A small nucleic acid detection kit based on probe anchoring double strands and its application

Abstract

The present invention provides a small nucleic acid detection kit based on probe anchored double strands and its application, and the present invention belongs to the field of nucleic acid detection technology. A small nucleic acid detection kit based on probe anchored double strands includes a main probe, an auxiliary probe, an anchor probe and a fluorescent probe, an amplification primer pair of a target small nucleic acid and a magnetic bead sample releaser; the main probe includes an auxiliary probe binding region, a target small nucleic acid binding region and an anchor probe binding region in sequence; the auxiliary probe binding region includes an upstream primer complementary region and a fluorescent probe complementary region for amplifying a target small nucleic acid; the anchor probe binding region is complementary to a downstream primer for amplifying a target small nucleic acid; the 5' end of the anchor probe or the main probe is labeled with biotin; the magnetic bead sample releaser includes streptavidin-modified magnetic beads. Using the kit to detect small nucleic acids is conducive to eliminating interference, controlling background, and improving the sensitivity, specificity and combinatoriality of small nucleic acid amplification detection, which has obvious advantages over the prior art.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection, and in particular relates to a small nucleic acid detection kit based on probe-anchored double strands and an application thereof. Background Art

[0002] Small RNA (miRNA, micro RNA) is a type of single-stranded non-coding small molecule RNA with a length of about 20 to 24 nucleotides (nt). It is widely present in human tissues, cells, blood, and body fluids. It has important gene regulation functions. Its abnormal expression is closely related to the occurrence, development and metastasis of various diseases, especially tumors. Extracellular small nucleic acids (cell-free miRNA, cfmiRNA), also known as circulating small nucleic acids (circulating miRNA, ctmiRNA), are a type of small nucleic acids that are released into the body through active cell secretion or passive leakage such as tissue damage and cell rupture, and are stably present in the blood and other body fluids in the form of being encapsulated by exosomes or microvesicles or bound to proteins. They are suitable as molecular markers for disease detection. Abnormally enriched tumor-derived cfmiRNA in the blood can occur in the early stages of the tumor and originate from the expression and secretion of tumor cells in situ in the tissue, while circulating tumor cells (CTC) and free DNA (ctDNA) are usually the result of direct metastasis of tumor cells into the blood in the late stages of the tumor. Therefore, cfmiRNA detection can achieve higher sensitivity than CTC and ctDNA detection, and is also superior to conventional tumor markers and protein markers such as autoantibodies for tumor detection.

[0003] The amplification detection method of cfmiRNA can achieve better sensitivity and accuracy than other methods. It is the most commonly used mainstream method, usually based on real-time fluorescence quantitative PCR amplification. The main process is to use the target small nucleic acid to prepare the PCR template, and then perform fluorescence quantitative PCR amplification. The Ct value of the amplification result is inversely proportional to the number of copies of the target small nucleic acid. The smaller the Ct value, the more copies of the target small nucleic acid. No Ct value indicates that the target small nucleic acid has not been detected. There are two main methods for preparing PCR templates from target small nucleic acids. The first category is reverse transcription, including PolyA tailing reverse transcription, tailing long primer reverse transcription, stem-loop primer reverse transcription (stem-loop method) and locked nucleotide (LNA) primer reverse transcription, etc. The mainstream is the stem-loop method. In this type of method, since the overall length of small nucleic acids is only about 22 nt, the part that can be used for reverse transcription and the part that can be used for upstream primers are only about 11 nt respectively. Therefore, it is difficult to eliminate the interference of a large number of non-target nucleic acids in the sample and it is difficult to ensure the specificity of reverse transcription and PCR amplification, resulting in high background and poor repeatability. In addition, it is not compatible with universal primer PCR, and it is also difficult to perform multiple PCR, and the detection combination performance is low. The second category is the main probe method. In the early stage, our team invented a method of preparing PCR templates by hybridizing and capturing the main probe of target RNA and then amplifying and detecting, including: (1) "A Wash-free Main Probe PCR Detection Method for RNA" (ZL201310205271.6) is a PCR detection method for RNA that can use universal primers, but it is directly applied to small nucleic acid detection and is easily interfered by hybridization of precursors and genomic DNA. It cannot solve the problems of high background and poor repeatability. (2) "A method and kit for combined amplification detection of micronucleic acids" (application number: 202011041856.5) is a PCR detection method for small nucleic acids, which uses single-stranded main probe hybridization to capture multiple target small nucleic acids, removes excess single-stranded main probes through mung bean nuclease digestion, purifies the main probe that forms a double strand with the target small nucleic acid, and then performs PCR amplification detection to indicate the presence of the target small nucleic acid. This method is conducive to eliminating interference and improving the performance of the detection combination, but it is found in the specific application that this method has two main shortcomings: (1) It is not conducive to the detection of diseases with high genetic heterogeneity, such as tumors. This method requires the simultaneous presence of multiple target small nucleic acids in the sample, but the high degree of genetic heterogeneity, that is, the probability of multiple target small nucleic acids appearing simultaneously in different patient individuals, is not high. (2) It is not conducive to the detection of samples with high nucleic acid content. Mung bean nuclease has no selectivity for single-stranded nucleic acids. When the nucleic acid content in the sample is high, the mung bean nuclease in the system is saturated with a large amount of single-stranded nucleic acids in the sample and cannot remove the single-stranded main probe in time, resulting in serious background amplification. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a small nucleic acid detection kit based on probe-anchored double-stranded nucleic acid and its application, which has the characteristics of simple operation, good repeatability and combination, and can inhibit background amplification and improve tumor detection sensitivity.

