Molecular markers related to sheep growth traits and their applications
By sequencing the sheep FADS3 gene and analyzing its polymorphic sites, specific primer pairs and KASPar primer pairs were designed, which enabled rapid identification of fast-growing sheep, solved the problem of genetic improvement of sheep growth traits, and improved breeding efficiency and economic benefits.
Patent Information
- Application Number
- CN202210821797.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-12
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2042-07-12
AI Technical Summary
Currently, there is little research on the sheep FADS3 gene, and its role in growth and development is unclear, which has affected the genetic improvement of sheep growth traits and the rapid breeding process.
By sequencing and analyzing the sheep FADS3 gene, the A/C polymorphic site at position 111 was discovered. Specific primer pairs and KASPar primer pairs were designed, and a molecular marker detection method was established. PCR amplification and fluorescence signal detection were used to screen out fast-growing sheep.
It achieves the rapid and accurate identification of fast-growing sheep, shortens the breeding process, improves the efficiency of genetic improvement of sheep growth traits, and reduces testing costs.
Smart Images

Figure BDA0003742544080000081 
Figure BDA0003742544080000091 
Figure HDA0003742544090000011
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular markers, and particularly relates to a FADS3 gene segment as a molecular marker affecting sheep growth traits and application thereof. Background Art
[0002] Currently, little research has been conducted on the sheep FADS3 gene. FADS3 (fatty acid desaturase 3) is a protein-coding gene that belongs to the fatty acid desaturase (FADS) gene family. Within this gene family, FADS1 and FADS2 genes are involved in essential fatty acid metabolism, which is closely related to animal growth. The FADS3 gene shares high homology and structural similarity with FADS1 and FADS2, suggesting that it may have similar functions and play an important role in growth and development. However, the specifics of its function remain unclear.
[0003] my country has become one of the world's largest producers of mutton, and the mutton industry has enormous potential for development. Mutton is also popular in the market because it is lower in fat and cholesterol than pork, higher in protein, and has a more delicate texture and is easier to digest. Huyang (Huyang) is one of the most important sheep breeds, characterized by early sexual maturity, year-round estrus, good lactation, rapid growth, and strong tolerance to roughage and stress. Huyang are primarily found along the Yangtze River.
[0004] This study sequences and analyzes the FADS3 gene to explore the relationship between its different genotypes and sheep growth, aiming to provide genetic material for genetic improvement to enhance sheep growth, accelerate the cultivation of new fast-growing, high-quality meat sheep breeds with independent intellectual property rights, and shorten the breeding process. Summary of the Invention
[0005] To address the above-mentioned technical problems, the present invention provides a molecular marker associated with sheep growth traits and its application. The molecular marker of the present invention is amplified from the sheep FADS3 gene, and its nucleotide sequence is shown in SEQ ID NO. 1. By amplifying and sequencing the DNA sequence of the sheep FADS3 gene, polymorphic sites in the FADS3 gene are identified, and the correlation between different genotypes and sheep growth traits is analyzed. A detection method for molecular markers containing polymorphic sites is established, and this molecular marker can be applied to the breeding of new, high-quality meat sheep breeds.
[0006] One object of the present invention is to provide a molecular marker associated with sheep growth traits, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the M at position 111 represents A or C, and since the above sequence has an A / C mutation at the 111th base, it leads to the A / C polymorphism of the sheep FADS3 gene at this site.
[0007] Among them, SEQ ID NO.1: TACTATGTGCCAGGCTCCGAATTCAGCGCTTGATTTATAGACAGTCCCTCTTTGAATCCTCATGATACCTCTATGGGACAGGTACTGTTATTATTTCCATTTTACAGATGMGAAAACAGACTCAGAGGGGCAAAATGACTTGAAATTAAGTGATGGGTCTCGGATTTGGATTCACAGCCCATGCTCTTA ACCACCTGCTCCACTGCCCCTTAGCTGCTTATTTCATTCATTCATTCATTCTTCAATTATTGACTCACTAGATTCAACAGCAGATACCAGCAAGCATATCCCATGTGCGAAACCTTGACCTAACCTCTGAAGATACAGCTATGAACAGAAAATCTGCAGGGAGGGACTTCCCTGACAGTCCAGTGGTTAAGGCT
[0008] The second object of the present invention is to provide a primer set for detecting the above-mentioned molecular markers, preferably, comprising an upstream primer and a downstream primer, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0009] SEQ ID NO.2: TACTATGTGCCAGGCTCCGAA
[0010] SEQ ID NO.3: AGCCTTAACCACTGGACTGTCA
[0011] The third object of the present invention is to provide a KASPar primer set for detecting the above molecular markers, which includes two forward primers and a universal reverse primer, and the nucleotide sequences thereof are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.
