Genetically engineered bacteria secreting extracellular mussel proteins and construction method and application thereof

Abstract

The application discloses a kind of extracellular secretion mussel protein genetically engineered bacteria and its construction method and application, belong to genetic engineering technical field.The application is connected by signal peptide screening, and signal peptide is connected with the gene of mussel protein and is transferred into plasmid pET-Duet and is fused expression.Further, the application is transferred into plasmid pET-Duet with cutinase Tfu-0883 gene, and signal peptide-mussel protein fusion protein is co-expressed, and finally realizes the extracellular secretion of mussel protein.In addition, the application optimizes fermentation medium by adding surfactant, thereby improving extracellular secretion level.The yield of mussel protein in purified fermentation broth can reach 20-40mg / L.The application realizes the extracellular secretion of soluble mussel protein with biological activity in escherichia coli, weakens the cytotoxicity caused by product accumulation, promotes the sustained synthesis of mussel protein, and avoids subsequent cell disruption operation, and optimizes the process.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a genetically engineered bacterium for extracellular secretion of mussel protein as well as a construction method and application thereof. BACKGROUND

[0002] Mussel is a common bivalve mollusk. A kind of adhesive protein secreted by the byssus gland of mussel is called mussel foot protein (Mfp). Currently, six kinds of foot proteins (Mfp-1~Mfp-6) have been identified. Mussel protein has high-strength and long-lasting adhesion capacity, and can maintain the stability of mussel under repeated flushing of water flow. In addition, mussel protein has good biocompatibility, non-sensitization and non-toxicity, etc., so that the mussel foot protein has broad application potential in many industries such as medicine, electronic equipment, automobile and aerospace industry, and coating.

[0003] The traditional mussel foot protein extraction method is direct extraction method, which has high production cost and low extraction efficiency. The high price limits the research and utilization of mussel protein, so people begin to obtain Mfps by means of genetic engineering technology. In the recombinant protein expression system, both prokaryotes and eukaryotes are reported as hosts. The commonly used prokaryotic hosts are mainly bacteria (Escherichia coli), and the eukaryotic hosts include insects, yeasts (Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces lactis) and plants (tobacco, chicory). Mefp-1, Mfp-5, Mfp-3A, Mcofp-1,-3, etc. are expressed in prokaryotic hosts; Mefp-3, Mefp-1, Mcfp-3, Mgfp-5, etc. are expressed in eukaryotic hosts. Mussel foot protein has not been produced on a large scale, mainly due to the low yield of heterologous expression. Moreover, the reducing environment in the cytoplasm of Escherichia coli is not conducive to the formation of protein disulfide bond, so that the soluble protein with biological activity is less expressed, and is mostly expressed in the form of inclusion body. The oxidizing periplasmic space provides a good environment for the correct folding of the peptide chain, and the less proteolytic enzyme makes the product less degradable. However, the periplasmic space of the bacterium is limited, and the large capacity of the fermentation medium may be the best place for the recombinant protein. However, due to the double membrane and complex periplasmic space of Escherichia coli, protein secretion needs to cross the inner and outer membranes of the two membranes, which is more difficult than gram-positive bacteria.

[0004] Signal peptide (SP) is a short peptide chain located at the N-terminal of the target protein, which can guide the protein to transfer to the periplasmic space. The signal peptide reaches the lumen of the endoplasmic reticulum through the pore formed by the membrane protein, and is then hydrolyzed by the signal peptide enzyme located on the membrane surface. With the help of the signal peptide, the nascent polypeptide chain is transferred from the cytoplasm to the periplasmic space, folded in the periplasmic space, and finally secreted outside the cell. However, for the proteins located in the cell, even if the signal peptide is added to the target protein, it cannot be secreted outside the cell when expressed in E. coli, so other means are needed to help the target protein to realize secretion. Common means include improving the output ability of the target protein (enhancing the signal peptide, strengthening the transcription regulator, overexpressing the transport RNA, etc.), adjusting the permeability of the cell membrane (external damage, key enzyme knockout, lipid hydrolase, etc.).

