Nocardia seriolae vaccine, preparation method and application thereof
By preparing recombinant protein vaccines, DNA vaccines, and targeted DNA vaccines for Nocardia amberis, and using ABP as a candidate antigen, the safety and immunoprotection issues of Nocardiasis in California bass have been resolved, achieving effective prevention and control of nocardiasis in bass with significant immunoprotective effects and environmental advantages.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHENZHEN WANKESEN BIOTECHNOLOGY CO LTD
- Filing Date
- 2023-01-06
- Publication Date
- 2026-05-15
AI Technical Summary
Existing vaccines for nocardiosis in California bass have safety issues and limited immune protection. Traditional drug treatments pose risks of environmental pollution and drug resistance. There is a need to develop safe, environmentally friendly, and highly effective vaccines to prevent and control this disease.
Using the ABC family ATP-binding protein (ABP) on the Nocardia purpurea membrane protein as a candidate antigen, primers were designed and cloned into a vector to prepare recombinant protein vaccines, DNA vaccines, and targeted DNA vaccines. Mannosaccharified chitosan was used to encapsulate eukaryotic recombinant plasmids as targeted DNA vaccines.
The prepared recombinant protein vaccine, DNA vaccine, and targeted DNA vaccine have significant immunoprotective effects on sea bass, effectively preventing nocardiosis. They are simple to operate, safe, environmentally friendly, and long-lasting.
Smart Images

Figure CN116236566B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to vaccines for the prevention and control of fish diseases. More specifically, it relates to Nocardia amberjack recombinant protein vaccines, DNA vaccines, and targeted DNA vaccines, as well as their preparation and application. Background Technology
[0002] California bass, scientific name: largemouth bass ( Micropterus salmoides The California bass (California bass), belonging to the order Perciformes and family Sunfishidae, is a freshwater fish with high economic value due to its delicious flesh, strong disease resistance, rapid growth, ease of harvesting, and wide temperature tolerance. While California bass farming has developed rapidly in my country, the increasing scale and intensification of aquaculture have led to frequent outbreaks of diseases, particularly nocardiosis, which has become a bottleneck restricting the healthy development of the aquaculture industry.
[0003] Nocardiosis in largemouth bass often results in mass mortality, causing significant economic losses to the industry due to its long incubation period, high morbidity rate, and slow disease progression. Traditional treatments for nocardiosis involve multiple sensitive antibiotics, offering limited efficacy and posing serious problems such as environmental pollution, microbial resistance, and drug residues. Compared to traditional drugs, vaccines offer advantages in aquaculture, including safety, environmental friendliness, and long-lasting protection. Vaccination is currently the most economical, effective, safe, and environmentally friendly method for controlling nocardiosis in fish. Therefore, developing vaccines against this pathogen and strengthening research on immunomodulatory control of Nocardiosis in largemouth bass are of great importance.
[0004] Currently, while inactivated Nocardia vaccines can increase serum agglutination antibody titers, they offer almost no immune protection after challenge. Attenuated Nocardia vaccines also have safety concerns. Therefore, the development of inactivated and attenuated Nocardia vaccines is unlikely and practically impractical. Compared to traditional vaccines, recombinant protein and DNA vaccines are likely to be safer and more effective.
[0005] Mannose is widely distributed in nature, and the sugar compounds it participates in are abundant in the body fluids and tissues of organisms. It is biologically safe and non-toxic, and can be metabolized and degraded by the body after ingestion. D-mannose can be recognized and bound by mannose receptors on antigen cells, mediating phagocytosis by macrophages. Modifying vaccine systems with mannose can achieve targeted anti-tumor and antiviral functions. Summary of the Invention
[0006] The purpose of this invention is to provide a vaccine for the prevention and treatment of nocardiosis in fish, which has the advantages of being safe, environmentally friendly, and having a long-lasting effect in preventing and treating nocardiosis in amberjack.
