A stochastic multi-target assembly and editing method

Abstract

The application provides a random multi-target assembly and editing method. By adding a Barcode sequence, using the strategy of homoterminal enzyme, different target sites and different sgRNA scaffolds can be randomly combined together, combined with the base editing tool MoBE, and directed evolution can be performed on the 34th exon of the endogenous gene of rice ACC, so as to screen herbicide-resistant plants with new mutations.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for random multi-target assembly and editing. Background Technology

[0002] Directed evolution is the artificial simulation of natural evolution, either in vivo or in vitro. It involves creating numerous mutations to apply selective pressure and select proteins with desired traits. Through directed evolution, the function of one or more genes in plants and animals can be altered to obtain mutants that express the desired traits.

[0003] The CRISPR / Cas9 system has attracted much attention since its inception due to its simple design and ease of use. However, because the editing products produced by CRISPR / Cas9 are mainly insertions and deletions (indels), frameshift mutations often lead to loss of gene function, which greatly limits its application in directed evolution. Precision editing systems such as base editing and guided editing, developed based on the CRISPR / Cas9 system, cause changes in amino acids through base substitutions. The emergence of precision editing has greatly promoted the application of directed evolution in plants and animals. Hess et al. used CBE to directionally evolve herbicide-resistant mutations R78N, A79G, A79T, A108V, and G242D in the human PSMB5 gene (Hess et al., 2016); Kuang et al. simultaneously used ABE and CBE to directionally evolve the P171F herbicide-resistant mutation in the rice ALS gene (Kuang et al., 2020); Li et al. used the dual-base editing system STEME (Saturated Targeted Endogenous Mutagenesis Editor) to directionally evolve the P1927F herbicide-resistant mutation in the rice ACC gene (Li et al., 2020); Xu et al. used the Primeediting (PE) system to perform saturation mutations at a single site in the rice ACC gene to evolve the P1927Y herbicide-resistant mutation (Xu et al., 2021);

[0004] Precise editing has been widely used in directed evolution, but current research on directed evolution in plants and animals is based on mutant libraries generated from single sgRNA libraries, and the mutations screened are all single-site mutations. In many cases, the generation of desirable traits may result from mutations at multiple sites in a single gene or multiple sites in multiple genes simultaneously, but existing tools cannot create a mutant library that generates multiple edits at random sites in a single gene or multiple genes. Summary of the Invention

[0005] To address the problems existing in the above-mentioned technologies, this invention develops a random multi-target assembly method. Figure 1 This method directs the evolution of endogenous genes in plants, particularly rice, by generating multiple base edits at random multiple sites.

[0006] The first objective of this invention is to provide a random multi-target assembly and editing method, which involves selecting an endogenous gene or a segment of an endogenous gene from the species to be edited, designing all target sites, and assembling them using a random multi-target assembly system; the assembly system enables multiple random target sites to be assembled together, thereby generating edits at multiple random sites.

[0007] Furthermore, the method includes the following steps:

[0008] S1: For each target site, two complementary single-stranded primers are synthesized in opposite directions. After annealing, they are formed into double strands to obtain the target primer annealing product. The target primer annealing product contains the Target sequence, two BsaI restriction sites, and a unique barcode sequence corresponding to the Target sequence.

[0009] The mixing method of target primer annealing products is distinguished based on whether the target site is on the coding strand or the non-coding strand, specifically as follows:

[0010] The target primer annealing products of each coding strand are mixed together to obtain a coding strand target primer annealing product mixture;

[0011] The annealed products of the target primers from each non-coding strand are mixed together to obtain a mixture of non-coding strand target primer annealed products. This mixture of target primer annealed products is... Figure 1 The target primer pairs of the coding and non-coding strands are annealed and then mixed.

[0012] S2: Construct a backbone vector comprising, in sequence, a BglII restriction site, a promoter, a ccdB lethal gene sequence, two BsaI restriction sites located upstream and downstream of the ccdB lethal gene sequence, each with its own unique barcode sequence (Barcode-SC), and an Acc65I restriction site; digest the backbone vector with BsaI to remove the ccdB lethal gene sequence, obtaining the BsaI-digested backbone vector, i.e. Figure 1 The unloaded;

[0013] S3: The mixture of annealed primers for the coding strand target obtained in S1 and the mixture of annealed primers for the non-coding strand target obtained in S1 were ligated between the promoter and the barcode-SC sequence of the BsaI-digested backbone vector from S2. After electroporation into E. coli, a coding strand target library without sgRNA scaffold and a non-coding strand target library without sgRNA scaffold were obtained. Figure 1 The Targets repository;

[0014] S4: Construct sgRNA scaffolds sequences, wherein the sgRNA scaffolds sequences contain sequentially linked SgRNAscaffolds, terminators, BamHI, and BsrGI restriction sites. The sgRNA scaffolds sequences are digested with BsaI to obtain BsaI-digested SgRNA scaffolds. Figure 1 The BsaI-digested SgRNA scaffolds;

[0015] S5: Constructing sgRNA expression units: The coding target library without sgRNA scaffold and the non-coding target library without sgRNA scaffold constructed in S3 were digested with BsaI to obtain the coding target library without sgRNA scaffold and the non-coding target library without sgRNA scaffold after digestion with BsaI.

[0016] The BsaI-digested sgRNA scaffolds sequences obtained in S4 were ligated with a BsaI-digested target library containing the coding strand without sgRNA scaffolds and a BsaI-digested target library containing the non-coding strand without sgRNA scaffolds. After electroporation into *E. coli*, target libraries containing sgRNA scaffolds and non-coding strands with sgRNA scaffolds were obtained, namely, the coding strand sgRNA expression units and the non-coding strand sgRNA expression units. Figure 1 The complete library.

[0017] The target sites in the coding strand sgRNA expression units are all derived from the coding strand, and the target sites in the non-coding strand sgRNA expression units are all derived from the non-coding strand. The target sites of the coding strand are assembled together with the coding strand, and the target sites of the non-coding strand are assembled together with the non-coding strand.

[0018] S6: Take the coding strand sgRNA expression unit or the non-coding strand sgRNA expression unit obtained in S5;

[0019] S7: The coding strand sgRNA expression units or non-coding strand sgRNA expression units obtained in S6 are digested with BamHI / BsrGI to obtain linearized backbone fragments of the initial target library of the coding strand or non-coding strand.

[0020] S8: The coding strand sgRNA expression unit or the non-coding strand sgRNA expression unit obtained in S6 is double-digested with BglII / Acc65I to obtain the linearized insert fragment of the coding strand or the non-coding strand.

[0021] S9: The linearized insert fragment obtained in S8 is joined with the linearized backbone fragment of the initial target library obtained in S7. After electroporation transformation of E. coli, a random dual-target library of the coding strand or a random dual-target library of the non-coding strand is obtained; that is... Figure 1 The random dual sgRNA library.

