Application of Hsa_circRNA_100632 as a diagnostic marker for fulminant type 1 diabetes

Abstract

The present invention relates to the field of medical technology, and in particular to the use of Hsa_circRNA_100632 as a diagnostic marker for fulminant type 1 diabetes (FT1D). The level of hsa_circRNA_100632 in peripheral blood mononuclear cells (PBMC) of FT1D patients is significantly increased, and there is a significant difference between the level of hsa_circRNA_100632 in type 1 diabetes patients and normal controls. It can be used as a diagnostic biomarker for the diagnosis and differential diagnosis of FT1D patients in clinical practice. In addition, upregulating the level of hsa_circRNA_100632 can construct a model of FT1D.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to the use of Hsa_circRNA_100632 as a diagnostic marker for fulminant type 1 diabetes. Background Art

[0002] Fulminant type 1 diabetes (FT1D) is a new subtype of type 1 diabetes (T1D) proposed by Japanese scholars in recent years. The main clinical manifestations are acute onset, severe ketoacidosis, and rapid failure of β-cell function. The condition is serious and the prognosis is grim. It is an emergency and critical disease that often involves multiple clinical disciplines such as internal medicine, obstetrics and gynecology, and emergency department. However, the pathogenesis of FT1D is currently unclear, and early diagnosis and prediction are difficult. Therefore, in-depth exploration of FT1D molecular markers for diagnosis and prediction is of great clinical significance.

[0003] Circular RNA (circRNA) is a new type of non-coding RNA that does not have a 5' end cap and a 3' end poly (A) tail. Due to its special closed circular structure, it is not easily degraded by nucleases and has good stability, making it a good choice for disease diagnostic markers. In recent years, many studies have shown that circRNA plays an important role as a molecular marker in tumors, nervous system diseases, cardiovascular diseases and immune diseases.

[0004] Further research on the role of circRNA in FT1D will help to explore the cause of fulminant type 1 diabetes and point out the direction of treatment for the disease. Therefore, it is of great significance to further explore whether circRNA can be used as a biomarker for early diagnosis, differential diagnosis and prediction of FT1D. Summary of the invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide the application of hsa_circRNA_100632 as a diagnostic marker for fulminant type 1 diabetes.

[0006] The present study found that the level of hsa_circRNA_100632 in peripheral blood mononuclear cells (PBMCs) of FT1D patients was significantly increased, which was significantly different from that of type 1 diabetes patients and normal controls.

[0007] Therefore, the present invention provides the use of hsa_circRNA_100632 as a marker in the preparation of a diagnostic product for fulminant type 1 diabetes.

[0008] The present invention also provides the use of a reagent for detecting hsa_circRNA_100632 in the preparation of a diagnostic product for fulminant type 1 diabetes.

[0009] In the present invention, the fulminant type 1 diabetes diagnostic product is a diagnostic reagent, a diagnostic tool and / or a diagnostic kit, which is not limited in the present invention.

[0010] The present invention also provides a reagent for detecting hsa_circRNA_100632, including any one of the following I) to IV):

[0011] I), detection primers of hsa_circRNA_100632;

[0012] II), detection probe of hsa_circRNA_100632;

[0013] III), aptamer of hsa_circRNA_100632;

[0014] IV), chip used to detect hsa_circRNA_100632.

[0015] The reagent for detecting hsa_circRNA_100632 provided by the present invention uses PCR or isothermal amplification to detect samples, the PCR method includes a conventional PCR method, and can also be qPCR, RTPCR, digital PCR, the isothermal amplification includes LAMP, ERA, NERA, NASBA, RCA, HAD, RPA, the target of the PCR or isothermal amplification can be hsa_circRNA_100632, or a product obtained by transcription of hsa_circRNA_100632, which can be full-length or a partial fragment, and the present invention is not limited to this.