[0005] Cutinase is a multifunctional enzyme that can hydrolyze various soluble esters and insoluble polymeric cutin. Cutinase has phospholipase hydrolysis activity, which hydrolyzes the phospholipid components of the E. coli cell membrane, thereby improving the permeability of the cell membrane to realize the extracellular secretion of the target protein. Surfactants can dissolve the lipid substances in the cell membrane from the outside, increase the permeability of the cell membrane, and help the target protein to be secreted outside the cell, thereby improving the extracellular secretion ability.

[0006] At present, there is no report on the extracellular secretion of mussel protein in E. coli expression system. In previous studies, it was found that the accumulation of soluble mussel protein would have a toxic effect on the bacteria, so it is of great significance to realize the extracellular secretion of soluble mussel protein, avoid intracellular accumulation of the product, reduce the pressure on the bacteria, and simplify the downstream purification process. SUMMARY

[0007] The technical problem to be solved by the present application is to provide a genetically engineered bacterium for extracellular secretion of mussel protein.

[0008] The technical problem to be solved by the present application is to provide a genetically engineered bacterium for extracellular secretion of mussel protein.

[0009] The technical problem to be solved by the present application is to provide a genetically engineered bacterium for extracellular secretion of mussel protein.

[0010] To solve the above technical problems, the technical scheme adopted by the present application is as follows:

[0011] A genetically engineered bacterium for extracellular secretion of mussel protein, taking E. coli BL21 (DE3) as the expression host, inserting a signal peptide gene, a mussel protein gene and a cutinase gene on the expression vector in sequence, wherein the signal peptide gene is expressed in fusion with the mussel protein gene, and then co-expressed with the cutinase gene.

[0012] The expression vector is pET-Duet (purchased from Novagen).

[0013] The signal peptide is any one of Bla, OmpC, MglB, OmpA, DsbA and PelB, the nucleic acid sequence of which is shown as SEQ ID NO. 3, 5, 7, 9, 11, 13, and the corresponding amino acid sequence is shown as SEQ ID NO. 4, 6, 8, 10, 12, 14.

[0014] The preferred signal peptide is Bla, OmpC or MglB, and the most preferred signal peptide is Bla.

[0015] The mussel protein is Mgfp-5, the nucleic acid sequence of which is shown as SEQ ID NO. 1, and the corresponding amino acid sequence is shown as SEQ ID NO. 2.

[0016] The cutinase is cutinase Tfu-0883, the nucleic acid sequence of which is shown as SEQ ID NO. 15, and the corresponding amino acid sequence is shown as SEQ ID NO. 16.

[0017] The application also provides a construction method of the genetically engineered bacteria for extracellular secretion of the mussel protein, comprising the following steps:

[0018] (1) The signal peptide is connected to the mussel protein gene fragment by PCR, and the signal peptide is located at the N-terminus of the mussel protein. The connected fragment is introduced into one of the multiple cloning sites of the plasmid pET-Duet, to obtain the plasmid pET-Duet into which the signal peptide and the mussel protein gene are introduced.

[0019] (2) The cutinase gene is introduced into the other multiple cloning site of the plasmid pET-Duet into which the signal peptide and the mussel protein gene are introduced obtained in step (1), to obtain a recombinant plasmid.

[0020] (3) The recombinant plasmid obtained in step (2) is introduced into E. coli BL21 (DE3) for expression to obtain a recombinant E. coli, which is the genetically engineered bacteria for extracellular secretion of the mussel protein.

[0021] The application of the genetically engineered bacteria for extracellular secretion of the mussel protein in the fermentation preparation of the mussel protein is also within the scope of the application.

[0022] The application of the genetically engineered bacteria for extracellular secretion of the mussel protein in the fermentation preparation of the mussel protein comprises the following steps:

[0023] (a) The genetically engineered bacteria are activated by plate and inoculated into a shake flask for culture to prepare a seed liquid;

[0024] (b) inoculating the seed liquid obtained in step (a) into a liquid culture medium for fermentation culture at an inoculation amount of 1-10% v / v, and collecting the fermentation supernatant and the bacterial cells.

[0025] In step (a), the culture condition is 35-40°C, 180-220 rpm for 8-12 h.

[0026] The preferred culture condition is 37°C, 200 rpm overnight culture for 10 h.

