Single primer duplex fluorescent detection kit for identifying capripoxvirus and bovine papular dermatosis virus and special primer and probe thereof

Abstract

This invention discloses a single-primer dual-fluorescence detection kit for identifying sheep poxvirus and bovine nodular dermatovirus, along with its dedicated primers and probes, belonging to the field of biological technology. The kit provided by this invention includes universal PCR amplification primers for detecting sheep poxvirus, a probe for detecting sheep poxvirus, and a probe for detecting bovine nodular dermatovirus. It can be used for direct qualitative identification and detection of sheep poxvirus and bovine nodular dermatovirus within the genus *Capepoxvirus*, exhibiting advantages such as high sensitivity, strong specificity, and good repeatability, and can also achieve accurate quantification. This invention can provide technical support and assistance for the identification and differentiation of *Capepoxvirus* viruses, epidemiological investigations, virus control, and the purification and screening of vaccine raw materials.

Description

Technical Field

[0001] This invention belongs to the field of biological technology, specifically relating to a single-primer dual-fluorescence detection kit for identifying sheep pox virus (including goat pox virus and sheep pox virus) and bovine nodular dermatosis virus, as well as its dedicated primers and probes, and a non-disease diagnostic method for differentiating between sheep pox virus and bovine nodular dermatosis virus. Background Technology

[0002] The genus Capripox virus belongs to the family Poxviridae and the subfamily Chordatapoxvirinae. This genus includes goatpox virus (GTPV), sheep pox virus (SPPV), and bovine nodular dermatosis virus (LSDV). These viruses are DNA viruses with a genome length of approximately 150 kb, encoding 147 open reading frames.

[0003] The main symptoms of goat pox virus disease are papular-pustular pox lesions. Goat pox virus can infect goats of all breeds, sexes, and ages, with lambs being the most susceptible, with an infection rate of 100%. It primarily infects other goats through contact with broken skin, inhalation, or transmission via vectors, and spreads rapidly within the same flock. Sheep pox, also known as sheep smallpox, is a contagious disease caused by sheep pox virus, characterized by specific pox lesions on the skin and mucous membranes throughout the body. Sheep of all breeds, sexes, and ages are susceptible, and infected sheep experience fever and a high mortality rate. Bovine nodular dermatitis is an acute, subacute, or chronic infectious disease caused by bovine nodular dermatitis virus, characterized by fever and widespread nodules on the skin, mucous membranes, and organ surfaces. Infected cattle experience swollen lymph nodes, mastitis in lactating cows, and orchitis in bulls causing permanent or temporary infertility, leading to death in severe cases. These three goat pox virus genera have caused serious economic losses to dairy and beef cattle farming.

[0004] Vaccination is the primary means of controlling viruses. Although there is some cross-protection among goatpox virus, sheep pox virus, and bovine nodular dermatitis virus (BNDV), goatpox vaccine can be used as a preventive measure for BNDV. However, targeted vaccination will bring better control results. However, the genomic sequence differences among members of the goatpoxvirus genus are relatively small, which increases the difficulty of identifying members of the genus, such as the difference between sheep poxvirus (including goatpox virus and sheep poxvirus) and BNDV. Currently, although methods exist for identifying members of the goatpoxvirus genus, such as patent document CN112126717A (hereinafter referred to as Document 1), which discloses a dual fluorescent PCR primer, probe, method, and kit for identifying sheep poxvirus and BNDV, the method disclosed in Document 1 cannot directly identify and detect sheep poxvirus and BNDV. Summary of the Invention

[0005] To address one or more problems existing in the prior art, one aspect of the present invention provides a single-primer dual-fluorescence detection kit for identifying sheep poxvirus and bovine nodular dermatosis virus, wherein the sheep poxvirus includes goat poxvirus and sheep poxvirus, and the detection kit comprises:

[0006] A universal PCR amplification primer set for detecting goatpoxviruses, comprising the forward primer LSD13F shown in SEQ ID NO:1 and the reverse primer LSD13R shown in SEQ ID NO:2;

[0007] The probe GaPvP for detecting sheep pox virus has the nucleotide sequence shown in SEQ ID NO:3; and

[0008] The probe LSDVP, used to detect bovine nodular dermatitis virus, has the nucleotide sequence shown in SEQ ID NO:4.

[0009] In some embodiments, the 5' ends of the probe GaPvP and the probe LSDVP are labeled with different fluorescent reporter groups, and the 3' ends of both are labeled with fluorescent quencher groups.

[0010] In some embodiments, the detection kit further includes standards: CDS17 standard and CDS21 standard; each standard is in a single package or a mixed package of equal concentrations; when using the kit to perform single-primer dual real-time quantitative PCR detection of sheep pox virus and bovine nodular dermatovirus, the single-packaged standards are mixed at equal concentrations or the mixed-packaged standards are used directly.

