A bivalent nucleic acid aptamer and its design method
By designing bivalent nucleic acid aptamers and utilizing U-shaped linkage structures and repulsive forces to maintain conformational stability, the problem of reduced conformational freedom when nucleic acid aptamers bind to thrombin was solved, achieving high affinity and specific binding effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SOUTHWEST UNIV
- Filing Date
- 2022-12-30
- Publication Date
- 2026-06-30
AI Technical Summary
Existing nucleic acid aptamers exhibit a rapid conformational change when binding to thrombin, resulting in a significant reduction in conformational freedom, a drastic decrease in entropy, and a decrease in affinity.
A bivalent nucleic acid aptamer is designed by extending the double-stranded ends of monovalent aptamer A and monovalent aptamer B to form double-stranded extension arms A and B, which are then connected by an intermediate bridge to form a U-shaped connection. The connection between the intermediate bridge and the extension arm consists of two short terminal strands that are either loops or repulsive, thus maintaining the conformational stability of the aptamer.
It improves the binding efficiency and affinity of nucleic acid aptamers to targets, ensures that aptamers have a clear orientation and distance before binding, and enhances their binding ability with receptors such as proteins.
Smart Images
Figure CN116179555B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomaterials, specifically relating to a bivalent nucleic acid aptamer and its design method. Background Technology
[0002] Nucleic acid aptamers possess specific recognition capabilities, thereby directly or indirectly regulating protein function and holding significant research value for the regulation of organismal activity. Thrombin, a related protein in the coagulation cascade, is one of the earliest receptors used in aptamer research. Existing aptamers are mainly screened using the Systematic Evolution of Ligands Exponential Enrichment (SELEX) technique, or improved from existing monovalent aptamers to obtain bivalent or multivalent aptamers with higher affinity.
[0003] However, in the existing technology, the monovalent aptamer that binds to thrombin has the defect of low affinity. When designing the bivalent aptamer, the rigidity, distance and spatial orientation of the connection between aptamers in the molecule are ignored, which leads to a rapid change in conformation during the binding process with the receptor, resulting in a great reduction in conformational freedom, a sharp reduction in entropy and a decrease in affinity. Summary of the Invention
[0004] The purpose of this invention is to provide a semi-rigid bivalent aptamer for nucleic acids to solve the problem that existing nucleic acid aptamers undergo rapid conformational changes during binding with receptors, resulting in a significant reduction in conformational freedom, a sharp decrease in entropy, and a reduction in affinity.
[0005] The technical solution of this invention is a bivalent nucleic acid aptamer, including a monovalent aptamer A and a monovalent aptamer B, wherein the monovalent aptamer A and monovalent aptamer B are the same or different monovalent aptamers; the double-stranded end of monovalent aptamer A is extended to form a double-stranded extension arm A, and the double-stranded end of monovalent aptamer B is extended to form a double-stranded extension arm B, and extension arm A and extension arm B are connected by a double-stranded intermediate bridge; the extension arm A, the intermediate bridge, and the extension arm B form a U-shaped secondary structure connecting part, which connects and assembles monovalent aptamer A and monovalent aptamer B; the connection between the intermediate bridge and the extension arm A is a loop or two mutually exclusive short terminal strands; the connection between the intermediate bridge and the extension arm B is a loop or two mutually exclusive short terminal strands.
[0006] Furthermore, the bivalent nucleic acid aptamer is assembled from at least one single-stranded nucleic acid.
[0007] Preferably, the bivalent nucleic acid aptamer is assembled from 1 to 3 single-stranded nucleic acids.
[0008] More preferably, the bivalent nucleic acid aptamer is assembled from a single-stranded nucleic acid.
[0009] Furthermore, the loop has 3 to 6 bases.
[0010] Specifically, the free bases of the broken single strand are the same 2 to 5 bases.
[0011] Specifically, in the nucleic acid aptamer, the proportion of bases A and T / U is 40-60%, and the proportion of bases C and G is 40-60%. Particular attention should be paid to ensuring that the content of bases C and G is not too high, otherwise G-quadruplexes or i-motifs may be formed. Preferably, in the nucleic acid aptamer, the proportion of bases A and T / U is approximately 50%, and the proportion of bases C and G is approximately 50%.