[0022] S10: The random dual-target library (coding or non-coding) obtained in S9 is double-digested with BamHI / BsrGI to obtain linearized fragments of the target library (coding or non-coding) after BamHI / BsrGI digestion. The linearized fragments of the initial target library (coding or non-coding) obtained in S8 after BglII / Acc65I digestion are used as insert fragments for ligation. After electroporation and transformation into *E. coli*, the next round of random multi-target libraries is obtained. This cycle is repeated, using the linearized fragments of the target library obtained in the previous round after BamHI / BsrGI digestion as the backbone and the linearized fragments of the initial target library obtained in S8 after BglII / Acc65I digestion as insert fragments for ligation. After electroporation and transformation into *E. coli*, the next round of random multi-target libraries is obtained. With each additional round, each vector in the target library gains one more target (sgRNA), resulting in either a random multi-target library (coding or non-coding). Figure 1 The random n×sgRNA library;

[0023] S11: The pH-MoBE vector is digested with BsaI to remove the ccdB lethal gene, resulting in a linearized backbone fragment. The coding strand random dual-target vector library or non-coding strand random dual-target vector library obtained in S9, or the coding strand or non-coding strand random multi-target library obtained in S10, is digested with BglII / Acc65I to obtain linearized coding strand or non-coding strand random dual-target fragments, or linearized coding strand or non-coding strand random multi-target fragments. The linearized coding strand or non-coding strand random dual-target fragments, or linearized coding strand or non-coding strand random multi-target fragments, are ligated with the BsaI-digested linearized pH-MoBE backbone fragment to obtain a pH-MoBE vector with coding strand or non-coding strand random dual targets, or with coding strand or non-coding strand random multi-targets.

[0024] S12: The pH-MoBE vector obtained in S11, with random dual targets in either the coding or non-coding strands, or random multi-target vectors in either the coding or non-coding strands, is transferred into the species to be edited, thereby generating edits at two or more random sites.

[0025] Furthermore, the mixing described in S1 is either mixing equal amounts of the target primer annealing products of the coding strand, or mixing equal amounts of the target primer annealing products of the non-coding strand.

[0026] Furthermore, the target primer annealing product sequence described in S1 is as follows:

[0027] Oligo-F(x): GGCG (Target-F) N20 GTTT AGAGACCTAGGTCTCT GTAC A(Barcode-F) N8

[0028] Oligo-R(x): GACT (Barcode-R) N8 T GTAC AGAGACCTAGGTCTCT AAAC (Target-R) N20

[0029] The underlined sequence represents the sticky ends after enzyme digestion, the italicized sequence represents the BsaI restriction site, and the bolded sequence represents variable bases.

[0030] Furthermore, the promoter in S2 is selected from OsU3, OsU6, and TaU6; preferably, the promoter is selected from OsU3.

[0031] Furthermore, the skeletal carrier described in S2 is selected from pOsU3-S1, pOsU3-S2, and pOsU3-S3.

[0032] Furthermore, in the sgRNA scaffolds sequence described in S4, the sgRNA scaffold is selected from esgRNA-2×MS2, esgRNA-2×boxB, and esgRNA-boxB-MS2, and the terminator is selected from SUP4 Terminater.

[0033] Furthermore, the sgRNA expression unit described in S5 includes:

[0034] A-promoter-Target-SgRNAscaffold-terminator-BC-(Barcode-T)-(Barcode-SC)-D;

[0035] A and B are a pair of isomeric enzyme cleavage sites, and C and D are a pair of isomeric enzyme cleavage sites.

[0036] In a particular embodiment, the sgRNA expression unit in S5 includes: A-promoter-Target(N 20 )-SgRNA scaffold-terminator-BC-(Barcode-T)-(Barcode-SC)-D;

[0037] Furthermore,

[0038] The restriction enzyme sites of the two pairs of isosinetases A and B, and C and D in the sgRNA expression unit are selected from restriction endonuclease sites with the same sticky ends after digestion.

[0039] In the sgRNA expression unit, Target is a designed random target site sequence.

[0040] The SgRNA scaffold in the sgRNA expression unit is selected from esgRNA-2×MS2, esgRNA-2×boxB, and esgRNA-boxB-MS2;

[0041] The terminator in the sgRNA expression unit is selected from SUP4 Terminater;

[0042] In the sgRNA expression unit, the Barcode-T is a random 8bp sequence corresponding to the random Target;

[0043] In the sgRNA expression unit, Barcode-SC consists of three random 8bp sequences corresponding to the SgRNA scaffold.

[0044] Furthermore,

[0045] A and B are selected from BglII and BamHI;

[0046] C and D are selected from BsrGI and Acc65I;

[0047] Target, Barcode-T, and Barcode-SC do not contain BglII, BamHI, BsrGI, Acc65I, or BsaI restriction sites;

[0048] The nucleotide sequences of esgRNA-2×MS2 are shown in SEQ ID NO.12, esgRNA-2×boxB are shown in SEQ ID NO.13, and esgRNA-boxB-MS2 are shown in SEQ ID NO.14.

[0049] The terminator is selected from the SUP4 Terminater nucleotide sequence as shown in SEQ ID NO.15.

[0050] Furthermore, in S6, when the coding strand sgRNA expression unit or the non-coding strand sgRNA expression unit includes different types due to different SgRNA scaffolds, the coding strand sgRNA expression units containing each SgRNA scaffold are mixed in equal amounts, or the non-coding strand sgRNA expression units containing each SgRNA scaffold are mixed in equal amounts.

[0051] Furthermore, the random dual-target vector library mentioned in S9 is BglII-promoter-(Target-A)-(Scaffold-X)-terminator-promoter-(Target-B)-(Scaffold-Y)-terminator-BamHI-BsrGI-(Barcode-TB)-(Barcode-SC-Y)-(Barcode-TA)-(Barcode-SC-X)-Acc65I;

[0052] Target-A and Target-B can be any target point in the coding chain or non-coding chain;

[0053] Scaffold-X and Scaffold-Y are selected from any one of esgRNA-boxB-MS2, esgRNA-2×MS2 and esgRNA-2×boxB;

[0054] Barcode-TA and Barcode-TB are the barcode sequences corresponding to any target point in the encoded or non-encoded chain;

[0055] Barcode-SC-X and Barcode-SC-Y are selected from the barcode sequences corresponding to any one of esgRNA-boxB-MS2, esgRNA-2×MS2, and esgRNA-2×boxB.

[0056] Furthermore, the species to be edited described in S12 is a plant;

[0057] Preferably, the plant is a monocotyledonous plant or a dicotyledonous plant;

[0058] More preferably, the plant is rice.

[0059] Furthermore, the selected endogenous genes are chosen from OsACC, OsALS, OsEPSPS, and OsHPPD.

[0060] Preferably, the endogenous gene is selected from OsACC;

[0061] Further preferred, the endogenous gene is selected from the 34th exon of the OsACC gene;

[0062] Compared with the prior art, the technical solution of this application has the following beneficial effects:

[0063] (1) This assembly system can randomly assemble different target sites together, with little workload and strong randomness. Gene editing using the random multi-target vector library obtained through this assembly system can greatly increase the mutation abundance.

[0064] (2) Combining the remodeling system with precise editing technology for directed evolution can lead to the directed evolution of new mutations that occur at multiple sites in a gene or at multiple sites in multiple genes.

[0065] In the nucleotide sequence of this invention, "N" represents any one of the four degenerate bases (ATGC).

[0066] The Target sequence mentioned in this invention refers to the target sequence.

[0067] The barcode sequence mentioned in this invention refers to a DNA barcode, wherein:

[0068] The Barcode-T and BC-T mentioned in this invention refer to: a random 8bp sequence corresponding to a random spacer.

[0069] The Barcode-SC described in this invention consists of three random 8bp sequences corresponding to SgRNA scaffold.

[0070] The sgRNA scaffold described in this invention refers to an sgRNA scaffold, specifically sgRNA scaffold 1, which is esgRNA-2×MS2 as shown in SEQ ID NO.12; sgRNA scaffold 2, which is esgRNA-2×boxB as shown in SEQ ID NO.13; and sgRNA scaffold 3, which is esgRNA-boxB-MS2 as shown in SEQ ID NO.14.