[0011] In another aspect, the present invention provides a universal PCR amplification primer for detecting goatpoxviruses, which is used in the above-mentioned detection kit and includes the forward primer LSD13F shown in SEQ ID NO: 1 and the reverse primer LSD13R shown in SEQ ID NO: 2.

[0012] In another aspect, the present invention provides a probe GaPvP for detecting sheep pox virus, which is used in the above-mentioned detection kit. The nucleotide sequence of the probe GaPvP is shown in SEQ ID NO:3, with a fluorescent reporter group labeled at its 5' end and a fluorescent quencher group labeled at its 3' end.

[0013] In another aspect, the present invention provides a probe LSDVP for detecting bovine nodular dermatosis virus, which is used in the above-mentioned detection kit. The nucleotide sequence of the probe LSDVP is shown in SEQ ID NO:4, with a fluorescent reporter group labeled at its 5' end and a fluorescent quencher group labeled at its 3' end.

[0014] Another aspect of the present invention provides a non-disease diagnostic method for differentiating between sheep pox virus and bovine nodular dermatosis virus, comprising the following steps:

[0015] S1: Extract DNA from the sample to be tested;

[0016] S2: Using the DNA extracted in step S1 as a template, perform single-primer dual fluorescent PCR amplification using the universal PCR amplification primer set, probe GaPvP and probe LSDVP in the kit mentioned above, and obtain the amplification curve;

[0017] S3: Analyze the amplification curve obtained in step S2 to determine whether the sample to be tested contains sheep pox virus and / or bovine nodular dermatosis virus;

[0018] The criteria for judgment are:

[0019] If an amplification curve appears in the fluorescence channel corresponding to the GaPvP probe, and the Ct value is ≤38, the sample is determined to contain sheep pox virus; if the Ct value is >40, it is determined to be negative, meaning the sample does not contain sheep pox virus; if 38 < Ct value ≤40, and the Ct value is ≤40 upon retesting, the sample is determined to contain sheep pox virus; if there is no amplification curve or the Ct value is >40 upon retesting, the sample is determined to not contain sheep pox virus.

[0020] If an amplification curve appears in the fluorescence channel corresponding to the probe LSDVP, and the Ct value is ≤38, the sample is determined to contain bovine nodular dermatitis virus (BND). If the Ct value is >40, the sample is determined to be negative, meaning the sample does not contain BND. If 38 < Ct value ≤40, and the Ct value is ≤40 upon retesting, the sample is determined to contain BND. If there is no amplification curve or the Ct value is >40 upon retesting, the sample is determined to not contain BND.

[0021] In some embodiments, the 25-30 μL system for dual fluorescent PCR amplification in step S2 comprises: 0.25-0.75 μL of forward primer LSD13F (10 μM), 0.25-0.75 μL of reverse primer LSD13R (10 μM), 0.50-1.00 μL of probe GaPvP (10 μM), 0.50-1.00 μL of probe LSDVP (10 μM), 1-3 μL of DNA template, 10-15 μL of qPCR Mix, and ddH2O to make up to 25-30 μL.

[0022] In some embodiments, the procedure for dual fluorescence PCR amplification in step S2 includes: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10–15 s; annealing and extension at 55°C for 30–34 s; and 40–45 cycles.

[0023] In some embodiments, the 5' end of the GaPvP probe is labeled with a fluorescent reporter group VIC, and the 3' end with a quencher group MGB; the 5' end of the LSDVP probe is labeled with a fluorescent reporter group FAM, and the 3' end with a quencher group MGB; the determination criterion is:

[0024] If an amplification curve appears in the VIC fluorescence channel and the Ct value is ≤38, the sample is determined to contain sheep pox virus; if the Ct value is >40, the sample does not contain sheep pox virus; if 38 < Ct value ≤40, and the Ct value is ≤40 upon retesting, the sample is determined to contain sheep pox virus; if there is no amplification curve or the Ct value is >40 upon retesting, the sample is determined to not contain sheep pox virus.

[0025] If an amplification curve appears in the FAM fluorescence channel and the Ct value is ≤38, the sample is determined to contain bovine nodular dermatitis virus (BND). If the Ct value is >40, the sample does not contain BND. If 38 < Ct value ≤40, and the Ct value is ≤40 upon retesting, the sample is determined to contain BND. If there is no amplification curve or the Ct value is >40 upon retesting, the sample is determined to not contain BND.