[0007] The present invention provides vaccines for better prevention and control of nocardiac disease in fish, including recombinant protein vaccines, DNA vaccines, and targeted DNA vaccines for Nocardia.
[0008] To achieve the above objectives, the technical solution adopted in this invention is as follows: ATP-binding protein (abbreviated as ABP) of the ABC family on the membrane protein of Nocardia amurensis is selected as a candidate antigen, primers are designed according to the gene sequence of the candidate antigen, cloned into a vector, and recombinant plasmids are obtained. Recombinant protein vaccines, DNA vaccines and targeted DNA vaccines are prepared respectively.
[0009] This invention provides a method for preparing Nocardia auriculata vaccine, the method comprising: designing primers based on the gene sequence of ABP, cloning them into a vector to obtain prokaryotic expression recombinant plasmids and eukaryotic expression recombinant plasmids, culturing engineered strains containing prokaryotic expression recombinant plasmids, fermenting, disrupting, and purifying to obtain a recombinant protein vaccine; culturing engineered strains containing eukaryotic expression recombinant plasmids, extracting large quantities of endotoxin-free recombinant plasmids to obtain a DNA vaccine; and using eukaryotic recombinant plasmids encapsulated with mannosylchitosan as a targeted DNA vaccine.
[0010] The amino acid sequence of the ABP is shown in SEQ ID No: 6, and the nucleotide sequence of its encoding gene is shown in SEQ ID No: 5.
[0011] The present invention also provides recombinant protein vaccines, DNA vaccines and targeted DNA vaccines for nocardiosis prepared by the above preparation methods.
[0012] Furthermore, the present invention also provides the application of recombinant protein vaccines, DNA vaccines, and targeted DNA vaccines for the prevention and treatment of nocardiosis.
[0013] By implementing the technical solution of this invention, the following beneficial effects can be achieved: the recombinant protein vaccine, DNA vaccine, and targeted DNA vaccine for nocardiosis prepared by this invention have significant immunoprotective effects on sea bass and can effectively prevent nocardiosis infection. This vaccine is simple to operate, safe to use, and has significant protective effects. It is safe, environmentally friendly, and long-lasting in the prevention and control of nocardiosis in fish, and has good practical application value. Attached Figure Description
[0014] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings involved in the embodiments of the present invention will be briefly described below. Obviously, the listed drawings are only a part of the content of the embodiments of the present invention.
[0015] Figure 1The images show the electrophoresis results of PCR amplification of the Nocardia amberriformis ABP-binding protein gene E. coli BL21 / pET32a-ABP recombinant strain using specific ABP gene primers. Lane 1 shows the PCR amplification electrophoresis results of the recombinant plasmid pMD19T-ABP, and lane 2 shows the PCR amplification electrophoresis results of the recombinant strain E. coli BL21 / pET32a-ABP.
[0016] Figure 2 The results are obtained by gel electrophoresis of the recombinant plasmid pET32a-ABP double enzyme digestion products.
[0017] Figure 3 The images show the electrophoresis results of PCR amplification of the Nocardia amberriformis ABP-binding protein gene E. coli DH5α / pcDNA-ABP recombinant strain using specific ABP gene primers. Lane 1 shows the PCR amplification electrophoresis results of the recombinant plasmid pMD19T-ABP, and lane 2 shows the PCR amplification electrophoresis results of the recombinant strain E. coli DH5α / pcDNA-ABP.
[0018] Figure 4 The results are obtained by gel electrophoresis of the recombinant plasmid pcDNA-ABP double enzyme digestion products.
[0019] Figure 5 The results are from SDS-PAGE electrophoresis of recombinant proteins, with lane 2 showing the electrophoresis results of purified ABP.
[0020] Figure 6 To test the efficacy of the immune challenge protection test, the survival of the bass in each group is shown. The horizontal axis represents the time after infection, and the vertical axis represents the survival rate.
