A microRNA agomir that inhibits schistosome oviposition and its applications

Abstract

The application discloses a microRNA agomir for inhibiting schistosome oviposition and application thereof, the microRNA agomir can improve the expression amount of miR-1 in schistosomes, and the miR-1 gene sequence is shown as SEQ ID NO:1. Through an in-vitro culture test, the action time, action frequency, action dosage form and dosage of the microRNA agomir for targeted mature schistosomes are determined, it is found that the microRNA agomir can greatly increase the expression amount of miR-1 in schistosomes, thereby destroying the normal morphological structure of the reproductive organs (testis of male schistosomes and ovary of female schistosomes) of schistosomes and inhibiting oviposition of female schistosomes. It is first proved that the miR-1 can be used as a potential drug target for resisting schistosomes. The agomir is expected to become a substitute for resisting schistosomes and has a wide development and application prospect.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and biomedicine, and in particular to a microRNA agomir that can disrupt the normal structure of the reproductive organs of schistosomes and inhibit oviposition in female schistosomes, and its applications. Background Technology

[0002] Schistosomiasis is a neglected tropical disease that seriously endangers the health of people in endemic areas and hinders socio-economic development. It is prevalent in 78 countries and regions across Africa, Asia, and the Americas, with Schistosomiasis mansoni, Schistosomiasis haematobium, and Schistosomiasis japonicus being the most widespread and harmful. Globally, 239 million people are infected with schistosomiasis, and nearly 800 million are at risk of infection. In 2016, the global burden of schistosomiasis was 1.86 million disability-adjusted life years. In my country, Schistosomiasis japonicus is prevalent, mainly distributed in the Yangtze River basin and 12 provinces (municipalities and autonomous regions) south of it. Currently, praziquantel remains the only effective drug for treating schistosomiasis; however, it is ineffective in killing juvenile worms, cannot prevent reinfection, and large-scale, repeated praziquantel chemotherapy has led to drug resistance in some endemic areas. Therefore, research into new therapeutic targets and candidate vaccine molecules for schistosomiasis is urgently needed.

[0003] Schistosomiasis is a dioecious species, with the eggs laid by the female being the primary cause of disease and transmission. The eggs deposited in the liver and intestinal tissues trigger a series of immune responses that can lead to illness, loss of labor capacity, and even death. Simultaneously, eggs excreted in feces and released into water hatch into miracidia that infect snails, a crucial link in the transmission of schistosomiasis. Therefore, effectively inhibiting oviposition by female worms is of paramount importance for controlling schistosomiasis.

[0004] MicroRNAs (miRNAs), important members of the small non-coding RNA (sncRNA) family, are small ribonucleic acid molecules (20–24 nt) originating from hairpin transcripts. They are widely present in eukaryotic cells and viruses and play important roles in various physiological and pathological processes, regulating growth, development, differentiation, proliferation, death, and metabolism in numerous organisms. In most cases, mature miRNAs, through their 5' 2–8 nt seed sequence, recognize the complementary sequence of the 3' UTR of target mRNA, forming a miRNA RISC complex, and inhibit gene expression through translational repression or induction of mRNA degradation.

[0005] Over the past decade, a surge in research on Schistosoma miRNAs has suggested their potential role in processes such as sex differentiation, synapsis, maturation, and reproduction. To date, the miRBase database contains 79 *Schistosoma japonicum* miRNAs and 225 *Schistosoma mansoni* miRNAs. Numerous studies, using small RNA sequencing, have revealed that *Schistosoma microRNA-1* (miR-1) expression is lower in sexually mature female *Schistosoma mansoni*, *Schistosoma haematobium*, and *Schistosoma japonicum* than in males. In sexually infected female *Schistosoma japonicum* with fully developed reproductive organs (capable of oviposition), miR-1 expression is lower than in sexually infected females with incomplete reproductive organ development (not capable of oviposition) at the same stage. *Schistosoma japonicum* begins oviposition in a suitable definitive host approximately 24 days after infection. Analysis of *Schistosoma japonicum* miRNA expression profiles at different developmental stages in mice revealed that miR-1 expression gradually decreases in females after oviposition. Therefore, miR-1 plays a negative regulatory role in oviposition in sexually mature females.