[0012] Specifically, the monovalent aptamer A and monovalent aptamer B are monovalent aptamers for the fibrinogen binding site and heparin binding site on thrombin (T), respectively.
[0013] Furthermore, the thrombin divalent nucleic acid aptamer is assembled from single-stranded nucleic acids with nucleotide sequences as shown in SEQ ID No. 1-3.
[0014] SEQ ID No.1 single-stranded nucleic acid: aagtccgtggtagggcaggttggggtgacttagatgaggcacgtcccgctc;
[0015] SEQ ID No. 2 Single-stranded nucleic acid: cgagtataggaatggtgcgtaggttggtgtggttggggcgcacaaaa;
[0016] SEQ ID No. 3 Single-stranded nucleic acid: aacattcctatactcggagcgggacgtgaactacctcatct.
[0017] Specifically, the buffer solution used for assembling the thrombin divalent nucleic acid aptamer is TAE / Mg. 2+ +100mM K + The molar ratio of the single-stranded nucleic acids shown in SEQ ID Nos. 1-3 used is 1:1:1; the buffer solution TAE / Mg 2+ +100mM K + The formula is: 40mM tris(hydroxymethyl)aminomethane, 2mM disodium ethylenediaminetetraacetate, 20mM glacial acetic acid, 1.25mM magnesium acetate tetrahydrate and 100mM potassium chloride, pH 7.4.
[0018] The reaction procedure for assembling the divalent nucleic acid aptamer of thrombin is as follows: 95℃ for 5 min, 65℃ for 30 min, 50℃ for 30 min, 37℃ for 30 min, 25℃ for 30 min, and 4℃ for 2 h.
[0019] Specifically, the monovalent aptamer A is the same as the monovalent aptamer B, and the two are connected by a semi-rigid chain, with the target being fluorescein thioflavin T (ThT).
[0020] Furthermore, the bivalent nucleic acid aptamer of the fluorescein thioflavin T (ThT) is assembled from single-stranded nucleic acids with nucleotide sequences as shown in SEQ ID No. 4 and 5.
[0021] SEQ ID No. 4 Single-stranded nucleic acid: ggcgcgaggaaggaggucugaggaggucacugcgccuuaugcuagcugucaauauuu, the italicized ones are the monovalent aptamers of ThT;
[0022] SEQ ID No. 5 Single-stranded nucleic acid: ggcgcgaggaaggaggucugaggaggucacugcgccuuauauugacagcuagcauuu, the italicized text represents the monovalent aptamer of ThT.
[0023] Specifically, the buffer used for assembling the bivalent nucleic acid aptamer of fluorescein thioflavone T (ThT) is: 40 mM (4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid) (HEPES), 100 mM potassium chloride, 1 mM magnesium chloride, pH 7.4; the molar ratio of the single-stranded nucleic acids shown in SEQ ID No. 4 and 5 is 1:1.
[0024] Specifically, the assembly procedure for the bivalent nucleic acid aptamer of fluorescein thioflavone T (ThT) is as follows: 85℃ for 2 min, 65℃ for 5 min, 50℃ for 5 min, 45℃ for 5 min, 37℃ for 5 min, 25℃ for 5 min, and 20℃ for 5 min.
[0025] When assembling the bivalent aptamer, the number of single strands used for assembly can be adjusted as needed; it can be one or more. However, using a single strand yields the best results.
[0026] In a U-shaped divalent aptamer, when the intermediate bridge connects to either extension arm A or extension arm B, forming a single-chain disconnected state, the free single-chain bases, using the same base types, maintain a certain repulsive force, bringing extension arm A or extension arm B closer to the receptor (target). At the connection point of extension arm A, the intermediate bridge, and extension arm B, one end forms a loop, while the other end remains a non-closed chain, ensuring that the resulting near-U-shaped secondary structure is semi-rigid and improving the binding efficiency with the target molecule.