[0016] In some embodiments, the detection primers of hsa_circRNA_100632 include primer pairs as shown in SEQ ID NO. 4 to 5. The sequence shown in SEQ ID NO. 4 is: ctgtattcttgcttcgctgctt, and the sequence shown in SEQ ID NO: 5 is: ctcctccgctgcctttcc.

[0017] The chip for detecting hsa_circRNA_100632 of the present invention may carry the primers, probes or adaptors of the present invention, or may carry other substances that can be used to detect hsa_circRNA_100632, and the present invention is not limited to this.

[0018] Furthermore, the present invention also provides a diagnostic product for fulminant type 1 diabetes, which comprises the reagent described in the present invention.

[0019] The diagnostic product of the present invention also includes a total RNA extraction reagent, a reverse transcription reagent and an RT-qPCR detection reagent.

[0020] The total RNA extraction reagent described in the present invention is a total RNA extraction reagent for PBMC. In some embodiments, the total RNA is extracted using the Trizol method.

[0021] The present invention also provides a method for diagnosing fulminant type 1 diabetes, which comprises detecting the expression level of hsa_circRNA_100632 in a sample.

[0022] The detection described in the present invention adopts RT-qPCR method, and judges whether the sample comes from a patient with fulminant type 1 diabetes according to the expression level of hsa_circRNA_100632. The sample is PBMC.

[0023] Specifically, the diagnostic method for fulminant type 1 diabetes described in the present invention comprises extracting RNA from PBMC, calculating the expression of hsa_circRNA_100632 relative to Control after RT-qPCR detection, and judging whether the patient is a fulminant type 1 diabetes patient according to the relative expression. In the present invention, the Control is the expression of hsa_circRNA_100632 in PBMC of healthy people, and the relative expression of 1.558 is used as the cutoff value. A relative expression greater than 1.558 indicates that the patient may suffer from fulminant type 1 diabetes.

[0024] The expression level of hsa_circRNA_100632 in patients with fulminant type 1 diabetes was significantly higher than that in patients with type 1 diabetes and normal controls. Therefore, overexpression or further activation of hsa_circRNA_100632 can be used to construct a fulminant type 1 diabetes model.

[0025] The present invention provides an application of hsa_circRNA_100632 as a target in constructing a fulminant type 1 diabetes model.

[0026] The present invention also provides a reagent for constructing a fulminant type 1 diabetes model, which comprises any one of the following i) to iii):

[0027] i) Reagents for overexpressing hsa_circRNA_100632;

[0028] ii), a reagent that increases the activity of hsa_circRNA_100632;

[0029] iii), substances that reduce the level or activity of hsa_circRNA_100632 inhibitors.

[0030] The present invention also provides a method for constructing a fulminant type 1 diabetes model, which is treated with the reagent described in the present invention to increase the level or activity of hsa_circRNA_100632.

[0031] In the present invention, the model is an animal model or a cell model. The reagent for overexpressing hsa_circRNA_100632 can be a reagent for transfecting or transforming cells, which is not limited in the present invention. The reagent for increasing the activity of hsa_circRNA_100632 in the present invention can increase the activity of hsa_circRNA_100632 or activate hsa_circRNA_100632. The substance that reduces the level of hsa_circRNA_100632 inhibitors, or the substance that reduces the activity of hsa_circRNA_100632 inhibitors, can be a small molecule compound or can knock down or knock out hsa_circRNA_100632 inhibitors by means of genetic engineering. The present invention is also not limited to this.

[0032] The present invention proves through research that the level of hsa_circRNA_100632 in PBMC of FT1D patients is significantly increased, which is significantly different from that of type 1 diabetes patients and normal controls, and can be used as a diagnostic biomarker for diagnosis and differential diagnosis of FT1D patients in clinic. In addition, upregulating the level of hsa_circRNA_100632 can construct a model of FT1D. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The volcano plot of differential expression of circRNA in PBMC of FT1D patients is shown. Note: The two black vertical dashed lines represent 1.5-fold up-regulation and down-regulation of expression levels, respectively. The black horizontal dashed line represents a p value of 0.05. The red and green dots in the figure represent circRNAs with statistical differences and 1.5-fold up-regulation and down-regulation of expression levels, respectively. The black dots represent circRNAs without statistical differences.

