and mouse CD47.

[0185] Figure 8A

[0186] In vitro assays were conducted to investigate the mediated killing effect of candidate antibodies on SK-OV3 ovarian cancer and NCI-H292 lung cancer cell lines. SK-OV3 and NCI-H292 cell lines, both Luciferase-expressing cell lines, were cultured in DMEM medium (10% FBS, 1% antibiotic) at 37°C and 5% CO2. Tumor cells were seeded at a density of 1E4 cells / well in 96-well plates and cultured overnight at 37°C until adherence. After 24 hours, the medium was removed. A blank control group was added with 200 μL of medium, a positive control group was added with B6H12 antibody, and the experimental groups (numbered 1-10) were added with candidate antibodies (Hu004-65, Hu004-66, Hu004-67, Hu004-68, Hu004-69, Hu004-73, Hu004-74, Hu004-91, Hu004-100, and Hu004-101), respectively. CD16 CAR-T cells were added to both the positive control and experimental groups at a density of 2E4 cells / well, and culture medium was added to bring the final antibody concentration to 10 μg / mL. After 24 hours, the supernatant was removed, and 50 μL of 1x cell lysis buffer (Promega, catalog number E1531) was added to each well. The cells were incubated at room temperature with shaking for 30 minutes, and then 30 μL of luciferase substrate (Promega, catalog number E151A) was added to each well. The cells were then analyzed using a microarray assay. (Navigator Microplate Luminometer, Promega, Steady-Glo protocol). The results, as shown in Figure 6, indicate that candidate antibodies Hu004-65 and Hu004-101 exhibited strong mediated killing activity against the NCI-H292 tumor cell line in vitro, comparable to the positive control antibody. Figure 6 also shows that candidate antibodies Hu004-65 and Hu004-101 demonstrated higher mediated killing activity against the SK-OV3 tumor cell line in vitro than the positive control antibody B6H12, both achieving twice the killing rate of B6H12. This experiment demonstrates that candidate antibodies Hu004-65 and Hu004-101 possess broad-spectrum antitumor activity in vitro.

[0187] Figure 8B

[0188] 7.1 Construction of pSC65 vector carrying αCD47-Fc(ALIE) target gene

[0189] The DNA sequence of αCD47-Fc(ALIE) was artificially synthesized, as shown in SEQ ID NO:1. The synthesized DNA sequence was used as a template for PCR amplification with the following primers.

[0190] The primers for amplification are:

[0191] Upstream: SEQ ID NO:20

[0192] GTACCAGGCCTAGTACTATGGAGAGGACCCTTGTCTG

[0193] Downstream: SEQ ID NO:21

[0194] AATAAGCTCGAAGTCGACCTAGGAGAGATGCTGATG

[0195] PCR reaction procedure: 94℃ pre-denaturation for 5 minutes; 98℃ denaturation for 10 seconds, 58℃; annealing for 30 seconds, 72℃ extension for 1 minute, 30 cycles; 72℃ for a further extension for 10 minutes, terminate at 25℃.

[0196] Recovery and Cloning of PCR Products: After amplification, the target gene was isolated in a 2% agarose gel. Simultaneously, the pSC65 vector was linearized by SalI digestion (Thermo Scientific, catalog number ER0642) and recovered from the gel. PCR fragments and vector digestion fragments were recovered using the Sanprep DNA Gel Extraction Kit (Promega, catalog number A9282). The recovered gene product and the linearized vector were ligated using homologous recombination (Novizan, catalog number c112-02). The ligation product was transformed into *E. coli* TOP10 and grown overnight on ampicillin-containing plates. On the second day, single colonies were randomly selected for sequencing, mutation site correction, and verification of complete sequence correctness. The pSC65 shuttle plasmid of the αCD47-Fc(ALIE) gene was successfully cloned. The plasmid construction diagram is shown below. Figure 9 As shown.