[0006] miRNA agomir is a double-stranded miRNA that has been artificially labeled and chemically modified. It enhances the expression of endogenous miRNAs by mimicking them, thereby regulating gene expression in organisms. Generally, miRNA agomir is modified on the antisense strand, with two thiocyanate backbones at the 5' end, four thiocyanate backbones and cholesterol at the 3' end, and a full-strand methoxy group. This modification method results in higher affinity for the cell membrane, greater stability, and a longer duration of regulatory function in vivo. This invention synthesizes *Schistosoma japonicum* miR-1 agomir. In vitro culture revealed that this miR-1 agomir significantly increases miR-1 expression in both male and female *Schistosoma japonicum*, disrupts the normal morphology of reproductive organs, and inhibits oviposition in females. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention aims to provide a microRNA agomir that inhibits schistosome oviposition and its application. This miRNA agomir can significantly increase the expression level of miR-1 in schistosomes, disrupt the normal morphological structure of male testes and female ovaries, and inhibit oviposition in females. This invention is the first to demonstrate that miR-1 can serve as a potential drug target for anti-schistosome treatment.

[0008] To address the aforementioned technical problems, this invention provides a microRNA agomir that inhibits oviposition in schistosomes, wherein the microRNA agomir can increase the expression level of miR-1 in schistosomes.

[0009] Specifically, the miR-1 gene sequence is shown in SEQ ID NO: 1.

[0010] Specifically, the schistosome mentioned is Schistosoma japonicum.

[0011] Specifically, the microRNA agomir is prepared as a PEI+miR-1 agomir complex solution using PEI as the transfection reagent and sterile physiological saline as the solvent.

[0012] Specifically, the preparation method of the PEI+miR-1 agomir composite solution is as follows:

[0013] (1) Accurately weigh 50mg of PEI powder, add 45ml of deionized water, dissolve in boiling water bath and cool, adjust pH to 7.0 with dilute hydrochloric acid, and finally make up to 50ml with deionized water to prepare 1μg / μL PEI stock solution. After sterilization by filtration through a 0.22μm filter membrane, dispense and freeze at -20℃ to avoid repeated freeze-thaw cycles.

[0014] (2) Take the synthesized miR-1 agomir powder and dissolve it in sterile physiological saline to make a final concentration of 0.1 μg / μL;

[0015] (3) Take 1 μg / μL of PEI stock solution, dilute it with sterile physiological saline to 0.1 μg / μL, let it stand at room temperature for 5 min, then take an equal volume of miR-1 agomir solution and PEI solution, mix them, and let them stand at room temperature for 20 min to form a composite solution of PEI+miR-1 agomir.

[0016] Specifically, miR-1 can serve as a potential drug target for anti-schistosomiasis drugs.

[0017] The present invention also provides the use of the microRNA agomir as described in claim 1 in the preparation of anti-schistosomiasis drugs.

[0018] Specifically, the microRNA agomir can disrupt the normal morphological structure of the reproductive organs of schistosomes.

[0019] Specifically, the microRNA agomir can inhibit oviposition in female insects.

[0020] Specifically, the microRNA agomir can increase the expression levels of apoptosis-related genes in schistosomes.

[0021] Specifically, the dosage form of the drug is injection, oral preparation, lozenge, spray, suspension, capsule, tablet, pill, or granule.

[0022] Specifically, the drug also includes one or more of pharmaceutically acceptable carriers, diluents, or excipients.

[0023] This invention provides a miR-1 agomir that significantly increases the expression level of miR-1 in Schistosoma. Through in vitro culture experiments, the duration, frequency, dosage, and formulation of action against sexually mature Schistosoma were determined. It was found that it can disrupt the normal morphological structure of the reproductive organs of Schistosoma (testes in males and ovaries in females) and inhibit oviposition in females. This agomir is expected to become an alternative means of combating Schistosoma and has broad prospects for development and application. Attached Figure Description

[0024] To more clearly illustrate the technical solution of the present invention, the accompanying drawings used in the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 A: Schematic diagram comparing the expression levels of miR-1 in male and female Schistosoma japonicum worms at 24 and 28 days post-infection in mice (dpi: days post-infection);