[0027] In step (a), the formula of the LB culture medium is 10 g / L peptone, 5 g / L yeast powder, 10 g / L sodium chloride, and 25-50 μg / mL ampicillin.

[0028] In step (b), the inoculation amount of the seed liquid is 1-10% v / v, and the preferred inoculation amount is 10%.

[0029] In step (b), the fermentation culture condition is 35-40°C, 180-220 rpm culture, until OD 600 When OD reaches 2-3, an inducer is added at a final concentration of 0.1-1 mM, and the culture is continued for 6-10 h.

[0030] Specifically, the inducer is IPTG.

[0031] The preferred fermentation condition is 37°C, 200 rpm culture until OD 600 is 2-3, IPTG is added to a final concentration of 1 mM, and the culture is continued at 37°C, 200 rpm for 6 h.

[0032] In step (b), the liquid culture medium is 10-20 g / L peptone, 5-10 g / L yeast powder, 10-20 g / L sodium chloride, 25-50 μg / mL ampicillin, and 1-5 g / L surfactant.

[0033] Specifically, the surfactant is any one of Span-80, Tween-80, Tween-60, Trition-X100, SDS, and dimethyl sulfoxide. The preferred surfactant is Trition-X100.

[0034] In step (b), the concentration of the extracellularly secreted mussel protein can reach 20-40 mg / L.

[0035] The preferred concentration of the extracellularly secreted mussel protein is 35-40 mg / L.

[0036] Beneficial effects:

[0037] (1) The present research firstly realizes the expression of mussel protein in E. coli, and realizes the extracellular secretion of mussel protein by fusing with signal peptide and co-expressing with cutinase. In addition, the yield of extracellular secretion is improved by optimizing the fermentation medium, which is helpful for industrial production. The mussel protein prepared by the present application can be widely applied in the fields of medicine, instruments, coating and the like.

[0038] (2) The present application establishes a method for realizing the extracellular secretion of mussel protein, so that the mussel protein can be directly extracted in the fermentation medium, avoids the operation of breaking the bacterial cells, optimizes the process, and all the secreted proteins are soluble proteins with biological activity. BRIEF DESCRIPTION OF DRAWINGS

[0039] The above and / or other aspects of the present application will become apparent and more readily appreciated from the following description, taken in conjunction with the accompanying drawings, in which:

[0040] Figure 1 A framework diagram for the extracellular secretion of Mgfp-5 expression vector is shown in Figure 1.

[0041] Figure 2 For SDS-PAGE electrophoresis analysis of Mgfp-5, M: protein standard molecular weight, S: intracellular soluble expression of Mgfp-5, IS: intracellular inclusion body expression of Mgfp-5, E: extracellular secretion of Mgfp-5; (a) Example 1: the culture medium is added with 1% Trition-X100, and the strain is a recombinant strain. (b) Comparative Example 1: the culture medium is added with 1% Trition-X100, and the strain is Mgfp-5 expressed alone. (c) Comparative Example 2: the culture medium is not added with a surfactant, and the strain is a recombinant strain. (d) Comparative Example 3: the culture medium is added with 1% Span-80, and the strain is a recombinant strain. (e) Comparative Example 4: the culture medium is added with 1% Tween-80, and the strain is a recombinant strain. (f) Comparative Example 5: the culture medium is added with 1% SDS, and the strain is a recombinant strain.

[0042] Figure 3 A growth curve for the extracellular secretion experiment of Mgfp-5 is shown in Figure 3.

[0043] Figure 4 A yield graph for the extracellular secretion experiment of Mgfp-5 is shown in Figure 4.

[0044] Figure 5SDS-PAGE analysis of Mgfp-5 under different signal peptide conditions, M: protein standard molecular weight, S: intracellular soluble expression of Mgfp-5, IS: intracellular inclusion body expression of Mgfp-5, E: extracellular secretion of Mgfp-5; Example 1: signal peptide is Bla, culture medium added 1% Trition-X100, strain is recombinant strain. Example 2: signal peptide is OmpC, culture medium added 1% Trition-X100, strain is recombinant strain. Example 3: signal peptide is MglB, culture medium added 1% Trition-X100, strain is recombinant strain. DETAILED DESCRIPTION

[0045] In the following examples, the experimental methods described are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0046] In the following examples, the concentration of the extracellularly secreted mussel protein Mgfp-5 is detected using a Bradford protein concentration detection kit.