[0071] The SUP4 Terminater and Ter mentioned in this invention refer to: terminator, specifically the nucleotide sequence shown in SEQ ID NO.15.

[0072] The Target-scaffold mentioned in this invention refers to a combination of Target and sgRNA Scaffold. Attached Figure Description

[0073] Figure 1A schematic diagram of a random multi-target assembly method.

[0074] Figure 2 Statistical graph of target site coverage in initial vector libraries (i.e., sgRNA expression units or complete sgRNA libraries) of coding and non-coding strands.

[0075] Figure 3 Statistical chart of target proportion in random single-target and multi-target vector libraries of coding chains; Figure 3 A is a statistical chart showing the proportion of target points in the random single-target carrier library (initial library) of the coding chain; Figure 3 B is a statistical chart showing the proportion of target points in the random dual-target vector library of the coding chain; Figure 3 C is a statistical chart showing the proportion of target points in the random three-target vector library of the coding chain;

[0076] Figure 4 Statistical chart of target proportion in non-coding chain random single-target and multi-target vector libraries; Figure 4 A is a statistical chart showing the proportion of targets in the non-coding chain random single-target vector library (initial library); Figure 4 B is a statistical chart showing the proportion of target points in the non-coding chain random dual-target vector library; Figure 4 C is a statistical chart showing the proportion of target points in the non-coding chain random three-target vector library;

[0077] Figure 5 The proportion of the three sgRNA scaffolds in coding and non-coding strand random vector libraries ( Figure 5 A) and Target-scaffold type analysis diagram ( Figure 5 B).

[0078] Figure 6 Flowchart for directed evolution screening of herbicide-resistant sites.

[0079] Figure 7 The regeneration status of callus tissue after 2 weeks of culture under high-concentration screening conditions is shown. The left side is the positive control group, and the middle and right sides are the experimental groups.

[0080] Figure 8 This is a sequence peak diagram of the barcode type and genotype of herbicide-resistant plants. Detailed Implementation

[0081] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0082] Example 1: Design all target sites for the 34th exon of the OsACC endogenous gene.

[0083] To construct a randomized multi-target vector library targeting OsACC, the 34th exon of OsACC, which is 2412 bp in length, was selected. Based on the MoBE editing window, all the target sequences that meet the requirements were designed.

[0084] In this embodiment, when selecting the target sequence, a 20bp-NGG or CCN-20bp target sequence is selected on the 34th exon of OsACC, and positions 1-10 of the target sequence should contain the base C and / or A. However, the position of the target sequence in this invention is not limited to this, and can be located at any position in any gene.

[0085] 1. Coding strand

[0086] The target sequence of the coding strand and the two complementary single-stranded primer pairs (SgF / SgR) are shown in Table 1:

[0087] Table 1

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098] 2. No-Coding strand

[0099] The target sequence of the non-coding strand and the two complementary single-stranded primers (SgF / SgR) are shown in Table 2:

[0100] Table 2

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107] Example 2: Construction of a randomized multi-target vector library

[0108] 1. Anneal the sgRNA primers targeting the coding or non-coding strands, respectively.

[0109] The sgRNA primer pairs corresponding to OsACC-C1~OsACC-C130 and OsACC-NC1~OsACC-NC84 in Example 1 (i.e., SgF and SgR corresponding to each target sequence in Tables 1 and 2) were annealed as follows: 98℃, 5 min; 95℃, 1 min; 90℃, 1 min; 80℃, 1 min; 70℃, 1 min; 60℃, 1 min; 50℃, 1 min; 40℃, 1 min; 30℃, 1 min; 20℃, 1 min; 10℃, 1 min; and stored at 4℃.

[0110] The obtained double strand includes a Target sequence, two BsaI restriction sites, and a unique barcode sequence corresponding to the Target sequence.

[0111] Equal amounts of the target primer annealing products from each coding strand were mixed together to obtain a mixture of coding strand target primer annealing products.

[0112] Equal amounts of the annealed primer products of each non-coding strand were mixed together to obtain a mixture of annealed primer products of non-coding strands.

[0113] II. Constructing the backbone vectors pOsU3-S1, pOsU3-S2, and pOsU3-S3 and digesting them with enzymes respectively.

[0114] The pOsU3-S1, pOsU3-S2, and pOsU3-S3 vectors were digested with BsaI (37°C, 2 h) and the large fragments of the vectors were recovered for subsequent experiments in step "four". The nucleotide sequence of the backbone vector pOsU3-S1 is shown in SEQ ID NO.6, the nucleotide sequence of the backbone vector pOsU3-S2 is shown in SEQ ID NO.7, and the nucleotide sequence of the backbone vector pOsU3-S3 is shown in SEQ ID NO.8.

[0115] in:

[0116] The method for constructing the pOsU3-S1 vector is as follows:

[0117] (1) The pOsU3-sgRNA vector was double-digested with HindIII / EcoRI (37℃, 2h), and the large fragment of the vector was recovered for use in step (4) experiment;

[0118] The nucleotide sequence of the pOsU3-sgRNA vector is shown in SEQ ID NO.1;

[0119] (2) Primer pairs were designed to amplify the fragment BglII-OsU3 shown in SEQ ID NO.2 using pOsU3-sgRNA as a template. The primers are:

[0120] OsU3-F:cgttgtaaaacgacggccagtAGATCTagtaattcatccaggtc

[0121] OsU3-R:ctggcttttagtaagccGGTCTCCcgccacggatcatctgc

[0122] (3) The ccdB lethal gene sequence shown in SEQ ID NO.16 was synthesized, and primer pairs were designed to amplify the ccdB-BarcodeS1-Acc65I fragment shown in SEQ ID NO.3 using the ccdB lethal gene as a template. The primers are:

[0123] ccdB-F:gcagatgatccgtggcgGGAGACCggcttactaaaagccag

[0124] S1-R:ctatgaccatgattacgccGGTACCGGCTACAGgactGGAGACCgtcgacctgcag

[0125] (4) The BglII-OsU3 obtained in step (2) and the ccdB-BarcodeS1-Acc65I fragment obtained in step (3) were recombined with the pOsU3-sgRNA vector digested with HindIII / EcoRI in step (1) to obtain the pOsU3-S1 vector shown in SEQ ID NO. 6. The recombination reaction system was as follows:

[0126] Matrix carrier fragment: Length (bp) × 0.02 / Concentration of recovered product (ng / uL)

[0127] Insertion fragment: Length (bp) × 0.04 / Concentration of recovered product (ng / uL)

[0128] 2×MultiF Seamless Assembly Mix(ABclonal RK21020): 5uL

[0129] ddH2O: up to 10uL

[0130] The reaction program was: 50℃, 30 min (with 1-2 inserted fragments) / 50℃, 60 min (with 2-4 inset fragments).

[0131] The method for constructing the pOsU3-S2 vector is as follows:

[0132] The remaining operations are the same as those for constructing the pOsU3-S1 vector, except that:

[0133] Step (3) The downstream primer is replaced with:

[0134] S2-R: ctatgaccatgattacgccGGTACCGCTCCTTGgactGGAGACCgtcgacctgcag;

[0135] The amplification product is the ccdB-BarcodeS2-Acc65I fragment shown in SEQ ID NO.4;

[0136] Accordingly, step (4) involves recombining the BglII-OsU3 and ccdB-BarcodeS2-Acc65I fragments with the pOsU3-sgRNA vector that has been double-digested with HindIII / EcoRI to obtain the pOsU3-S2 vector shown in SEQ ID NO.7.