[0005] The present invention provides a small nucleic acid detection kit based on probe-anchored double-stranded DNA, comprising a probe set, an amplification primer pair of a target small nucleic acid, and a magnetic bead sample release agent;

[0006] The probe set includes a main probe, an auxiliary probe, an anchor probe and a fluorescent probe; the main probe includes an auxiliary probe binding region, a target small nucleic acid binding region and an anchor probe binding region in sequence; the length of the main probe is consistent with the total length of the auxiliary probe, the target small nucleic acid and the anchor probe;

[0007] The auxiliary probe binding region includes an upstream primer complementary region and a fluorescent probe complementary region for amplifying the target small nucleic acid, and the length of the auxiliary probe binding region is consistent with the total length of the upstream primer and the fluorescent probe for amplifying the target small nucleic acid;

[0008] The anchor probe and the anchor probe binding region have the same length, and the anchor probe binding region is complementary to a downstream primer for amplifying a target small nucleic acid;

[0009] The 5' end of the anchor probe or main probe is labeled with biotin;

[0010] The magnetic bead sample release agent includes 40-80mM zinc chloride, 40-80mM sodium acetate, 40-80mM cysteine, 10%-18% ethylene carbonate by weight, 10%-30% formamide by volume, 4%-10% sodium dodecyl sulfate by weight, and 90-200μg / ml streptavidin-modified magnetic beads.

[0011] Preferably, the 3' terminal base of the main probe is adenine.

[0012] Preferably, the nucleotide sequence of the anchor probe binding region is SEQ ID NO: 3;

[0013] The nucleotide sequence of the anchor probe is SEQ ID NO:4.

[0014] Preferably, the nucleotide sequence of the downstream primer for amplifying the target small nucleic acid is SEQ ID NO:5.

[0015] Preferably, the nucleotide sequence of the auxiliary probe binding region is SEQ ID NO: 1;

[0016] The nucleotide sequence of the auxiliary probe is SEQ ID NO:2.

[0017] Preferably, the nucleotide sequence of the upstream primer for amplifying the target small nucleic acid is SEQ ID NO: 6;

[0018] The nucleotide sequence of the fluorescent probe is SEQ ID NO:7.

[0019] Preferably, the kit further comprises washing solution, mung bean nuclease, PCR amplification buffer, and 1× positive control;

[0020] The washing solution is an aqueous solution containing 5-20 mM 3-morpholinepropanesulfonic acid, 40-80 mM cysteine, 30-50 mM sodium acetate and 0.05%-0.1% Tween 20 in volume percentage.

[0021] The present invention provides application of the small nucleic acid detection kit based on probe anchoring double strands in small nucleic acid detection for non-disease diagnosis purposes.

[0022] Preferably, the small nucleic acid comprises at least one of the following mirRNAs: miR-191, miR-93, miR-16, miR-3662 and miR-181 families;

[0023] The miR-181 family includes at least one of miR-181a-5p, miR-181b-5p, miR-181c-5p and miR-181d-5p.

[0024] The present invention provides a method for detecting small nucleic acids for non-disease diagnosis purposes using the kit, comprising the following steps:

[0025] The sample to be tested, the main probe, the auxiliary probe, the anchor probe and the magnetic bead sample releaser are mixed, incubated, the supernatant is removed under magnetic field conditions, washed, and mung bean nuclease solution is added for enzymatic hydrolysis. The supernatant is removed under magnetic field conditions, washed, and PCR amplification buffer, fluorescent probe, and target small nucleic acid amplification primer pairs are added to perform fluorescent quantitative PCR amplification reaction. The detection result Ct value ≤35 indicates that the sample to be tested contains the target small nucleic acid, otherwise it does not contain it.

[0026] The present invention provides a small nucleic acid detection kit based on probe anchored double strands, comprising a probe group, an amplification primer pair of a target small nucleic acid and a magnetic bead sample releaser. During detection, the main probe, auxiliary probe, anchor probe and sample are mixed and incubated, the main probe can hybridize and bind to the auxiliary probe, anchor probe and target small nucleic acid at the same time to form a complete double strand, and bind to the streptavidin magnetic beads through the biotin labeled at the end of the anchor probe or the main probe, after the supernatant is sucked off and washed, the excess nucleic acid in the sample is washed away, and then the mung bean nuclease system is added to perform enzyme digestion reaction, the main probe that is not bound to the target small nucleic acid is in a single-stranded or partial state and is degraded, and the main probe that captures the target small nucleic acid remains intact in the double strand, after washing again, a fluorescent quantitative PCR buffer is added to perform an amplification reaction, and the presence of the target small nucleic acid is indicated according to the Ct value. Compared with the small nucleic acid detection methods disclosed in the prior art, the kit provided by the present invention uses universal auxiliary probes, anchor probes and main probes to hybridize and capture single-target small nucleic acids to form double strands, is independent of the simultaneous presence of multiple target small nucleic acids, and introduces biotin-streptavidin magnetic beads for extraction and washing before the mung bean nuclease cleavage step, which can remove other nucleic acids in the sample that compete with the mung bean nuclease, facilitate the degradation and removal of the single-stranded main probe and eliminate the background, thereby ensuring the accuracy and reliability of the detection results.

[0027] The present invention provides a small nucleic acid detection method for non-disease diagnosis purposes using the kit. The present invention directly cleaves and extracts RNA, simultaneously performs probe-specific hybridization and captures the main probe and target small nucleic acid with biotin-streptavidin magnetic beads, which can not only exclude various mung bean nuclease inhibitors, but also exclude a large number of non-target nucleic acids, greatly reduce the mung bean nuclease load, give full play to the mung bean nuclease enzyme activity, and remove the probe background. At the same time, the main probe combined with the target small nucleic acid forms a complete matching double-stranded chain with the auxiliary probe and the anchor probe, which is retained in the system to obtain a purified PCR template, which is beneficial to improve the PCR amplification efficiency. Therefore, the present invention can improve the specificity of small nucleic acid amplification detection and its sensitivity. Our experimental verification shows that the present invention can exclude excessive nucleic acid interference, can identify mismatches as low as 1nt, and can identify similar small nucleic acids within the small nucleic acid family. It is not only better than the traditional stem-loop method, but also better than the method of application number 202011041856.5. The sensitivity of the present invention can be as low as 100 copies / ml, which is 10 to 100 times higher than the method of application number 202011041856.5 or the stem-loop method. The present invention uses universal primers and universal fluorescent probes, and one reaction can detect more than 8 small nucleic acids, which greatly improves the performance of combined detection and is conducive to the detection of genetically heterogeneous diseases, especially tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a flow chart of the technical solution provided by the present invention.