[0026] The single-primer dual-fluorescence detection kit for identifying sheep poxvirus and bovine nodular dermatovirus provided by the above technical solution includes universal PCR primers for detecting goatpoxviruses and fluorescent probes for detecting sheep poxviruses (including goatpoxvirus and sheep poxvirus) and bovine nodular dermatovirus, respectively. It allows for the direct identification and detection of sheep poxvirus and bovine nodular dermatovirus using only one pair of universal PCR primers and two fluorescent probes, making it simpler and more efficient than the method disclosed in Reference 1. Sensitivity tests show that the kit and method provided by this invention achieve a detection sensitivity of 1 copy / μL for both sheep poxvirus and bovine nodular dermatovirus, significantly higher than the sensitivity (10 copies / μL) for identifying sheep poxviruses and bovine nodular dermatovirus in Reference 1. Therefore, the method and kit for identifying sheep pox virus and bovine nodular dermatosis virus provided by this invention can directly identify and distinguish between sheep pox virus and bovine nodular dermatosis virus in a single operation, and has high sensitivity. It can provide technical support and assistance for the identification and differentiation of goat poxviruses, epidemiological investigations, and virus prevention and control, and also help with the purification and screening of vaccine raw materials in vaccine production. Attached Figure Description

[0027] Figure 1This is a schematic diagram showing the partial sequence alignment of the CDS17 gene of the goat pox vaccine strain AV41 (MH381810.1) and the CDS21 gene of the bovine nodular dermatitis virus strain China / GD01 / 2020 (MW355944.1).

[0028] Figure 2 Amplification curves of CDS17 and CDS21 standards at various concentrations were obtained using the primers and probes from group 1 in Example 1.

[0029] Figure 3 Amplification curves of a series of concentrations of CDS17 standards were obtained using the primers and probes from group 1 in Example 1 on an ABI qPCR instrument.

[0030] Figure 4 According to Figure 3 The standard curve plotted from the amplification curve shown;

[0031] Figure 5 Amplification curves of CDS21 standards at a series of concentrations were obtained using the primers and probes from group 1 in Example 1 on an ABI qPCR instrument.

[0032] Figure 6 According to Figure 5 The standard curve is plotted from the amplification curve shown. Detailed Implementation

[0033] To address the deficiency in existing technologies regarding the simultaneous identification and detection of sheep poxvirus and bovine nodular dermatosis virus (BNDV), this invention aims to provide a single-primer dual-fluorescence PCR detection method for identifying and detecting these two viruses. This method can be used to directly distinguish between sheep poxvirus and BNDV, providing technical support for vaccine control of sheep poxviruses. Based on this, this invention also provides a single-primer dual-fluorescence detection kit for identifying sheep poxvirus and BNDV, along with its dedicated primers and probes, and the detection method.

[0034] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention and are not intended to limit the scope of the present invention.

[0035] Unless otherwise specified, all methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., 3rd edition, 2001, NY, Cold Spring Harbor).

[0036] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials used in this invention. In fact, the sources of biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethical standards can be substituted and used according to the suggestions in the embodiments.

[0037] The sequences involved in the embodiments can all be synthesized using existing techniques.

[0038] Example 1: Design and optimization of primers and probes

[0039] Gene sequences of sheep poxvirus, goat poxvirus, and bovine nodular dermatitis virus were retrieved from the NCBI GenBank nucleic acid database (http: / / www.ncbi.nlm.nih.gov). A comparison of the numerous gene sequences obtained revealed that the CDS17 gene (bases 14911-15231 of MH381810.1, shown in SEQ ID NO:5 in the sequence listing) of sheep poxvirus (e.g., goat pox vaccine strain AV41 (MH381810.1)) and the CDS21 gene (bases 15264-15602 of MW355944.1, shown in SEQ ID NO:6 in the sequence listing) of bovine nodular dermatitis virus (e.g., China / GD01 / 2020 strain (MW355944.1)) contained a 12-base deletion region in the CDS17 gene (e.g., the sequence of sheep poxvirus, goat poxvirus, and bovine nodular dermatitis virus). Figure 1(As shown in the box marked in the middle), the CDS17 gene of sheep poxvirus and the CDS21 gene of bovine nodular dermatitis virus were thus identified as target sequences for distinguishing between the two. Based on the identified target sequences, the inventors designed universal PCR primers for detecting sheep poxviruses and detection probes for sheep poxvirus and bovine nodular dermatitis virus, respectively, using primer and probe design software. The inventors have verified that there are multiple combinations of universal PCR primers for detecting goatpoxviruses that can achieve a distinguishing effect. However, there is only one set of detection probes that can distinguish between goatpoxvirus and bovine nodular dermatovirus (SEQ ID NO:3: GaPvP (5'-AG-----------GC-3') for goatpoxvirus and SEQ ID NO:4: LSDVP (5'-TG-----------AA-3') for bovine nodular dermatovirus). The four major differential bases of these two specially designed probes must be evenly distributed at the 5' and 3' ends of the probes to achieve a distinguishing effect. Probes with other structural forms at this position (e.g., the major differential bases are only distributed at the 5' or 3' ends of the probe, or are not evenly distributed at both ends of the probe (e.g., there are 3 differential bases at the 5' end and 1 differential base at the 3' end)) will cause the probes to lose their ability to distinguish between goatpoxvirus and bovine nodular dermatovirus.