[0197] 7.2 Recombination and screening of αCD47-Fc(ALIE) recombinant vaccinia virus

[0198] 1. Cell preparation: 143TK - Cells were seeded in 6-well plates, approximately 1 × 10⁶ cells per well. 6 After culturing for approximately 24 hours, when the cells have adhered to the wall and covered the entire bottom surface, proceed to the next step.

[0199] 2. Vaccine virus incubation: Infect cells with wild-type vaccinia virus Tiantan strain at 0.0125 / 3 PFU (PFU: plaque forming unit, virus titer), incubate at 37°C for 1 hour, remove the cells, aspirate the supernatant, wash once with 1 mL PBS, and then add 1 mL of complete culture medium.

[0200] 3. Plasmid transfection: The pSC65 shuttle plasmid carrying αCD47-Fc(ALIE) was transfected into 143TK. -Cells. Incubate at 37°C for approximately 48 hours, the exact time depending on the cytopathic effect.

[0201] 4. Plastering: Prepare 2×DMEM maintenance medium (containing 2% PS and 4% FBS) for virus plastering, add 2% preheated low melting point agarose and then add X-gal (final concentration of 200 μg / mL).

[0202] 5. Remove the supernatant from the 6-well plate, add 6 mL of the speckle-laying mixture to each well. Then carefully place the plate in a 4°C freezer to promote solidification. After the low-melting-point agarose has solidified, transfer it to a 37°C incubator and incubate upside down until clear blue spots appear.

[0203] 6. Pick the blue spots of the recombinant virus and add them to 500 μL of complete culture medium. Repeat the freeze-thaw cycle at -80℃ at least three times to release as much virus as possible.

[0204] 7. 143TK - Cells were seeded in 6-well plates, approximately 1 × 10⁶ cells per well. 6 Incubate for approximately 24 hours until the cells adhere to the wall and cover the entire bottom surface.

[0205] 8. Repeatedly blow into the blue spot in the EP tube until it is completely dispersed.

[0206] 9. Replace the complete culture medium with maintenance culture medium and then add the virus solution containing blue spots. Incubate at 37°C for 3-4 hours.

[0207] 10. Add screening pressure: Add BrdU (50 μg / mL) and incubate at 37°C for approximately 48 hours. Deploy plaques according to the viral plaque formation. This purification process needs to be repeated at least 5 times.

[0208] 11. Small-sample amplification of recombinant vaccinia virus: 143TK layer - Cells were grown in a six-well plate, 1 × 10⁶ cells per well. 6 Each cell is used when the area of ​​the well plate is approximately 100% of the bottom area.

[0209] 12. Before inoculating the virus, replace the medium in the wells with 2 mL of maintenance medium. Repeatedly pipet the purified virus solution containing blue spots until the blue spots disperse. Add approximately 100 μL of virus solution to each well. Incubate at 37°C for approximately 48 hours, and collect the samples based on the formation of viral spots.

[0210] 13. Sample collection: Carefully aspirate 1 mL of the culture medium supernatant from the well. Use the remaining 1 mL of culture medium to thoroughly blow off the cells and collect them in an EP tube. This can be used for subsequent PCR identification and as a seed for amplification.

[0211] The results of the identification are as follows Example 8: Amplification and titer determination of recombinant vaccinia virus of aCD47-Fc(ALIE)As shown, the recombinant vaccinia virus rTV-αCD47-Fc(ALIE) was successfully inserted into the αCD47-Fc(ALIE) gene.

[0212] 7.3 Validation of recombinant vaccinia virus expression of αCD47-Fc(ALIE)

[0213] 1. Cell preparation: Take a 10cm culture dish and seed 5×10⁶ cells. 6 One VERO cell / plate is recommended to ensure a cell density of 100% when inoculating with vaccinia virus the next day.

[0214] 2. Virus inoculation: Replace the complete culture medium with 8 mL of maintenance medium (DMEM medium + 2% FBS + 1% PS); then add the virus to obtain four candidate vaccinia virus strains, namely clones 7, 8, 9, and 10, which are then used to infect cells at an inoculation volume of approximately 0.02 MOI (MOI = virus PFU / cell number). Incubate at 37°C in a 5% CO2 incubator for 48 hours.