[0047] Example 1: Construction of genetically engineered bacteria producing extracellular mussel protein Mgfp-5 and preparation of extracellular mussel protein Mgfp-5 by shake flask fermentation.

[0048] 1. Obtaining of Bla-Mgfp-5 gene fragment

[0049] (1) Designing upstream and downstream primers according to the coding region sequence of Mgfp-5, the designed primers are:

[0050] Upstream primer 5-Bla-F:

[0051] 5'-GGTGTTCGCCAAGCTTGAATTCAGCAGCGAAGAATA-3'

[0052] Downstream primer 5-R:

[0053] 5'-CGCAAGCTTGTGGTGATGATGGTGATGGGACGAACCG-3'

[0054] PCR reaction system was 25 μL: Mgfp-5 genomic template DNA 2 μL, 2 μL of each upstream and downstream primer, 2×PhantaMax Master Mix 12.5 μL, ddH2O 6.5 μL. 2×Phanta Max Master Mix was purchased from Novozyme (Nanjing, China). The PCR reaction conditions were 94℃ pre-denaturation for 5 min, then 94℃ for 30 s, 60℃ for 30 s, 72℃ for 9 s, for a total of 30 cycles, and finally 72℃ for 10 min. The PCR product was subjected to 1% agarose gel, and the results showed that there was a specific band at 250 bp, and the Mgfp-5 gene fragment was recovered by cutting gel.

[0055] The nucleic acid sequence of the mussel protein Mgfp-5 is shown as SEQ ID NO. 1, and the corresponding amino acid sequence is shown as SEQ ID NO. 2.

[0056] (2) The upstream and downstream primers were designed according to the coding region sequence of the signal peptide Bla, and the designed primers were:

[0057] The upstream primer Bla-F is:

[0058] 5'- AGATATACCATGGgcATGGGCATGAGCATTCAGCA -3'

[0059] The downstream primer Bla-R is:

[0060] 5'- TATTCTTCGCTGCTGAATTCAAGCTTGGCGAACACC -3'

[0061] PCR reaction system was 25 μL: Bla genomic template DNA 2 μL, 2 μL of each upstream and downstream primer, 2×Phanta Max Master Mix 12.5 μL, ddH2O 6.5 μL. 2×Phanta Max Master Mix was purchased from Novozyme (Nanjing, China). The PCR reaction conditions were 94℃ pre-denaturation for 5 min, then 94℃ for 30 s, 60℃ for 30 s, 72℃ for 3 s, for a total of 30 cycles, and finally 72℃ for 10 min. The PCR product was subjected to 1% agarose gel, and the results showed that there was a specific band at about 80 bp, and the Bla gene fragment was recovered by cutting gel.

[0062] The nucleic acid sequence of the signal peptide Bla is shown as SEQ ID NO. 3, and the corresponding amino acid sequence is shown as SEQ ID NO. 4.

[0063] (3) The gene fragment of Bla and Mgfp-5 is connected by PCR, the upstream primer is Bla-F, and the downstream primer is 5-R. The PCR reaction system is the same as step 1 (1). The PCR reaction conditions are 94℃ pre-denaturation for 5 min, then 94℃ for 30 s, 60℃ for 30 s, 72℃ for 10 s, for a total of 30 cycles, and finally 72℃ extension for 10 min. The PCR product is subjected to 1% agarose gel, and the results show that there is a specific band at 300 bp. The Bla-Mgfp-5 gene fragment is recovered by cutting the gel.