[0040] From numerous universal PCR primers and probes designed based on the target sequences identified above, this invention designs multiple primer and probe combinations and screens out the following groups 1 and 2, with sequence information shown below:

[0041] Group 1:

[0042] Universal PCR primers for detecting goatpoxviruses include:

[0043] LSD13F: 5'-TCATTATCMTCACTACTAACRGTAT-3' (SEQ ID NO: 1);

[0044] LSD13R: 5'-AAAGCAATATGAAAMMRGCA-3' (SEQ ID NO: 2);

[0045] The probe GaPvP against sheep pox virus is 5'-AGATGGCGATGGTGC-3' (SEQ ID NO:3), with a fluorescent reporter group labeled VIC at the 5' end and a quencher group labeled MGB at the 3' end.

[0046] The probe LSDVP against bovine nodular dermatosis virus is 5'-TGATGGTGATGGTAA-3' (SEQ ID NO:4), with a fluorescent reporter group labeled FAM at its 5' end and a quencher group labeled MGB at its 3' end.

[0047] Group 2:

[0048] Universal PCR primers for detecting goatpoxviruses include:

[0049] LSD13F1: 5'-CATTATCATCACTACTAACGGTATC-3' (SEQ ID NO: 7);

[0050] LSD13R1: 5'-AATATCTATTGAACGTGTTACATTG-3' (SEQ ID NO: 8);

[0051] The probe GaPvP against sheep pox virus shown in SEQ ID NO:3;

[0052] The probe LSDVP against bovine nodular dermatitis virus is shown in SEQ ID NO:4.

[0053] Using the primers and probes from Groups 1 and 2 above, a series of 10-fold diluted standard solutions of positive standards (sheep pox virus and bovine nodular dermatosis virus positive standards, with concentrations of 10,000, and 10,000 respectively) were prepared. 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 The primers and probes were used to screen for preferred primer and probe combinations from Group 1 and Group 2 by performing single-primer dual real-time fluorescence PCR detection on the negative control and the negative control (PCR detection system as described in Example 2 below). Figure 2 The amplification curves of primers and probes for group 1 are shown (PCR machine model: BioRad). The curves marked with ○ are the amplification curves of bovine nodular dermatitis virus standards. The curves are represented from left to right as 10. 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 101 copies / μL, 10 0 The other set of figures represents the amplification curves of sheep pox virus standards, with the curves from left to right representing 10 copies / μL. 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 The primers and probes of group 1 showed a detection limit of 1 copy / μL for both sheep pox virus and bovine nodular dermatosis virus standards. However, the primers and probes of group 2 only achieved a detection limit of 10 copies / μL for both sheep pox virus and bovine nodular dermatosis virus standards. 2 copies / μL (not shown). Therefore, the primers and probes of group 1 are preferred in this invention as primer and probe combinations for single-primer dual real-time quantitative PCR to identify and detect sheep pox virus and bovine nodular dermatovirus.

[0054] Example 2: Establishment of standard curves for single-primer dual real-time quantitative PCR of sheep pox virus and bovine nodular dermatosis virus

[0055] This embodiment uses the primer and probe combination obtained in Example 1 to perform single-primer dual real-time quantitative PCR detection of sheep pox virus and bovine nodular dermatovirus and establish a standard curve.

[0056] 2.1 PCR amplification of the CDS17 gene of sheep pox virus and the CDS21 gene of bovine nodular dermatosis virus

[0057] Using the universal primers LSD13F and LSD13R from Group 1 obtained in Example 1, genomic DNA extracted from the goatpox vaccine strain AV41 (genomic DNA extraction was performed using a QIAGEN kit according to the instructions, the same below) and genomic DNA extracted from the bovine nodular dermatitis virus China / GD01 / 2020 strain culture were amplified by PCR. The CDS17 gene fragment of goatpox virus and the CDS21 gene fragment of bovine nodular dermatitis virus were obtained, respectively. The 25 μL reaction system used is shown in Table 1 below. The PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 55℃ annealing and extension for 30 s, for a total of 45 cycles; extension at 72℃ for 7 min.