[0026] Figure 1 B: Anatomical diagram of sexually mature male and female Schistosoma japonicum (Testis: testis; Ovary: ovary; Vitellaria: vitelline gland; Anterior: anterior end; Posterior: posterior end);

[0027] Figure 1 C: Schematic diagram comparing the expression levels of miR-1 in different parts of sexually mature male and female Schistosoma japonicum (*P<0.05,**P<0.01,ns:not significant);

[0028] Figure 2 Schematic diagram of the action time, frequency, mode of action, and dosage of miR-1 agomir, which inhibits oviposition of sexually mature schistosomes;

[0029] Figure 3 A: Statistical diagram of changes in miR-1 expression levels in male and female Schistosoma after treatment with miR-1 agomir (**P<0.01,****P<0.0001);

[0030] Figure 3 B: Statistical diagram of changes in oviposition rate of female schistosomes after miR-1 agomir treatment (**P<0.01);

[0031] Figure 4Effects of miR-1 agomir on the normal morphology of reproductive organs in male and female Schistosoma worms observed under a regular microscope (T: testis; O: ovary; V: vitelaria; M: male; F: female; scale bar: 100 μm for males; 200 μm for females; dashed lines indicate the outlines of the testis and ovary; the fraction in the upper right corner indicates the proportion of worms with similar morphology to the total number of worms observed).

[0032] Figure 5 Effects of miR-1 agomir on the normal morphological structure of the reproductive organs of male and female Schistosoma schistosomes under laser confocal microscopy (Testis; Ovary; Vitellaria; scale bar, 50 μm; dashed lines indicate the outlines of the testis and ovary, arrows indicate the cavitary structures in the ovary; the fraction in the upper right corner indicates the proportion of worms with similar morphology to the total number of worms observed).

[0033] Figure 6 Schematic diagram of changes in the expression levels of apoptosis-related genes in male and female Schistosoma after treatment with miR-1 agomir (*P<0.05,**P<0.01,***P<0.001,ns:not significant). Detailed Implementation

[0034] The technical solutions of the present invention will now be clearly and completely described with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0035] The RNA oligonucleotides and primers used for qRT-PCR in the following examples are shown in Tables 1 and 2 below;

[0036] Table 1. RNA oligonucleotides used for transfection

[0037] Gene Sequence (5'-3') miR-1 UGGAAUGUGGCGAAGUAUGGUC, SEQ ID NO: 1 scrambled UUGUACUACACAAAAGUACUG, SEQ ID NO: 2

[0038] Table 2. Primers used for qRT-PCR

[0039]

[0040] Example 1. Detection of miR-1 expression level in Schistosoma japonicum

[0041] (1) Expression levels of miR-1 in male and female insects at different developmental stages

[0042] Six C57BL / 6 mice were used, each infected with approximately 100 Schistosoma japonicum cercariae. Three mice were dissected at 24 and 28 days post-infection. Schistosoma cells were collected via portal vein perfusion. Total RNA was extracted from both male and female worms according to the kit (PrimeScript). TM After removing genomic DNA with an RT reagent kit with gDNA Eraser (RR047A, TAKARA), the relative expression level of miR-1 was detected by stem-loop qRT-PCR.

[0043] Reverse transcription conditions: 42℃ for 15 min, 85℃ for 5 sec, and stored at 4℃ (RR047A, TAKARA).

[0044] qPCR conditions: 95℃ pre-denaturation for 30 sec; 95℃ denaturation for 10 sec, 60℃ annealing / extension for 30 sec: 40 cycles; melting curve analysis 60-95℃ (Hieff qPCR SYBR Green Master, 11199ES03, YEASEN) (LightCycler 96 System, Roche, Switzerland).

[0045] The results showed that from 24 to 28 days post-infection, the expression level of miR-1 in both male and female worms showed a downregulation trend (e.g., Figure 1 A).