[0034] Figure 2 The figure shows the cluster diagram of differential expression of circRNA in PBMC of FT1D patients. Note: Each row represents the expression level of a circRNA, and each column represents the circRNA expression distribution of a sample. The color scale shows the relative expression level of circRNA in different samples: red indicates upregulation, and blue indicates downregulation (FT1D group: FD1, FD2, FD3, FD4, FD5; Control group: HC1, HC2, HC3, HC4, HC5);

[0035] Figure 3The statistical diagram of differential expression of 4 circRNAs verified by RT-qPCR is shown; * represents P < 0.05, ns represents no statistical difference;

[0036] Figure 4 The differential expression bar graph of 2 circRNAs was verified by RT-qPCR in the expanded samples. **** represents P < 0.0001, and ns represents no statistical difference.

[0037] Figure 5 The diagnostic and differential diagnostic value of hsa_circRNA_100632 for FT1D was shown by ROC evaluation analysis. DETAILED DESCRIPTION

[0038] The present invention provides the use of Hsa_circRNA_100632 as a diagnostic marker for fulminant type I diabetes. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0039] Hsa_circRNA_100632 is a circular RNA molecule (SEQ ID NO.1) with the sequence: GCAGCGGAGGAGGAAATGGCAGG TCCTAATCAACTCTGCATTCGCCGCTGGACTACCAAGCATGTAGCTGTGTGGCTGAAGGATGAAGGCTTTTTTGAATATGTGGACATTTTATGCAATAAGCACCGACTTGATGGAATCACATTGCTAACATTGACTGAATATGATCTCCGGTCTCCTCCTCTGGAAATCAAAGTCTTAGGGGACATTAAAAGGTTAATGCTCTCAGTCCGAAAATTGCAGAAAATACATATTGATGTTTTAGAAGAGATGGGCTACAACAGTGACAGTCCCATGGGTTCCATGACCCCTTTCATCAGTGCTCTTCAGAGTACAGACTGGCTCTGTAATGGGGAGCTTTCCCATGACTGTGACGGACCCATAACTGACTTGAATTCTGATCAGTACCAGTACATGAATGGTAAAAACAAACATTCTGTTCGAAGATTGGACCCAGAATACTGGAAGACTATACTGAGTTGTATATATGTTTTTATAGTATTTGGATTTACATCTTTCATTATGGTTATAGTCCATGAGCGAGTGCCTGACATGCAGACCTATCCACCACTCCCAGATATATTCTTAGACAGCGTTCCTAGAATCCCATGGGCCTTTGCCATGACGGAAGTATGTGGCATGATTCTGTGCTATATTTGGCTCCTGGTTCTTCTTCTTCACAAGCACAGGTCAATACTTCTGCGAAGGCTCTGTAGTCTGATGGGAACTGTATTCTTGCTTCGCTGCTTTACCATGTTTGTGACCTCCCTCTCCGTGCCAGGACAACACCTGCAGTGTACTGGAAAG.

[0040] The present invention collects PBMCs extracted from 5 FT1D patients and 5 healthy controls (Control), extracts RNA, uses Arraystar Human circRNA Arrays V2 chip detection, screens out differentially expressed circRNAs, performs cluster analysis, and uses Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) to perform gene function annotation analysis and signal pathway enrichment analysis, respectively, to predict the role of differentially expressed circRNAs in the occurrence and development of FT1D. Preliminary validation: Real-time fluorescence quantitative PCR (RT-qPCR) was used to preliminarily validate differentially expressed circRNAs in 7 FT1D patients and 7 Controls. Expanded sample validation: 32 FT1D patients, 58 classic T1D patients, and 86 Control samples were expanded by RT-qPCR for sample validation, and correlation statistical analysis was performed in combination with routine clinical indicators. The receiver operating characteristic curve (ROC) was used to evaluate its clinical value as a diagnostic marker for FT1D and explore its relationship with clinical characteristics.