[0027] The present invention also provides a method for designing the bivalent nucleic acid aptamers, comprising the following steps: (a) identifying the crystal structures of the two aptamers (A and B) interacting with the target (or obtained according to the AlphaFold algorithm of DeepMind); (b) designing an extension arm A of the double-stranded nucleic acid of the monovalent aptamer A; (c) designing an extension arm B of the double-stranded nucleic acid of the monovalent aptamer B; (d) designing a suitable nucleic acid such that its length and spatial position can bind to the extension arm A and the extension arm B, and the length connecting the extension arm A and the extension arm B is called the intermediate bridge; (e) connecting the extension arm A, the intermediate bridge and the extension arm B, and ensuring that there is a loop and / or a strand that is not connected at the connection between the intermediate bridge and the extension arm A or the extension arm B, and that the free bases of the disconnected single strands repel each other, so that the conformation of each nucleic acid segment remains unchanged before and after the construction of the multivalent aptamer, thereby obtaining the design unit of the multivalent aptamer, namely the bivalent aptamer.
[0028] The beneficial effects of the present invention: The present invention provides a method for constructing a bivalent nucleic acid aptamer: (1) Flexible connection can give the aptamer sufficient degrees of freedom, maximize the adjustment of its orientation and bind to the target receptor, and the enthalpy change is favorable. However, this binding method fixes the connection part to a specific conformation and produces a huge entropy loss, which reduces the overall degrees of freedom. Therefore, flexible connection often leads to favorable enthalpy change in the binding process, but can only slightly increase the binding force. (2) The orientation of the aptamer: The incorrectly oriented rigid connection causes the aptamer to be unable to bind to the protein effectively, producing enthalpy loss, and the affinity will not be greatly improved. (3) The role of the aptamer connection part: The aptamer can be rigidly pre-organized to interact with the target protein before the aptamer and protein bind, which is thermodynamically favorable.
[0029] The bivalent nucleic acid aptamers designed in this invention exhibit well-defined direction and distance when binding to receptors such as proteins and small molecules, demonstrating high affinity and specificity. Therefore, they can be applied in fields such as medicine, testing, and biology, where nucleic acids interact with corresponding proteins, pathogenic microorganisms, and small molecules. Furthermore, the design method of this invention is simple, widely applicable, and the synthesis method uses mild reaction conditions, does not require high temperature or high pressure, is easy to operate, uses inexpensive and readily available raw materials, and yields high product yields.
[0030] This invention provides a novel approach for designing multivalent nucleic acid aptamers. Based on the basic design concept of this invention, multivalent nucleic acid aptamers with high affinity, high binding strength, and good stability can be further designed according to the crystal structure of the target molecule. Attached Figure Description
[0031] Figure 1 , threeThe diagram shows that CD-RE31 and HD22 are monovalent nucleic acid aptamers that bind to the fibrinogen binding site and heparin binding site on thrombin (T); HD22-thrombin complex (Formula I) and RE31-thrombin complex (Formula II) are obtained by the simultaneous interaction of the two aptamers with the thrombin molecule; the double-stranded portions of HD22 and RE31 aptamers are extended, and then the two separate aptamers are linked together using DNA double strands to obtain a divalent nucleic acid aptamer (Formula V); Formula IV is a complex of a divalent nucleic acid aptamer and the target thrombin (T).
[0032] Figure 2 , three A schematic diagram of the assembled single-stranded nucleic acids; where TBA-1, TBA-2u, and TBA-3 are the single-stranded nucleic acids shown in SEQ ID Nos. 1 to 3, respectively; 0 / 0 A2 / 0 A4 This is the bivalent aptamer assembled according to the present invention.
[0033] Figure 3 The crystal structures of ThT and Corn are shown in VI; through Corn (Formula VII), by extending the double-chain ends of Corn and then connecting them through connecting arms, the secondary structure of bCorn (Formula VIII) is obtained.
[0034] Figure 4 A schematic diagram of the pairing of two single-stranded nucleic acids after assembly.
[0035] Figure 5 , 6 % Non-denaturing polyacrylamide gel electrophoresis was used to analyze the binding of the aptamer to thrombin. Control bivalent aptamer sequence bApt 1: ggttggtgtggttggtttttagtccgtggtagggcaggttggggtgact (SEQ ID No. 6); Control bivalent aptamer sequence bApt 2: agcagcacagaggtcagatgggttggtgtggttggtgagaccttgcatgcgacttggtgagcacgtgagaagtccgtggtagggcaggttggggtgactcctatgcg tgctaccgtgaa (SEQ ID No. 7); 0 / 0 A2 / 0 A4 The bivalent aptamer assembled according to the present invention; Apt: aptamer; T: thrombin.