[0021] Figure 7 The average antibody levels in the serum of sea bass in each group were measured in the efficacy test-serological evaluation experiment. The horizontal axis represents the number of days post-immunization, and the vertical axis represents OD (oxidative stress). 450 . Detailed Implementation
[0022] To make the objectives, technical solutions, and technical effects of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the scope of protection of this invention.
[0023] Unless otherwise specified, the experimental methods used in the embodiments of this invention are conventional methods. Unless otherwise specified, the experimental materials used in the embodiments are commercially available.
[0024] Example 1: Construction and identification of recombinant Escherichia coli strain E. coli BL21 / pET32a-ABP
[0025] 1. ABP gene amplification
[0026] Following the instructions of the bacterial genome extraction kit (Shanghai Bioengineering Co., Ltd.), the genome of *Nocardia amberjack* was extracted from laboratory-cultured culture. The ABP-binding protein gene was amplified using primer pairs.
[0027] rABP-F: CCCAAGCTTCGATGACCGACCATGT (SEQ ID No: 1),
[0028] rABP-R: CCGCTCGAGTCATGCGGGATTCCGT (SEQ ID No: 2).
[0029] The nucleotide sequence of the ABP encoding gene is shown in SEQ ID No: 5. The PCR product was identified by agarose gel electrophoresis at 120V for 30 minutes. The electrophoresis product was excised, recovered, and purified using a gel extraction kit (Beyotime Biotechnology Research Institute). The purified product was ligated into the pMD19-T vector at 16℃ for 0.5 h. The recombinant product was named pMD19T-ABP. The recombinant plasmid pMD19T-ABP was transformed into Escherichia coli BL21 competent cells, and the plasmid was extracted for PCR amplification and sequencing identification. The sequencing results are shown in SEQ ID No: 5. Figure 1 As shown in lane 1. The target band size is over 800 bp, consistent with the expected ABP gene size of 822 bp.
[0030] 2. Construction of recombinant Escherichia coli expressing ABP (E. coli BL21 / pET32a-ABP)
[0031] Construction of the prokaryotic expression vector pET32a-ABP: The recombinant pMD19T-ABP plasmid was double-digested with HindIII and Xho I endonucleases (Takara Bio Engineering (Dalian) Co., Ltd.) and cloned into the corresponding restriction sites on the pET-32a expression vector to obtain the recombinant plasmid pET32a-ABP.
[0032] Transformation and screening of recombinant plasmid pET32a-ABP: The recombinant plasmid pET32a-ABP was transformed into E. coli BL21(DE3) and plated on LB agar containing ampicillin. The culture was incubated overnight at 37°C with the plasmid inverted position. Single colonies containing the ABP gene were then selected for PCR detection and identification. The PCR products were analyzed by 1% agarose gel electrophoresis, and the size of the target band was observed under a gel imaging system. Figure 1As shown in lane 2, the colony that matches the expected 822bp ABP gene is the recombinant E.coli BL21 / pET32a-ABP.
[0033] 3. Identification of recombinant plasmid pET32a-ABP
[0034] Colonies that were PCR positive (containing the pET32a-ABP recombinant plasmid) were inoculated into LB broth containing 100 μg / mL ampicillin and incubated at 37°C and 180 rpm for 12–16 hours. Plasmid extraction was performed according to the Omega plasmid extraction kit instructions. After determining the plasmid concentration, 8 μL of plasmid solution, 1 μL of 10× digestion buffer, and 0.5 μL each of restriction endonuclease were mixed and digested at 37°C for 5 minutes. The digestion products were detected by 1% agarose gel electrophoresis. The results are shown below. Figure 2 As shown, the recombinant plasmid was digested into two parts, one of which was more than 800 bp in size, consistent with the expected 822 bp ABP gene.
[0035] Example 2: Construction and identification of recombinant Escherichia coli DH5α / pcDNA-ABP
[0036] 1. ABP gene amplification
[0037] Following the instructions of the bacterial genome extraction kit, the genome of *Nocardia amberjack* was extracted from laboratory-cultured culture. The ABP-binding protein gene was amplified using primer pairs.
