Methods of using the rps14 gene, drugs, and mouse models

By specifically overexpressing the Rps14 gene in Lgr5-positive inner ear stem cells, a mouse model was constructed, which solved the problem of low hair cell regeneration efficiency, achieved an increase in the number and functional maturity of hair cells, and improved hearing loss.

CN116059234BActive Publication Date: 2026-04-24SOUTHEAST UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTHEAST UNIV
Filing Date
2022-12-15
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve hair cell regeneration efficiency, promote the functional maturation of new cells, and increase the survival time of hair cells. There is also a lack of regulatory mechanisms for the proliferation and differentiation of inner ear stem cells into hair cells.

Method used

By constructing an Rps14 gene knock-in mouse model, the Rps14 gene was specifically overexpressed in Lgr5-positive inner ear stem cells using CRISPR/Cas9 gene editing technology, and activated by Tamoxifen to promote the proliferation and functional maturation of inner ear hair cells.

Benefits of technology

It significantly increased the number of ectopic inner and outer hair cells, improved hearing loss, and promoted the structural and functional repair of hair cells after damage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116059234B_ABST
    Figure CN116059234B_ABST
Patent Text Reader

Abstract

The application discloses application of an Rps14 gene, a medicine and a construction method of a mouse model, belongs to the technical field of biotechnology, and the nucleotide sequence of the Rps14 gene is shown as SEQ NO. 1; compared with the prior art, the specific Rps14 transgenic mouse with a loxp site provided in the application can be used for specifically studying functions and effects of Rps14 overexpression at different sites. Specific overexpression of Rps14 in Lgr5 positive inner ear stem cells can promote significant increase of ectopic hair cells, and effective effects can be used for promoting structural and functional repair after hair cell damage and for improving hearing loss. Rps14 can be synergistically regulated with other reported inner ear genes, for example, Atoh1, Gfi1, Pou3f4 and the like, and effectively promote more ectopic hair cell proliferation and functional maturation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of the Rps14 gene, drugs, and methods for constructing mouse models. Background Technology

[0002] Previous studies have found that cochlear supporting cells can serve as precursor cells for hair cell regeneration, possessing a certain ability to regenerate hair cells after hair cell damage, and Lgr5-positive supporting cells exhibit stronger hair cell regeneration capacity. This regenerative capacity is regulated by several genes and related signaling pathways, thereby breaking the "silent" state of cochlear progenitor cells and promoting the differentiation of supporting cells or cochlear progenitor cells into hair cells. For example, current research has identified Atoh1, Gfi1, Foxg1, p27Kip1, Wnt / β-catenin signaling pathways, and Notch signaling pathways as having regulatory roles. Although these genes and pathways are enlightening for regulating the regeneration of hair cells by inner ear supporting cells or progenitor cells, a series of problems remain to be solved. These problems include insufficient number of regenerated cells; hair cell-like cells lacking the normal functions of mature hair cells; and the inability of newly formed cells to survive for extended periods. These problems indicate that it is difficult to regenerate functional hair cells by regulating a single gene or only two genes. Therefore, further research is needed to improve hair cell regeneration efficiency, promote the functional maturation of newly formed cells, increase the survival time of newly formed hair cells, and promote the proliferation and differentiation of inner ear stem cells into hair cells through more gene regulation mechanisms. Summary of the Invention

[0003] To address the shortcomings of existing technologies, this invention proposes methods for the application of the Rps14 gene, the construction of drugs and mouse models, to improve hair cell regeneration efficiency, promote the functional maturation of new cells, increase the survival time of new hair cells, and promote the proliferation and differentiation of inner ear stem cells into hair cells.

[0004] The objective of this invention can be achieved through the following technical solutions:

[0005] The use of the Rps14 gene or its pharmaceutical derivatives in the preparation of drugs that promote the proliferation of inner ear hair cells, wherein the nucleotide sequence of the Rps14 gene is shown in SEQ NO.1.

[0006] Furthermore, the inner ear hair cells are the inner ear hair cells and outer hair cells in the inner ear basilar membrane.