[0029] Figure 2 The results of miR-181 family sequence homology analysis. DETAILED DESCRIPTION

[0030] The invention provides a small nucleic acid detection kit based on probe-anchored double-strands, comprising a probe group, an amplification primer pair of a target small nucleic acid and a magnetic bead sample release agent.

[0031] In the present invention, the probe group includes a main probe, an auxiliary probe, an anchor probe and a fluorescent probe. The main probe includes an auxiliary probe binding region, a target small nucleic acid binding region and an anchor probe binding region in sequence. The auxiliary probe binding region and the anchor probe binding region are universal regions, while the target small nucleic acid binding region is a variable region, which changes accordingly according to the different target small nucleic acid sequences. The length of the main probe is consistent with the total length of the auxiliary probe, the target small nucleic acid and the anchor probe. The auxiliary probe is 100% complementary to the sequence of the auxiliary probe binding region. The target small nucleic acid binding region is 100% complementary to the sequence of the target small nucleic acid. The anchor probe binding region is 100% complementary to the sequence of the anchor probe.

[0032] In the embodiment of the present invention, 4 sets of main probes are designed for small nucleic acid mirRNA: miR-191, miR-93, miR-16, miR-3662. The nucleotide sequences of miR-191, miR-93, miR-16, miR-3662 are as shown in SEQ ID NO:8 to SEQ ID NO:11, and the nucleotide sequences of the corresponding main probes are as shown in SEQ ID NO:12 to SEQ ID NO:15.

[0033] In the present invention, the auxiliary probe binding region includes an upstream primer complementary region and a fluorescent probe complementary region for amplifying a target small nucleic acid, and the length of the auxiliary probe binding region is consistent with the total length of the upstream primer and the fluorescent probe for amplifying a target small nucleic acid. The upstream primer complementary region for amplifying a target small nucleic acid is 100% complementary to the sequence of the upstream primer for amplifying a target small nucleic acid.

[0034] In the present invention, the anchor probe and the anchor probe binding region have the same length, and the anchor probe binding region is 100% complementary to the sequence of the downstream primer for amplifying the target small nucleic acid. The 5' end of the anchor probe or main probe is labeled with biotin.

[0035] In the present invention, when designing probes and primers, the design principle is preferably that the lengths of the upstream primer homologous part, the fluorescent probe homologous part and the anchor probe binding region are respectively between 20 and 30 nt, the sequences have no secondary structure, and there are no more than 4 consecutive single nucleotides; the Tm values ​​of the upstream primer homologous part and the anchor probe binding region are between 55°C and 60°C, and the Tm value of the fluorescent probe homologous part is between 65°C and 70°C.

[0036] In an embodiment of the present invention, the 3' terminal base of the main probe is preferably adenine. The nucleotide sequence of the anchor probe binding region is preferably SEQ ID NO:3; the nucleotide sequence of the anchor probe is preferably SEQ ID NO:4. The nucleotide sequence of the downstream primer for amplifying the target small nucleic acid is preferably SEQ ID NO:5. The nucleotide sequence of the auxiliary probe binding region is preferably SEQ ID NO:1; the nucleotide sequence of the auxiliary probe is preferably SEQ ID NO:2. The nucleotide sequence of the upstream primer for amplifying the target small nucleic acid is preferably SEQ ID NO:6; the nucleotide sequence of the fluorescent probe is preferably SEQ ID NO:7.

[0037] In the present invention, the magnetic bead sample releaser includes 40-80mM zinc chloride, 40-80mM sodium acetate, 40-80mM cysteine, 10%-18% ethylene carbonate by mass, 10%-30% formamide by volume, 4%-10% sodium dodecyl sulfate by mass, and 90-200μg / ml streptavidin modified magnetic beads. In the magnetic bead sample releaser, sodium acetate, zinc chloride, cysteine, ethylene carbonate, and glycerol provide suitable ionic strength, pH value, and nucleic acid hybridization conditions. Sodium dodecyl sulfate, zinc chloride, and cysteine ​​provide sample lysis, protein denaturation, and RNase enzyme inhibition. Streptavidin magnetic beads specifically adsorb anchor probes and the double strands formed with the main probe.

[0038] In the present invention, the kit preferably also includes a washing solution, mung bean nuclease, a PCR amplification buffer, and a 1× positive control. The washing solution is an aqueous solution containing 5-20 mM 3-morpholinepropanesulfonic acid, 40-80 mM cysteine, 30-50 mM sodium acetate, and 0.05%-0.1% (v / v) Tween 20. The PCR amplification buffer is an aqueous solution containing conventional components of fluorescent quantitative PCR containing hot-start DNA polymerase and dNTP. The present invention has no special restrictions on the source of the PCR amplification buffer, and the PCR amplification buffer known in the art can be used. In the embodiment of the present invention, the PCR amplification buffer is purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0039] The present invention provides application of the small nucleic acid detection kit based on probe anchoring double strands in small nucleic acid detection for non-disease diagnosis purposes.