[0058] Table 1: PCR amplification systems of CDS17 gene of sheep pox virus and CDS21 gene of bovine nodular dermatosis virus

[0059]

[0060] 2.2 Preparation of Standards

[0061] The purified and recovered CDS17 and CDS21 gene fragments were cloned into the pCE2-TA / Blunt-Zerovector vector (purchased from Invitrogen) to construct recombinant plasmids. Positive recombinant plasmids were screened and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing to verify successful plasmid construction. Sequencing results showed that two recombinant plasmids carrying the CDS17 and CDS21 gene fragments with correct sequences were obtained, named pCE2-CDS17 and pCE2-CDS21 recombinant plasmids, respectively. The recombinant plasmid DNA was extracted and used as standards, named CDS17 standard and CDS21 standard, respectively.

[0062] 2.3 Establishment of the standard curve for real-time quantitative PCR

[0063] The concentrations of the extracted CDS17 and CDS21 standards were determined using Nanodrop, and the copy numbers of each standard were calculated. The samples were then mixed at equal concentrations and serially diluted 10-fold to a final concentration of 1×10⁻⁶. 9 1×10 8 1×10 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 1×10 0 Using standard mixtures of different concentrations as templates, and following the reaction system (27 μL) in Table 2 below, single-primer dual real-time quantitative PCR was performed under the guidance of primers and probes from group 1 in Example 1. The PCR reaction conditions were as follows: For an ABI qPCR instrument: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s; 55℃ annealing and extension for 34 s, for a total of 45 cycles. For a BioRad qPCR instrument: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s; 55℃ annealing and extension for 30 s, for a total of 45 cycles.

[0064] Table 2: Single-primer dual real-time quantitative PCR reaction system

[0065]

[0066] The single-primer dual real-time quantitative PCR amplification curve of CDS17 standard (qPCR instrument model ABI) is as follows: Figure 3 As shown, the amplification curve of the standard is a smooth "S"-shaped curve (positive). Figure 3 The 10 lines in the image, from left to right, correspond to standard concentrations of 1×10⁻⁶. 9 1×10 8 1×10 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 1×10 0 copies / μL. After the test, a standard curve was plotted by comparing the concentration of each standard (X-axis) with its corresponding Ct value (Y-axis). The results are shown below. Figure 4 As shown, the correlation coefficient R 2 =0.973, the error is small, and the standard curve is usable. The single-primer dual real-time quantitative PCR amplification curve of CDS21 standard (qPCR instrument model ABI) is shown below. Figure 5 As shown, the amplification curve of the standard is a smooth "S"-shaped curve (positive). Figure 5 The 10 lines in the image, from left to right, correspond to standard concentrations of 1×10⁻⁶. 9 1×10 8 1×10 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 1×10 0 copies / μL. After the test, a standard curve was plotted by comparing the concentration of each standard (X-axis) with its corresponding Ct value (Y-axis). The results are shown below. Figure 6 As shown, the correlation coefficient R 2 =0.987, the error is small, and the standard curve is usable.

[0067] Example 3: Single-primer dual real-time quantitative PCR detection of sheep pox virus and bovine nodular dermatosis virus.

[0068] A one-step single-primer dual real-time quantitative PCR method was used to detect genomic DNA extracted from test samples (e.g., virus cultures or diseased tissue obtained from sheep). A mixture of CDS17 and CDS21 standards prepared in Example 2 was used as a positive control, and enzyme-free water was used as a negative control. Based on the real-time quantitative PCR results, the presence of sheep pox virus and / or bovine nodular dermatitis virus in the test samples was qualitatively detected. Then, based on the Ct value and the standard curve in Example 2, the copy number of the target gene of sheep pox virus and / or bovine nodular dermatitis virus in the test samples was determined, thus achieving quantitative detection of the virus.

[0069] The specific testing method includes the following steps:

[0070] 1) Genomic DNA was extracted from the samples to be tested. Using the extracted genomic DNA as a template, single-primer dual real-time quantitative PCR was performed under the guidance of primers (LSD13F and LSD13R from group 1 in Example 1) and probes (LSDP and CaPvP from group 1 in Example 1). The detection system of 27 μL real-time quantitative PCR is shown in Table 2 above. The reaction conditions for real-time quantitative PCR (using a BioRad qPCR instrument) were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s; and 55℃ annealing extension for 30 s, for a total of 45 cycles. Fluorescence signal detection was performed at the end of each annealing cycle. The FAM channel was selected for bovine nodular dermatovirus and the VIC channel was selected for sheep pox virus to obtain amplification curves.

[0071] 2) Qualitative detection of sheep pox virus and bovine nodular dermatosis virus is achieved using the Ct value or changes in fluorescence signal from the obtained amplification curves. The judgment criteria are as follows:

[0072] 2.1 Determination of Experimental Validity

[0073] If both positive controls show typical amplification curves in both FAM and VIC channels with Ct values ​​≤ 40, and the negative control shows no Ct values ​​or amplification curves in both FAM and VIC channels, then the test results are considered valid; otherwise, the test is considered invalid.

