A method for adding a polyamino acid segment to the free end of an antibody stabilizing region
By adding polyamino acid fragments, especially lysine and arginine, to the free end of the antibody stable region, the problem of low antibody detection sensitivity was solved, resulting in a significant improvement in antibody detection sensitivity, which is suitable for disease diagnosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GETEIN BIOTECH
- Filing Date
- 2021-08-20
- Publication Date
- 2026-06-12
AI Technical Summary
Existing antibodies have low sensitivity when detecting antigens, making it difficult to effectively detect trace substances in the body.
Polyamino acid fragments, particularly lysine and arginine, are added to the free end of the stable region of the antibody. These fragments are then integrated into the antibody's gene sequence using genetic engineering methods to construct a recombinant expression vector and express the target antibody containing the polyamino acids.
It significantly increases the binding amount of antibodies to fluorescein, and improves the detection sensitivity of antibodies by about 5-6 times, enabling more sensitive detection of changes in trace substances and providing better evidence for disease diagnosis.
Smart Images

Figure CN115927454B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering, and specifically to a method for adding polyamino acid fragments to the free end of the antibody stabilization region. Background Technology
[0002] Antibodies are proteins associated with the immune system, called immunoglobulins. Each antibody consists of four polypeptides—two heavy chains and two light chains linked together to form a "Y"-shaped structure. The amino acid sequence at the end of the "Y"-shaped molecule varies greatly between different antibodies. This variable region, consisting of 110-130 amino acids, gives the antibody the specificity to bind to the antigen.
[0003] The antibody variable region comprises the ends of both the light and heavy chains. Treatment of this region with proteases yields antigen-binding fragments containing the antibody variable ends. The light and heavy chain fragments are structurally identical, consisting of VL and CL light chain units linked by disulfide bonds, and VH and CH1 heavy chain units, each with a molecular weight of 60,000. This is called the Fab antigen-binding region, where each Fab can bind one antigen. The remaining fragment, composed of CH2 and CH3 heavy chain units, is readily crystallizable and is called the Fc stable region, which can bind to receptors (FcRs) on immune-active cells. Currently, the ability of antibodies to bind labeled substances is limited, resulting in low sensitivity for detecting trace amounts of substances in the body. Summary of the Invention
[0004] In view of the shortcomings of the prior art, the purpose of this invention is to provide a method for adding polyamino acid fragments to the free end of the antibody stable region, so as to solve the problem of low detection sensitivity of antibody antigens in the prior art.
[0005] To solve the above problems, the present invention adopts the following solution:
[0006] A method for adding a polyamino acid fragment to the free end of an antibody's stable region includes the following steps:
[0007] Obtain the gene sequence corresponding to the target antibody;
[0008] The gene sequence corresponding to the polyamino acid fragment is added to the gene sequence corresponding to the free end of the stable region of the target antibody to obtain the recombinant gene sequence.
[0009] The recombinant gene sequence was constructed into an expression vector and expressed to obtain a target antibody whose stable region contains polyamino acids at its free end.
[0010] The polyamino acid fragment contains multiple free amino groups.
[0011] Furthermore, the polyamino acid fragment contains multiple lysines and / or multiple arginines.
[0012] Furthermore, the total number of lysine and arginine is 10-20; the total number of amino acids in the polyamino acid fragment is less than 30.
[0013] Furthermore, the gene sequence corresponding to the target antibody is either the variable region gene sequence of the target antibody or the full gene sequence of the target antibody.
[0014] Furthermore, the recombinant gene sequence is obtained using the following methods:
[0015] Obtain the variable region gene sequence of the target antibody;
[0016] The variable region gene sequence was constructed into an expression vector to obtain a recombinant expression vector;
[0017] Obtain the gene sequence of the stable region of the homologous antibody;
[0018] By adding the gene sequence corresponding to the polyamino acid fragment to the gene sequence of the stable region of the homologous antibody, a modified gene sequence is obtained;
[0019] The modified gene sequence and the variable region gene sequence of the target antibody are ligated in a recombinant expression vector to obtain an expression vector containing the recombinant gene sequence.