[0064] 2. Obtaining of the cutinase Tfu-0883 gene fragment

[0065] The upstream and downstream primers are designed according to the coding region sequence of Tfu-0883, and the designed primers are as follows:

[0066] The upstream primer Tfu-F is as follows:

[0067] 5'-TAAGAAGGAGATATACATATGGCAGTTATGACCCCGCGCC-3'

[0068] The downstream primer Tfu-R is as follows:

[0069] 5'-GTTTCTTTACCAGACTCGAGTTAAAACGGGCAGGTACTGC-3'

[0070] The PCR reaction system is 25 μL: Tfu-0883 genomic template DNA 2 μL, upstream and downstream primers 2 μL each, 2×PhantaMax MasterMix 12.5 μL, and ddH2O 6.5 μL. The 2×PhantaMax MasterMix is purchased from Novozyme (Nanjing, China). The PCR reaction conditions are 94℃ pre-denaturation for 5 min, then 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, for a total of 30 cycles, and finally 72℃ extension for 10 min. The PCR product is subjected to 1% agarose gel, and the results show that there is a specific band below 1000 bp. The Tfu-0883 gene fragment is recovered by cutting the gel.

[0071] The cutinase Tfu-0883 has a nucleic acid sequence as shown in SEQ ID NO. 15, and a corresponding amino acid sequence as shown in SEQ ID NO. 16.

[0072] 3. Construction of the expression vector of the extracellular secretion mussel protein Mgfp-5

[0073] (1) A small amount of pET-Duet empty plasmid was extracted. The PCR product (Tfu-0883) and the plasmid pET-Duet (purchased from Novagen) were digested with restriction enzymes NdeI and XhoI, and the digested product was purified by 1% agarose gel and recovered for later use.

[0074] (2) The digested product Tfu-0883 was connected with the linearized pET-Duet plasmid. The reaction system was 5 μL of linearized vector, 3 μL of insert, 2 μL of ExnaseII, 4 μL of 5×CEII Buffer, and 6 μL of ddH2O. ExnaseII and 5×CEII Buffer were both purchased from Novagen (Nanjing, China). After 20 μL of the reaction system was reacted in an ice bath for 30 minutes, 100 μL of E. coli DH5α competent cells (purchased from Novagen) was added and continued to be reacted in an ice bath for 30 minutes. The cells were heat shocked at 42°C for 60-90 seconds, 5 times the volume of LB liquid medium (without resistance) was added, and the cells were recovered and cultured for 1 hour. Then, an appropriate volume was taken and plated (with ampicillin resistance at a concentration of 50 μg / mL), and the plate was cultured at 37°C for 12 hours. Single colonies were screened, cultured, and plasmid extraction and sequencing were performed, and finally the corresponding expression vector pET-Duet-Tfu-0883 was obtained. The recombinant plasmid was transformed into E. coli BL21 (DE3) for expression.

[0075] (3) A small amount of pET-Duet-Tfu-0883 plasmid was extracted. The PCR product (Bla-Mgfp-5) and the plasmid pET-Duet-Tfu-0883 were digested with restriction enzymes NcoI and HindIII, and the digested product was purified by 1% agarose gel and recovered for later use.

[0076] (4) The digested product Bla-Mgfp-5 was connected with the linearized pET-Duet-Tfu-0883 plasmid. The reaction system was 5 μL of linearized vector, 3 μL of insert, 2 μL of ExnaseII, 4 μL of 5×CEII Buffer, and 6 μL of ddH2O. ExnaseII and 5×CEII Buffer were both purchased from Novagen (Nanjing, China). After 20 μL of the reaction system was reacted in an ice bath for 30 minutes, 100 μL of E. coli DH5α competent cells was added and continued to be reacted in an ice bath for 30 minutes. The cells were heat shocked at 42°C for 60-90 seconds, 5 times the volume of LB liquid medium (without resistance) was added, and the cells were recovered and cultured for 1 hour. Then, an appropriate volume was taken and plated (with ampicillin resistance), and the plate was cultured at 37°C for 12 hours. Single colonies were screened, cultured, and plasmid extraction and sequencing were performed, and finally the expression vector pET-Duet-Bla-Mgfp-5-Tfu-0883 was obtained, which could realize the extracellular secretion of the mussel protein Mgfp-5. The recombinant plasmid was transformed into E. coli BL21 (DE3) for expression to obtain recombinant E. coli.