[0007] This application also provides a method for constructing an Rps14 transgenic mouse model, comprising the following steps:

[0008] The Hipp11 safe site on mouse chromosome 11 was selected, and the Rps14 gene was knocked into the targeting vector to construct a 5'-CAGPr-loxP-Stop-loxP-3×HA-EGE-YQH-083-ACDS-WPRE-pA-3' functional regulatory element. Gene-targeted mice were then prepared using CRISPR / Cas9 gene editing technology to obtain transgenic Rps14loxp mice. The nucleotide sequence of the Rps14 gene is shown in SEQ NO. 1.

[0009] Transgenic Rps14loxp mice were compared with Lgr5 EGFP-creERT2 / + Lgr5 was obtained by crossbreeding with tool mice. EGFP-creERT2 / + Rps14 loxp / - Double-positive mice, and in Lgr5 EGFP-creERT2 / + Rps14 loxp / - The Rps14 transgenic mouse model was obtained by injecting Tamoxifen into double-positive mice during the P0-P1 period.

[0010] Furthermore, the mouse is a C57BL / 6J mouse.

[0011] Furthermore, the homologous arms of the 5' and 3' ends of the functional control element are 1.8 kb and 1.4 kb, respectively.

[0012] This application also provides a medicament used in a dosage form suitable for releasing the Rps14 gene or a pharmaceutical derivative thereof in the inner ear of a user; the nucleotide sequence of the Rps14 gene is shown in SEQ NO. 1.

[0013] By adding conventional excipients and following conventional processes, the drug of this invention can be formulated into various pharmaceutically acceptable dosage forms, such as tablets, capsules, oral liquids, lozenges, injections, ointments, granules, or various sustained-release preparations.

[0014] The carrier of the drug of the present invention is a common type available in the pharmaceutical field, including: binders, lubricants, disintegrants, solubilizers, diluents, stabilizers, suspending agents or matrices, etc.; preferably, the dosage form is an injection.

[0015] The beneficial effects of this invention are:

[0016] The loxp-specific Rps14 transgenic mice proposed in this application can be used to specifically study the function and role of Rps14 overexpression at different sites. Specific overexpression of Rps14 in Lgr5-positive inner ear stem cells significantly promotes an increase in ectopic inner and outer hair cells, and its effective role can be used to promote the structural and functional repair of hair cells after damage, thereby improving hearing loss. Rps14 can synergistically regulate other previously reported inner ear genes, such as Atoh1, Gfi1, and Pou3f4, effectively promoting the proliferation and functional maturation of more ectopic hair cells. Attached Figure Description

[0017] The invention will now be further described with reference to the accompanying drawings.

[0018] Figure 1 This is a schematic diagram illustrating the in vivo construction of a mouse model specifically overexpressing the Rps14 gene according to this application.

[0019] Figure 2 This is a schematic diagram illustrating the regulatory effect of conditional overexpression of Rps14 on the number of ectopic hair cells in Lgr5-positive inner ear Sertoli cells according to this application. Detailed Implementation

[0020] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0022] (1) In this invention, a conditional overexpression of the Rps14 gene model containing the loxp site was constructed on chromosome 11 of C57BL / 6J mice, and specific overexpression of Rps14 was achieved in Lgr5 positive inner ear stem cells.

[0023] The specific construction process of Rps14 transgenic mice is as follows: Figure 1A: First, the Hipp11 safe site on mouse chromosome 11 was selected. Then, the regulatory region of the Rps14 target gene (i.e., EGE-YQH-083-A) (nucleotide sequence shown in SEQ NO.1) was knocked into the targeting vector to construct a 5'-CAGPr-loxP-Stop-loxP-3×HA-EGE-YQH-083-ACDS-WPRE-pA-3' functional regulatory element, with homologous arms at the 5' and 3' ends of approximately 1.8 kb and 1.4 kb, respectively. Gene-targeted mice were then prepared using CRISPR / Cas9 gene editing technology.