[0020] Furthermore, the gene sequence corresponding to the polyamino acid fragment is added to the gene sequence of the stable region of the homologous antibody, including:
[0021] Initial primers for obtaining the gene sequence of the stable region of the homologous antibody;
[0022] The target primer is obtained by adding a base sequence corresponding to a polyamino acid fragment to the 5' end of the initial primer.
[0023] PCR amplification was performed on a template containing a gene sequence with a stable region of homologous antibodies using the target primers, resulting in an modified gene sequence with a polyamino acid fragment at the C-terminus of the stable region of homologous antibodies.
[0024] Furthermore, the homologous antibody is a mouse-derived, rabbit-derived, or sheep-derived antibody.
[0025] Furthermore, the template is a subcloning vector containing a mouse Fc fragment gene.
[0026] Furthermore, the target primer contains restriction enzyme sites for EcoRI and XhoI at both ends, respectively.
[0027] Furthermore, the base sequence corresponding to the polyamino acid fragment is: AAGAAGAAGAAGAAACGCAAGAAGAAGAAGAAACGCAAGAAGAAGAAGAAACGC.
[0028] Furthermore, the gene expression vector is a pCDNA3.1 expression vector or a pCDNA3.4 expression vector.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] The modified antibody of this invention significantly increases the amount of fluorescein bound to the FC end. After being labeled with fluorescein, the detection sensitivity of the antibody antigen is increased by about 5-6 times, enabling more sensitive detection of changes in trace substances in the body and providing a better basis for disease diagnosis. Attached Figure Description
[0031] Figure 1 This is the expression fragment of the vector pCDNA3.4-LJ of this invention;
[0032] Figure 2 This is a color comparison image of the original antibody and the recombinant antibody after labeling according to the present invention;
[0033] Figure 3 This is a comparison chart of the signal values of the original antibody-fluorescein (YG) and the recombinant antibody-fluorescein (YG) of this invention. Detailed Implementation
[0034] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0035] A method for adding amino acids to the free end of an antibody's stable region includes the following steps:
[0036] (1) Obtain the gene sequence corresponding to the target antibody. The gene sequence of the target antibody at this location can be a variable region gene sequence or the full gene sequence of the antibody.
[0037] (2) Add the gene sequence corresponding to the polyamino acid fragment to the gene sequence corresponding to the free end of the target antibody stable region to obtain the recombinant gene sequence. The polyamino acid fragment needs to contain multiple free amino groups.
[0038] Because lysine and arginine side chains contain multiple free amino groups, which can improve the structural effect of target antibodies and fluorescein, in order to ensure the detection effect of antibodies, polyamino acids need to contain multiple lysine or multiple arginine, or multiple lysine and arginine at the same time. Among them, the total number of lysine and arginine is preferably 10-20; the total number of added amino acids should preferably be less than 30.
[0039] (3) The recombinant gene sequence was constructed into the expression vector for expression to obtain the target antibody with polyamino acids in the free end of the stable region.
[0040] The expression vector is pCDNA3.1 plasmid or pCDNA3.4 plasmid, or other expression vectors that can stably express recombinant gene sequences.
[0041] The target antibodies mentioned above include antibodies with high activity verified by ELISA and that can be used in immunochromatography.
[0042] When the variable region gene sequence of the target antibody is sequenced, and the recombinant gene sequence is obtained from the variable region gene sequence, the acquisition of the recombinant gene sequence and the construction of the expression vector will be carried out simultaneously. The specific steps are as follows:
[0043] First, the variable region gene sequence of the target antibody needs to be obtained and constructed into an expression vector to obtain a recombinant expression vector. Then, the gene sequence of the stable region of the homologous antibody is obtained, and the gene sequence corresponding to the polyamino acid fragment is added to the gene sequence of the stable region of the homologous antibody to obtain the modified gene sequence. Finally, the modified gene sequence is ligated into the recombinant expression vector, that is, the modified gene sequence and the variable region gene sequence of the target antibody are ligated in the recombinant expression vector to obtain an expression vector containing the recombinant gene sequence.