[0077] 4. Preparation of extracellular mussel protein Mgfp-5 by shake flask fermentation

[0078] The recombinant E. coli strain obtained in step 3 was activated by streaking on a plate. A single colony grown on the plate was picked and inoculated into a 5 mL LB medium in a shake flask and incubated at 37°C, 200 rpm overnight for 10 h. The culture was transferred into a 1 L baffled flask containing 200 mL liquid medium at a 10% v / v inoculum and incubated at 37°C, 200 rpm until the OD 600 was 2-3, IPTG was added to a final concentration of 1 mM and the culture was continued at 37°C, 200 rpm for 6 h. After the incubation, the fermentation supernatant and the bacterial cells were collected separately. The extracellular secreted Mgfp-5 was purified from the fermentation supernatant by nickel column affinity chromatography. The bacterial cells were disrupted by sonication and the disrupted cells were separated into soluble Mgfp-5 and inclusion bodies. The expression of the recombinant protein was then determined by SDS-PAGE electrophoresis.

[0079] The LB medium formula is 10 g / L peptone, 5 g / L yeast powder, 10 g / L sodium chloride and 25-50 μg / mL ampicillin; and the liquid medium formula is 10 g / L peptone, 5 g / L yeast powder, 10 g / L sodium chloride, 25-50 μg / mL ampicillin and 1 g / L Trition-X100.

[0080] Comparative Example 1: No signal peptide and cutinase were introduced, and other embodiments were the same as in Example 1.

[0081] Comparative Example 2: No surfactant was added to the liquid medium, and other embodiments were the same as in Example 1.

[0082] Comparative Example 3: 1 g / L Span-80 was added to the liquid medium, and other embodiments were the same as in Example 1.

[0083] Comparative Example 4: 1 g / L Tween-80 was added to the liquid medium, and other embodiments were the same as in Example 1.

[0084] Comparative Example 5: 1 g / L SDS was added to the liquid medium, and other embodiments were the same as in Example 1.

[0085] The results are shown in Table 1. Figure 2 , Figure 3 , Figure 4The yield of the extracellular secretion of soluble Mgfp-5 reached 35 mg / L in Example 1 of the present application due to the use of the genetically engineered bacteria of the present application and the addition of 1 g / L Trition-X100 in the culture medium. The extracellular secretion yield of Examples 2-4 was significantly lower than that of Example 1, and Examples 1 and 5 did not secrete at all. The addition of surfactants affects the growth of the bacteria, resulting in a decrease in biomass. Example 2 grew best because no surfactants were added, but the biomass of Example 1 decreased less than that of Example 2, and grew better than other surfactants. In summary, the use of the recombinant genetically engineered bacteria of the present research and the optimized culture medium obtained the best extracellular secretion yield of Mgfp-5.

[0086] Example 2: The signal peptide in Example 1 was replaced by OmpC, and the other conditions were the same as in Example 1.

[0087] The upstream primer 5-MglB-F corresponding to Mgfp-5 is:

[0088] 5'- GCAAATGCAAAGCTTGAATTCAGCAGCGAAGAATA -3'

[0089] The downstream primer 5-R corresponding to Mgfp-5 is unchanged.

[0090] The upstream primer OmpC-F corresponding to the signal peptide OmpC is:

[0091] 5'- GAGATATACCATGGgcATGGGCATGAAGGTTAAGG -3'

[0092] The downstream primer OmpC-R corresponding to OmpC is:

[0093] 5'- TATTCTTCGCTGCTGAATTCAAGCTTTGCATTTGC -3'.

[0094] The signal peptide OmpC has a nucleic acid sequence as shown in SEQ ID NO. 5 and a corresponding amino acid sequence as shown in SEQ ID NO. 6.

[0095] Example 3: The signal peptide in Example 1 was replaced by MglB, and the other conditions were the same as in Example 1.

[0096] The upstream primer 5-MglB-F corresponding to Mgfp-5 is:

[0097] 5'- CATGCCAAGCTTGAATTCAGCAGCGAAGAATACAA -3'

[0098] The downstream primer 5-R corresponding to Mgfp-5 is unchanged.