[0024] The successfully constructed transgenic Rps14 loxp mice were compared with Lgr5. EGFP-creERT2 / + Lgr5 was obtained by crossbreeding with tool mice. EGFP-creERT2 / + Rps14 loxp / - Double-positive mice were injected with Tamoxifen (0.075 mg / g body weight) during the P0-P1 period to activate Cre recombinase in Lgr5-positive inner ear Sertoli cells, thereby cleaving the stop sequence before the Rps14 encoding gene. This resulted in specific overexpression of Rps14 in Lgr5-positive inner ear stem cells. Cochleas were then harvested at P7 for subsequent experimental studies (flowchart shown). Figure 1 (as shown in B), and Lgr5 EGFP-creERT2 / + Single-positive mice were used as the experimental control group. Figure 1 B is a schematic diagram showing the specific overexpression of the Rps14 gene in Lgr5-positive inner ear Sertoli cells. Lgr5 EGFP-creERT2 / + Rps14 loxp / - Double-positive mice were injected with tamoxifen during the P0-P1 period, and the cochlea of ​​the mice was dissected and collected at P7.

[0025] Real-time quantitative PCR was used to investigate the overexpression of Rps14 in the cochlea. First, Lgr5... EGFP -creERT2 / + Rps14 + / - and Lgr5 EGFP-creERT2 / + Newborn mice were injected with tamoxifen at P0-P1, and the cochlear basilar membrane of each group of mice was dissected at P7 to extract basilar membrane tissue RNA. The tissue RNA was then isolated using TRIzol reagent extraction and chloroform organic reagent extraction. After isopropanol precipitation and ethanol purification, the RNA was reverse transcribed into cDNA using a reverse transcription kit. Finally, quantitative real-time PCR was performed using Actin as an internal reference gene and Rps14-specific primers (primer sequences are shown in Table 1). The relative expression level of Rps14 mRNA was calculated using the cycle threshold Ct value. Figure 1 As shown in C. After Tamoxifen activation, compared to Lgr5 EGFP-creERT2 / + Compared with the control mice, in Lgr5 EGFP-creERT2 / + Rps14 loxp / - The expression level of Rps14 in double-positive mice was significantly increased, indicating that we successfully achieved the specific overexpression of Rps14 in the inner ear.

[0026] Table 1 Primer sequences for fluorescence quantitative PCR of Rps14 and Actin

[0027] Primer name Primer sequence Rps14RT-PCRForward TGCCACATCTTTGCATCCTTC Rps14RT-PCRReverse ACTCATCTCGGTCAGCCTTCA ActinRT-PCRForward ACACCCCAGCCATGTACG ActinRT-PCRReverse TGGTGGTGAAGCTGTAGCC

[0028] (2) Explore the effect of specific overexpression of Rps14 on the regeneration of hair cells from inner ear stem cells. After Rps14 was overexpressed in Tamoxifen-activated Lgr5 EGFP-creERT2 / + Rps14 loxp / - double-positive mice, the cochleas of the mice were dissected at P7 and fixed in 4% PDA solution for 2 hours, and the cochlear basilar membranes were dissected into three parts: the apical turn, middle turn and basal turn under the microscope. After blocking for 1 hour, hair cells were labeled by anti-Myosin7a and fluorescent secondary antibody staining. Finally, the number of ectopic hair cells was photographed and counted under a confocal microscope, and the hair cells outside the three rows of outer hair cells and one row of inner hair cells in situ were regarded as ectopic hair cells. As Figure 2 shown in the fluorescence representative diagram of A, in Lgr5 EGFP-creERT2 / + Rps14 loxp / - the number of ectopic inner and outer hair cells in the apical, middle and basal turns of the cochleas of double-positive mice increased significantly. Then, the number of ectopic inner and outer hair cells and total ectopic hair cells in the apical, middle and basal turns of the cochleas of the mice and the whole cochlea (accumulation of apical, middle and basal turns) were counted, and the Lgr5 EGFP-creERT2 / + mice were used as the control group for statistical analysis.

[0029] Figure 2 B Compared with the control group of Lgr5 EGFP-creERT2 / + mice, in the Lgr5 EGFP -creERT2 / + Rps14 loxp / - double-positive mice with specific overexpression of the Rps14 gene, the number of ectopic inner hair cells in the apical, middle and basal turns of the cochlea increased, and significant differences were shown in the middle and basal turns (* represents P < 0.05; ** represents 0.001 < P < 0.01). It indicates that specific overexpression of Rps14 promotes the increase in the number of ectopic inner hair cells in the apical, middle and basal turns of the cochlea.