[0012] SEQ ID NO.4: gaaggtgaccaagttcatgctttgcccctctgagtctgttttct
[0013] SEQ ID NO.5: GAAGGTCGGAGTCAACGGATTGCCCCTCTGAGTCTGTTTTCG
[0014] SEQ ID NO.6: GACAGGTACTGTTATTATTTCCATTTTACAG
[0015] The present invention also provides a kit for detecting the above molecular markers, wherein the kit comprises a PCR primer pair or a KASPar primer pair for detecting the above molecular markers.
[0016] A fourth object of the present invention is to provide a method for detecting a molecular marker associated with sheep growth traits, wherein the nucleotide sequence of the molecular marker is as shown in SEQ ID NO. 1, wherein W at position 558 bp represents A or T. The method comprises detecting sheep genomic DNA using the above-mentioned primer pair or kit, and the specific detection method comprises the following steps:
[0017] a) amplifying sheep genomic DNA using the above primer pair, KASPar primer pair, or a kit comprising the above primer pair;
[0018] b) identifying the polymorphic sites of the amplified product obtained in step a).
[0019] Wherein, in step b), the above-mentioned typing and identification methods include but are not limited to direct sequencing method, probe method, gene chip method, and high-resolution melting curve method.
[0020] The method for detecting molecular markers related to sheep growth traits using the above primer pair comprises the following steps:
[0021] a) extracting genomic DNA from sheep blood as a sample, and performing high-throughput water-bath PCR amplification using primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6;
[0022] b) After amplification, the fluorescence signal was detected using the BMG PHERAstar instrument and the typing results were checked.
[0023] The application of the detection method of the molecular marker primer pair or detection kit as described above in the detection of sheep growth traits can determine the level of sheep growth traits by detecting the above-mentioned molecular markers in the genomic DNA of the sheep to be tested and analyzing the type of polymorphic sites, thereby screening out fast-growing sheep.
[0024] A fifth object of the present invention is to provide a method for using the molecular marker, primer pair, or detection kit described above in sheep breeding. By using the primer pair or kit to amplify and detect genomic DNA from sheep, the genotype of the FADS3 gene of the test sample is determined, thereby enabling the selection of fast-growing sheep breeds.
[0025] Finding the mutation sites of genes and discovering the relationship between genes and traits through association analysis is an important means of studying gene function and is also the basis for marker-assisted selection.
[0026] The present invention performs PCR amplification and sequencing on the FADS3 gene of the Hu sheep, a representative sheep breed, and discovers an A / C polymorphic site at the 111th position of the amplified fragment. By detecting the polymorphism of 1,195 Hu sheep and establishing a least squares model, the present invention determines a molecular marker associated with sheep growth traits. The molecular marker can be used for the breeding of fast-growing sheep, providing an effective genetic engineering means for the genetic improvement of sheep growth traits, and has significant practical application value.
[0027] The present invention detects molecular markers by designing KASPar primers. KASP is the abbreviation of competitive allele-specific PCR (Kompetitive Allele Specific PCR). This technology does not require the synthesis of specific fluorescent probes for each SNP site. Instead, based on its own unique ARM PCR principle, all site detections are ultimately amplified using universal fluorescent primers, greatly reducing reagent costs while retaining the accuracy of Taqman probe standards. This provides a simple, accurate, and low-cost operating method for the detection of molecular markers of the present invention.
[0028] The beneficial effects of the present invention are:
[0029] The present invention provides molecular markers associated with sheep growth traits and their A / C polymorphic sites. By determining the genotype of the polymorphism, it is possible to effectively identify fast-growing sheep, providing an effective detection method for the breeding of fast-growing sheep. By detecting the molecular markers and the polymorphic sites that cause them, the present invention can be used to select sheep homozygous for the AA gene for breeding, thereby improving sheep growth traits, shortening the breeding process, and contributing to increased economic benefits in the livestock and poultry industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1 This is a gel electrophoresis diagram of the sheep FADS3 gene fragment used as a molecular marker in the present invention.
[0031] Figure 2 This is the sequencing result of the sheep FADS3 gene mutation site in the present invention, and the box is the mutation site.