[0137] The method for constructing the pOsU3-S3 vector is as follows:

[0138] The remaining operations are the same as those for constructing the pOsU3-S1 vector, except that:

[0139] Step (3) The downstream primer is replaced with:

[0140] S3-R:ctatgaccatgattacgccGGTACCGTAAGGTGgactGGAGACCgtcgacctgcag

[0141] The amplification product is the ccdB-BarcodeS3-Acc65I fragment shown in SEQ ID NO.5;

[0142] Accordingly, step (4) involves recombining the BglII-OsU3 and ccdB-BarcodeS3-Acc65I fragments with the pOsU3-sgRNA vector that has been double-digested with HindIII / EcoRI to obtain the pOsU3-S3 vector shown in SEQ ID NO.8.

[0143] In this step, the main purpose of using BsaI enzyme to remove ccdB is to determine the success of ligation when the "three" vector is introduced into E. coli. First, enzyme digestion is necessary to expose the sticky ends for ligation. However, during the digestion process, some parts may not be cut. Uncut vector can survive in E. coli, leading to false positives. However, if ccdB is introduced without being cut, it will have a toxic effect on E. coli, causing its death and eliminating false positives.

[0144] III. Preparation of DH5E cells for electroporation conversion:

[0145] (1) Use a sterile pipette tip to apply the commercial version of ElectroMAX TM DH5α-E (Thermo Fisher 11319019) was streaked on antibiotic-free LB plates and incubated at 37°C for 18-24 hours.

[0146] (2) Pick a single colony of newly activated Escherichia coli from an LB plate and inoculate it into 5 mL of LB liquid medium;

[0147] (3) Incubate overnight at 37℃ and 200 rpm;

[0148] (4) Take the bacterial culture and inoculate it into 250mL SOB liquid medium at a ratio of 1:500, and incubate at 18℃ and 200rpm until OD600=0.6;

[0149] (5) Transfer the bacterial culture to a pre-cooled centrifuge bottle and incubate on ice for 10 minutes;

[0150] (6) Centrifuge at 4℃ and 4000rpm for 10min;

[0151] (7) Wash with pre-cooled sterile water 4 times, each time reducing the volume by half;

[0152] (8) Resuspend the bacterial cells in 5 ml of sterile water containing 10% glycerol (pre-cooled), dispense 100 μL into 1.5 mL sterile centrifuge tubes, freeze in liquid nitrogen, and store at -70°C.

[0153] Preparation of SOB medium:

[0154] Add 20g tryptone, 5g yeast extract, and 0.5g NaCl to 950ml of deionized water, and shake the container to completely dissolve the solutes. Add 10ml of 250mmol / L KCl solution (prepare by dissolving 1.86g KCl in 100ml of deionized water), adjust the pH to 7.0 with 5mol / L NaOH, and bring the volume to 1L with deionized water. Autoclave at 121℃ for 20min. Before use, add 5ml of sterile 2mol / L MgCl2 (prepare 2mol / L MgCl2 solution as follows: dissolve 19g MgCl2 in 90ml of deionized water, adjust the volume to 100ml with deionized water, and autoclave at 121℃ for 20min).

[0155] IV. Construction of the initial vector library (the initial vector library is either an sgRNA expression unit or a complete sgRNA library).

[0156] 4-1. Construction of the initial carrier library for the encoded chain and non-encoded chain:

[0157] (1) Take 5 μL of each of the annealing products corresponding to the coding chains OsACC-C1 to OsACC-C130 in “One” and mix them to obtain a mixture of coding chain target primer annealing products.

[0158] Take 5 μL of each of the annealing products corresponding to the non-coding strands OsACC-NC1 to OsACC-NC84 in “One” and mix them to obtain a mixture of non-coding strand target primer annealing products.

[0159] (2) The mixture of annealed primers for the coding strand and the annealed primers for the non-coding strand were respectively ligated between the promoter OsU3 and Barcode-SC sequences of the three BsaI-digested backbone vectors obtained in "II".

[0160] The connection system is as follows:

[0161] Target annealed: 10uL

[0162] Enzyme digestion vector: 20 ng

[0163] T4 DNA Ligase(NEB M0202L): 1uL

[0164] 10×T4 DNA Ligase Buffer: 2uL

[0165] ddH2O: up to 20uL

[0166] The reaction system was set at 16℃ for 30 minutes.

[0167] The ligation product was purified using a kit (NEB 10010692) for subsequent experiments;

[0168] (3) Take 200-500 ng of the purified product from (2) and transform it into Escherichia coli DH5E by electroporation. The transformation method is as follows:

[0169] 1. Thaw competent cells on ice, immediately add plasmid or purified ligation product, transfer to pre-cooled electroporation cuvette (0.1 cm gap), and place on ice for 5 min;

[0170] 2. The electric field conditions are: electric field strength 18 kV / cm, pulse duration 5 ms;

[0171] 3. Immediately after electric shock, add 900 μL of antibiotic-free LB medium and incubate at 37°C and 220 rpm for 1 hour;

[0172] 4. Centrifuge at 6000 rpm for 1 min, discard the supernatant (leaving about 50 μL), mix thoroughly by pipetting, and spread onto the corresponding resistant solid culture medium.

[0173] (4) Use a spreading stick to scrape all the colonies on the LB plate into an Erlenmeyer flask containing 100 mL of liquid LB. Shake at 37°C and 220 rpm for 8-12 h. Extract plasmids using a kit (Promega 0000504352) to obtain three coding strand target libraries without sgRNA Scaffold and three non-coding strand target libraries without sgRNA Scaffold.

[0174] (5) The three coding target libraries without sgRNA scaffold and the three non-coding target libraries without sgRNA scaffold were inactivated by BsaI restriction enzyme digestion (37℃, 2h; 80℃, 20min) to obtain the coding target library without sgRNA scaffold digested by BsaI and the non-coding target library without sgRNA scaffold digested by BsaI; these were used for subsequent experiments.

[0175] (6) Construct sgRNA scaffolds sequences, wherein the sgRNA scaffolds sequences contain sequentially connected SgRNAscaffold, terminator, BamHI and BsrGI restriction sites.

[0176] The three sgRNA scaffolds are: sgRNA scaffold 1 is esgRNA-2×MS2 as shown in SEQ ID NO.12, sgRNA scaffold 2 is esgRNA-2×boxB as shown in SEQ ID NO.13, and sgRNA scaffold 3 is esgRNA-boxB-MS2 as shown in SEQ ID NO.14.

[0177] The SgRNA scaffold terminator fragment is obtained as follows:

[0178] Primer pairs were designed and PCR amplification was performed using pOsU3-esgRNA-2×MS2 (SEQ ID NO. 9), pOsU3-esgRNA-2×boxB (SEQ ID NO. 10), and pOsU3-esgRNA-boxB-MS2 (SEQ ID NO. 11) as templates. Three sgRNA fragments were obtained: esgRNA-2×MS2 (SEQ ID NO. 12) with the terminal ligated to SUP4Terminater (SEQ ID NO. 15); esgRNA-2×boxB (SEQ ID NO. 13) with the terminal ligated to SUP4Terminater (SEQ ID NO. 15); and esgRNA-boxB-MS2 (SEQ ID NO. 14) with the terminal ligated to SUP4Terminater (SEQ ID NO. 15). The scaffolds sequence (which already contains BamHI and BsrGI restriction sites) has a -BamHI-BsrGI restriction site with the nucleotide sequence GGATCCTGTACA at its 3' end as shown in SEQ ID NO.15.