[0041] The results showed that the circRNAs sequenced in the FT1D group were compared with those in the Control group. With the differential expression fold (FC) > 1.5 and P < 0.05 as the screening criteria, 26 differentially expressed circRNAs were screened out (13 up-regulated and 13 down-regulated). Bioinformatics analysis showed that the enriched host genes were mainly involved in non-homologous end joining, 2-oxocarboxylic acid metabolism, arginine biosynthesis and other pathways. Four of the circRNAs were selected and verified by RT-qPCR in 14 samples. The up-regulated hsa_circRNA_100632 and down-regulated hsa_circRNA_406299 were consistent with the chip results (statistically significant). Expanded sample verification showed that hsa_circRNA_100632 showed significant statistical differences in the Control group, T1D group, and FT1D group (F = 32.904, P < 0.0001), and its expression level showed an increasing trend in these three groups. At the same time, compared with the Control group, the area under the curve (AUC) of hsa_circRNA_100632 in the FT1D group was 0.870 (95%CI: 0.807-0.933), and compared with the T1D group, the area under the curve (AUC) of hsa_circRNA_100632 was 0.782 (95%CI: 0.691-0.872).

[0042] The present invention proves that the level of hsa_circRNA_100632 in PBMC of FT1D patients is significantly increased, which is significantly different from that of type 1 diabetes patients and normal controls, and can be used as a diagnostic biomarker for diagnosis and differential diagnosis of FT1D patients in clinic. In addition, upregulating the level of hsa_circRNA_100632 can construct a model of FT1D.

[0043] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below in conjunction with the embodiments: Example

[0044] 1. Materials and Methods

[0045] 1. Research subjects

[0046] All patients and healthy controls involved in this study signed informed consent, and this study was reviewed and approved by the Ethics Committee of the National Clinical Research Center for Metabolic Diseases, Second Xiangya Hospital, Central South University (ZYF2021100).

[0047] 1.1 FT1D group

[0048] A total of 39 patients with FT1D who visited the Department of Metabolic Endocrinology, Second Xiangya Hospital, Central South University from January 2021 to January 2022 were collected, with an average age of 36.28±12.35 years, including 18 females and 21 males.

[0049] FT1D inclusion criteria: (1) ketosis or ketoacidosis within 1 week of hyperglycemia symptoms; (2) initial blood glucose >16mmol / L and first glycosylated hemoglobin (HbA1c) <8.5%. (3) serum fasting C-peptide (FCP) <100pmol / L (0.3ng / ml) and 2-hour postprandial C-peptide (PCP) <170pmol / L (0.5ng / ml) at onset.

[0050] 1.2 T1D group

[0051] A total of 58 T1D patients who visited the Department of Metabolic Endocrinology, Second Xiangya Hospital, Central South University from January 2021 to January 2022 were collected, with an average age of 31.72±12.29 years, including 33 females and 25 males.

[0052] T1D inclusion criteria: (1) meeting the 1999 WHO diagnostic criteria for diabetes; (2) developing ketosis or ketoacidosis without obvious causes within six months of onset; (3) positive glutamic acid decarboxylase antibody (GADA); (4) dependent on insulin treatment; (5) excluding patients with secondary diabetes, other autoimmune diseases, tumors, etc.

[0053] 1.3 Control Group

[0054] A total of 93 healthy volunteers who visited the Physical Examination Center of the Second Xiangya Hospital of Central South University from January 2021 to January 2022 were collected, with an average age of 32.69±8.93 years, including 50 females and 43 males.