[0036] Figure 6 Real-time light scattering detection of 3nM aptamers (TBA15, HD22, bApt 1, bApt 2, 0 / 0) A2 / 0 A4 The ability to inhibit 3nM thrombin activity.
[0037] Figure 7 Atomic force microscopy characterization of the morphology of the divalent aptamer and thrombin conjugate, (a) showing the rigid divalent aptamer O / O of the present invention. A2 / 0 A4 (b) is a bivalent aptamer connected by a flexible intermediate chain, and (c) is a rigid bivalent aptamer bApt2 obtained by screening and separation using the SELEX technique.
[0038] Figure 8 The affinity values of Corn and bCorn with ThT are respectively. Detailed Implementation
[0039] The sources of the main reagents or instruments used in the following examples:
[0040] Main instruments: Bruker atomic force microscope (USA), MicroCal ITC-200 isothermal titration calorimeter (GE Healthcare), Hitachi F-7000 fluorescence spectrophotometer, HOEFER SE600 vertical electrophoresis apparatus.
[0041] Main reagents: All DNA was purchased from Shanghai Sangon Biotech Co., Ltd.; all RNA was purchased from Shanghai Dina Biotechnology Co., Ltd.; Stains-all dye and ThT were purchased from Sigma Aldrich; fibrinogen was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; poly-L-lysine was purchased from Ted Pell, Inc. (USA); and other reagents used for buffer solutions were purchased from Shanghai Sangon Biotech Co., Ltd., Shanghai Yuanye Biotechnology Co., Ltd., Beijing Dingguo Changsheng Biotechnology Co., Ltd., and Chengdu Kelong Reagent Factory (Sichuan).
[0042] Example 1 Assembly of thrombin bivalent nucleic acid aptamers
[0043] Based on the known crystal structures of thrombin protein and aptamers (three-dimensional simulation structures such as...), Figure 1As shown, the crystal structures of these two molecules are simulated for docking. The two monovalent aptamers, CD-RE31 and HD22, fold to form a stable G-quadruplex structure, which binds to the fibrinogen binding site and heparin binding site on thrombin (T) to form HD22-thrombin (Formula I) and RE31-thrombin (Formula II), respectively. The two monovalent aptamers react with thrombin to form a complex structure of Formula III. The double-stranded portion of the HD22 aptamer is extended, and then the two separate aptamers are connected by DNA double strands (Formula IV) to form a rigid bivalent aptamer connected by an intermediate rigid structure. The rigid structure of the intermediate connecting part, the adjustable orientation of the single-chain ring, and the design of the short single chains that repel each other at the lower right corner of the U-shape ensure the ideal distance for the aptamer to bind to the protein, maintain the appropriate spatial orientation, and adjust to the optimal position for different binding sites of the protein. The conformation does not change significantly before and after the interaction, and it has the largest enthalpy reduction and the smallest entropy loss. Compared with monovalent interaction, multivalent interaction reduces the enthalpy change while the entropy change remains unchanged, thus resulting in a lower Gibbs free energy and thermodynamic advantages.
[0044] Based on the foregoing analysis and approach, the specific procedures are as follows: Synthesize the single-stranded nucleic acids shown in SEQ ID Nos. 1–3, and then assemble them. The assembly buffer used is TAE / Mg. 2+ +10mM K + The molar ratio of the single-stranded nucleic acids shown in SEQ ID Nos. 1-3 used is 1:1:1; the buffer solution TAE / Mg 2+ +100mM K + The formulation was: 40 mM tris(hydroxymethyl)aminomethane, 2 mM disodium ethylenediaminetetraacetate, 20 mM glacial acetic acid, 1.25 mM magnesium acetate tetrahydrate, and 10 mM potassium chloride, pH 7.4. The assembly reaction procedure was: 95℃ for 5 min, 65℃ for 30 min, 50℃ for 30 min, 37℃ for 30 min, 25℃ for 30 min, and 4℃ for 2 h. The pairing status of the assembled bivalent nucleic acid aptamers is as follows: Figure 2 As shown.