[0215] 3. Protein purification: Collect cell supernatant according to the viral plaque formation, enrich antibody with Protein G agarose column (GE, catalog number 28-9031-34), and dissolve in PBS buffer.

[0216] 4. CD47 antibody affinity assay: The purified protein was mixed with A549 cells (1×10⁻⁶ cells) at a concentration of 40 μg / mL. 6 Cells were incubated at room temperature for 15 minutes, with a sample without αCD47-Fc (ALIE) protein used as a blank control. Cells were washed twice with 1 mL of PBS containing 2% FBS (FPBS); 1 μL of PE-labeled anti-human IgG Fc antibody (BioLegend, catalog number 409304) was added to each sample, and the cells were incubated at room temperature for 15 minutes; after washing twice with 1 mL of FPBS, the cells were resuspended in 200 μL of FBS and analyzed.

[0217] The results are as follows Example 9: Effect of recombinant vaccinia virus of aCD47-Fc(ALIE) on in vitro killing of hepatoma cells As shown, compared with the blank control, in the four vaccinia virus groups, the binding rate of αCD47-Fc(ALIE) secreted by clone 9 to A549 cells was approximately 95%. This indicates that the CD47 antibody gene carried on this recombinant vaccinia virus not only successfully expressed CD47 antibody, but also had better binding affinity to CD47 protein on A549 cells. Clone 9 was deposited and named rTV-αCD47-Fc(ALIE), with accession number CCTCC NO:V202080, deposit date January 2, 2021, and deposit address at the China Center for Type Culture Collection.

[0218] Example 10: Effect of recombinant vaccinia virus of aCD47-Fc(ALIE) on in vitro anti-lung cancer

[0219] 8.1 Amplification and purification of recombinant vaccinia virus αCD47-Fc(ALIE)

[0220] 1. VERO cell seeding: 5 × 10⁶ cells per 10 cm dish. 6 It is advisable to ensure that the cell density reaches 100% when inoculating with the vaccinia virus the next day.

[0221] 2. Before virus inoculation, replace the complete culture medium with 8 mL of maintenance culture medium (DMEM medium + 2% FBS + 1% PS). After inoculating with the virus (0.02 MOI), continue to incubate in an incubator at 37℃ and 5% CO2 for about 48 hours. Collect samples according to the formation of viral plaques.

[0222] 3. Collecting vaccinia virus: Discard the culture medium in the dish, take 2 mL of maintenance culture medium and blow off the remaining cells, then collect them in a 15 mL centrifuge tube.

[0223] 4. After freezing for 24 hours, the collected virus solution was repeatedly frozen and thawed twice. Density gradient centrifugation was performed using 36% sucrose solution at 16000g for 90 minutes at 4°C. The supernatant was carefully discarded, and the virus precipitate in the centrifuge tube was dissolved in PBS buffer. The tubes were aliquoted and stored at -80°C until the virus titer was determined. 8.2 Titer Determination of Recombinant Vaccine Virus of αCD47-Fc(ALIE)

[0224] 1.143TK - Cell preparation: 143TK - Cells were seeded in 24-well plates, 2 × 10⁶ cells per well. 5 Each cell should be used in a 24-well plate with a cell density of 100% of the bottom area.

[0225] 2. Dilute the virus. Dilute the vaccinia virus solution with maintenance medium, starting with a 1:100 dilution and performing 10-fold serial dilutions until the final volume is 1100 μL.

[0226] 3. Discard the complete culture medium in the 24-well plate, add 500 μL of diluted virus solution, and set up replicates for each sample. Incubate at 37°C with 5% CO2 for approximately 48 hours, adjusting the plaque formation time according to the viral plaque formation.