[0046] (2) Expression levels of miR-1 in different parts of the parasite

[0047] Several C57BL / 6 mice infected with approximately 100 cercariae were collected. On day 30 post-infection, the mice were dissected, and the worms were collected. Using a syringe needle, the male worm was cut into three parts along the anterior and posterior margins of the testis: the anterior portion, the portion containing the testis (referred to as "testicle" in the diagram), and the posterior portion. The female worm was cut into three parts along the anterior and posterior margins of the ovary: the anterior portion, the ovary, and the vitelline gland (e.g., ...). Figure 1 B). Collect sufficient amounts of each part of the male and female worms, extract total RNA, and follow the instructions in the kit (PrimeScript). TM After removing genomic DNA using an RT reagent kit with gDNAEraser (RR047A, TAKARA), the relative expression levels of miR-1 in different parts of the insect body were detected by stem-loop RT-PCR.

[0048] Reverse transcription conditions: 42℃ for 15 min, 85℃ for 5 sec, and stored at 4℃ (RR047A, TAKARA).

[0049] qPCR conditions: 95℃ pre-denaturation for 30 sec; 95℃ denaturation for 10 sec, 60℃ annealing / extension for 30 sec: 40 cycles; melting curve analysis 60-95℃ (Hieff qPCR SYBR Green Master, 11199ES03, YEASEN) (LightCycler 96 System, Roche, Switzerland).

[0050] The results showed that there was no statistically significant difference in miR-1 expression levels among the anterior, testis, and tail of male insects; however, in female insects, miR-1 expression levels in the ovary and vitelline gland were significantly lower than in the anterior region, while there was no statistically significant difference in miR-1 expression levels between the ovary and vitelline gland (*P<0.05, **P<0.01, ns: not significant). Figure 1 C).

[0051] Example 2. Method of action and effect evaluation of miR-1 agomir

[0052] (1) Preparation of PEI+miR-1 agomir complex solution

[0053] Accurately weigh 50 mg of PEI (Polyethylenimine, Linear, MW 25,000) powder, add 45 ml of deionized water, dissolve in a boiling water bath and cool, adjust the pH to 7.0 with dilute hydrochloric acid, and finally bring the volume to 50 ml with deionized water to prepare a 1 μg / μL stock solution. Filter the solution through a 0.22 μm filter membrane for sterilization, then dispense and store at -20°C to avoid repeated freeze-thaw cycles.

[0054] Schistosoma japonicum miR-1 agomir was synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd. The synthesized miR-1 agomir powder was dissolved in sterile physiological saline to a final concentration of 0.1 μg / μL. A 1 μg / μL PEI stock solution was diluted with sterile physiological saline to 0.1 μg / μL and allowed to stand at room temperature for 5 min. 100 μL of the miR-1 agomir solution and the PEI solution were mixed and allowed to stand at room temperature for 20 min to form a 200 μL composite solution containing 10 μg PEI + miR-1 agomir.

[0055] The control group consisted of scrambled agomir containing irrelevant sequences, also synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd. The preparation method was the same as above, forming a 200 μL control composite solution containing 10 μg PEI + scrambled agomir.

[0056] (2) Duration, frequency and dosage of miR-1 agomir action

[0057] Take 12-well cell culture plates and add 2-3 mL of Schistosoma medium (DMEM high-glucose medium containing 10% FBS (fetal bovine serum), 100 U / mL penicillin, and 100 μg / mL streptomycin) and 10-15 pairs of synocascara (adults 28 days post-infection) to each well for aseptic culture. Divide the plates into two groups of 6 wells each. On the day of culture and 48 hours after culture, add 200 μL of the above compound solution to each well (experimental group) and the control group (control compound solution). Culture at 37℃ and 5% CO2. On day 4 post-treatment, collect the schistosomes and eggs.

[0058] (3) Effects of miR-1 agomir on oviposition in sexually mature females

[0059] After two treatments with miR-1 agomir and 4 days of culture (e.g.) Figure 2 Collect a portion of the worms, wash three times with PBS (DEPC water), and extract total RNA from both male and female worms according to the kit (PrimeScript). TM After removing genomic DNA using an RT reagent kit with a gDNA Eraser (RR047A, TAKARA), the expression level of miR-1 in Schistosoma was detected by stem-loop qRT-PCR. Simultaneously, all eggs in the culture medium were collected and counted, and the changes in oviposition rate in females after miR-1 agomir treatment were statistically analyzed.

[0060] Reverse transcription conditions: 42℃ for 15 min, 85℃ for 5 sec, and stored at 4℃ (RR047A, TAKARA).