[0045] Example 2 Assembly of fluorescein-thioflavone T (ThT) bivalent nucleic acid aptamers
[0046] Based on the known crystal structures of luciferin thioflavin T (ThT) and its RNA aptamer (Corn), a bivalent RNA aptamer (bCorn) for ThT was designed to enhance the binding affinity of this fluorescent molecule to the RNA aptamer. The crystal structures of ThT and Corn are shown in Figure VI. Figure 3 Based on this structure, the secondary structure of bCorn (Equation VIII) is designed using Corn (Equation VII).
[0047] Based on the aforementioned analysis and approach, the specific procedures are as follows: The single-stranded nucleic acids shown in SEQ ID No. 4 and 5 were synthesized and then assembled. The assembly buffer was: 40 mM (4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid) (HEPES), 100 mM potassium chloride, 1 mM magnesium chloride, pH 7.4; the molar ratio of the single-stranded nucleic acids shown in SEQ ID No. 4 and 5 was 1:1. The assembly procedure was: 85℃ for 2 min, 65℃ for 5 min, 50℃ for 5 min, 45℃ for 5 min, 37℃ for 5 min, 25℃ for 5 min, and 20℃ for 5 min. The pairing of the assembled bivalent nucleic acid aptamers is as follows: Figure 4 As shown.
[0048] Example 3: Comparison of binding rates of different aptamers of thrombin
[0049] Monovalent aptamers or assembled bivalent aptamers are mixed with thrombin in an equimolar ratio in a K-containing solution. + The aptamer-thrombin conjugate was obtained by incubation in a buffer solution at 25°C for 2 hours. The binding efficiency of the aptamer to thrombin was analyzed by 6% non-denaturing polyacrylamide gel electrophoresis. Figure 5 As shown, the rigid bivalent aptamer designed using this invention exhibits the highest binding rate to thrombin, at 71%.
[0050] Example 4: Comparison of the affinity of different aptamers for thrombin
[0051] In the isothermal titration calorimetric method, the sample cell temperature was set to 25℃, the number of titrations was 20 drops with an interval of 120 seconds, the syringe speed was 1000 r / min, the system compensation power was generally set to 5 μcal / s, and the baseline run time before the formal titration was selected as 60 seconds. The titration concentrations were: 70 μM TBA15 (SEQ ID No. 8: ggttggtgtggttgg), titrating 5 μM thrombin; 30 μM HD22 (SEQ ID No. 9: agtccgtggtagggcaggttggggtgact), titrating 2 μM thrombin; 25 μM bApt 1, titrating 2 μM thrombin; and 20 μM rigid divalent aptamer (bApt 2, 0 / 0). A2 / 0 A4 2 μM thrombin was titrated. The binding affinity of different aptamers to thrombin is shown in Table 1. The rigid divalent aptamer designed in this invention showed the highest affinity to thrombin, at 2.8 ± 0.2 nM.
[0052] Table 1 Affinity Kd values
[0053] aptamers Kd(nM) TBA15 422.0±8.2 HD22 234.8±14.5 bApt 1 14.2±0.9 bApt 2 7.8±0.7 <![CDATA[0 / 0 A2 / 0 A4 ]]> 2.8±0.2
[0054] Example 5: Comparison of the ability of different aptamers of thrombin to inhibit thrombin activity
[0055] Preparation of 0.30 mg / mL fibrinogen: Weigh 0.03 g of fibrinogen, add purified water to a final volume of 10 mL to obtain a 10-fold concentrated solution, then dilute it 10 times before use. The fibrinogen solution should be prepared fresh and stored at 4 degrees Celsius.
[0056] 3nM aptamers (TBA15, HD22, bApt 1, bApt 2, O / O) A2 / 0 A4 ) were mixed with 3nM thrombin in TAE / Mg 2+ +100mM K + In the buffer solution; under the buffer system environment, use the same volume of primary water instead of aptamer to mix with 3 nM thrombin as a blank control. Finally, after incubating these mixtures at 25°C for 0.5 hours, start measuring the changes in fluorescence signal immediately.
[0057] Time-scanning was used, with both excitation (Ex) and emission (Em) wavelengths set to 650 nm, excitation slit width of 10 nm, emission slit width of 5 nm, PMT voltage of 700 V, response time of 2.0 s, and a total scan time of 1200 s. The ability of different aptamers to inhibit thrombin activity was measured by real-time light scattering. Figure 6 As shown, the rigid bivalent aptamer designed using this invention exhibits the strongest ability to inhibit thrombin activity.