[0038] rABP-F: CCCAAGCTTTATGACCGACCATGT (SEQ ID No: 3),
[0039] rABP-R: CCGCTCGAGTCATGCGGGATTCCGT (SEQ ID No: 4).
[0040] The nucleotide sequence of the gene encoding the ABP-binding protein is shown in SEQ ID No: 5. The PCR product was identified by agarose gel electrophoresis at 120V for 30 minutes. The electrophoresis product was excised, recovered, and purified using a gel extraction kit. The purified product was ligated into the pMD19-T vector, and the recombinant product was named pMD19T-ABP. The transformants were transformed into Escherichia coli DH5α competent cells, and plasmids were extracted for PCR amplification and sequencing identification. The results are shown in SEQ ID No: 5. Figure 3 As shown in lane 1 of the image. The target band size is over 800 bp, consistent with the expected ABP gene size of 822 bp.
[0041] 2. Construction of recombinant Escherichia coli (E. coli DH5α / pcDNA-ABP) expressing ABP-binding protein
[0042] Construction of the eukaryotic expression vector pcDNA-ABP: The recombinant pMD19T-ABP plasmid was double-digested with Hind III and Xho I restriction enzymes (Takara Bio Engineering (Dalian) Co., Ltd.). The digestion conditions were 37℃ water bath for 0.5 h. The plasmid was then cloned into the corresponding restriction sites (Hind III and Xho I) on the pcDNA eukaryotic expression vector to obtain the recombinant plasmid pcDNA-ABP.
[0043] Transformation and screening of recombinant plasmid pcDNA-ABP: The recombinant plasmid pcDNA-ABP was transformed into E. coli DH5α, plated on LB agar medium containing ampicillin, and incubated overnight at 37°C. Single colonies were then picked for colony PCR identification. The PCR products were analyzed by 1% agarose gel electrophoresis, and the size of the target band was observed under a gel imaging system. Figure 3 As shown in lane 2, the target band size is over 800 bp, and the colony that matches the expected ABP gene size of 822 bp is the recombinant E. coli DH5α / pcDNA-ABP.
[0044] 3. Identification of recombinant plasmid pcDNA-ABP
[0045] E. coli DH5α containing the pcDNA-ABP recombinant plasmid was inoculated into LB medium containing 100 μg / mL ampicillin and cultured at 37°C and 180 rpm for 12–16 hours. Plasmid extraction was performed according to the Omega plasmid extraction kit instructions. After determining the plasmid concentration, 8 μL of plasmid solution, 1 μL of 10× digestion buffer, and 0.5 μL each of restriction endonuclease were mixed and digested at 37°C for 5 minutes. The digestion products were detected by 1% agarose gel electrophoresis. The results are shown below. Figure 4 As shown, the enzyme digestion result is consistent with the expected 822bp.
[0046] Example 3: Preparation of Recombinant Protein Vaccine
[0047] 1. Inducible expression of recombinant E. coli BL21 / pET32a-ABP
[0048] A small amount of the production strain *E. coli* BL21 was picked up using an inoculation loop and streaked onto an LB solid medium plate. After static incubation at 37°C for 12–16 hours, a single colony was picked and inoculated into LB liquid medium. The culture was then incubated at 37°C and 180 rpm for 12–16 hours as the primary seed culture. The primary seed culture was then inoculated at 1% (v / v) into LB liquid medium and incubated at 37°C and 180 rpm for 12–16 hours as the secondary seed culture. The secondary seed culture was then inoculated at 1% (v / v) into modified LB medium, with ampicillin added to a final concentration of 100 μg / mL. Fermentation was carried out at 37°C with aeration for 5–7 hours at dissolved oxygen levels of 30%–40%, until the OD of the bacterial culture was reached. 600 When the value is 1.1~1.3, add IPTG (isopropyl-β-D-thiogalactoside) to a final concentration of 0.001 mol / L, induce culture at 37℃ for 6 hours, and then stop fermentation.