[0061] qPCR conditions: 95℃ pre-denaturation for 30 sec; 95℃ denaturation for 10 sec, 60℃ annealing / extension for 30 sec: 40 cycles; melting curve analysis 60-95℃ (Hieff qPCR SYBR Green Master, 11199ES03, YEASEN) (LightCycler 96 System, Roche, Switzerland).

[0062] The results showed that the miR-1 expression levels in male and female worms of the *agomir* group detected by stem-loop qRT-PCR were significantly higher than those in the scrambled *agomir* group (e.g., *agomir*). Figure 3 A). Compared with the scrambled agomir group, the average number of eggs laid by females in the miR-1 agomir group was significantly lower (**P<0.01) (e.g. Figure 3 B).

[0063] (4) Effects of miR-1 agomir on the normal morphology and structure of schistosomiasis reproductive organs

[0064] The remaining worms were separated into male and female worms using an anesthetic (0.25% ethyl 3-aminobenzoate solution) and fixed in AFA solution (Alcohol-Formalin-Acetic acid: 50% 95% ethanol, 6% formalin, 4% glacial acetic acid, with the remainder made up with purified water). The fixed worms were then stained with Carboxymethyl red and the effects of miR-1 agomir treatment on the normal morphology and structure of the reproductive organs of male and female Schistosoma were observed under a conventional microscope and a laser confocal microscope (emission wavelength 488 nm).

[0065] Under a regular microscope, it was found that, compared with the scrambled agomir group, the testes of males and the ovaries of females in the miR-1 agomir group showed varying degrees of shrinkage (e.g., Figure 4 Further observations using laser confocal microscopy confirmed that after treatment with miR-1 agomir, the testes of male Schistosoma and the ovaries of females exhibited shrinkage, with indistinct boundaries between each testis and a reduction in mature spermatocytes within the testes. In the ovaries of females, not only were there fewer mature oocytes, but numerous cavities were also observed, indicating disruption of the normal ovarian structure, possibly related to apoptosis in the ovarian tissue (e.g., Figure 5 ).

[0066] (5) Detection of apoptosis-related gene expression levels in male and female Schistosoma after miR-1 agomir treatment

[0067] The apoptosis pathway in Schistosoma japonicum mainly includes the caspase cascade pathway and the mitochondrial-initiated pathway. To confirm the occurrence of apoptosis, qRT-PCR was used to detect the changes in the expression levels of 12 apoptosis-related genes (AIF, APAF, BAK, BAX, BCL2, caspase-9, CIAP, caspase-3, cyc, IAP, p53, and TNFR) in male and female schistosomes after treatment with miR-1 agomir. cDNA was collected from schistosomes treated with miR-1 agomir, and qPCR was used to detect changes in the expression levels of apoptosis-related genes in male and female schistosomes.

[0068] The expression levels of 12 genes related to the apoptosis pathway (caspase cascade pathway and mitochondrial initiation pathway) in Schistosoma japonicum were detected. The results showed that, except for the cyc gene, whose expression level did not change significantly in either male or female worms after miR-1 agomir treatment, the expression levels of the other 11 genes increased in female worms. Furthermore, the expression levels of BAK, BAX, caspase-3, and IAP genes were also significantly upregulated in male worms. This suggests that miR-1 agomir treatment may initiate the apoptosis pathway in Schistosoma japonicum (e.g., caspase cascade pathway and mitochondrial initiation pathway). Figure 6 ).

[0069] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of a microRNA agomir in the preparation of an anti-schistosomiasis drug, characterized in that, The microRNAagomir can enhance the activity of schistosomes. miR-1 Expression levels: The microRNA agomir was prepared using PEI as the transfection reagent and sterile physiological saline as the solvent to achieve PEI+ expression levels. miR-1 Agomir's complex solution, the miR-1 The gene sequence is shown in SEQ ID NO: 1, and the schistosome is Schistosoma japonicum.

2. The application according to claim 1, characterized in that, The dosage form of the drug is injection, oral, spray, suspension, capsule, tablet, pill or granule.

3. The application according to claim 1, characterized in that, The drug also includes a pharmaceutically acceptable carrier, which is one or more of a diluent or excipient.

Images