[0055] Inclusion criteria for normal controls: (1) fasting blood glucose (FBG) <5.6mmol / L; (2) HbA1c <6.1%; (3) patients with other autoimmune diseases, tumors, etc. are excluded.

[0056] 2. Sample collection

[0057] All subjects had 4.5 ml of peripheral fasting blood drawn intravenously into EDTA anticoagulant tubes, and peripheral blood mononuclear cells (PBMCs) were separated on the same day and dispensed into 1.5 ml centrifuge tubes. 1 ml of Trizol (invitrogen, 15596026) was added and stored in a -80°C refrigerator for subsequent total RNA extraction.

[0058] 3. Experimental methods

[0059] 3.1 PBMC isolation

[0060] PBMCs were separated using Ficoll Plus (GE, 17-1440-03) according to density gradient centrifugation. 4.5 ml of PBS (Gibco, C10010500BT) was used to dilute Ficoll Plus at 1:1:1, and blood was layered. Density gradient centrifugation (20°C, 800G, 25min, +0-0) was performed. The liquid in the tube was divided into three layers. The PBMCs (buffy coat layer) were transferred to a 15 ml centrifuge tube using a Pasteur pipette. The PBMCs were eluted with PBS, and the red blood cells were lysed and eluted after centrifugation again (20°C, 300G, 8min, +8-9). Finally, the separated PBMCs were transferred to a 1.5 ml centrifuge tube, 1 ml of Trizol was added to lyse the PBMCs and stored in a -80°C refrigerator.

[0061] 3.2 Total RNA extraction

[0062] Total RNA was extracted from frozen PBMCs of the three groups using the Trizol method (Invitrogen, 17-1440-03) according to the manufacturer's instructions. RNA concentration and purity were determined using a NanoDrop ND-1000 instrument (NanoDrop Thermo). The average A260 / A280 value was 1.8-2.0.

[0063] 3.3 CircRNA chip detection

[0064] Sample labeling and array hybridization were performed according to the manufacturer's instructions (Arraystar Human circRNA ArrayV2, 8x15K). First, total RNA was digested with RNase R (Epicentre, Inc.) to remove linear RNA and enrich circRNA. Then, the enriched circRNA was amplified and transcribed into fluorescent cRNA using a random primer method (Arraystar Super RNA Labeling Kit; Arraystar). The labeled cRNA was purified using the RNeasy Mini Kit (Qiagen), and the concentration of cRNAs and specific activity (pmol Cy3 / μg cRNA) were determined by NanoDrop 2000 spectrophotometer. Then, 5ul of No. 10 blocking agent and 1ul of No. 25 fragmentation buffer were added, heated at 60°C for 30 minutes, and 1μg of labeled cRNA was fragmented. Then 25μl of 2× hybridization buffer was added to dilute the labeled cRNA. Finally, 50μl of hybridization solution was dispensed into the gasket slide and assembled onto the circRNA expression microarray slide. The slides were incubated in an Agilent hybridization oven at 65°C for 17 h before washing, fixing, and scanning using an Agilent scanner G2505C. The scanned images were imported into Agilent Feature Extraction Software (version 11.0.1.1) for raw data extraction.

[0065] 3.4 Verification of differential circRNAs

[0066] Based on the analysis of the original data and the prediction of bioinformatics, four abnormally expressed circRNAs were selected for RT-qPCR verification. After that, two circRNAs were screened out for further sample verification in the Control group, FT1D group, and T1D group. β-actin was used as an internal reference. Total RNA reverse transcription and RT-qPCR were completed using a kit (Promega, A6001, A5001). The specific operations are as follows:

[0067] 3.4.1 Total RNA reverse transcription

[0068] (1) Add 1ug RNA and 1ul random primer to a 200uL EP tube, and then add Nuclease-Free Water to make a 10ul system; Heater: 70℃, 5min, and immediately place on ice for ≥5min.