[0074] 2.2 Determination of the Sample to be Tested

[0075] If an amplification curve appears in the FAM channel of the tested sample and the Ct value is ≤38, it is considered positive for bovine nodular dermatitis virus (BND) nucleic acid, meaning the sample contains BND virus. If 38 < Ct value ≤40, a retest with a Ct value ≤40 is considered positive; no amplification curve or a retest with a Ct value >40 is considered negative, meaning the sample does not contain BND virus. If an amplification curve appears in the VIC channel of the tested sample and the Ct value is ≤38, it is considered positive for sheep pox virus (EPV) nucleic acid, meaning the sample contains EPV. If 38 < Ct value ≤40, a retest with a Ct value ≤40 is considered positive; no amplification curve or a retest with a Ct value >40 is considered negative, meaning the sample does not contain EPV. Regardless of whether it's the FAM or VIC channel, a Ct value >40 is considered negative, meaning the sample does not contain BND virus and / or EPV.

[0076] Subsequently, the copy number of the corresponding viral target gene contained in the sample to be tested can be determined based on the Ct value of the amplification curve and the corresponding standard curve determined in Example 2.

[0077] Example 4: Specificity, sensitivity, and repeatability tests of a single-primer dual real-time quantitative PCR method for the identification and detection of sheep pox virus and bovine nodular dermatosis virus.

[0078] 4.1 Specificity Test

[0079] Genomic DNA of *Streptococcus ovis*, *Mycoplasma ovis*, *Pasteurella multocida*, *Infectious Bovine Rhinotracheitis Virus*, *Mannialus bovis*, and *Escherichia coli* (preserved in the applicant's laboratory) was extracted according to the QIAGEN kit instructions and used as test samples. A mixture of CDS17 and CDS21 standards prepared in Example 2 was used as a positive control, and enzyme-free water was used as a negative control. Single-primer dual real-time quantitative PCR was performed under the guidance of the primers and probes shown in Group 1 obtained in Example 1 of this invention. The PCR reaction system and reaction conditions were as described in Example 2 to verify the specificity of the method of this invention.

[0080] The results showed that only the positive control showed an amplification curve, while no amplification curve was observed in the channels corresponding to each test sample, indicating that all test samples were negative, thus proving that the method provided by this invention has good specificity.

[0081] 4.2 Sensitivity Test

[0082] As described in Example 2, CDS17 and CDS21 standards were mixed at equal concentrations and then serially diluted 10-fold to a concentration of 1×10⁻⁶. 9 1×10 8 1×10 7 1×10 6 1×105 1×10 4 1×10 3 1×10 2 1×10 1 1×10 0 The standard mixture of copies / μL was used as a template, and real-time quantitative PCR was performed under the guidance of the primers and probes of group 1 obtained in Example 1. The PCR reaction system and reaction conditions were as described in Example 2 to verify the detection sensitivity of the method of the present invention.

[0083] Test results as follows Figure 3 and Figure 5 As shown, where Figure 3 This represents the single-primer dual real-time quantitative PCR amplification curve of the CDS17 standard. Figure 5 The single-primer dual real-time quantitative PCR amplification curves of the CDS21 standard show that the single-primer dual real-time quantitative PCR detection method of the present invention for identifying and detecting sheep pox virus and bovine nodular dermatovirus can detect both CDS17 and CDS21 target genes at a sensitivity of 1 copy / μL. That is, the sensitivity of the single-primer dual real-time quantitative PCR method for identifying and detecting sheep pox virus and bovine nodular dermatovirus provided by the present invention can reach 1 copy / μL.

[0084] 4.3 Repeatability Test

[0085] As described in Example 2, CDS17 and CDS21 standards were mixed at equal concentrations and then serially diluted 10-fold to a concentration of 1×10⁻⁶. 9 1×10 8 1×10 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 1×10 0 The samples were divided into copies / μL, with three replicates for each gradient. Each gradient standard mixture was used as a template. Real-time quantitative PCR was performed under the guidance of the primers and probes of group 1 obtained in Example 1. The PCR reaction system and reaction conditions were as described in Example 2 to verify the reproducibility of the method of the present invention.

[0086] The results showed that the single-primer dual real-time quantitative PCR detection method for identifying sheep pox virus and bovine nodular dermatovirus provided by the present invention has good repeatability, with the standard deviation of the cycle number not exceeding 0.5.

[0087] Example 5: A single-primer dual real-time quantitative PCR kit for the identification and detection of sheep pox virus and bovine nodular dermatosis virus.