[0049] 2. Bacterial solution treatment and ultrasonic disruption
[0050] Fermentation products were centrifuged at 12000 rpm at room temperature using a tubular centrifuge to collect bacterial cells. The cells were washed twice with 0.015 mol / L PBS solution (pH 7.2). The collected cells were resuspended in 0.015 mol / L PBS solution (pH 7.2) at a 1:9 mass-to-volume ratio. The bacteria were then homogenized using a high-pressure homogenizer at 2–8 °C. After passing the bacteria through the homogenizer twice, a smear of the homogenized bacterial solution was prepared and stained with 0.1% crystal violet solution for 0.5 minutes. Observation was performed under a microscope in 3–5 fields of view. Complete disruption was indicated by cell fragmentation, with no intact bacterial cells visible in the field of view. The disruption was continued until the bacterial disruption rate no longer changed. The precipitate of the disrupted bacterial cells was then collected by centrifugation at 12000 rpm at room temperature.
[0051] 3. Protein purification
[0052] Dissolve each gram of protein precipitate in 10 mL of dissolving buffer (5 mmol / L imidazole, 0.5 mmol / L sodium chloride, 8 mol / L urea, 20 mmol / L Tirs-HCl, pH 7.9). After dissolving for 2 hours at room temperature with shaking at 200 rpm, centrifuge at 10,000 rpm for 30 minutes at 4°C and collect the supernatant. Equilibrate the Ni-integral affinity chromatography column thoroughly with equilibration buffer (5 mmol / L imidazole, 0.5 mmol / L sodium chloride, 8 mol / L urea, 20 mmol / L Tirs-HCl, pH 7.9), load the sample at twice the column volume, equilibrate again with equilibration buffer, and then elute with elution buffer (0.5 mol / L imidazole, 0.5 mmol / L sodium chloride, 8 mol / L urea, 20 mmol / L Tirs-HCl, pH 7.9) and collect the protein. 200 mL of purified protein (liquid state) was placed in a SnakeSkin T dialysis bag (10K MWCO) and directly immersed in 10 L of refolding solution (150 mM NaCl, 2.5 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 1% Tween-20, 10 mM β-cyclodextrin, 1 M cysteine, 3 mM reduced glutathione and 1 mM oxidized glutathione, pH 7.9). Dialyzed at 4 °C for 12 h, with the solution changed every 6 h. After dialysis, the dialyzed protein solution was collected and stored at 4 °C for later use.
[0053] 4. Endotoxin removal
[0054] Add Triton X-114 to the dialyzed protein solution to a final concentration of 1.5% (referring to the concentration of Triton X-114), and stir at 4°C for 1 hour. After treatment, restore the sample temperature to 30°C and maintain for 40 minutes. Centrifuge at 17000 rpm to remove the precipitate and collect the supernatant. Repeat the above method for removing endotoxins three times.
[0055] 5. Detection of recombinant proteins
[0056] SDS-PAGE: After ultrasonic disruption of the bacterial culture, add an equal volume of 2× gel loading buffer (SDS-PAGE protein loading buffer) to the disrupted solution; separately, add an equal volume of purified ABP directly to the 2× gel loading buffer. Boil both mixtures for 10 minutes, then perform SDS-PAGE electrophoresis. The acrylamide concentration in the separating gel is 15%. Stain with Coomassie Brilliant Blue, and destain until the bands are clear. Results are as follows: Figure 5 As shown, lane 2 is the purified ABP, and the size of the expressed target protein is more than 40 kDa, which is consistent with expectations.
[0057] 6. Determination of protein concentration
[0058] The purified ABP was dissolved in PBS solution, and the protein concentration was determined by BCA kit (Nanjing Jiancheng Bioengineering Institute). The solution was then diluted to 1 mg / mL for subsequent prevention and treatment of nocardiosis in fish.