[0040] In an embodiment of the present invention, the small nucleic acid preferably includes at least one of the following mirRNAs: miR-191, miR-93, miR-16, miR-3662 and miR-181 family. The nucleotide sequences of miR-191, miR-93, miR-16 and miR-3662 are as shown in SEQ ID NO:8 to SEQ ID NO:11. The miR-181 family includes at least one of miR-181a-5p, miR-181b-5p, miR-181c-5p and miR-181d-5p. The nucleotide sequences of miR-181a-5p, miR-181b-5p, miR-181c-5p and miR-181d-5p are as shown in SEQ ID NO:20 to SEQ ID NO:23.

[0041] The present invention provides a method for detecting small nucleic acids for non-disease diagnosis purposes using the kit, comprising the following steps:

[0042] The sample to be tested, the main probe, the auxiliary probe, the anchor probe and the magnetic bead sample releaser are mixed, incubated, the supernatant is removed under magnetic field conditions, washed, and mung bean nuclease solution is added for enzymatic hydrolysis. The supernatant is removed under magnetic field conditions, washed, and PCR amplification buffer, fluorescent probe, and target small nucleic acid amplification primer pairs are added to perform fluorescent quantitative PCR amplification reaction. The detection result Ct value ≤35 indicates that the sample to be tested contains the target small nucleic acid, otherwise it does not contain it.

[0043] In the present invention, the working concentration of the main probe is preferably 110-130nM, more preferably 120nM. The working concentration of the auxiliary probe is preferably 110-130nM, more preferably 120nM. The working concentration of the anchor probe is preferably 110-130nM, more preferably 120nM. The sample to be tested preferably includes a plasma sample or a tissue fluid or a cell culture fluid. The volume ratio of the sample to be tested and the magnetic bead sample release agent is 9-10:4, more preferably 9.5:4.

[0044] In the present invention, the incubation condition is preferably 28-35°C for 8-12 min, more preferably 30°C for 10 min. The concentration of the mung bean nuclease solution is preferably 0.15-0.25 U / μl, more preferably 0.2 U / μl. The solvent of the mung bean nuclease solution is an aqueous solution containing 30 mM sodium chloride and 1 mM zinc chloride in 50 mM sodium acetate buffer at pH 5.0. The added volume of the mung bean nuclease solution is 1 / 2 volume of the sample to be tested.

[0045] In the present invention, the procedure of the fluorescence quantitative PCR amplification reaction is 95° C. for 10 minutes, followed by 40 cycles of 93° C. for 10 seconds and 65° C. for 40 seconds, and the fluorescence signal is collected at 65° C. The volume ratio of the sample to be tested to the PCR amplification buffer is preferably 9 to 10:3, more preferably 9.5:3.

[0046] In the present invention, the method provided by the present invention has strong anti-interference ability and high detection sensitivity (sample cell concentration is 0.1 / μl, small nucleic acid 10 copies / ml), which is more advantageous than the method of application number 202011041856.5. The method of the present invention can achieve high specificity in distinguishing different types of small nucleic acids in the same family, and the positive rate of lung cancer blood detection is 100%, as shown in Table 1.

[0047] Table 1 Comparison of results of different methods for detecting small nucleic acids

[0048]

[0049] The following is a detailed description of a small nucleic acid detection kit based on probe-anchored double-stranded nucleic acid and its application provided by the present invention in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0050] The sequences and corresponding numbers are shown in Table 2.

[0051] Table 2 Number and sequence information

[0052]

[0053]

[0054] Example 1

[0055] Detection of small nucleic acids in cell culture supernatant using the method of the present invention and universal fluorescent probe

[0056] Taking A549 lung cancer cells and lung cancer-related small nucleic acid miR-411 as an example, we first designed and synthesized the main probe for detection, miR-411 main probe TS0411, the sequence of which is: 5'- GAGGCACAGCAGGTGCAGGTCCGGATGCTGCAGTGATGGCA GGTTAGTGGACCGTGTTACATA CCTCCACGTGACCCTGACGTA-3', wherein the 5' end and the 3' end (underlined) are universal sequences, the 5' end is completely homologous to the upstream universal primer and universal fluorescent probe, the 3' end is completely complementary to the universal anchor probe, and the middle part (in bold) is the target small nucleic acid binding region, which is completely complementary to the target small nucleic acid miR-16. The auxiliary probe (SEQ ID NO: 2), anchor probe (SEQ ID NO: 4), PCR primers (SEQ ID NO: 5 and SEQ ID NO: 6), and fluorescent probe (SEQ ID NO: 7) are all universal. The 5' end of the fluorescent probe is labeled with the fluorescent group FAM, and the 3' end is labeled with the quenching group BHQ1. The system preparation is as described above. Take 100 μl of A549 cell culture supernatant or 100 μl of purified water (negative control), centrifuge at 12000 rpm for 1 min, aspirate 90 μl of supernatant, transfer to a tube containing 40 μl of magnetic bead sample release agent, mix, and keep warm at 30°C for 10 min; adsorb with a magnet, aspirate the supernatant, add 900 μl of washing solution and mix, adsorb with a magnet again, aspirate the supernatant, add 50 μl of mung bean nuclease solution, and keep warm at 30°C for 1 min; adsorb with a magnet again, aspirate the supernatant, add 900 μl of washing solution and mix, adsorb with a magnet again, aspirate the supernatant, add 30 μl of PCR solution, aspirate and mix, and transfer to a PCR tube, and incubate at ABI7500 On the PCR thermal cycler, the PCR program was as follows: 95°C for 10 min, then 40 cycles of 93°C for 10 seconds and 65°C for 40 seconds, and the fluorescence signal was collected at 65°C (FAM channel). The fluorescence quantitative PCR reaction was performed, and the result of the A549 cell culture supernatant sample was positive (amplification, i.e., Ct value 35), indicating that the content of miR-411 in the sample reached a detectable level. The negative control result was negative (no amplification, i.e., no Ct value), indicating that the operation process was normal and there was no contamination.