[0069] (2) Prepare another 10uL system reaction mixture (RT-Mix) (Table 1)

[0070]

[0071] (3) Add 10ul of RT-Mix to (1). Anneal at 25℃ for 5min; elongate at 42℃ for 1h; inactivate at 70℃ for 15min. If not in use for a long time, store in a -20℃ refrigerator.

[0072] 3.4.2 RT-qPCR validation

[0073] The RT-qPCR reaction used a 384-well plate, with a reaction system of 10 μl in each well. Three replicate wells were set up for each sample, and the instrument used was a Quantstudio 6 fluorescence quantitative PCR instrument.

[0074] (1) Primer preparation

[0075] Primer design and synthesis were commissioned to Sangon Biotech (Shanghai) Co., Ltd. (Table 2).

[0076]

[0077] (2) Configure the RT-qPCR amplification system (Table 3):

[0078]

[0079] (3) The PCR reaction program was as follows: pre-denaturation: 95°C, 10 min; thermal cycling: 95°C, 15 s; 60°C, 1 min (40 cycles); melting curve: 95°C, 15 s; 60°C, 1 min; 95°C, 15 s.

[0080] 4 Statistical methods

[0081] Normal data were expressed as mean ± standard deviation, non-normal data were expressed as interquartile range, and categorical variable data were expressed as frequency. -ΔΔCTThe relative expression levels of the selected circRNAs in RT-qPCR were calculated by the Shapiro-Wilk test. The normality of the data was tested. The data that met the normal distribution were analyzed by independent sample t-test or one-way analysis of variance (ANOVA). Otherwise, the rank sum test (Mann-Whitney U test or Kruskal-Wallis H test) was used for the analysis of differences between the groups of categorical data. The Spearman correlation coefficient was used to evaluate the relationship between circRNAs and traditional biomarkers of FT1D, and the receiver operating characteristic curve (ROC) was used to evaluate the diagnostic and differential diagnostic performance of circRNAs for FT1D. Statistical analysis was performed using SPSS 26.0 (IBM SPSS, Inc., Chicago, IL, USA) and GraphPad Prism 8.4.3 (Graphpad Software Inc., San Diego, CA, USA). P values ​​< 0.05 were considered statistically significant.

[0082] Three results

[0083] 1 Differential expression profile of circRNAs in PBMCs of FT1D patients

[0084] A total of 13,563 circRNAs were detected in PBMCs of FT1D patients using Arraystar circRNA chips. Compared with the control group, 26 differentially expressed circRNAs were found in FT1D patients, of which 13 were upregulated and 13 were downregulated. Figure 1 ) showed statistically significant circRNAs between the FT1D group and the Control group (FC ≥ 1.5, p<0.05). The heat map generated by cluster analysis intuitively showed the distribution characteristics and expression levels of differential circRNAs between FT1D patients and Controls ( Figure 2 ). The study showed that the expression levels of some circRNAs were significantly different in PBMCs of FT1D patients and controls.

[0085] 2 RT-qPCR verification of circRNA expression

[0086] To verify the accuracy of the microarray chip results, we selected four differentially expressed circRNAs (hsa_circRNA_100632, hsa_circRNA_406299, hsa_circRNA_103774, hsa_circRNA_401089) in PBMCs of seven FT1D patients and seven Controls, and used RT-qPCR to detect the relative expression levels of the above four circRNAs in FT1D patients and Controls, and further identified the differentially expressed circRNAs. The results are shown in Figure 3 The expression levels of hsa_circRNA_406299 (downregulated) and hsa_circRNA_100632 (upregulated) in PBMC of FT1D patients were statistically significant (P<0.05). The samples were further expanded in another cohort, and these two circRNAs were validated by RT-qPCR in 32 FT1D patients, 58 T1D patients and 86 Controls (Table 4). The results are as follows Figure 4 The expression level of hsa_circRNA_100632 in the FT1D group was significantly higher than that in the T1D group and the Control group (F=32.904, P<0.0001).