[0179] The primers are:

[0180] Scaffold-F:AAAggtctctGTTTAAGAGCTATG

[0181] Scaffold-R:AAAggtctcTGTACAGGATCCagacataaaaaacaaaaaaaGGG

[0182] The PCR reaction system is as follows:

[0183] Template carrier: 1uL (20-50ng)

[0184] Primer-F: 1.5uL (10uM)

[0185] Primer-R: 1.5uL (10uM)

[0186] 2×PCR Buffer for KOD FX:25uL

[0187] 2mM dNTPs: 10uL

[0188] KOD FX (TOYOBO KFX-101): 1uL

[0189] ddH2O: 10uL

[0190] The reaction procedure was as follows: 94℃, 2 min (pre-denaturation); 98℃, 10 s (denaturation); primer Tm -5℃, 30 s (annealing); 68℃ extension (1 kb / min); denaturation-annealing-extension repeated for 35 cycles; 68℃, 10 min (full extension); 4℃ (storage).

[0191] Alternatively, the following three sgRNA scaffolds sequences (containing BamHI and BsrGI restriction sites) can be obtained artificially: esgRNA-2×MS2 as shown in SEQ ID NO.12 with the end linked to SUP4 Terminater as shown in SEQ ID NO.15; esgRNA-2×boxB as shown in SEQ ID NO.13 with the end linked to SUP4 Terminater as shown in SEQ ID NO.15; and esgRNA-boxB-MS2 as shown in SEQ ID NO.14 with the end linked to SUP4 Terminater as shown in SEQ ID NO.15.

[0192] (7) The three sgRNA scaffolds sequence fragments constructed in (6), esgRNA-2×MS2-SUP4Terminater, esgRNA-2×boxB-SUP4Terminater and esgRNA-boxB-MS2-SUP4Terminater, were digested with BsaI (37℃, 2h) to obtain three BsaI-digested sgRNA scaffolds. The digested fragments were recovered for subsequent experiments. (8)

[0194] The coding target library without sgRNA scaffolds, which was constructed in step (5) and digested with BsaI, and the non-coding target library without sgRNA scaffolds, which was also digested with BsaI, were ligated with the three types of BsaI-digested sgRNA scaffolds obtained in step (7). The ligation system was as follows:

[0195] Excerpt: 10ng

[0196] Enzyme digestion vector: 40 ng

[0197] T4 DNA Ligase(NEB M0202L): 1uL

[0198] 10×T4 DNA Ligase Buffer: 2uL

[0199] ddH2O: up to 20uL

[0200] The reaction system was set at 16℃ for 30 minutes.

[0201] The ligation product was purified using a kit for subsequent experiments;

[0202] (9) Take 200-500 ng of the purified product and transform it into Escherichia coli DH5E by electroporation; the transformation method is the same as (3);

[0203] (10) Using a spreading stick, scrape all colonies from the LB agar plate into an Erlenmeyer flask containing 100 mL of liquid LB. Incubate at 37°C and 220 rpm for 8-12 hours. Extract plasmids using the kit to obtain three coding strand sgRNA expression units and three non-coding strand sgRNA expression units. Figure 1 The complete sgRNA library shown is shown.

[0204] (11) Primers were designed to amplify the (Barcode-T)-(Barcode-SC) sequences of the six complete sgRNA libraries obtained in (10) using them as templates. The primer pairs were:

[0205] Barcoding-F: TTTTATGTCTGGATCCTGTACA

[0206] Barcoding-R: gaccatgattacgccGGTACC

[0207] The PCR reaction system is as follows:

[0208] 5×FastPfu Buffer: 10uL

[0209] 2.5mM dNTP: 4uL

[0210] Primer-F: 2uL (10uM)

[0211] Primer-R: 2uL (10uM)

[0212] Template: 20ng

[0213] FastPfu (2.5 U / μL): 1 μL

[0214] ddH2O: up to 50uL

[0215] The reaction procedure was as follows: 95℃, 2 min (pre-denaturation); 95℃, 20 s (denaturation); primer Tm℃, 30 s (annealing); 72℃ extension (1 kb / min); denaturation-annealing-extension repeated for 35 cycles; 72℃, 5 min (full extension); 4℃ (storage).

[0216] The PCR products from each library were mixed in equal volumes and recovered via gel extraction. The recovered products were then sent to BGI Genomics for next-generation sequencing. Sequencing results analysis showed that in the complete sgRNA libraries containing three different sgRNA scaffolds—esgRNA-2×MS2, esgRNA-2×boxB, and esgRNA-boxB-MS2—the coverage of the coding target sites ranged from 97.69% to 100%. This data indicates that each complete sgRNA library essentially contained all the target sites of the coding strand. Figure 2 In complete non-coding strand sgRNA libraries containing three different sgRNA scaffolds—esgRNA-2×MS2, esgRNA-2×boxB, and esgRNA-boxB-MS2—the coverage of non-coding strand target sites ranged from 92.86% to 98.81%. This data indicates that each complete sgRNA library essentially contained all non-coding strand target sites. Figure 2 ).

[0217] 2. Construction of a multi-target vector library with randomized coding chains:

[0218] (1) Take 10ug of each of the three coding strand sgRNA expression units with all target sites of the coding strand constructed in "IV. (10)" and mix them for subsequent experiments;

[0219] (2) The vector library mixed in (1) was digested with BamHI / BsrGI (37℃, 2h), and the digested vector fragments were recovered to obtain the linearized backbone fragment of the initial target library of the coding strand, which was used for subsequent experiments.

[0220] (3) The vector library mixed in (1) was double-digested with BglII / Acc65I (37℃, 2h) to recover the expression unit fragment of the coding strand target site library of about 650bp, that is, the linearized insertion fragment of the coding strand, for subsequent experiments.

[0221] (4) The 650bp coding strand target site library expression unit obtained in (3) was ligated with the mixed vector library fragment obtained in (2) after BamHI / BsrGI digestion. The reaction system was as follows:

[0222] Excerpt: 260ng

[0223] Enzyme digestion vector: 400 ng

[0224] T4 DNA Ligase(NEB M0202L): 10uL

[0225] 10×T4 DNA Ligase Buffer: 20uL

[0226] ddH2O: up to 200uL

[0227] The reaction system was set at 16℃ for 30 minutes.

[0228] The ligation product was purified using a kit for subsequent experiments;

[0229] (5) Take 200-500 ng of the purified product and transform it into Escherichia coli DH5E by electroporation.

[0230] Using a spreading stick, scrape all colonies from the LB plate into an Erlenmeyer flask containing 100 mL of liquid LB. Incubate at 37°C and 220 rpm for 8-12 hours. Extract plasmids using the kit to obtain a library of random dual-target vectors with two random coding strand target sites and two random sgRNA backbones.

[0231] (6) The random dual-target vector library of the coding strand obtained in (5) was digested with BamHI / BsrGI (37℃, 2h), and the digested vector fragments were recovered for subsequent experiments.

[0232] (7) The 650bp coding strand target site library expression unit obtained in (3) was ligated with the coding strand random dual-target vector library fragment obtained in (6) after BamHI / BsrGI restriction enzyme digestion. The reaction system was as follows:

[0233] Excerpt: 210ng

[0234] Enzyme digestion vector: 400 ng

[0235] T4 DNA Ligase(NEB M0202L): 10uL

[0236] 10×T4 DNA Ligase Buffer: 20uL

[0237] ddH2O: up to 200uL

[0238] The reaction system was set at 16℃ for 30 minutes.