[0058] Example 6: Atomic force microscopy characterization of the conformation of the divalent aptamer-thrombin conjugate.
[0059] The assembled bivalent aptamer and thrombin in an equimolar ratio in a K-containing solution + The aptamer-thrombin conjugate can be obtained by incubating in a buffer solution at 25°C for 2 hours as a test sample.
[0060] Add 20 μL of 5 μg / μL poly-L-lysine solution to the mica surface. After 10 minutes, dry the surface with nitrogen gas and wash it twice with primary water. Take 5 μL of the sample diluted to 30 nM, drop it onto the mica surface, disperse it evenly to allow the sample to adsorb, and let it stand for 3 to 5 minutes. Finally, add 20 μL of buffer solution to the sample surface and scan the sample under an atomic force microscope. The results are as follows. Figure 7 As shown.
[0061] Example 7: Comparison of Affinity of Different ThT Aptamers
[0062] 1.0 μM ThT was reacted with different concentrations of bCorn (0.0625, 0.125, 0.25, 0.5, 1.0, 2.0, 4.0, 8.0, 16.0 μM), and the fluorescence value at a maximum emission wavelength of 487 nm at 20 °C was measured. Buffer solution: 100 mM potassium chloride, 1 mM magnesium chloride, pH 7.4; fluorescence spectrophotometer model: Hitachi F-7000FL; maximum excitation wavelength: 450 nm. The data were fitted using Graphpad Prism 9 and the Hill equation, and the affinity value Kd was calculated [Reference: Zhang, Z.; Oni, O.; Liu, J. New insights into a classic aptamer: binding sites, cooperation and more sensitive adenosine detection. Nucleic Acids Research, 2017, 45(13): 7593-7601]. The affinity values of Corn and bCorn for ThT were 1.9 μM and 5.2 μM, respectively, as shown in the results. Figure 8 As shown.
[0063] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.
Claims
1. A bivalent nucleic acid aptamer, characterized in that, It is assembled from three single-stranded nucleic acids as shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3; The SEQ ID NO: 1 is: aagtccgtggtagggcaggttggggtgacttagatgaggcacgtcccgctc; The SEQ ID NO:2 is: cgagtataggaatggtgcgtaggttggtgtggttggggcgcacaaaa; The SEQ ID NO:3 is: aacattcctatactcggagcgggacgtgaactacctcatct; The SEQ ID NO:1 forms a monovalent aptamer HD22; The SEQ ID NO:2 forms a monovalent aptamer RE31; SEQ ID NO:3 forms a double-chain intermediate bridge; The bichain end of the monovalent aptamer HD22 is extended to form a bichain extension arm A; The double-chain end of the monovalent aptamer RE31 is extended to form a double-chain extension arm B; The extension arm A and extension arm B are connected by a double-chain intermediate bridge; The extension arm A, the intermediate bridge, and the extension arm B form a U-shaped secondary structure connecting part, which connects and assembles the monovalent aptamer HD22 and the monovalent aptamer RE31.
2. The bivalent nucleic acid aptamer as described in claim 1, characterized in that, The monovalent aptamers HD22 and RE31 are monovalent aptamers for the fibrinogen binding site and heparin binding site on thrombin, respectively.
3. The bivalent nucleic acid aptamer as described in claim 2, characterized in that, The buffer used for assembling the thrombin divalent nucleic acid aptamer was TAE / Mg2+ + 10 mM K+; the molar ratio of the single-stranded nucleic acids shown in SEQ ID No. 1 to 3 was 1:1:1; the formulation of the buffer TAE / Mg2+ + 100 mM K+ was: 40 mM tris(hydroxymethyl)aminomethane, 2 mM disodium ethylenediaminetetraacetate, 20 mM glacial acetic acid, 1.25 mM tetramethylaminetetraacetic acid, and 100 mM tetramethylaminetetraacetic acid. Magnesium acetate in water and 10 mM potassium chloride, pH 7.
4.
4. The bivalent nucleic acid aptamer as described in claim 3, characterized in that, The assembly reaction procedure was as follows: 95 °C for 5 min, 65 °C for 30 min, 50 °C for 30 min, 37 °C for 30 min, 25 °C for 30 min, and 4 °C for 2 h.