[0044] The aforementioned homologous antibodies can be mouse, rabbit, or sheep antibodies, with mouse antibodies being preferred.
[0045] The following section uses murine antibodies as an example to explain the specific steps of the above method in detail.
[0046] 1. Construction of variable region carrier
[0047] The target antibody was sequenced to obtain the amino acid sequence of its variable region; the corresponding variable region gene sequence was obtained based on the amino acid sequence of the variable region; and the variable region gene sequence was constructed into a gene expression vector.
[0048] The variable region gene sequence was optimized for mammalian cell expression system and constructed into the pCDNA3.1 expression vector via BamHI and EcoRI restriction sites to obtain the recombinant expression vector pCDNA3.1-KB.
[0049] 2. Construction of mouse-derived FC fragment gene sequence
[0050] 2.1 Design of primers for mouse-derived FC fragments
[0051] Primers are crucial for the specificity of PCR reactions, and the specificity of PCR products depends on the complementarity between the primers and the DNA template. In our laboratory, using a subcloning vector containing a mouse Fc fragment gene as a template, we designed and synthesized a pair of primers capable of amplifying the mouse Fc fragment gene using the molecular biology software Primepremier 5.0. We added a polylysine-arginine sequence corresponding to the base sequence AAGAAGAAGAAGAAACGCAAGAAGAAGAAGAAACGCAAGAAGAAGAAGAAACGC to the 5' end of the primers. Restriction endonuclease sites EcoRI and XhoI were added to both ends of the primers, respectively. At this point, the target gene obtained from the template and primers contains the gene sequence corresponding to the polyamino acid fragment.
[0052] 2.2 Amplification of the target gene
[0053] In this laboratory, a subcloning vector containing a mouse Fc fragment gene was used as a template for amplification of the target gene. The table below shows the amplification system and procedure, with the reaction components added in the correct order.
[0054] The PCR reaction system is shown in the table below:
[0055] Element Dosage (μL) 2*Taq Mix (DNA polymerase) 10 sterile deionized water 7 LJ Cap F (primer) 1 LJ Cap R (primer) 1 DNA template 1 Overall system 20
[0056] The PCR reaction procedure is shown in the table below:
[0057] Reaction temperature (°C) Program Purpose reaction time Number of reactions 94 Pre-variation 3min 1 94 High temperature deformation 30s 35 55 Low temperature annealing 30s 35 72 medium temperature extension 45s 35 72 medium temperature extension 7min 1 4 Low temperature storage ∞ 1
[0058] 2.3 Purification of PCR products
[0059] a. Aspirate 50 μL of PCR product into the corresponding centrifuge tubes, add 250 μL of GC buffer to each tube, mix well, add to the centrifuge column, centrifuge at 13000g for 1 min, remove the liquid from the centrifuge tubes, and then put them back into the centrifuge column for later use.
[0060] b. Add 500 μL of cleaning solution to each tube, centrifuge at 13000 g for 1 min, and repeat twice;
[0061] c. Discard the liquid from the centrifuge tube, open the cap of the centrifuge column and place it in the centrifuge along with the sleeve, centrifuge at 16000g for 4 minutes;
[0062] d. Remove the core of the centrifuge column, insert a new centrifuge tube, add 50 μL of sterile pure water to the white film in the center of the centrifuge column, and let it stand at room temperature for 3 minutes;
[0063] e. Cover the centrifuge column and place it together with the centrifuge tube into the centrifuge. Centrifuge at 13000g for 1 minute to obtain the purified target gene.
[0064] 2.4 Construction of restriction enzyme sites
[0065] The double enzyme digestion system of the target gene and the vector pCDNA 3.1-KB is shown in the table below.