[0032] Figure 3 This is the KASPar SNP typing result of the sheep FADS3 gene mutation site in the present invention. DETAILED DESCRIPTION
[0033] The present invention is described in detail below with reference to examples, and the advantages of the present invention will become clearer as the description progresses. It should be understood that the scope of protection claimed by the present invention is not limited by the specific embodiments described. The specific examples provided by the present invention are merely exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art may modify the specific embodiments of the present invention or make equivalent substitutions for some technical features with reference to the description in the specification. Such improvements and substitutions that do not require creative work should also fall within the scope of protection of the claims attached to the present invention.
[0034] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents used in the examples are of analytical grade or above.
[0035] Example 1 Amplification of FADS3 gene
[0036] (1) Primer design
[0037] Using sheep FADS3 gene DNA (GenBank accession number: NC_040272.1) as a template, a pair of primers were designed using Oligo7.0 software: upstream primer and downstream primer. The primer sequences are as follows:
[0038] Upstream primer (SEQ ID NO. 2): 5'-TACTATGTGCCAGGCTCCGAA-3'
[0039] Downstream primer (SEQ ID NO.3): 5'-AGCCTTAACCACTGGACTGTCA-3'
[0040] (2) Amplification and sequencing of the FADS3 gene
[0041] Genomic DNA extracted from sheep whole blood cells was used as a DNA template for PCR amplification. The reaction system consisted of 35 μL of 2× PCR Master Mix (17.5 μL), 1 μL of upstream primer (10 μmol / L), 1 μL of downstream primer (10 μmol / L), and 1 μL of DNA template, which was then made up to 35 μL with ddH2O. PCR amplification reaction conditions were: 94°C for 3 min;
[0042] 94℃30s, 54.5℃30s, 72℃30s, 35 cycles,
[0043] Finally, heat at 72℃ for 10 minutes.
[0044] The PCR amplification products were detected by 1.5% agarose gel electrophoresis. Figure 1As shown in the figure, lane M: DL2000 Marker, lanes 1-10: FADS3 gene amplification results. The amplified PCR fragment was sequenced, and the results showed that a 383 bp specific amplified fragment was obtained, the specific nucleotide sequence of which is shown in SEQ ID NO. 1. There is a polymorphic site in this fragment, specifically, M at the 111 bp site is A or C, that is, the amplified FADS3 gene fragment (SEQ ID NO. 1) has an A / C polymorphism at the 111 bp site (see Figure 2 ).
[0045] Among them, SEQ ID NO.1:
[0046] TACTATGTGCCAGGCTCCGAATTCAGCGCTTGATTTATAGACAGTCCCTCTTTGAATCCTCATGATACCTCTATGGGACAGGTACTGTTATTATTTCCATTTTACAGATGMGAAAACAGACTCAGAGGGGCAAAATGACTTGAAATTAAGTGATGGGTCTCGGATTTGGATTCACAGCCCATGCTCTTAAC CACCTGCTCCACTGCCCCTTAGCTGCTTATTTCATTCATTCATTCATTCTTCAATTATTGACTCACTAGATTCAACAGCAGATACCAGCAAGCATATCCCATGTGCGAAACCTTGACCTAACCTCTGAAGATACAGCTATGAACAGAAAATCTGCAGGGAGGGACTTCCCTGACAGTCCAGTGGTTAAGGCT
[0047] DNA sequence homology search and identification:
[0048] The sequenced DNA was compared with known physiologically functional genes published in the GenBank database using BLAST (Basic Local Alignment Search Tool) software from the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and determine the functional information of the DNA sequence. The search results showed that the sequence shared 99% partial sequence identity with the ovine FADS3 gene (GenBank accession number: NC_040272.1).
[0049] Example 2 Establishment of Genotyping Detection Method
[0050] 1) Primer sequence design
[0051] A KASPar primer pair was designed for the A / C polymorphic site of the amplified fragment in Example 1, thereby being used for specific detection of the polymorphic site. The nucleotide sequence of the designed KASPar primer pair is:
[0052] Forward primer A1 (SEQ ID NO.4) for detecting Allele C:
[0053] 5'-GAAGGTGACCAAGTTCATGCTCCGTTAAACATTTTTGGAAAAATTGCTTTTA-3';
[0054] Forward primer A2 (SEQ ID NO.5) for detecting Allele A:
[0055] 5'-GAAGGTCGGAGTCAACGGATTGCCCCTCTGAGTCTGTTTTCG-3';
[0056] Universal reverse primer C (SEQ ID NO. 6): 5'-GACAGGTACTGTTATTATTTCCATTTTACAG-3'.