[0087]

[0088] Note: a One-way ANOVA; b Chi-square test; c Kruskal-Wallis H test; d Mann-Whitney U.

[0089] BMI: body mass index; TG: triglycerides; TC: total cholesterol; LDLC: low-density lipoprotein cholesterol; HDLC: high-density lipoprotein cholesterol; FBG: fasting blood glucose; FCP: fasting C-peptide; HbA1c: glycosylated hemoglobin

[0090] 3 Relationship between Hsa_circRNA_100632 and clinical characteristics

[0091] The Spearman correlation analysis of the expanded sample data showed that the expression level of hsa_circRNA_100632 was negatively correlated with fasting C-peptide in the FT1D group, suggesting that the higher the expression of hsa_circRNA_100632, the lower the fasting C-peptide in FT1D patients (Table 5).

[0092]

[0093] Note: * Represents P<0.05; FBG: fasting blood glucose; FCP: fasting C-peptide; HbA1c: glycosylated hemoglobin

[0094] 4. Diagnostic value of Hsa_circRNA_100632 for FT1D

[0095] To explore the diagnostic and differential diagnostic value of hsa_circRNA_100632 for FT1D, further receiver operating characteristic (ROC) curve analysis showed that hsa_circRNA_100632 had a high accuracy in distinguishing FT1D from T1D, and FT1D from Control ( Figure 5 ).

[0096] Identifying FT1D vs. For Control, when the Youden index reached its maximum value of 0.56, the optimal diagnostic cutoff value was 1.558, and the area under the curve (AUC) was 0.870 (95%CI: 0.807-0.933) (P<0.0001), the sensitivity was 69.23%, and the specificity was 87.10%.

[0097] Identifying FT1D vs. For T1D, when the Youden index reached the maximum value of 0.40, the optimal diagnostic cutoff value was 2.158, the area under the curve (AUC) of hsa_circRNA_100632 was 0.782 (95%CI: 0.691-0.872) (P<0.0001), the sensitivity was 43.6%, and the specificity was 96.6%.

[0098] Discussion

[0099] Numerous evidences show that circRNA, due to its unique circular structure, non-degradable and good stability, has been confirmed to not only participate in the occurrence and development of various diseases such as tumors and immune diseases, but also serve as a biological marker and potential therapeutic target for the diagnosis of various diseases. At present, the role of circRNA in diabetes and its complications is becoming increasingly prominent. Deciphering the potential relationship between circRNA and diabetes may provide us with new ideas for understanding the pathogenesis of diabetes.

[0100] T1D is a chronic autoimmune disease with pancreatic β-cell function destruction and absolute insulin deficiency. Patients need to rely on insulin treatment for life, which is more difficult to prevent and treat than common type 2 diabetes. The role of circRNA in T1D has attracted close attention from scholars. A study found that 68 circRNAs in the plasma of newly diagnosed T1D patients were significantly abnormal, including 61 up-regulated and 7 down-regulated. Among them, 4 circRNAs (hsa_circRNA_101062, hsa_circRNA_100332, hsa_circRNA_085129 and hsa_circRNA_103845) were statistically different after RT-qPCR verification. 93 differentially expressed circRNAs were found in the peripheral whole blood of T1D patients, of which 30 were up-regulated and 63 were down-regulated. Six were randomly selected for verification, and it was found that hsa_circ_0072697 and hsa_circ_0002473 were still significantly different after RT-qPCR verification. Studies have found that circPPM1F in T1D patients is mainly expressed in monocytes and promotes the activation of M1 macrophages through the circPPM1F-HuR-PPM1F-NF-κB pathway. Overexpression of circPPM1F may lead to islet damage. Yang and colleagues found that has_circ_0060450 may be used as a potential biomarker for T1D for early identification and diagnosis of T1D.