[0066] Element Dosage (μL) Purified fragments or vectors 42 Endonuclease buffer 5 EcoRI (rapid endonuclease) 1.5 Rapid endonuclease XhoI 1.5
[0067] Following the above system, each component was added sequentially to a 200 μL centrifuge tube under sterile conditions. After gently mixing with a pipette, the mixture was incubated at 37°C for 2 hours. The enzyme digestion reaction was terminated by adding 6 μL of 10× DNA loading buffer. The product after the double enzyme digestion reaction was purified to obtain the target gene and vector pCDNA3.1-KB containing the double enzyme digestion sites.
[0068] 3. Ligation of the target gene fragment and the expression vector pCDNA 3.1-KB
[0069] The ligation system for the target gene and expression vector is shown in the table below:
[0070] Element Dosage (μL) pCDNA3.1-KB vector digestion and purification fragment 5 Cloning and enzyme digestion to purify the fragment (target gene) 2 T4 DNA ligase 2 buffer solution 1
[0071] According to the components and dosages in the table above, add the different reagents sequentially to 200 μL LEP tubes. Gently mix with a pipette and incubate overnight at 16°C. Ligate the target fragment to the vector plasmid to form a complete closed circular structure, obtaining the vector expression fragment shown in the figure below. This forms the expression vector pCDNA3.1-LJ containing the recombinant gene sequence. Figure 1 As shown.
[0072] 4. Expression of recombinant gene sequences:
[0073] a. Transfection with recombinant expression vector pCDNA3.1-LJ
[0074] The HEK293 cell concentration was adjusted to 10. 6 Cells / mL, transfer 50mL to a new 250mL cell shake flask. Take 2.5mL of serum-free 293 medium and add 150μL of liposome 3000 transfection reagent; take another 2.5mL of serum-free 293 medium and add 100μL of vector plasmid and 200μL of P3000 reagent; mix the liquids from the above two steps, let stand at room temperature for 5min, and then add to the cell shake flask. Incubate on a shaker for 6h (37℃, 130r / min, CO2 concentration 5%), then centrifuge at 100g for 5min, discard the supernatant, resuspend the pellet in preheated cell culture medium, incubate on a shaker for 36h, centrifuge at 12000g for 10min, discard the pellet, and keep the supernatant.
[0075] b. Antibody purification
[0076] The collected samples were purified using an AKATA purification system. The purification steps were as follows: The Protein A column was equilibrated with 100 mmol PBS phosphate buffer (pH 7.2–7.4) and the machine was kept running until the baselines of A260, A280, and conductivity stabilized and the parameters returned to zero. The PBS was replaced with the sample to be purified, and then impurities were eluted with washing buffer A (50 mmol Tris + 1 mol NaCl, pH 8.0). Impurities were eluted again with washing buffer B (50 mmol MES, pH 8.0). Finally, the target protein was collected by elution with 0.1 mol glycine (pH 2.7), which is the recombinant antibody.
[0077] 5. Marking of target gene expression products
[0078] a. Mix the original antibody and recombinant antibody with fluorescein at a ratio of 1 mg antibody to 0.1 mg fluorescein and mix well. Then add 20 μL of freshly prepared EDC solution (concentration of 50 mg / ml), mix well, and incubate on a mixer for 2-4 hours.
[0079] b. Dialyze the incubated antibody overnight in 20 mmol PB solution at 4°C. The next day, remove the dialyzed antibody-fluorescein for immunochromatographic assay.
[0080] Based on the above labeling method, ten groups of antigens at different concentrations were tested, and the detection results of the original antibody and recombinant antibody at different concentrations were obtained. The specific results are shown in the table below:
[0081]
[0082] like Figure 3 As shown, the comparison of the above ten sets of experimental results reveals that after recombinant antibody and fluorescent labeling, the detection sensitivity of antibody antigen is increased by about 5-6 times, which can more sensitively detect changes in trace substances in the body.