[0059] Example 4: Preparation of DNA Vaccine
[0060] The eukaryotic recombinant expression vector bacterium pcDNA-ABP / DH5α (i.e., E. coli DH5α / pcDNA-ABP) and the empty plasmid bacterium pcDNA / DH5α were inoculated into LB liquid medium containing 100 μg / mL ampicillin and cultured at 37℃ with shaking at 200 rpm for 8-10 h until the bacterial concentration OD500 was determined. 600 When the pH reaches 1.5-2.0, stop shaking. Add the bacterial culture to a 50 mL centrifuge tube and centrifuge at 8000 rpm for 5 min to collect the bacterial cells (repeat the centrifugation operation once). Use the EZNA@Fastfiler Endo-free Plasmid Maxiprep kit to extract large quantities of endotoxin-free eukaryotic expression recombinant plasmids; refer to the kit instructions for specific procedures. Dilute the endotoxin-free plasmid to a concentration of 600 μg / mL for subsequent prevention and control of nocardiosis in fish.
[0061] Example 5: Preparation of a Targeted DNA Vaccine
[0062] The eukaryotic recombinant plasmid (pcDNA-ABP) was dissolved in 5 mM Na2SO4 to a concentration of 1200 μg / mL. Laboratory-prepared mannosyl-modified chitosan (MCS) (preparation process: 1.9 g chitosan was dissolved in 475 ml of water, then 1% glacial acetic acid (1 ml acetic acid) was added, followed by 5 g sodium hydroxide in 250 ml of water. After adjusting the pH to 6.2 with sodium hydroxide, 0.5 g mannose was added, and the mixture was stirred for 24 h. Afterwards, it was centrifuged, washed, dialyzed, and then lyophilized.) was dissolved in 5 mM NaAC-HAc to a concentration of 0.02%. The mixture of the 1200 μg / mL eukaryotic recombinant plasmid and the 0.02% MCS solution was vigorously shaken for 30 seconds in a 55°C water bath to obtain the targeted DNA vaccine.
[0063] Example 6: Evaluation of vaccine immunoprotective efficacy
[0064] 1. Efficacy testing - protection against immune challenge
[0065] Three hundred healthy sea bass aged 60 days or older, weighing 1.0-1.2g, were divided into five groups of 60 fish each: a PBS control group (PBS), a pcDNA control group (pcDNA), a recombinant protein vaccine group (ABP), a DNA vaccine group (pcDNA-ABP), and a targeted DNA vaccine group (MCS-pcDNA-ABP). The recombinant protein vaccine, DNA vaccine, and targeted DNA vaccine were prepared according to Examples 3, 4, and 5, respectively. The vaccine dose for the recombinant protein vaccine group was 10 μg / fish, while the vaccine dose for the DNA vaccine group and the targeted DNA vaccine group was 20 μg / fish. Control groups were set up for each group; the control group for the recombinant protein vaccine group was the PBS control group, and the control group for the DNA vaccine group was the pcDNA control group. All control groups received the same dose of control reagent. The immunization method for the PBS control group and the recombinant protein vaccine group was intraperitoneal injection, while the immunization method for the pcDNA control group, the DNA vaccine group, and the targeted DNA vaccine group was intramuscular injection into the dorsal fin. After 28 days of continuous observation, the fish were challenged with Nocardia bacteria via intraperitoneal injection at 100 μL (7500 CFU / mL) / fish. Following the viral challenge, the fish were observed for 14 consecutive days, with regular checks and records of disease progression. Dead bass were promptly dissected. The survival status of the bass in each group is shown in the table below. Figure 6 .
[0066] Depend on Figure 6 It can be seen that the survival rate of sea bass was greater than 50% 14 days after injection and challenge in the ABP group, pcDNA-ABP group, and MCS-pcDNA-ABP group, which was significantly better than that in the PBS group and pcDNA group, proving that all three vaccines can give sea bass good immunity against Nocardia.