[0057] Example 2

[0058] Detection of small nucleic acids in cell culture supernatant using the method of the present invention and specific fluorescent probe

[0059] In the application scenario where synchronous amplification detection and differentiation of different target small nucleic acids are required, the method of the present invention can use specific fluorescent probes. Taking A549 lung cancer cells and miR-411 and miR-16 as examples, the main probe for detection is first designed and synthesized. The main probe TS0411 of miR-411 is the same as in Example 1, and the main probe TS0016 of miR-16 is shown in the sequence table. The auxiliary probe, anchor probe, and PCR primer are universal, and the sequences are as described above. The fluorescent probe is specific to the target small nucleic acid. The sequence of the miR-411 specific fluorescent probe (SP0411) is: 5'- ATGGCAGGTTAGTGGACCGTGTTACATA-3', the 5' end is labeled with the fluorescent group FAM, the 3' end is labeled with the quenching group BHQ1, and the sequence of the miR-16 specific fluorescent probe (SP0016) is: 5'- ATGGCA CGC CAATATTTACGTGCTGCTA-3', the 5' end is labeled with the fluorescent group HEX, and the 3' end is labeled with the quenching group BHQ1, wherein the bold part is the part that is completely complementary to the target small nucleic acid, and the underlined part upstream is part of the universal sequence to increase the probe Tm value. The system preparation is as described above. Take 100 μl of A549 cell culture supernatant or 100 μl of purified water (negative control), centrifuge at 12000 rpm for 1 min, aspirate 90 μl of supernatant, transfer to a tube containing 40 μl of magnetic bead sample release agent, mix, and keep warm at 30°C for 10 min; adsorb with a magnet, aspirate the supernatant, add 900 μl of washing solution and mix, adsorb with a magnet again, aspirate the supernatant, add 50 μl of mung bean nuclease solution, and keep warm at 30°C for 1 min; adsorb with a magnet again, aspirate the supernatant, add 900 μl of washing solution and mix, adsorb with a magnet again, aspirate the supernatant, add 30 μl of PCR solution, aspirate and mix, and transfer to a PCR tube, and incubate at ABI7500 On the PCR thermal cycler, the PCR program was as follows: 95°C for 10 min, followed by 40 cycles of 93°C for 10 s and 65°C for 40 s, and the fluorescence signal was collected at 65°C (FAM / HEX dual channels). The results of the FAM channel and HEX channel of the A549 cell culture supernatant sample were both positive (amplification, i.e., Ct value), indicating that the contents of miR-411 and miR-16 in the sample reached a detectable level. The results of the negative control FAM channel and HEX channel were both negative (no amplification, i.e., no Ct value), indicating that the operation process was normal and there was no contamination.

[0060] Example 3

[0061] Detection of small nucleic acids in cell culture supernatant using the method of the present invention and universal fluorescent dyes

[0062] Taking A549 lung cancer cells and miR-411 as an example, the main probe, auxiliary probe, anchor probe, and PCR primers are the same as in Example 1, but the fluorescent probe is not used, and SYBR Green I is added to 0.4× in the PCR solution. The rest of the system is prepared as described above. Take 100 μl of A549 cell culture supernatant or 100 μl of purified water (negative control), centrifuge at 12000 rpm for 1 min, aspirate 900 μl of supernatant, transfer to a tube containing 40 μl magnetic bead sample release agent, mix, and keep warm at 30°C for 10 min; adsorb with a magnet, aspirate the supernatant, add 900 μl washing solution and mix, adsorb with a magnet again, aspirate the supernatant, add 50 μl mung bean nuclease solution, and keep warm at 30°C for 1 min; adsorb with a magnet again, aspirate the supernatant, add 900 μl washing solution and mix, adsorb with a magnet again, aspirate the supernatant, add 30 μl PCR solution, aspirate and mix, and transfer to a PCR tube, and incubate at Macrostone SLAN-96p On the PCR thermal cycler, the PCR program was: 95°C for 10 min, then 40 cycles of 93°C for 10 seconds, 65°C for 30 seconds, and 74°C for 34 seconds. The fluorescence signal was collected at 74°C (SYBR channel). The fluorescence quantitative PCR reaction was performed. The result of the A549 cell culture supernatant sample was positive (amplification, that is, Ct value), indicating that the content of miR-411 in the sample reached a detectable level. The negative control result was negative (no amplification, that is, no Ct value), indicating that the operation process was normal and there was no contamination.

[0063] Example 4

[0064] Composition of the kit of the present invention

[0065] Take the production of 95 sets of the kit according to the conventional specification of 8 reactions / package as an example. According to the usual 95% yield, 100 sets are planned. The components and required quantities are shown in Table 3 below. Materials are prepared (Table 4) and the kit is prepared and packaged according to the kit formula in the manual.

[0066] Table 3 100 sets of planned quantity groups

[0067]

[0068]

[0069] Table 4 Bill of Materials

[0070]

[0071]

[0072] Example 5

[0073] Anti-interference experiment

[0074] The present invention designs and synthesizes the main probes of four human miRNAs, namely miR-93, miR-191, miR-3662, and miR-16, which are respectively recorded as: TS0093, TS0191, TS3662, and TS0016, and artificially synthesizes oligonucleotides whose sequences are homologous to these four miRNAs: OLI0093, OLI0191, OLI3662, and OLI0016. The specific sequence information is shown in Table 1.

[0075] The anti-interference comparison experiment of the method of the present invention and the method of application No. 202011041856.5 was carried out using DH5α Escherichia coli culture fluid and homologous oligonucleotides. The negative samples NL01 and NH01 were 20 μl and 200 μl respectively. 5 / μl of E. coli culture medium, positive samples PL01 and PH01 were 20μl and 200μl respectively 10 5 / μl E. coli culture medium was supplemented with 10 3 The above 4 homologous oligonucleotides were copied and repeated 3 times each. When using the method of the present invention to perform experiments, we supplemented the sample with PBS buffer so that the sample volume reached 100 μl, and then performed the detection operation according to the steps described above. When using the method of application number 202011041856.5 to perform experiments, we directly added 10 times the volume of the treatment solution 1 containing the probe to the sample according to the method, and continued the operation according to the steps of the method.