[0088] Based on Examples 1 and 2, the real-time quantitative PCR detection kit provided by the present invention includes primers (LSD13F and LSD13R of group 1 in Example 1, which are universal PCR amplification primers for detecting goatpoxvirus) and probes (LSDP and CaPvP of group 1 in Example 1, the 5' ends of probes GaPvP and LSDVP can be labeled with different fluorescent reporter groups, and the 3' ends of both probes can be labeled with fluorescent quenching groups, wherein probe GaPvP is used to detect goatpoxvirus, and probe LSDVP is used to detect bovine nodular dermatitis virus).

[0089] Specifically, when using this kit, the reagents for a 25–30 μL real-time quantitative PCR reaction system include: 0.25–0.75 μL of forward primer LSD13F (10 μM), 0.25–0.75 μL of reverse primer LSD13R (10 μM), 0.50–1.00 μL of probe GaPvP (10 μM), 0.50–1.00 μL of probe LSDVP (10 μM), 1–3 μL of DNA template, 10–15 μL of qPCR Mix, and ddH2O to make up to 25–30 μL.

[0090] For ease of detection, the kit may also include positive and negative controls. The positive controls are genomic DNA of sheep pox virus and bovine nodular dermatosis virus. Each positive control is individually packaged. The negative control is a reaction system that does not contain Clostridium perfringens types A, B, C, and D, such as H2O (double-distilled water, sterile deionized water, etc.).

[0091] For ease of detection, the kit may also include standards: CDS17 standard and CDS21 standard, each in a single package or a mixed package of equal concentrations; when using the kit to perform single-primer dual real-time quantitative PCR detection of sheep pox virus and bovine nodular dermatovirus, the single-packaged standards are mixed at equal concentrations.

[0092] For ease of testing, the kit may also include the standard curve obtained in Example 2 and instructions, which include the PCR reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10-15 s, 55℃ annealing extension for 30-34 s, 40-45 cycles.

[0093] Example 6: Clinical Sample Testing

[0094] In this embodiment, the single-primer dual real-time quantitative PCR kit for identifying and detecting sheep pox virus and bovine nodular dermatosis virus provided in Example 5 was used to perform PCR qualitative and quantitative detection on five clinical bovine and ovine tissues and virus cultures obtained from sheep diseased tissues provided by the Animal Routine Diseases and Pathogens Research Center of Jinyu Baoling Biopharmaceutical Co., Ltd. The detection results are shown in Table 3 below.

[0095] According to the results in Table 3, among the five clinical samples tested, samples T1 and T2 were positive for sheep pox virus, meaning they contained sheep pox virus; sample T3 was negative; sample T4 was positive for bovine nodular dermatitis virus, meaning it contained bovine nodular dermatitis virus; and sample T5 was double positive for both sheep pox virus and bovine nodular dermatitis virus, meaning it contained both viruses. Table 3 also shows the copy number of the target viral gene in samples T1-T5. It is evident that the kit provided by this invention can be used to identify and detect sheep pox virus and bovine nodular dermatitis virus, and can achieve both qualitative and quantitative detection. Therefore, the kit and method provided by this invention can provide technical support and assistance for the identification and differentiation of sheep poxviruses, epidemiological investigations, and virus control, and also contribute to the purification and screening of vaccine raw materials in vaccine production.

[0096] Table 3: Results of single-primer dual real-time quantitative PCR detection of 5 clinical samples

[0097]

[0098] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention. sequence list <110> Jinyu Baoling Biological Pharmaceutical Co., Ltd. <120> A single-primer dual-fluorescence detection kit for identifying sheep pox virus and bovine nodular dermatovirus, along with its dedicated primers and probes. <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <400> 1 tcattatcmt cactactaac rgtat 25 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 aaagcaatat gaaammrgca 20 <210> 3 <211> 15 <212> DNA <213> Artificial Sequence <400> 3 agatggcgat ggtgc 15 <210> 4 <211> 15 <212> DNA <213> Artificial Sequence <400> 4 tgatggtgat ggtaa 15 <210> 5 <211> 321 <212> DNA <213> Goatpox virus strain AV41 (CDS17) <400> 5 ttatagaaat acatcatcat ttgaaacact gtcgttataa tttatgtaat acattacttt 60 atgaggtgtc tttctttttg taaatttata cttgtagtta taattatatt tagtatcatt 120 atcatcacta ctaacggtat tactatcact atcactatca ttagcaccat cgccatctaa 180 caatgtaaca cgttcaatag atattgcttttttcatattg cttttcctta taaaactaac 240 acatttaata gcattttctt ttagactttt ttttaataat ttgtagccaa atactatacc 300 acaataaatt tttttatcca t 321 <210> 6 <211> 339 <212> DNA <213> Bovine nodular skin disease virus strain China / GD01 / 2020 (CDS21) <400> 6 ttatagaaat acatcatcat ttgaaacact gtcgtcataa tttatgtaat acattacttt 60 atgaggtgtc tttctttttg taaatttata cttgtagtta taattatatt tagtatcatt 120 atcatcacta ctaacggtat cactatcact attactatta ctatcattag caccattacc 180 atcaccatca ccatctaaca atgtaacacg ttcaatagat attgccgttt tcatattgct 240 tttccttata aaactaacac atttaatagc cttttctttt atactttttt ttaataatct 300 gtaaccaaat actataccac aataaatttttttatccat 339 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <400> 7 cattatcatc actactaacg gtatc 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <400> 8 aatatctatt gaacgtgtta cattg 25