[0067] 2. Potency testing - serological evaluation
[0068] Two hundred and fifty healthy bass were randomly divided into five groups: a PBS control group (PBS), a pcDNA control group (pcDNA), a recombinant protein vaccine group (ABP), a DNA vaccine group (pcDNA-ABP), and a targeted DNA vaccine group (MCS-pcDNA-ABP). All bass were immunized by injection (the PBS control group and the recombinant protein vaccine group were immunized by intraperitoneal injection, while the pcDNA control group, the DNA vaccine group, and the targeted DNA vaccine group were immunized by intramuscular injection into the dorsal fin). The vaccinated bass were then transferred to different tanks and tested daily. In each group, three fish were randomly selected weekly for sampling and plasma preparation, continuing until the fourth week (28 days). The plasma was stored at -20°C. Serum diluted with PBS containing 3% skim milk was used as the primary antibody and incubated at 37°C for 1.5 hours. Using purified ABP-binding protein (containing his-tag) as the antigen, and mouse anti-6×His-labeled antibody diluted 1:1500 and goat-mouse IgG antibody, with TMB as the colorimetric substrate, the OD was measured. 450 The average level of antibodies in the serum was analyzed. Specific results are as follows: Figure 7 As shown.
[0069] Depend on Figure 7 It can be seen that the OD values of the ABP group, pcDNA-ABP group, and MCS-pcDNA-ABP group 28 days after immunization were... 450 The values were all greater than 0.5, and significantly better than those of the PBS group and the pcDNA group, proving that all three vaccines induced antibody production in the serum of bass and maintained it at a high level.
[0070] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered illustrative and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention, and no reference numerals in the claims should be construed as limiting the scope of the claims.
[0071] sequence list
[0072] SEQ ID No: 1 CCCAAGCTTCGATGACCGACCATGT
[0073] SEQ ID No: 2 CCGCTCGAGTCATGCGGGATTCCGT
[0074] SEQ ID No: 3 CCCAAGCTTTATGACCGACCATGT
[0075] SEQ ID No:4 CCGCTCGAGTCATGCGGGATTCCGT
[0076] SEQ ID No:5
[0077] tcatgcggga ttccgttccg gttcacgttc acgttccaga tcccgcagca cctgcgccac 60
[0078] gtgatcaccc gcctccgggc cctcgtaggc tcgcacgact tcctctattc caccgtgcat 120
[0079] ccgcacgttg ccgtggtcga tccagagagc ggaatcacac aattgcgcca ggaactcatt 180
[0080] ggaatgcgag gcgaacacca gcagaccgga gcgggacacc aattcctgca accgggttcg 240
[0081] cgccttcttc atgaactccg cgtcgaccgc gccgatgccc tcgtcgagca gcaggatctc 300
[0082] cggatcgatg gaggtcacca cgcccatggc cagccgcacc cgcatgccgg tggaataggt 360
[0083] gcgcagcggc atttccaaat agtcgccgag ctcggtgaat tcagcgatct catcgatcgt 420
[0084] ggcgagcatc tgcttgcggg tctgcccgag gaacagaccg cgaatgatga tgttgtcgta 480
[0085] gccggagatc tccggatcca tgccgacacc gagatcgaag accggcgcga cgcgtccgcg 540
[0086] aatccgcgcg ctgccgcggg tgggttcgta aatgcccgaa agcaggcgca gcagtgtcga 600
[0087] tttgcccgcg ccattgtggc cgaccaggcc gacccgatcg ccttccttga gcgacagatt 660
[0088] gatgtcgcgc agcgcctcga ccaccaccac gtcggattgg ttgcggccga tggcaccgcc 720