[0076] The results showed that when the E. coli content was 20×10 5 When the content of E. coli was increased by 10 times to 200×10 5 When the method of the present invention is 27.66, the negative result of "No Ct" without background amplification and the positive result of good amplification can still be obtained, but the method of application No. 202011041856.5 can no longer obtain the negative result of without background amplification. At the same time, the fluctuation of its amplification results increases, indicating that it is seriously interfered. The specific data are shown in the following table (Table 5):

[0077] Table 5 Experimental comparison between the method of the present invention (PADSA) and the method of application No. 202011041856.5 (MCAP)

[0078]

[0079] Note: Ct1-Ct3 are the results of 3 parallel experiments, and Cta is the average value.

[0080] E. coli total RNA and homologous oligonucleotides were further used to conduct anti-interference comparison experiments between the method of the present invention and the method of application number 202011041856.5. E. coli total RNA was extracted and purified from DH5α E. coli using the alkaline lysis method and adjusted to the required concentration with ultrapure water. Negative samples NL02 and NH02 contained 20 μl of E. coli total RNA with a concentration of 0.1 μg / μl and 1.0 μg / μl, respectively, and positive samples PL02 and PH02 contained 20 μl of E. coli total RNA with a concentration of 0.1 μg / μl and 1.0 μg / μl, respectively, with 10 3 The above 4 homologous oligonucleotides were copied and repeated 3 times each. When using the method of the present invention to perform experiments, we supplemented the sample with PBS buffer so that the sample volume reached 100 μl, and then performed the detection operation according to the steps described above. When using the method of application number 202011041856.5 to perform experiments, we directly added 10 times the volume of the treatment solution 1 containing the probe to the sample according to the method, and continued the operation according to the steps of the method. The results show that when the total RNA concentration of E. coli is 0.1 μg / μl, both methods can obtain a negative result of "No Ct" for background-free amplification, and can also give a positive result of good amplification with an average Ct value (Cta) of 27.61 and 28.20 respectively; when the RNA concentration of E. coli is increased by 10 times to 1.0 μg / μl, the method of the present invention can still obtain a negative result of "No Ct" for background-free amplification and a positive result of good amplification of 27.69, but the method of application number 202011041856.5 can no longer obtain a negative result of background-free amplification, and at the same time, the fluctuation of its amplification results increases, indicating that it is seriously interfered. The specific data are shown in Table 6 below.

[0081] Table 6 Experimental comparison between the method of the present invention (PADSA) and the method of application No. 202011041856.5 (MCAP)

[0082]

[0083] Note: Ct1-Ct3 are the results of 3 parallel experiments, and Cta is the average value.

[0084] Example 6

[0085] Lung cancer A549 cells were used to compare the sensitivity of the method of the present invention and the method of application number 202011041856.5 for cell detection.

[0086] Take freshly harvested A549 cells and adjust the cell concentration to 100 cells / μl with PBS buffer, take 20μl of cell suspension, dilute it 10 times with PBS buffer, and obtain 100μl of cell suspension samples with concentrations of 10 / μl, 1 / μl, and 0.1 / μl, respectively, which are recorded as PA010, PA001, and PA0.1. We took 10μl of each sample, repeated 3 times for each sample, and applied the method of the present invention to perform combined detection of the four target small nucleic acids miR-191, miR-93, miR-16, and miR-3662, and compared the method of application number 202011041856.5 at the same time. When conducting experiments using the method of application number 202011041856.5, we directly added 10 times the volume of the probe-containing treatment solution 1 to the sample according to the method, and continued to operate according to the steps of the method. The results show that when the sample cell concentration is 10 / μl and 1 / μl, both methods can obtain positive results with amplification, and the method of the present invention obtains a smaller Ct value, indicating that better amplification can be achieved. When the sample cell concentration is 0.1 / μl, the method of the present invention can still obtain a positive result of good amplification, but the comparison method can no longer obtain amplification. Therefore, it can be seen that the method of the present invention can achieve better cell detection sensitivity (100 / ml) than the method of application number 202011041856.5. The specific data are shown in Table 7 below.

[0087] Table 7 Experimental comparison between the method of the present invention (PADSA) and the method of application No. 202011041856.5 (MCAP)

[0088]

[0089] Note: NC is the negative control of purified water. Ct1-Ct3 are the results of 3 parallel experiments, and Cta is the average value.

[0090] Example 7

[0091] We cultured A549 cells for 3 consecutive days at a growth density close to 100%, then collected the culture supernatant, and aliquoted it at 10 μl / portion to obtain the A549 culture supernatant sample, which was recorded as EC010. The combined detection of the four target small nucleic acids miR-191, miR-93, miR-16, and miR-3662 was performed using the method of the present invention and the method of application number 202011041856.5, and 3 repetitions were performed for each. When the method of the present invention was used to perform the experiment, we supplemented the sample with PBS buffer so that the sample volume reached 100 μl, and then performed the detection operation according to the steps described above. When the method of application number 202011041856.5 was used to perform the experiment, we directly added 10 times the volume of the treatment solution 1 containing the probe to the sample according to the method, and continued to operate according to the steps of the method. The results showed that both methods could obtain positive results with amplification, and the method of the present invention obtained a smaller Ct value, indicating that better amplification could be achieved, that is, better sensitivity for detecting extracellular small nucleic acids could be achieved. The specific data are shown in Table 8 below.

[0092] Table 8 Experimental comparison between the method of the present invention (PADSA) and the method of application No. 202011041856.5 (MCAP)

[0093]

[0094] Note: NC is the negative control, PA010 is the positive control of 10 cells / μl A549 cells. Ct1-Ct3 are the results of 3 parallel experiments, and Cta is the average value.