[0227] 4. Preparation of speckle gel: Prepare 8 mL of speckle medium containing 2×DMEM medium + 4%FBS + 2%PS and 8 mL of low-melting-point agarose melted in a boiling water bath and placed in a 37℃ water bath. Mix the two together, and then add X-gal to the mixture (200 μg / mL).

[0228] 5. Remove the supernatant from the 24-well plate. Immediately add the speckle mixture from (4) to each 24-well plate, 500 μL. Then carefully place the plate in a 4°C freezer to promote solidification. After the low-melting-point agarose has solidified, transfer it to a 37°C incubator and incubate upside down until clear blue spots appear.

[0229] 6. Virus plaque counting: First, observe whether the number of viral plaques decreases by a factor of ten. Then, count the number of single-digit blue plaques in the two replicates of the seed virus. The sum of the blue plaque values ​​in the two wells, multiplied by the reciprocal of the dilution value of that well, is the virus titer in 1 mL.

[0230] Example 11: Test of SIRPa-Fc(ALIE) protein for in vitro mediation of broad-spectrum antitumor activity

[0231] 1. The experimental groups are as follows:

[0232] A: Wild-type vaccinia virus Tian Tan strain (TTV) treatment group, hrCD16 T cell group, recombinant vaccinia virus group of αCD47-Fc (ALIE) (rTV-αCD47-Fc (ALIE)) and rTV-αCD47-Fc (ALIE) combined with hrCD16 T cell therapy group.

[0233] B: Wild-type vaccinia virus Tian Tan strain (TTV) treatment group, NK cell group, recombinant vaccinia virus group of αCD47-Fc (ALIE) (rTV-αCD47-Fc (ALIE)) and rTV-αCD47-Fc (ALIE) combined with NK cell therapy group.

[0234] Among them, hrCD16 T cells are primary T cells modified with a variant hrCD16 chimeric receptor, which can bind efficiently to the Fc of CD47 antibody (modified by mutation), thereby mediating the targeted killing of tumor cells by T cells. NK cells are expanded and sorted from human PBMCs.

[0235] 2. HepG2 cell preparation: HepG2 is a stable cell line overexpressing luciferase (Shanghai Xinwan Biotechnology Co., Ltd.); HepG2 cells were seeded in 96-well plates, approximately 1 × 10⁶ cells per well. 4 Each cell should be used in a 96-well plate with a cell density of 100% of the bottom area.

[0236] 3. Virus Inoculation: In the recombinant vaccinia virus group and the combination therapy group, HepG2 cells were infected with recombinant vaccinia virus (rTV-αCD47-Fc(ALIE)) for 12 hours. The viral load increased from 3.125 × 10⁻⁶ cells / year. 2 PFU up to 2×10 4Seven doses were administered in 2-fold increments between PFUs. HepG2 cells infected with wild-type vaccinia virus (TTV) served as a control.

[0237] 4. Twelve hours after infection, 1×10⁻⁶ T cells were added to the hrCD16 T cell group and the combination therapy group. 4 10 hrCD16T cells were cultured for another 12 hours; or 1×10 hrCD16T cells were added to the NK cell group and the combination therapy group 12 hours after infection. 4 The NK cells were cultured for another 12 hours.

[0238] 5. Discard the cell supernatant and perform luciferase detection using the Luciferase Assay System (Promega, catalog number E1501). The specific method is as follows: Discard the supernatant, add 50 μL of 1× cell lysis buffer to each well, and incubate on a shaker at room temperature for 30 minutes; add 30 μL of substrate and perform the assay (avoid light exposure).

[0239] As shown in Figure 10, the fluorescence values ​​measured in the rTV-αCD47-Fc(ALIE) group and the combined treatment group decreased with increasing viral titer, indicating that the killing effect on HepG2 cells increased with increasing viral titer. Compared with the groups treated with virus alone or with hrCD16T cells or NK cells alone, the rTV-αCD47-Fc(ALIE) combined with hrCD16T or NK cells significantly enhanced the killing effect on HepG2 cells in vitro.