[0099] The upstream primer MglB-F corresponding to MglB is:

[0100] 5'-AGGAGATATACCATGGgcATGGGCATGAACAAGAA-3'

[0101] The downstream primer MglB-R corresponding to MglB is:

[0102] 5'-TTGTATTCTTCGCTGCTGAATTCAAGCTTGGCATG-3'

[0103] The signal peptide MglB has the nucleic acid sequence shown in SEQ ID NO. 7 and the corresponding amino acid sequence shown in SEQ ID NO. 8.

[0104] The results are shown in Table 1. Figure 5 As shown in Table 1, compared with Example 1 and Examples 2 and 3, the signal peptide is replaced, and 1 g / L Trition-X100 surfactant is added. As can be seen from the figure, the three signal peptides Bla, OmpC and MglB can all enable Mgfp-5 to be secreted outside the cell, but the secretion efficiency of Bla is the best, and the band is the clearest, which is superior to the secretion promotion effect of signal peptides OmpC (20.5 mg / L) and MglB (24.5 mg / L).

[0105] The present application provides a kind of extracellular secretion mussel protein genetically engineered bacteria and its construction method and application idea, the method and approach for specifically realizing the technical scheme are many, above-mentioned only preferred embodiment of the present application, it should be pointed out, for the ordinary skilled person in the art, without departing from the principles of the present application, can make a number of improvements and refinements, these improvements and refinements also should be regarded as the protection scope of the present application. The components not explicitly described in the embodiment can be realized by prior art.

Claims

1. A genetically engineered bacterium for extracellular secretion of a mussel protein, characterized by, In E. coli BL21(DE3) as an expression host, a signal peptide gene, a mussel protein gene and a cutinase gene are sequentially inserted into an expression vector, wherein the signal peptide gene is fused with the mussel protein gene for expression, and then co-expressed with the cutinase gene; The signal peptide is Bla, and its nucleic acid sequence is shown as SEQ ID NO. 3; the mussel protein is Mgfp-5, and its nucleic acid sequence is shown as SEQ ID NO. 1; the cutinase is cutinase Tfu-0883, and its nucleic acid sequence is shown as SEQ ID NO.

15. The surfactant Trition-X100 is added in the fermentation process of the genetically engineered bacteria for extracellular secretion of the mussel protein. 2.The genetically engineered bacteria according to claim 1, characterized in that, The expression vector is pET-Duet.

3. A method for constructing a genetically engineered bacterium for extracellular secretion of a mussel protein, characterized by, The method comprises the following steps: (1) The signal peptide is connected with the gene fragment of the mussel protein by PCR, and the signal peptide is located at the N terminal of the mussel protein. The connected fragment is introduced into one of the multiple cloning sites of the plasmid pET-Duet, to obtain the plasmid pET-Duet into which the signal peptide and the gene of the mussel protein are introduced; (2) The cutinase gene is introduced into the other multiple cloning site of the plasmid pET-Duet into which the signal peptide and the gene of the mussel protein are introduced obtained in step (1), to obtain the recombinant plasmid; (3) The recombinant plasmid obtained from step (2) is introduced into E. coli BL21(DE3) to express a recombinant E. coli, which is a genetically engineered bacterium capable of secreting the mussel protein outside the cell.

4. The application of the genetically engineered bacteria for extracellular secretion of the mussel protein in claim 1-2 in the fermentation process of the mussel protein. wherein, The application comprises the following steps: (a) The genetically engineered bacteria in claim 1-2 are activated by plate and inoculated into a shake flask containing LB culture medium for culture, to prepare seed liquid; (b) The seed liquid obtained in step (a) is inoculated into liquid culture medium for fermentation culture at an inoculation amount of 1-10% v / v, to obtain the extracellularly secreted mussel protein; In step (b), the liquid culture medium is 10-20 g / L protein peptone, 5-10 g / L yeast powder, 10-20 g / L sodium chloride, 25-50 μg / mL ampicillin and 1-5 g / L surfactant; the surfactant is Trition-X100.

5. Use according to claim 4, characterized in that, In step (a), the culture condition is 35-40℃, 180-220rpm for 8-12h; in step (b), the fermentation culture condition is 35-40℃, 180-220rpm until OD 600 When OD reaches 2-3, add inducer, final concentration of inducer is 0.1-1mM, continue to culture for 6-10h.

Images