[0095] Example 8

[0096] The sensitivity of the method of the present invention was tested using miR-16 homologous oligonucleotide OLI0016.

[0097] 10 3 The aforementioned OLI0016 sample of 100 copies / ml was diluted 10 times in a gradient manner to obtain 1ml of 100 copies / ml (LC0016100), 10 copies / ml (LC0016010), and 1 copy / ml (LC0016001) positive dilution samples, and then the detection operation was performed according to the steps described above, and each was repeated 3 times. The results showed that the positive dilution samples LC0016100 and LC0016010 were significantly amplified, and LC0016001 was amplified, but the fluctuation was large and close to the sensitivity limit. Based on this, we infer that the sensitivity of the method of the present invention can stably reach 10 copies / ml. The specific data are shown in Table 9 below.

[0098] Table 9 Sensitivity test of the method of the present invention (PADSA)

[0099]

[0100] Note: NCR01 is a negative control for E. coli. Ct1-Ct3 are the results of three parallel experiments, and Cta is the average value. If parallel experiments have both Ct values ​​and no Ct values, the average value will not be calculated.

[0101] Example 9

[0102] The specificity of the method of the present invention was further investigated by detecting homologous oligonucleotides of the human miR-181 small nucleic acid family.

[0103] The human miR-181 family has four different 5p mature forms: miR-181a-5p, miR-181b-5p, miR-181c-5p, and miR-181d-5p. The sequences are very similar, with only 1-5 nucleotide differences between them (see Appendix). Figure 2 ), but their expression and regulatory effects are different in different disease pathologies. For example, more and more evidence shows that miR-181a and b are upregulated in gastric cancer, which may promote the occurrence, development, invasion and metastasis of gastric cancer, while miR-181c is lowly expressed in gastric cancer tissues and may have an inhibitory effect on gastric cancer. The expression and role of miR-181d in gastric cancer are still unclear. Therefore, the small nucleic acid amplification detection method should not only achieve high sensitivity, but also high specificity to distinguish different types of small nucleic acids in the same family. Four oligonucleotides that are completely homologous to the four miR-181s were artificially synthesized, respectively denoted as: OLI181a, OLI181b, OLI181c, OLI181d, and the corresponding main probes, respectively denoted as: TS181a, TS181b, TS181c, TS181d (see the sequence table for specific sequence information), and the oligonucleotide sample concentration was adjusted to 10 5 The method of the present invention is operated as described above. The results show that the oligonucleotide samples and the corresponding main probe combinations can be significantly amplified, while the cross combinations have no amplification, indicating that the method of the present invention can achieve high specificity in distinguishing different small nucleic acids in the same family. The specific data are shown in Table 10 below.

[0104] Table 10 Detection of human miR-181 small nucleic acid family homologous oligonucleotides by the method of the present invention (PADSA)

[0105]

[0106] Note: Ct1-Ct3 are the results of 3 parallel experiments.

[0107] Example 10

[0108] Small nucleic acid combination detection, i.e., simultaneous detection of whether one or more of multiple target small nucleic acids are expressed in a sample, is the key to high performance in the detection of diseases with high genetic heterogeneity, such as tumors. The above-mentioned eight oligonucleotides (OLI0093, OLI0191, OLI3662, OLI0016, OLI181a, OLI181b, OLI181c, OLI181d) were further used to investigate the combination performance of the method of the present invention.

[0109] The eight main probes (TS0093, TS0191, TS3662, TS0016, TS181a, TS181b, TS181c, TS181d) were added to the magnetic bead sample release agent at a concentration of 15 nM. The remaining reagent compositions and detection procedures were the same as before. The concentration of each oligonucleotide sample was adjusted to 10 4 copies / ml, the concentration of the 8-oligonucleotide mixed sample (OL1TO8) is 8×10 4 The results showed that each oligonucleotide sample and oligonucleotide mixed sample could be significantly amplified, indicating that the method of the present invention can achieve high specificity in distinguishing different small nucleic acids in the same family. The specific data are shown in Table 11 below.

[0110] Table 11 Combination detection of 8 oligonucleotides by the method of the present invention

[0111]

[0112] Note: NC is the negative control, Ct1-Ct3 are the results of 3 parallel experiments, and Cta is the average value.

[0113] Embodiment 11

[0114] MiR-885-5p, miR-34b and miR-3662 are three small nucleic acids that have been verified by multiple literature reports to be highly expressed in lung cancer tissues but not expressed in adjacent tissues. We synthesized the main probes for these three target small nucleic acids (see the sequence list for detailed sequence information), which are recorded as: TS0885, TS034b, and TS3662.

[0115] 2 ml of sodium heparin anticoagulated whole blood samples were collected from 10 confirmed lung cancer patients and 10 healthy volunteers, and purified water negative control and A549 cell positive control were performed at the same time. After centrifugation at 5000 rpm for 3 min, about 95 μl of supernatant was transferred to a tube containing 40 μl of magnetic bead sample release agent, mixed, and kept at 30°C for 10 min; after adsorption with a magnet, the supernatant was removed, 950 μl of washing solution was added and mixed, and then adsorbed with a magnet again, the supernatant was removed, 50 μl of mung bean nuclease solution was added, and the mixture was kept at 30°C for 1 min; then the supernatant was removed by magnet adsorption, 950 μl of washing solution was added and mixed, and then adsorbed with a magnet again, the supernatant was removed, and 30 μl of PC was added. R solution was incubated at 95°C for 10 minutes and briefly centrifuged at 12000rpm. 30μl of the supernatant was transferred to a PCR tube, and the fluorescent quantitative PCR reaction was performed using the above-mentioned PCR program. The test results showed that the negative control had no amplification, and the positive control Ct value was 22.21, indicating that the experimental quality control was qualified; the Ct values ​​of the blood samples of 10 lung cancer patients were between 24.29 and 30.43, all of which were positive, indicating that the positive rate of the blood for lung cancer detection using the method of the present invention for the combination of these three target small nucleic acids was 100%; at the same time, the blood samples of 10 healthy volunteers had no amplification, indicating that the negative compliance rate of the blood for the combination of these three target small nucleic acids using the method of the present invention was 100%.