[0089] cgccttgccc atgaacgcct tcttcagcga acgggacttg gcgtcgaaga tcgggaactc 780
[0090] cacccacgcg ttctgggttt cgatactcac atggtcggtc at 822
[0091] SEQ ID No: 6
[0092] Met Thr Asp His Val Ser Ile Glu Thr Gln Asn Ala Trp Val Glu Phe ProIle
[0093] Phe Asp Ala Lys Ser Arg Ser Leu Lys Lys Ala Phe Met Gly Lys Ala GlyGly
[0094] Ala Ile Gly Arg Asn Gln Ser Asp Val Val Val Val Glu Ala Leu Arg AspIle
[0095] Asn Leu Ser Leu Ly sGlu Gly Asp Arg Val Gly Leu Val Gly His Asn GlyAla
[0096] Gly Lys Ser Thr Leu Leu Arg Leu Leu Ser Gly Ile Tyr Glu Pro Thr ArgGly
[0097] Ser Ala Arg Ile Arg Gly Arg Val Ala Pro Val Phe Asp Leu Gly Val GlyMet
[0098] Asp Pro Glu Ile Ser Gly Tyr Asp Asn Ile Ile Ile Arg Gly Leu Phe LeuGly
[0099] Gln Thr Arg Lys Gln Met Leu Ala Thr Ile Asp Glu Ile Ala Glu Phe ThrGlu
[0100] Leu Gly Asp Tyr Leu Glu Met Pro Leu Arg Thr Tyr Ser Thr Gly Met ArgVal
[0101] Arg Leu Ala Met Gly Val Val Thr Ser Ile Asp Pro Glu Ile Leu Leu LeuAsp
[0102] Glu Gly Ile Gly Ala Val Asp Ala Glu Phe Met Lys Lys Ala Arg Thr ArgLeu
[0103] Gln Glu Leu Val Ser Arg Ser Gly Leu Leu Val Phe Ala Ser His Ser AsnGlu
[0104] Phe Leu Ala Gln Leu Cys Asp Ser Ala Leu Trp Ile Asp His Gly Asn ValArg
[0105] Met His Gly Gly Ile Glu Glu Val Val Arg Ala Tyr Glu Gly Pro Glu AlaGly
[0106] Asp His Val Ala Gln Val Leu Arg Asp Leu Glu Arg Glu Arg Glu Pro GluArg
[0107] Asn Pro Ala。
Claims
1. A method for preparing a Nocardia auriculata vaccine, characterized in that, The Nocardia auriculata vaccine uses an ATP-binding protein of the ABC family on the Nocardia auriculata membrane protein as a candidate antigen. The amino acid sequence of the candidate antigen is shown in SEQ ID No:
6. Primers are designed based on the gene sequence of the candidate antigen, and the protein is cloned into a vector to obtain a recombinant plasmid.
2. The method for preparing Nocardia auriculata vaccine according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the ATP-binding protein of the ABC family on the Nocardia purpurea membrane protein is shown in SEQ ID No:
5.
3. The method for preparing Nocardia auriculata vaccine according to claim 1, characterized in that, The plasmid is a prokaryotic expression recombinant plasmid. By culturing an engineered bacterial strain containing the plasmid, a recombinant protein vaccine of Nocardia auriculata can be obtained.
4. The method for preparing Nocardia auriculata vaccine according to claim 1, characterized in that, The plasmid is a eukaryotic expression recombinant plasmid. The plasmid is extracted to obtain a Nocardia auriculata DNA vaccine.
5. The method for preparing Nocardia auriculata vaccine according to claim 4, characterized in that, The eukaryotic recombinant plasmid was encapsulated with mannosaccharified chitosan to obtain a Nocardia piraceae targeted DNA vaccine.
6. A Nocardia auriculata vaccine, characterized in that, It is obtained by the preparation method described in any one of claims 1-5.
7. The use of the Nocardia auriculata vaccine of claim 5 in the preparation of products for the prevention and treatment of diseases caused by Nocardia auriculata.