[0239] The ligation product was purified using a kit for subsequent experiments;

[0240] (8) Take 200-500 ng of the purified product and transform it into Escherichia coli DH5E by electroporation.

[0241] Using a spreading stick, scrape all colonies from the LB plate into an Erlenmeyer flask containing 100 mL of liquid LB. Incubate at 37°C and 220 rpm for 8-12 hours. Extract plasmids using the kit to obtain a library of random three-target vectors with three random coding strand target sites and three random sgRNA backbones.

[0242] (12) Using the same system and program, the Barcoding-F / Barcoding-R primer pair described in "IV.1.(11)" was used to amplify the n×[(Barcode-T)-(Barcode-SC)] sequence of the random dual-target vector library and the random triple-target vector library of the coding strand as templates. The second round PCR products of each library were mixed in equal amounts and then recovered by gel. The recovered products were sent to BGI Genomics for next-generation sequencing.

[0243] Data analysis of the proportion of each target site in each round of the coding chain library shows that, compared with the initial coding chain library, the proportion of each target site in the random dual-target library and the random triple-target library of the coding chain does not change significantly. This indicates that the initial input library determines the uniformity of each target site in the random multi-target library of the coding chain. Figure 3 ).

[0244] 3. Construction of a non-coding stylus random multi-target vector library:

[0245] (1) Take 10ug of each of the three non-coding sgRNA expression units with all target sites of the non-coding strand constructed in "IV. (10)" and mix them for subsequent experiments;

[0246] (2) The vector library mixed in (1) was digested with BamHI / BsrGI (37℃, 2h), and the digested vector fragments were recovered to obtain the linearized backbone fragment of the initial target library of the coding strand, which was used for subsequent experiments.

[0247] (3) The vector library mixed in (1) was double-digested with BglII / Acc65I (37℃, 2h) to recover the non-coding strand target site library expression unit fragment of about 650bp, i.e. the linearized insertion fragment of the coding strand, for subsequent experiments;

[0248] (4) The 650bp non-coding strand target site library expression unit obtained in (3) was ligated with the mixed vector library fragment obtained in (2) after BamHI / BsrGI digestion. The reaction system was as follows:

[0249] Excerpt: 260ng

[0250] Enzyme digestion vector: 400 ng

[0251] T4 DNA Ligase(NEB M0202L): 10uL

[0252] 10×T4 DNA Ligase Buffer: 20uL

[0253] ddH2O: up to 200uL

[0254] The reaction system was set at 16℃ for 30 minutes.

[0255] The ligation product was purified using a kit for subsequent experiments;

[0256] (5) Take 200-500 ng of the purified product and transform it into Escherichia coli DH5E by electroporation.

[0257] Using a spreading stick, scrape all colonies from the LB plate into an Erlenmeyer flask containing 100 mL of liquid LB. Incubate at 37°C and 220 rpm for 8-12 hours. Extract plasmids using the kit to obtain a non-coding strand random dual-target vector library with two random non-coding strand target sites and two random sgRNA backbones.

[0258] (6) The non-coding strand random dual-target vector library obtained in (5) was digested with BamHI / BsrGI (37℃, 2h), and the digested vector fragments were recovered for subsequent experiments.

[0259] (7) The 650bp non-coding target site library expression unit obtained in (3) was ligated with the non-coding random dual-target vector library fragment obtained in (6) after digestion with BamHI / BsrGI. The reaction system was as follows:

[0260] Excerpt: 210ng

[0261] Enzyme digestion vector: 400 ng

[0262] T4 DNA Ligase(NEB M0202L): 10uL

[0263] 10×T4 DNA Ligase Buffer: 20uL

[0264] ddH2O: up to 200uL

[0265] The reaction system was set at 16℃ for 30 minutes.

[0266] The ligation product was purified using a kit for subsequent experiments;

[0267] (8) Take 200-500 ng of the purified product and transform it into Escherichia coli DH5E by electroporation.

[0268] Using a spreading stick, scrape all colonies from the LB plate into an Erlenmeyer flask containing 100 mL of liquid LB. Incubate at 37°C and 220 rpm for 8-12 hours. Extract plasmids using the kit to obtain a non-coding strand random three-target vector library with three random non-coding strand target sites and three random sgRNA backbones.

[0269] (12) Using the same system and program, the Barcoding-F / Barcoding-R primer pair described in "IV.1.(11)" was used to amplify the n×[(Barcode-T)-(Barcode-SC)] sequence of the non-coding strand random dual-target vector library and the non-coding strand random triple-target vector library as templates. The second round PCR products of each library were mixed in equal amounts and then recovered by gel extraction. The recovered products were sent to BGI Genomics for next-generation sequencing.

[0270] Data splitting and analysis of the proportion of each target site in each round of the non-coding chain library showed that, compared with the initial non-coding chain vector library, the proportion of each target site in the non-coding chain random dual-target vector library and the non-coding chain random triple-target vector library did not change significantly. This indicates that the initial input library determines the uniformity of each target site in the non-coding chain random multi-target vector library. Figure 4 ).

[0271] Analysis of the proportion of sgRNA scaffolds and target-scaffold types in both coding and non-coding random vector libraries showed that the proportions of the three sgRNA scaffolds remained relatively constant in both libraries. However, the number of target-scaffold types increased significantly with the increase in the number of random targets. In random single-target libraries, the coding library contained approximately 390 target-scaffold types, while the non-coding library contained only 240. In random dual-target libraries, the number of target-scaffold types increased to approximately 4000 in both the coding and non-coding libraries. Figure 5 ).

[0272] The results above show that the random multi-target assembly system can randomly combine multiple target sites and various sgRNA backbones, which greatly improves the diversity of target-scaffolds in the vector library, and its hybrid construction method greatly reduces the workload.

[0273] Example 3. Directed evolution of the OsACC gene to screen for herbicide resistance sites.

[0274] 1. Construction of pH-MoBE vector library with random dual targets

[0275] (1) Select the coding strand random dual-target vector library constructed in “Example 2, IV, 2, (5)” and the non-coding strand random dual-target vector library constructed in “Example 2, IV, 3, (5)”, and perform double digestion with BglII / Acc65I on them respectively. The coding strand random dual-target expression units and non-coding strand random dual-target expression unit fragments of about 1300bp were recovered for subsequent experiments.

[0276] (2) The pH-MoBE vector with nucleotide sequence SEQ ID NO.19 as shown was digested with BsaI (37℃, 2h), and the large fragment of the vector was recovered for subsequent experiments;

[0277] The method for constructing the pH-MoBE vector is as follows:

[0278] The pHUE411 vector was digested with HindIII (37℃, 2h), and the large fragment of the vector was recovered for subsequent experiments.

[0279] Using the pOsU3-S1 vector with nucleotide sequence SEQ ID NO.6 as a template, primers were designed to amplify the ccdB nucleotide sequence with SEQ ID NO.16 as shown. The primers are:

[0280] ccdB-F: gacggccagtgccaagctGATCGGAGACCggcttactaaaag

[0281] ccdB-R:cactgcaggcatgcaagctGTACGGAGACCgtcgacctg

[0282] The intermediate vector was obtained by recombination reaction of ccdB with the large fragment of pHUE411 vector digested with HindIII.