[0030] Figure 2 C Compared with the control group of Lgr5 EGFP-creERT2 / + mice, in the Lgr5 EGFP -creERT2 / +Rps14 loxp / - In double-positive mice, the number of ectopic outer hair cells in the apical, middle, and basal regions of the cochlea showed an increasing trend. This indicates that specific overexpression of Rps14 has a certain promoting effect on the increase of ectopic outer hair cells in the apical, middle, and basal regions of the cochlea.

[0031] Figure 2 D and Lgr5 EGFP-creERT2 / + Compared to control mice, Lgr5 mice with specific overexpression of the Rps14 gene... EGFP -creERT2 / + Rps14 loxp / - In double-positive mice, the number of ectopic inner hair cells throughout the cochlea was significantly increased (*P<0.05). This indicates that specific overexpression of Rps14 promotes the increase of ectopic inner hair cells throughout the cochlea.

[0032] Figure 2 E and Lgr5 EGFP-creERT2 / + Compared to control mice, Lgr5 mice with specific overexpression of the Rps14 gene... EGFP -creERT2 / + Rps14 loxp / - In double-positive mice, the number of ectopic outer hair cells throughout the cochlea was significantly increased (*P<0.05). This indicates that specific overexpression of Rps14 promotes the increase of ectopic outer hair cells throughout the cochlea.

[0033] Figure 2 F and Lgr5 EGFP-creERT2 / + Compared to control mice, Lgr5 mice with specific overexpression of the Rps14 gene... EGFP -creERT2 / + Rps14 loxp / In double-positive mice, the number of ectopic hair cells (ectopic inner hair cells plus ectopic outer hair cells) throughout the cochlea was significantly increased (*** represents P<0.001). This indicates that specific overexpression of Rps14 promotes the increase of ectopic hair cells throughout the cochlea.

[0034] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

[0035]

[0036]

Claims

1. The application of the Rps14 gene in the preparation of drugs that promote the proliferation of inner ear hair cells, characterized in that, The nucleotide sequence of the Rps14 gene is shown in SEQ NO.

1. The inner ear hair cells are the inner and outer hair cells in the basilar membrane of the inner ear. The Rps14 gene is specifically overexpressed in Lgr5-positive inner ear stem cells.

2. A method for constructing an Rps14 transgenic mouse model, characterized in that, Includes the following steps: The Hipp11 safe site on mouse chromosome 11 was selected, and the Rps14 gene was knocked into the targeting vector to construct a 5'-CAGPr-loxP-Stop-loxP-3×HA-EGE-YQH-083-ACDS-WPRE-pA-3' functional regulatory element. Gene-targeted mice were then prepared using CRISPR / Cas9 gene editing technology to obtain transgenic Rps14loxp mice. The nucleotide sequence of the Rps14 gene is shown in SEQ NO.

1. Transgenic Rps14loxp mice and Tool mouse hybridization to obtain Double-positive mice, and in The Rps14 transgenic mouse model was obtained by injecting Tamoxifen into double-positive mice during the P0-P1 period.

3. The construction method according to claim 2, characterized in that, The mice in question were C57BL / 6J mice.

4. The construction method according to claim 2, characterized in that, The homologous arms of the 5' and 3' ends of the functional control element are 1.8 kb and 1.4 kb, respectively.

5. A drug, characterized in that, The drug is adapted to release the Rps14 gene at the user's inner ear site; the nucleotide sequence of the Rps14 gene is shown in SEQ NO.

1.

6. The drug according to claim 5, characterized in that, Dosage forms include tablets, capsules, liquids, lozenges, aerosols, injections, ointments, and granules.

7. The drug according to claim 6, characterized in that, The dosage form is an injection.

Citation Information

Patent Citations

  • Method for regulating and controlling proliferation and differentiation of inner ear stem cells by Rps14 and Foxg1 and application of method

    CN112899278A

  • Construction method of GPA, Espin and Ikzf2 mouse models

    CN113273545A