[0116] Example 12

[0117] Detection of three lung cancer-specific small nucleic acids in human blood using the kit of the present invention

[0118] The kit produced was used to amplify and detect three small nucleic acids that are highly expressed in lung cancer, such as miR-885-5p, miR-34b, and miR-3662. We synthesized the main probes of these three target small nucleic acids (see the sequence table for specific sequence information): TS0885, TS034b, and TS3662, mixed them in equal proportions to make the total concentration 1.2μM (0.4μM each), and aspirated 40μl and added it to 300μl 1.1× magnetic bead sample release agent provided by the kit. After mixing, it was dispensed into 2ml centrifuge tubes at 40μl / tube, and 15.3ml purified water was added to the 10× washing solution. The specific composition and detection operation of the remaining components were the same as above. We collected 2 ml of sodium heparin anticoagulated whole blood samples from 10 confirmed lung cancer patients and 10 healthy volunteers, and performed purified water negative control and A549 cell positive control at the same time. After centrifugation at 5000 rpm for 3 min, about 100 μl of supernatant was transferred to a tube containing 40 μl of magnetic bead sample release agent, mixed, and kept at 30°C for 10 min; after adsorption with a magnet, the supernatant was removed, 950 μl of washing solution was added and mixed, and then adsorbed with a magnet again, the supernatant was removed, 50 μl of mung bean nuclease solution was added, and kept at 30°C for 1 min; then the supernatant was removed by magnet adsorption, 950 μl of washing solution was added and mixed, and then the supernatant was removed by magnet adsorption, 30 μl of PCR solution was added, pipetted and mixed, and transferred to a PCR tube, and then the ABI7500 was used for PCR. On the PCR instrument, the PCR program is as follows: 95°C for 10 min, then 40 cycles of 93°C for 10 seconds and 65°C for 40 seconds, and the fluorescence signal is collected at 65°C (FAM channel) to perform a fluorescence quantitative PCR reaction; the computer automatically analyzes the results based on the threshold: if the sample has a Ct value, it is judged to be amplified, and if the Ct value is less than 35, it is judged to be significantly amplified, which is positive; if there is no Ct value, it is judged to be non-amplified, which is negative; if the Ct value is between 35 and 40, it is a gray area, and if it can be repeated, it is judged to be weakly positive. The test results in this case: the negative control has no amplification, and the positive control Ct value is 23.03, indicating that the experimental quality control is qualified; the Ct values ​​of the blood samples of 10 lung cancer patients are between 25.13 and 33.19, all of which are positive, indicating that the positive rate of the present invention kit for detecting lung cancer blood for these three target small nucleic acid combinations is 100%; at the same time, the blood samples of 10 healthy volunteers have no amplification, indicating that the negative compliance rate of the present invention kit for detecting these three target small nucleic acid combinations is 100%.

[0119] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A small nucleic acid detection kit based on probe anchoring double strands, characterized in that: Includes probe set, primer pair for amplification of target small nucleic acid, magnetic bead sample release agent, washing solution, mung bean nuclease, PCR amplification buffer and 1× positive control; The probe set includes a main probe, an auxiliary probe, an anchor probe and a fluorescent probe; The nucleotide sequence of the anchor probe is SEQ ID NO: 4; The nucleotide sequence of the auxiliary probe is SEQ ID NO: 2; The nucleotide sequence of the fluorescent probe is SEQ ID NO: 7; The target small nucleic acids are miR-191, miR-93, miR-16, and miR-3662, and the corresponding nucleotide sequences of the main probes are shown in SEQ ID NO: 12 to SEQ ID NO: 15; The nucleotide sequence of the upstream primer for amplifying the target small nucleic acid is SEQ ID NO: 6; The nucleotide sequence of the downstream primer for amplifying the target small nucleic acid is SEQ ID NO: 5; The 5' end of the anchor probe or main probe is labeled with biotin; The magnetic bead sample release agent includes 40-80 mM zinc chloride, 40-80 mM sodium acetate, 40-80 mM cysteine, 10%-18% ethylene carbonate by weight, 10%-30% formamide by volume, 4%-10% sodium dodecyl sulfate by weight, and 90-200 μg / ml streptavidin-modified magnetic beads; The washing solution is an aqueous solution containing 5-20 mM 3-morpholinepropanesulfonic acid, 40-80 mM cysteine, 30-50 mM sodium acetate, and 0.05%-0.1% Tween 20 by volume.

2. The small nucleic acid detection kit based on probe anchoring double strands according to claim 1, characterized in that: The 3' terminal base of the main probe is adenine.

3. Use of the small nucleic acid detection kit based on probe anchoring double strands according to claim 1 or 2 in small nucleic acid detection for non-disease diagnosis purposes.

4. A method for detecting small nucleic acids for non-disease diagnosis purposes using the kit according to claim 1 or 2, characterized in that: The following steps are involved: The sample to be tested, the main probe, the auxiliary probe, the anchor probe and the magnetic bead sample releaser are mixed, incubated, the supernatant is removed under magnetic field conditions, washed, and mung bean nuclease solution is added for enzymatic hydrolysis. The supernatant is removed under magnetic field conditions, washed, and PCR amplification buffer, fluorescent probe, and target small nucleic acid amplification primer pairs are added to perform fluorescent quantitative PCR amplification reaction. The detection result Ct value ≤35 indicates that the sample to be tested contains the target small nucleic acid, otherwise it does not contain it.

Images