[0283] The intermediate vector was double-digested with StuI / SacI (37℃, 2h), and the large fragment of the vector was recovered for subsequent experiments;

[0284] Primer pairs were designed to amplify the NLS-nCas9(D10A)-Linker-NLS fragment and the T2A-MCP-Linker-NLS-PmCDA1-Linker-UGI-Linker-NLS-T2A-TadA9-Linker-N22p-NLS fragment using the MoBE fragment shown in SEQ ID NO.17 as a template. The primers are:

[0285] MoBE-F1: gttacttctgcagccctaggcctATGaagcggccagcggcg

[0286] MoBE-R1: CCTCTGCCCTCCTTAAGcaccttccgcttcttctttggGCT

[0287] MoBE-F2:GGGAGCccaaagaagaagcggaaggtgCTTAAG

[0288] MoBE-R2: acgaacgaaagctctgagctctcagcgtaccgaattcccCACC

[0289] The pH-MoBE vector was obtained by recombination of the NLS-nCas9(D10A)-Linker-NLS fragment and the T2A-MCP-Linker-NLS-PmCDA1-Linker-UGI-Linker-NLS-T2A-TadA9-Linker-N22p-NLS fragment with the intermediate vector large fragment digested by Stui / SacI.

[0290] The nucleotide sequence of the MoBE fragment, SEQ ID NO.17, is shown below.

[0291] pHUE411 vector reference: A CRISPR / Cas9 toolkit for multiplex genome editing in plants; BMC Plant Biol; 2014

[0292] (3) The approximately 1300 bp coding strand random dual-target expression unit and non-coding strand random dual-target expression unit fragments obtained in (1) were respectively ligated with the pH-MoBE vector obtained in (2) after digestion with BsaI. The ligation system was as follows:

[0293] Clip: 140ng

[0294] Enzyme digestion vector: 600 ng

[0295] T4 DNA Ligase(NEB M0202L): 5uL

[0296] 10×T4 DNA Ligase Buffer: 10uL

[0297] ddH2O: up to 100uL

[0298] The reaction system was set at 16℃ for 30 minutes.

[0299] The ligation products were purified using kits for subsequent experiments;

[0300] (4) Take 100-400 ng of each purified product and transform them into Escherichia coli DH5α;

[0301] Using a spreading stick, all colonies on the LB plate were scraped into Erlenmeyer flasks containing 100 mL of liquid LB. The culture was incubated at 37°C and 220 rpm for 8-12 hours. Plasmids were extracted using the kit to obtain pH-MoBE vectors with random dual targets in the coding strand and pH-MoBE vectors with random dual targets in the non-coding strand.

[0302] 2. Screening for herbicide-resistant sites using Agrobacterium-infected rice callus.

[0303] Screening process for herbicide-resistant sites ( Figure 6 )for:

[0304] (1) The pH-MoBE vector with random dual targets in the coding strand and the pH-MoBE vector with random dual targets in the non-coding strand obtained in Example 3, 1 and step (4) were respectively transformed into Agrobacterium EHA105.

[0305] Meanwhile, the STEME-1 vector, which targets P1927, was used as a positive control and transformed into Agrobacterium EHA105.

[0306] P1927 is the herbicide resistance site screened using STEME-1, as reported in a previous article: Targeted, random mutationnesis of plant genes with dual cytosine and adenine base editors; Nature Biotechnology; 2020

[0307] (2) Scrape Agrobacterium (approximately 3000 clones) from LB plates and mix them together with random double-target pH-MoBE vectors with non-coding strands and random double-target pH-MoBE vectors. Adjust their OD to between 0.02 and 0.05 with infection solution (with added AS) for subsequent experiments.

[0308] (3) Select about 30,000 rice callus tissues induced for about 45 days, and infect the callus tissues with the prepared infection solution containing Agrobacterium for 30 minutes.

[0309] The infected callus tissue was spread evenly on the co-culture medium and incubated in the dark at 22°C for 3 days.

[0310] Wash the wound with sterile water 5 times to remove Agrobacterium on the surface of the callus, and then kill Agrobacterium with 2 / 1000 carbobenzyl for 20 minutes.

[0311] The callus tissue was placed on a selection medium with hygromycin resistance and cultured at 28°C for 4 weeks;

[0312] Approximately 18,000 positive callus cells that had differentiated into small particles were transferred to a container with 0.108 mg L... -1 On the selection medium of haloxyfop, cultured at 28°C for 4-6 weeks;

[0313] Approximately 600 surviving, herbicide-resistant calluses that had differentiated into small grains were transferred to a container containing 0.162 mg L... - 1 Incubate haloxyfop on differentiation medium at 28°C for 2-4 weeks;

[0314] The differentiated seedlings were transferred to a container with 0.162 mg L... -1 Incubate at 28°C for 2 weeks on rooting medium;

[0315] (4) Extract DNA from 2-3 cm of seedling leaves, and design primer pairs to amplify the target-scaffold barcode sequence and the 34th exon sequence of OsACC, respectively. The primers are:

[0316] Barcode-F:AGTAATTCATCCAGGTCACC

[0317] Barcode-R:tgcacactaaaaagataaaactgtagag

[0318] OsACC-F:GATTTTCCACTGGTGAGTGTGACTGC

[0319] OsACC-R:GCTCTCTAGAGGGATCCATCTG

[0320] The PCR products were sent to Sangon Biotech for sequencing analysis to determine their target-scaffold combination type and editing type.

[0321] Following the above experimental procedure, we screened out herbicide-resistant plants that showed better growth than the positive control. Figure 7 ).

[0322] Barcode-T to Barcode-SC analysis and genotypic analysis of herbicide-resistant plants revealed 13 target sites among the 10 edited herbicide-resistant plants. The three sgRNA scaffold combinations were randomized, and the target-scaffold types were diverse and randomized. Mutation types included heterozygous and biallelic mutations, single-point mutations, and multi-site mutations. Based on mutation type, they could be divided into three main categories: W2125C, I2139N, and C2186R. Among these, V1703I, D1970N, R2126T, G2127A, F2207L, and E2327K were novel sites never before reported. Figure 8 (Table 3).

[0323] Table 3

[0324]

[0325]

[0326] The results above demonstrate that by using a random multi-target assembly system combined with the base editing tool MoBE, herbicide-resistant plants with novel mutations can be directionally evolved in rice.