[0240] Example 12: Test of rTV-Hu004-65-Fc(ALIE) vaccinia virus for in vitro mediation of broad-spectrum antitumor activity

[0241] 1. The experimental groups are as follows:

[0242] A: Wild-type vaccinia virus Tian Tan strain (TTV) treatment group, hrCD16 T cell group, αCD47-Fc (ALIE) recombinant vaccinia virus group, and rTV-αCD47-Fc (ALIE) combined with hrCD16 T cell treatment group.

[0243] B: Wild-type vaccinia virus Tian Tan strain (TTV) treatment group, NK cell group, recombinant vaccinia virus group with αCD47-Fc (ALIE), and combined treatment group with rTV-αCD47-Fc (ALIE) and NK cells.

[0244] 2. Preparation of NCI-H292 tumor cell line: The NCI-H292 tumor cell line is a stable cell line overexpressing luciferase (Shanghai Xinwan Biotechnology Co., Ltd.); NCI-H292 cells were seeded in 96-well plates, approximately 1 × 10⁶ cells per well. 4Each cell should be used in a 96-well plate with a cell density of 100% of the bottom area.

[0245] 3. Virus Inoculation: In the recombinant vaccinia virus group and the combination therapy group, NCI-H292 cells were infected with recombinant vaccinia virus (rTV-αCD47-Fc(ALIE)) for 12 hours. The viral load increased from 3.125 × 10⁻⁶ cells / year. 2 PFU up to 2×10 4 Seven doses were administered in 2-fold increments between PFUs. Meanwhile, NCI-H292 cells infected with wild-type vaccinia virus (TTV) served as a control.

[0246] 4. Twelve hours after infection, 1×10⁻⁶ T cells were added to the hrCD16 T cell group and the combination therapy group. 4 10 hrCD16T cells were cultured for another 12 hours; or 1×10 hrCD16T cells were added to the NK cell group and the combination therapy group 12 hours after infection. 4 The NK cells were cultured for another 12 hours.

[0247] 5. Discard the cell supernatant and perform luciferase detection using the Luciferase Assay System (Promega, catalog number E1501). The specific method is as follows: Discard the supernatant, add 50 μL of 1× cell lysis buffer to each well, and incubate on a shaker at room temperature for 30 minutes; add 30 μL of substrate and perform the assay (avoid light exposure).

[0248] 6. The results are shown in Figure 11. With increasing viral titer, the fluorescence values ​​of the wild-type vaccinia virus Tian Tan strain (TTV) group, the rTV-αCD47-Fc (ALIE) group, and the group treated with rTV-αCD47-Fc (ALIE) combined with hrCD16 T cells or NK cells decreased, indicating enhanced killing effect on the NCI-H292 tumor cell line. Compared to adding the virus alone or adding hrCD16 T cells or NK cells alone, the combination of rTV-αCD47-Fc (ALIE) with hrCD16 T cells or NK cells significantly improved the killing effect on the NCI-H292 tumor cell line.

[0249] 7. In conclusion, recombinant vaccinia virus rTV-αCD47-Fc (ALIE), as an oncolytic virus, can significantly inhibit the growth of various solid tumor cells, including human liver cancer and lung cancer, and has very high application value for tumor treatment. This oncolytic virus is simple to prepare, facilitating large-scale production and widespread use.