[0101] FT1D is a special type of T1D that develops suddenly. It has an acute onset, severe condition, high mortality rate and great harm. The current clinical diagnostic criteria for fulminant type 1 diabetes are: (1) ketosis or ketoacidosis occurs within 1 week of hyperglycemia symptoms; (2) initial blood glucose>16mmol / L and first glycosylated hemoglobin (HbA1c)<8.5%. (3) serum fasting C-peptide (FCP)<100pmol / L (0.3ng / ml) and 2-hour postprandial C-peptide (PCP)<170pmol / L (0.5ng / ml) at onset. If all three of the above criteria are met at the same time, it can be diagnosed as fulminant type 1 diabetes. The existing clinical diagnostic criteria for FT1D involve complicated indicators and are relatively time-consuming. They require the combination of blood sugar at onset, HbA1c, and clinical symptoms of ketoacidosis within 1 week of onset, plus fasting C-peptide and 2-hour postprandial C-peptide levels (FCP and 2hPCP) after complete relief of ketoacidosis for diagnosis. Complete relief of ketoacidosis usually takes 1-2 weeks, and FT1D is diagnosed based on C-peptide levels after 2 weeks. This situation hinders the early diagnosis of FT1D patients and is not conducive to subsequent precise intervention and prognosis judgment. Therefore, in-depth exploration of molecular markers for early diagnosis of FT1D is of great clinical significance.

[0102] At present, there are no reports on the diagnostic value of circRNA for FT1D. In this study, a series of differential circRNAs were screened in PBMCs of FT1D patients by circRNA chips. Through preliminary verification and expanded sample verification, it was found that the expression level of hsa_circRNA_100632 in the FT1D group was significantly higher than that in the T1D group and the Control group. Correlation analysis found that the expression level of hsa_circRNA_100632 in the FT1D group was negatively correlated with fasting C-peptide, indicating that the higher the expression of hsa_circRNA_100632, the lower the fasting C-peptide of FT1D patients. Receiver operating characteristic (ROC) curve analysis showed that hsa_circRNA_100632 had a high accuracy in distinguishing FT1D from T1D and FT1D from Control. The best diagnostic cutoff expression of hsa_circRNA_100632 for diagnosing FT1D was 1.558, with an area under the curve (AUC) of 0.870 (95%CI: 0.807-0.933), a sensitivity of 69.23%, and a specificity of 87.10%. When used to distinguish FT1D from T1D, the best diagnostic cutoff expression was 2.158, with an area under the curve (AUC) of 0.782 (95%CI: 0.691-0.872), a sensitivity of 43.6%, and a specificity of 96.6%, indicating that hsa_circRNA_100632 has a very good specificity as a differential diagnostic indicator.

[0103] Bioinformatics analysis revealed that hsa_circRNA_100632 originated from SMAD8. Existing studies have shown that SAMD8 is a ceramide phosphoethanolamine synthetase in the endoplasmic reticulum, which has potential dual activity as a ceramide sensor. Its N-terminal SAM domain can control ER ceramide levels and inhibit ceramide-induced mitochondrial apoptosis. Studies have found that high glucose can mediate podocyte apoptosis by causing mitochondrial dysfunction through oxidative stress. However, whether hsa_circRNA_100632 is involved in cell damage and apoptosis in the process of FT1D disease and its mechanism need further study.

[0104] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of hsa_circRNA_100632 as a marker in the preparation of a diagnostic product for fulminant type 1 diabetes; the nucleic acid sequence of hsa_circRNA_100632 is shown in SEQ ID NO:

1.

2. Use of a reagent for detecting hsa_circRNA_100632 in the preparation of a diagnostic product for fulminant type 1 diabetes, wherein the reagent for detecting hsa_circRNA_100632 comprises a primer pair as shown in SEQ ID NO.4 to 5; the nucleic acid sequence of hsa_circRNA_100632 is as shown in SEQ ID NO:1.

Images