Claims

1. A test kit for discriminating between capripoxvirus and parapoxvirus bovis, the test kit comprising: The universal PCR amplification primer set with nucleotide sequences as shown in SEQ ID NO:1-2, the probe GaPvP with nucleotide sequence as shown in SEQ ID NO:3 for detecting sheep pox virus, and the probe LSDVP with nucleotide sequence as shown in SEQ ID NO:4 for detecting bovine nodular dermatosis virus.

2. The detection kit according to claim 1, wherein the 5' ends of the probe GaPvP and the probe LSDVP are labeled with different fluorescent reporter groups, and the 3' ends of both are labeled with fluorescent quenching groups.

3. The test kit according to claim 1 or 2 further includes CDS17 standard and CDS21 standard; each standard is in single packaging or mixed packaging of equal concentration.

4. A primer-probe combination for identifying sheep pox virus and bovine nodular dermatovirus, wherein the primer-probe combination comprises a universal PCR amplification primer set with nucleotide sequences as shown in SEQ ID NO:1-2, a probe GaPvP for detecting sheep pox virus with nucleotide sequences as shown in SEQ ID NO:3, and a probe LSDVP for detecting bovine nodular dermatovirus with nucleotide sequences as shown in SEQ ID NO:

4.

5. A non-disease diagnostic method for differentiating between sheep pox virus and bovine nodular dermatosis virus, comprising the following steps: S1: Extract DNA from the sample to be tested; S2: Using the DNA extracted in step S1 as a template, fluorescent PCR amplification is performed using the universal PCR amplification primer set, probe GaPvP and probe LSDVP in the kits described in any one of claims 1-3 to obtain an amplification curve; S3: Analyze the amplification curve obtained in step S2 to determine whether the sample to be tested contains sheep pox virus and / or bovine nodular dermatosis virus; The criteria for judgment are: If an amplification curve appears in the fluorescence channel corresponding to the probe GaPvP and the Ct value is ≤38, the sample to be tested is determined to contain sheep pox virus; if 38 < Ct value ≤40, and the Ct value is ≤40 after another test, the sample to be tested is determined to contain sheep pox virus; if the Ct value >40, the sample to be tested is determined not to contain sheep pox virus. If 38 < Ct value ≤ 40, and the Ct value is > 40 upon retesting, then the sample to be tested is determined to be free of sheep pox virus; if there is no amplification curve, then the sample to be tested is determined to be free of sheep pox virus. If an amplification curve appears in the fluorescence channel corresponding to the probe LSDVP, and the Ct value is ≤38, the sample is determined to contain bovine nodular dermatitis virus (BND). If 38 < Ct value ≤40, and the Ct value is ≤40 upon retesting, the sample is determined to contain BND. If the Ct value >40, the sample is determined not to contain BND. If 38 < Ct value ≤40, and the Ct value is >40 upon retesting, the sample is determined not to contain BND. If no amplification curve appears, the sample is determined not to contain BND.

6. The method according to claim 5, wherein the 25-30 µL system for fluorescent PCR amplification in step S2 comprises: 0.25-0.75 µL of 10 µM forward primer LSD13F, 0.25-0.75 µL of 10 µM reverse primer LSD13R, 0.50-1.00 µL of 10 µM probe GaPvP, 0.50-1.00 µL of 10 µM probe LSDVP, 1-3 µL of DNA template, 10-15 µL of qPCR Mix, and ddH2O to make up to 25-30 µL.

7. The method according to claim 5, wherein the procedure for fluorescent PCR amplification in step S2 includes: Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 10–15 s; annealing and extension at 55℃ for 30–34 s; repeat 40–45 times.

8. The method according to claim 5, wherein the fluorescent reporter group labeled at the 5' end of the probe GaPvP is VIC and the quencher group labeled at the 3' end is MGB; and the fluorescent reporter group labeled at the 5' end of the probe LSDVP is FAM and the quencher group labeled at the 3' end is MGB.

Images