[0250] ​

[0251] The SIRPα-Fc(ALIE) antibody (sequence shown as SEQ ID NO: 3 or 4) of this invention was used in an in vitro assay to mediate the killing of SK-OV3 ovarian cancer and NCI-H292 lung cancer cell lines. SK-OV3 and NCI-H292 cell lines, both of which are Luciferase-expressing cell lines, were cultured in DMEM medium (10% FBS, 1% antibiotic) at 37°C and 5% CO2. Tumor cells were seeded at a density of 1E4 / well in 96-well plates and cultured overnight at 37°C until adherence. After 24 hours, the medium was removed. A blank control group was added with 200 μL of medium, a positive control group was added with B6H12 antibody, and the experimental groups were added with the proteins SIRPα-Fc(WT) and SIRPα-Fc(ALIE), respectively. CD16CAR-T cells were added to both the positive control and experimental groups at a density of 2E4 / well, and medium was added to bring the final antibody concentration to 10 μg / mL. After 24 hours, remove the supernatant, add 50 μL of 1x cell lysis buffer (Promega, catalog number E1531) to each well, incubate at room temperature with shaking for 30 minutes, and then add 30 μL of luciferase substrate (Promega, catalog number E151A) to each well. Analyze the results using a microarray analyzer. (Navigator Microplate Luminometer, Promega, Steady-Glo protocol). The results, shown in Figure 12, indicate that the SIRPα-Fc(ALIE) antibody exhibits strong mediated killing activity against the NCI-H292 tumor cell line in vitro, comparable to the positive control antibody. Figure 12 also shows that the SIRPα-Fc(ALIE) antibody demonstrates higher mediated killing activity against the SK-OV3 tumor cell line in vitro than the positive control antibody B6H12, achieving a killing rate 1.2 times higher. This experiment demonstrates that the SIRPα-Fc(ALIE) antibody also possesses the ability to mediate broad-spectrum antitumor activity in vitro.

[0252] ​

[0253] The Hu004-65-Fc(ALIE) antibody (sequence shown in SEQ ID NO: 5 and 9) of this invention was loaded into a vaccinia virus vector, and its mediated killing effect on SK-OV3 ovarian cancer and NCI-H292 lung cancer cell lines was investigated in vitro. SK-OV3 and NCI-H292 cell lines, both Luciferase-expressing cell lines, were cultured in DMEM medium (10% FBS, 1% antibiotic) at 37°C and 5% CO2. Tumor cells were seeded at a density of 1E4 / well in 96-well plates and cultured overnight at 37°C until adherence. After 24 hours, the culture medium was removed. A blank control group was added with 200 μL of culture medium, a virus control group was added with wild-type virus infection supernatant, a positive control group was added with culture supernatant from rTV-B6H12-Fc(ALIE) cell infection, and the experimental group was added with rTV-Hu004-65-Fc(ALIE) vaccinia virus infection supernatant. CD16 CAR-T cells were added to the virus control group, positive control group, and experimental group at a density of 2E4 cells / well. After 24 hours, the supernatant was removed, and 50 μL of 1x cell lysis buffer (Promega, catalog number E1531) was added to each well. The cells were incubated at room temperature with shaking for 30 minutes, and then 30 μL of luciferase substrate (Promega, catalog number E151A) was added to each well. The cells were then analyzed using a microarray assay. (Navigator Microplate Luminometer, Promega, Steady-Gloprotocol). The results, shown in Figure 13, indicate that rTV-Hu004-65-Fc(ALIE) exhibits strong mediated killing activity against the NCI-H292 tumor cell line in vitro, comparable to the positive control antibody. Figure 13 also shows that rTV-Hu004-65-Fc(ALIE) demonstrates higher mediated killing activity against the SK-OV3 tumor cell line in vitro than the positive control rTV-B6H12-Fc(ALIE), achieving a killing rate 1.6 times higher. This experiment demonstrates that the poxvirus rTV-Hu004-65-Fc(ALIE) prepared from the candidate antibody Hu004-65-Fc(ALIE) also possesses the ability to mediate broad-spectrum antitumor activity in vitro.