[0057] The above primers were synthesized by Beijing Sangon Biotechnology Co., Ltd. Each primer in the KASPar primer pair was diluted to 10 μmol / L and mixed in a volume ratio of 12:12:30 for forward primer A1:forward primer A2:reverse primer C.
[0058] 2) DNA quality control
[0059] Genomic DNA can be extracted from sheep whole blood using a DNA extraction kit. The quality of the extracted genomic DNA is tested using 1% agarose gel electrophoresis and Nanodrop 2100. Qualified DNA requires the following: (1) Agarose gel electrophoresis shows a single DNA band with no obvious smearing. (2) Nanodrop 2100 detection shows A260 / 280 between 1.8-2.0; A260 / 230 between 1.8-2.0; and no obvious light absorption at 270nm. Based on the KASPar detection technology of LGC (UK) and the genome size, the DNA dosage is calculated to be 10-20ng / sample. The extracted genomic DNA is diluted to a concentration of 10-20ng / μL and used as a DNA template.
[0060] 3) Genotyping
[0061] First, use the K-pette dispensing workstation to add 1.5 μL of the diluted test DNA template (10-20 ng / μL) and the blank control (no template control, NTC, using sterile water) into a 384-well reaction plate, and dry it at 60°C for 30 minutes (drying oven, LGC Company) to convert the DNA into dry powder for use.
[0062] Each primer in the above KASPar primer pair was diluted to 10 μmol / L and mixed at a volume ratio of 12:12:30 (forward primer A1:forward primer A2:reverse primer C) to prepare a primer mixture for later use.
[0063] Then, using the Kraken operating system, a Meridian sample station was used to add 1× Master Mix (1536 microplate, Part No. KBS-1016-011) and primer mixture to each reaction well. Immediately after the mix was dispensed, the microplate was sealed using a Kube heat sealer and then a Fusion laser sealer. High-throughput waterbath PCR amplification was performed using a Hydrocycler. The PCR reaction was performed in a high-throughput waterbath system using the following procedure:
[0064] Initial denaturation at 94°C for 15 minutes;
[0065] 94°C, 20 seconds (denaturation) - 61°C-55°C, 1 minute (annealing & extension), 10 cycles of touch-down amplification, decreasing 0.6°C per cycle;
[0066] Amplification was continued for 26 cycles: 94°C, 20 seconds (denaturation) - 55°C, 60 seconds.
[0067] After amplification, the BMG PHERAstar instrument was used to detect the fluorescence signal and check the typing. The specific results are as follows Figure 3 Each dot in the figure represents a sample to be tested. The red dot near the left indicates that the locus is a homozygous genotype "CC"; the green dot near the middle indicates that the locus is a heterozygous genotype "CA" or "AC"; and the blue dot near the right indicates that the locus is a homozygous genotype "AA".
[0068] 4) Application of the molecular markers of the present invention in association analysis of sheep growth traits
[0069] A total of 1,195 Hu sheep were tested for polymorphism, their genotypes were determined, and the least squares model described below was established to conduct association analysis between genotype and growth traits.
[0070] Y ijk=μ+Genotype i +P j +S k +ε ijk
[0071] Among them, Y ijk is the observed value of the growth trait, μ is the overall mean, and Genotype i is the genotype effect, P j is the batch effect, S k is the seasonal effect, ε ijk is a random error, assuming that ε ijk They are independent of each other and obey N(0,σ2) distribution.
[0072] Genotyping results at position 111 of SEQ ID NO. 5 showed that among the 1195 individuals, 370 had the AA genotype, 590 had the AC genotype, and 235 had the CC genotype. The results of the genotype-trait association analysis are shown in Table 1 (results are expressed as mean ± standard deviation).
[0073] Table 1 Association analysis between FADS3 gene polymorphism and growth traits in Hu sheep
[0074]
[0075]
[0076] Note: Weight represents body weight (kg); Height represents height; Length represents length; and Chest represents chest circumference (cm). Weight80 represents weight at 80 days, and Weight100 represents weight at 100 days. Other data are represented similarly. Data in the same row with different superscripts indicate significant differences (P < 0.05); data with the same superscript or no superscript indicate nonsignificant differences (P > 0.05).