[0083] This invention improves the sensitivity of antibody-antigen detection during labeling by adding multiple amino acids to the free end of the antibody's Fc stable region, thereby increasing its binding to fluorescein. Figure 2 As shown, by comparing the color intensity, it can be found that the amount of fluorescein bound to the FC end of the antibody modified in this invention is significantly increased.
[0084] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this patent should be determined by the appended claims. SEQUENCE LISTING <110> BaseBio Technology Co., Ltd. <120> A method for adding polyamino acid fragments to the free end of the antibody stable region <130> 20250603 <160> 1 <170> PatentIn version 3.5 <210> 1 <211> 54 <212> DNA <213> Artificial synthesis <400> 1 aagaagaaga agaaacgcaa gaagaagaag aaacgcaaga agaagaagaa acgc 54
Claims
1. A method of adding a polyamino acid fragment to the C-terminus of an antibody Fc region, characterized by, Includes the following steps: Obtain the gene sequence corresponding to the target antibody; The gene sequence corresponding to the polyamino acid fragment is added to the gene sequence corresponding to the C-terminus of the Fc region of the target antibody to obtain the recombinant gene sequence. The recombinant gene sequence was constructed into an expression vector and expressed to obtain a target antibody whose C-terminus of the Fc region contains polyamino acids. The polyamino acid fragment contains multiple free amino groups; The base sequence corresponding to the polyamino acid fragment is: AAGAAGAAGAAGAAACGCAAGAAGAAGAAGAAACGCAAGAAGAAGAAGAAACGC.
2. The method of claim 1, wherein the polynucleotide is selected from the group consisting of SEQ ID NOs: 1-4. The gene sequence corresponding to the target antibody is either the variable region gene sequence of the target antibody or the full gene sequence of the target antibody.
3. The method for adding a polyamino acid fragment to the C-terminus of the Fc region of an antibody according to claim 2, characterized in that, The recombinant gene sequence is obtained using the following methods: Obtain the variable region gene sequence of the target antibody; The variable region gene sequence was constructed into an expression vector to obtain a recombinant expression vector; Obtain the gene sequence of the Fc region of the homologous antibody; The gene sequence corresponding to the polyamino acid fragment was added to the gene sequence of the Fc region of the homologous antibody to obtain the modified gene sequence. The modified gene sequence and the variable region gene sequence of the target antibody are ligated in a recombinant expression vector to obtain an expression vector containing the recombinant gene sequence.
4. The method for adding a polyamino acid fragment to the C-terminus of the Fc region of an antibody according to claim 3, characterized in that, Adding the gene sequence corresponding to the polyamino acid fragment to the gene sequence of the Fc region of the homologous antibody, including: Initial primers for obtaining the gene sequence of the Fc region of the homologous antibody; The target primer is obtained by adding a base sequence corresponding to a polyamino acid fragment to the 5' end of the initial primer. By using target primers to amplify a template containing the Fc region of a homologous antibody through PCR, a modified gene sequence containing a polyamino acid fragment at the C-terminus of the Fc region of the homologous antibody was obtained.
5. The method for adding a polyamino acid fragment to the C-terminus of the Fc region of an antibody according to claim 3, characterized in that, The homologous antibody is a mouse, rabbit, or sheep antibody.
6. The method for adding a polyamino acid fragment to the C-terminus of the Fc region of an antibody according to claim 4, characterized in that, The template is a subcloning vector containing a mouse Fc fragment gene.
7. The method for adding a polyamino acid fragment to the C-terminus of the Fc region of an antibody according to claim 4, characterized in that, The target primer contains restriction endonucleases at both ends. EcoRI and XhoI The restriction enzyme sites.
8. The method for adding a polyamino acid fragment to the C-terminus of the Fc region of an antibody according to claim 1, characterized in that, The gene expression vector is either pCDNA3.1 expression vector or pCDNA3.4 expression vector.