[0254] The above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. An antibody or antigen-binding fragment thereof capable of specifically binding to CD47, wherein the VH of the antibody or antigen-binding fragment thereof comprises a VH CDR1 as set forth in SEQ ID NO: 17, a VH CDR2 as set forth in SEQ ID NO: 18, and a VH CDR3 as set forth in SEQ ID NO: 19; and the VL of the antibody or antigen-binding fragment thereof comprises a VL CDR1 as set forth in SEQ ID NO: 11, a VL CDR2 as set forth in SEQ ID NO: 12, and a VL CDR3 as set forth in SEQ ID NO: 13; or the VL of the antibody or antigen-binding fragment thereof comprises a VL CDR1 as set forth in SEQ ID NO: 14, a VL CDR2 as set forth in SEQ ID NO: 15, and a VL CDR3 as set forth in SEQ ID NO: 16; or the VL of the antibody or antigen-binding fragment thereof comprises a VL CDR1 as set forth in SEQ ID NO: 22, a VL CDR2 as set forth in SEQ ID NO: 23, and a VL CDR3 as set forth in SEQ ID NO:

24.

2. The antibody or antigen-binding fragment thereof of claim 1, wherein, the antibody or antigen-binding fragment thereof comprises a VH having a sequence as set forth in SEQ ID NO: 9 and a VL having a sequence as set forth in any one of SEQ ID NOs: 5, 7, or 25.

3. The antibody or antigen-binding fragment thereof of claim 1, wherein, the antibody or antigen-binding fragment thereof further comprises: (a) a heavy chain constant region of a human immunoglobulin; and (b) a light chain constant region of a human immunoglobulin.

4. The antibody or antigen-binding fragment thereof of claim 3, wherein, the heavy chain constant region is an IgG heavy chain constant region.

5. The antibody or antigen-binding fragment thereof of claim 4, wherein, the IgG heavy chain constant region is an IgG1, IgG2, IgG3, or IgG4 heavy chain constant region.

6. The antibody or antigen-binding fragment thereof of claim 4, wherein, the IgG heavy chain constant region is a human IgG1 or human IgG4 heavy chain constant region.

7. The antibody or antigen-binding fragment thereof of claim 3, wherein, the light chain constant region is a kappa light chain constant region.

8. The antibody or antigen-binding fragment thereof of claim 1, wherein, the antigen-binding fragment is selected from the group consisting of a Fab, Fab', (Fab')2, Fv, disulfide linked Fv, or scFv; and / or, the antibody is a murine, chimeric, or humanized antibody.

9. The antibody or antigen-binding fragment thereof of claim 1, wherein, the antibody is a fully human antibody.

10. An isolated nucleic acid molecule encoding the antibody or antigen-binding fragment thereof or the heavy chain variable region and the light chain variable region of the antibody or antigen-binding fragment thereof of any one of claims 1-9.

11. The isolated nucleic acid molecule of claim 10, wherein, the nucleic acid molecule comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 6, 8, 10, or 26.

12. A vector comprising the isolated nucleic acid molecule of claim 10 or 11.

13. The vector of claim 12, wherein, the vector is a cloning vector or an expression vector.

14. The vector of claim 12, wherein, the vector is a virus.

15. The vector of claim 12, wherein, the vector is cloning vector AbVec-hIgKappa or cloning vector AbVec-hIgG1.

16. A host cell comprising the isolated nucleic acid molecule of claim 10 or 11 or the vector of any one of claims 12-15.

17. The host cell of claim 16, wherein, the host cell is prokaryotic or eukaryotic.

18. The host cell of claim 16, wherein, The host cell is selected from an E. coli cell, a yeast cell, a mammalian cell, or other cell suitable for producing an antibody or antigen-binding fragment.

19. The host cell of claim 16, wherein, The host cell is a mammalian cell.

20. The host cell of claim 16, wherein, The host cell is a human, murine, ovine, equine, canine, or feline cell.

21. The host cell of claim 16, wherein, The host cell is a 293 cell or a CHO cell.

22. A method of producing an antibody or antigen-binding fragment thereof of any one of claims 1-9, comprising culturing the host cell of any one of claims 16-21 under conditions that allow expression of the antibody or antigen-binding fragment thereof of any one of claims 1-9, and recovering the antibody or antigen-binding fragment thereof from the cultured host cell culture.