[0077] The results showed that as the measurement period increased, the A / C mutation site at position 111, as shown in SEQ ID NO.1, was significantly correlated with sheep growth traits. Sheep carrying the AA genotype had better weight, height, body weight, and chest circumference than sheep carrying the CC genotype. This indicates that the A allele is the dominant allele. During breeding, AA genotype sheep are used as breeding stock and crossed with other sheep. In particular, artificial insemination using semen from AA genotype rams can greatly improve breeding efficiency, resulting in a flock that has advantages in weight, height, chest circumference, and body length, as well as a faster growth rate.
Claims
1. Application of a primer set for detecting molecular markers related to Hu sheep growth traits in Hu sheep breeding, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQID NO.1, in which the M at the 111th base represents A or C. The mutation leads to the A / C polymorphism of the molecular marker. Among them, sheep carrying the AA genotype are superior to sheep carrying the CC genotype in weight at 100 days, height from 100 to 140 days, body length from 80 to 100 days, and chest circumference at 160 days. The purpose of breeding is to select fast-growing Hu sheep.
2. Application of a PCR primer set for detecting molecular markers related to Hu sheep growth traits in Hu sheep breeding, characterized in that: The PCR primer set includes an upstream primer and a downstream primer, and their nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the M at the 111th base represents A or C. This mutation causes the A / C polymorphism of the molecular marker, among which sheep carrying the AA genotype have better weight at 100 days, height at 100-140 days, body length at 80-100 days, and chest circumference at 160 days than sheep carrying the CC genotype; the purpose of breeding is to select fast-growing Hu sheep.
3. Application of the KASPar primer set for detecting molecular markers related to Hu sheep growth traits in Hu sheep breeding, characterized in that: The KASPar primer set includes two forward primers and a universal reverse primer, and its nucleotide sequences are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the M at the 111th base represents A or C. This mutation results in the A / C polymorphism of the molecular marker. Among them, sheep carrying the AA genotype have better weight at 100 days, height from 100 to 140 days, body length from 80 to 100 days, and chest circumference at 160 days than sheep carrying the CC genotype; the purpose of breeding is to select fast-growing Hu sheep.
4. Application of a detection kit for detecting molecular markers related to Hu sheep growth traits in Hu sheep breeding, characterized in that: The detection kit comprises a PCR primer set or a KASPar primer set, wherein the PCR primer set comprises an upstream primer and a downstream primer, and the nucleotide sequences thereof are shown in SEQ ID NO.2 and SEQ ID NO.3; the KASPar primer set comprises primers with nucleotide sequences shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the M at the 111th base thereof represents A or C, and the mutation results in the A / C polymorphism of the molecular marker, wherein sheep carrying the AA genotype have better weight at 100 days, height at 100-140 days, body length at 80-100 days, and chest circumference at 160 days than sheep carrying the CC genotype; the purpose of breeding is to select fast-growing Hu sheep.
5. A method for detecting molecular markers related to Hu sheep growth traits for use in Hu sheep breeding, comprising the following steps: 1) using a PCR primer set with nucleotide sequences such as SEQ ID NO. 2 and SEQ ID NO. 3 or a KASPar primer set with nucleotide sequences such as SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, or using a kit containing the aforementioned PCR primer set or KASPar primer set, amplifying Hu sheep genomic DNA; 2) performing typing identification on the amplified product obtained in step 1) where M represents A or C at the 111th base of the sequence shown in SEQ ID NO. 1; wherein, Sheep carrying the AA genotype had better weight at 100 days, height at 100-140 days, body length at 80-100 days, and chest girth at 160 days than sheep carrying the CC genotype; The purpose of breeding is to select fast-growing Hu sheep.
6. The use according to claim 5, characterized in that The typing and identification method in step 2) is direct sequencing or fluorescence method.
7. The use according to claim 5, characterized in that PCR amplification was performed using KASPar primer pairs, and after amplification, the typing results were determined by detecting the fluorescence signal.
8. Molecular markers related to Hu sheep growth traits, or PCR primer pairs or KASPar primer sets for detecting molecular markers related to Hu sheep growth traits, or use of methods for detecting molecular markers related to Hu sheep growth traits in detecting growth traits related to Hu sheep; characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein the M at the 111th base represents A or C, and the mutation results in the A / C polymorphism of the molecular marker. The growth traits of the Hu sheep include weight at 100 days, height at 100-140 days, body length at 80-100 days, and chest circumference at 160 days; Among them, sheep carrying the AA genotype have better weight at 100 days, height from 100 to 140 days, body length from 80 to 100 days, and chest circumference at 160 days than sheep carrying the CC genotype; the nucleotide sequences of the PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequences of the KASPar primer pairs are shown in SEQ ID NO.4-6.