[0327] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for random multi-target assembly and editing, characterized in that, Select an endogenous gene or a segment of an endogenous gene from the species to be edited, design all target sites, and assemble them using a random multi-target assembly system; the assembly system can assemble multiple random target sites together, thereby generating edits at multiple random sites. The method includes the following steps: S1: For each target site, two complementary single-stranded primers are synthesized in opposite directions. After annealing, they are formed into double strands to obtain the target primer annealing product. The target primer annealing product contains the Target sequence, two BsaI restriction sites, and a unique barcode sequence corresponding to the Target sequence. The target primer annealing products of each coding strand are mixed together to obtain a coding strand target primer annealing product mixture; The target primer annealing products of each non-coding strand are mixed together to obtain a mixture of non-coding strand target primer annealing products; S2: Construct a backbone vector comprising, in sequence, a BglII restriction site, a promoter, a ccdB lethal gene sequence, two BsaI restriction sites located upstream and downstream of the ccdB lethal gene sequence, and a unique barcode sequence Barcode-SC and an Acc65I restriction site; digest the backbone vector with BsaI to remove the ccdB lethal gene sequence, thereby obtaining a BsaI-digested backbone vector; S3: The mixture of annealed primers for the coding strand target obtained in S1 and the mixture of annealed primers for the non-coding strand target obtained in S1 are ligated between the promoter and the Barcode-SC sequence of the backbone vector digested by BsaI in S2. After electroporation transformation of E. coli, a coding strand target library without sgRNA scaffold and a non-coding strand target library without sgRNA scaffold are obtained. S4: Construct sgRNA Scaffolds sequences, wherein the sgRNA Scaffolds sequences contain sgRNAScaffold, terminator, BamHI and BsrGI restriction sites connected in sequence, and the sgRNA Scaffolds sequences are digested with BsaI to obtain BsaI-digested sgRNA Scaffolds. S5: Constructing sgRNA expression units: The coding strand target library without sgRNA scaffold and the non-coding strand target library without sgRNA scaffold constructed in S3 were digested with BsaI to obtain the coding strand target library without sgRNA scaffold and the non-coding strand target library without sgRNA scaffold after digestion with BsaI. The BsaI-digested sgRNA scaffolds sequences obtained in S4 were ligated with the BsaI-digested coding strand target library without sgRNA scaffolds and the BsaI-digested non-coding strand target library without sgRNA scaffolds. After electroporation transformation into E. coli, coding strand target libraries with sgRNA scaffolds and non-coding strand target libraries with sgRNA scaffolds were obtained, namely coding strand sgRNA expression units and non-coding strand sgRNA expression units. S6: Take the coding strand sgRNA expression unit or the non-coding strand sgRNA expression unit obtained in S5; S7: The coding strand sgRNA expression units or non-coding strand sgRNA expression units obtained in S6 are digested with BamHI / BsrGI to obtain linearized backbone fragments of the initial target library of the coding strand or non-coding strand. S8: The coding strand sgRNA expression unit or the non-coding strand sgRNA expression unit obtained in S6 is double-digested with BglII / Acc65I to obtain the linearized insert fragment of the coding strand or the non-coding strand. S9: The linearized insert fragment obtained in S8 is connected with the linearized backbone fragment of the initial target library obtained in S7. After electroporation transformation of E. coli, a random dual-target library of the coding strand or a random dual-target library of the non-coding strand is obtained. S10: The coding strand random dual-target library or non-coding strand random dual-target library obtained in S9 is double-digested with BamHI / BsrGI to obtain linearized fragments of the target library obtained by double-digesting with BamHI / BsrGI in either the coding or non-coding strands. The linearized fragments of the initial target library obtained in S8, which were double-digested with BglII / Acc65I, are used as insert fragments for ligation. After electroporation and transformation into E. coli, the next round of random multi-target libraries is obtained. This cycle is repeated, using the linearized fragments of the target library obtained in the previous round, which were double-digested with BamHI / BsrGI, as the backbone and the linearized fragments of the initial target library obtained in S8, which were double-digested with BglII / Acc65I, as insert fragments for ligation. After electroporation and transformation into E. coli, the next round of random multi-target libraries is obtained. With each additional round, each vector in the target library contains one more target sgRNA, resulting in either a coding strand random multi-target library or a non-coding strand random multi-target library. S11: The pH-MoBE vector is digested with BsaI to remove the ccdB lethal gene, resulting in a linearized backbone fragment. The coding strand random dual-target vector library or non-coding strand random dual-target vector library obtained in S9, or the coding strand or non-coding strand random multi-target library obtained in S10, is digested with BglII / Acc65I to obtain linearized coding strand or non-coding strand random dual-target fragments, or linearized coding strand or non-coding strand random multi-target fragments. The linearized coding strand or non-coding strand random dual-target fragments, or linearized coding strand or non-coding strand random multi-target fragments, are ligated with the BsaI-digested linearized pH-MoBE backbone fragment to obtain a pH-MoBE vector with coding strand or non-coding strand random dual targets, or with coding strand or non-coding strand random multi-targets. S12: The pH-MoBE vector obtained in S11 with random dual targets in the coding or non-coding strands, or random multi-target targets in the coding or non-coding strands, is transferred into the species to be edited, thereby generating editing at two or more random sites. The sgRNA expression unit described in S5 includes: A-promoter-target-sgRNA Scaffold-terminator-BC-(Barcode-T)-(Barcode-SC)-D; A and B are the restriction sites of a pair of isosine enzymes, and C and D are the restriction sites of a pair of isosine enzymes. The restriction enzyme sites of the two pairs of isosine enzymes A and B, and C and D in the sgRNA expression unit are selected from restriction endonuclease sites with the same sticky ends after digestion. In the sgRNA expression unit, Target is a designed random target site sequence; The random dual-target vector library mentioned in S9 is BglII-promoter-(Target-A)-(Scaffold-X)-promoter-(Target-B)-(Scaffold-Y)-terminator-BmHI-BsrGI-(Barcode-TB)-(Barcode-SC-Y)-(Barcode-TA)-(Barcode-SC-X)-Ac65I; Target-A and Target-B can be any target point in the coding chain or non-coding chain; Scaffold-X and Scaffold-Y are selected from any one of esgRNA-boxB-MS2, esgRNA-2×MS2 and esgRNA-2×boxB; Barcode-TA and Barcode-TB are the barcode sequences corresponding to any target point in the encoded or non-encoded chain; Barcode-SC-X and Barcode-SC-Y are selected from any one of the barcode sequences corresponding to esgRNA-boxB-MS2, esgRNA-2×MS2, and esgRNA-2×boxB. The plant in question is rice; In the sgRNA expression unit, the sgRNA scaffold is selected from esgRNA-2×MS2, esgRNA-2×boxB, and esgRNA-boxB-MS2; The terminator in the sgRNA expression unit is selected from SUP4 Terminater; In the sgRNA expression unit, the Barcode-T is a random 8bp sequence corresponding to the random Target; In the sgRNA expression unit, Barcode-SC consists of three random 8bp sequences corresponding to sgRNA Scaffold.

2. The random multi-target assembly and editing method according to claim 1, characterized in that, The mixing described in S1 refers to mixing equal amounts of the target primer annealing products of the coding strand, or mixing equal amounts of the target primer annealing products of the non-coding strand.

3. The random multi-target assembly and editing method according to claim 1, characterized in that, The promoter mentioned in S2 is selected from OsU3, OsU6, and TaU6.

4. The random multi-target assembly and editing method according to claim 3, characterized in that, The promoter mentioned in S2 is selected from OsU3.

5. The random multi-target assembly and editing method according to claim 1, characterized in that, The skeletal carrier described in S2 is selected from pOsU3-S1, pOsU3-S2, and pOsU3-S3.

6. The random multi-target assembly and editing method according to claim 1, characterized in that, In the sgRNAScaffolds sequence described in S4, the sgRNA Scaffold is selected from esgRNA-2×MS2, esgRNA-2×boxB, and esgRNA-boxB-MS2, and the terminator is selected from SUP4 Terminater.

7. The random multi-target assembly and editing method according to claim 6, characterized in that, A and B are selected from BglII and BamHI; C and D are selected from BsrGI and Acc65I; Target, Barcode-T, and Barcode-SC do not contain BglII, BamHI, BsrGI, Acc65I, or BsaI restriction sites; The nucleotide sequences of esgRNA-2×MS2 are shown in SEQ ID NO.12, esgRNA-2×boxB are shown in SEQ ID NO.13, and esgRNA-boxB-MS2 are shown in SEQ ID NO.

14. The terminator is selected from the SUP4 Terminater nucleotide sequence as shown in SEQ ID NO.

15.

8. The random multi-target assembly and editing method according to claim 1, characterized in that, In S6, when the coding strand sgRNA expression unit or the non-coding strand sgRNA expression unit includes different types due to different sgRNA scaffolds, the coding strand sgRNA expression units containing each type of sgRNA scaffold are mixed in equal amounts, or the non-coding strand sgRNA expression units containing each type of sgRNA scaffold are mixed in equal amounts.

Images