23. A recombinant oncolytic virus, wherein the oncolytic virus is operably inserted or comprises a genetic coding sequence of an anti-CD47 antibody or CD47 ligand; wherein, The genetic coding sequence is located in the thymidine kinase region of the recombinant oncolytic virus; The oncolytic virus comprises a genetic coding sequence as set forth in SEQ ID NO: 1 or 3. The oncolytic virus comprises a viral backbone derived from a modified or engineered vaccinia virus Tian strain.

24. The recombinant oncolytic virus of claim 23, wherein, The genetic coding sequence of the anti-CD47 antibody or CD47 ligand is expressed alone or in fusion with other genes or fragments. The other genes or fragments for fusion expression are Fc fragments.

25. The recombinant oncolytic virus of claim 23 or 24, wherein, The anti-CD47 antibody comprises the antibody or antigen-binding fragment thereof of any one of claims 1-9.

26. The recombinant oncolytic virus of claim 25, wherein, The anti-CD47 antibody further comprises an Fc mutant with A330L / I332E mutation.

27. The recombinant oncolytic virus of claim 25, wherein, The amino acid sequence of the anti-CD47 antibody is set forth in SEQ ID NO:

2.

28. The recombinant oncolytic virus of claim 25, wherein, The CD47 ligand is an extracellular domain of SIRPa.

29. The recombinant oncolytic virus of claim 25, wherein, The amino acid sequence of the anti-CD47 ligand is set forth in SEQ ID NO:

4.

30. A recombinant vaccinia virus Tian strain, designated as rTV-aCD47-Fc(ALIE), with a preservation number of CCTCC NO: V202080.

31. A method of producing the recombinant oncolytic virus of any one of claims 23-29, comprising the steps of: 1) synthesizing a genetic coding sequence comprising an anti-CD47 antibody or CD47 ligand; 2) cloning the coding sequence obtained in step 1) into a shuttle plasmid of the oncolytic virus to construct a recombinant plasmid vector; 3) transfecting the recombinant plasmid vector obtained in step 2) into the oncolytic virus, and obtaining the recombinant oncolytic virus through screening; and, culturing the obtained recombinant oncolytic virus.

32. The method of claim 31, comprising the steps of: 1) synthesizing a human gene aCD47-Fc(ALIE) with a sequence as set forth in SEQ ID NO: 1; or comprising a nucleic acid sequence as set forth in any one of SEQ ID NO: 6, 8, 10, or 26; or synthesizing a human gene SIRPa-Fc(ALIE) with a sequence as set forth in SEQ ID NO: 3; 2) subclone the synthesized aCD47-Fc(ALIE) gene or SIRP a-Fc(ALIE) gene into the TK region of the vaccinia virus shuttle plasmid pSC65 to construct recombinant plasmid pSC65-aCD47-Fc(ALIE) or pSC65-SIRP a-Fc(ALIE); 3) Using homologous recombination, the pSC65-αCD47-Fc(ALIE) plasmid or the pSC65-SIRPα-Fc(ALIE) plasmid was transfected into TK143 cells that had already been infected with wild-type vaccinia virus. - In cells, homologous recombination of the two is performed to produce recombinant vaccinia virus rTV-αCD47-Fc(ALIE) or rTV-SIRPα-Fc(ALIE); after screening, recombinant oncolytic vaccinia virus containing the coding sequence of pSC65-αCD47-Fc(ALIE) shown in SEQ ID NO:1 or recombinant oncolytic vaccinia virus containing the coding sequence of pSC65-SIRPα-Fc(ALIE) shown in SEQ ID NO:3 in the TK region is obtained.

33. The method of claim 32, wherein, The aCD47-Fc(ALIE) gene or SIRP a-Fc(ALIE) gene is controlled by the early / late promoter p7.5 of vaccinia virus.

34. Use of the recombinant oncolytic virus of any one of claims 23 to 29 or the recombinant vaccinia virus Tian Tan strain of claim 30 for the preparation of an antitumor drug; wherein The tumor is selected from one or more of lung cancer, liver cancer, and ovarian cancer.

Images