Trim66 protein polyclonal antibody, preparation and application thereof

Abstract

The present application relates to an antigen polypeptide for preparing a TRIM66 protein polyclonal antibody and a TRIM66 protein polyclonal antibody prepared by the antigen polypeptide. The present application also provides a method for preparing a TRIM66 protein polyclonal antibody and application of the prepared TRIM66 protein polyclonal antibody.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology. More specifically, this invention relates to a TRIM66 protein polyclonal antibody and its applications. Background Technology

[0002] Embryonic stem cells (ESCs) derived from the inner cell mass (ICM) retain the ability to differentiate into cell types from all three germ layers. TRIM66 (also known as TIF1δ, transcription intermediate factor 1δ) is a TIF1 family protein with an N-terminal region containing a RING, B-box, and coil-coil domain, and a PHD finger preceding the C-terminal bromodomain. TRIM66 protein is highly expressed in ESCs and is significantly downregulated during differentiation. Knockout or knockdown of the TRIM66 gene in ESCs induces significant DNA damage and genomic instability, and mouse blastocysts with TRIM66 gene deletion also exhibit high levels of DNA damage and genomic instability.

[0003] Mouse embryonic stem cells (mESCs) are an important research model for studying mouse embryonic development. Detecting the expression of TRIM66 in mESCs requires specific and highly sensitive antibodies against mouse TRIM66. Such antibody detection is undoubtedly important for understanding the molecular mechanisms of TRIM66 in DNA damage repair and genome stability maintenance in ESCs. Summary of the Invention

[0004] By combining theoretical research and experimental methods, the inventors analyzed the sequence of mouse TRIM66 protein, selected polypeptide fragments of different structural domains for animal immunization, and screened out specific antigen polypeptides that can be used to produce specific and highly sensitive polyclonal antibodies that can successfully detect TRIM66 protein in mESC, thus completing this invention.

[0005] Specifically, this invention relates to an antigenic polypeptide for preparing a TRIM66 protein polyclonal antibody and the TRIM66 protein polyclonal antibody prepared from the antigenic polypeptide. This invention also provides a method for preparing a TRIM66 protein polyclonal antibody and the application of the prepared TRIM66 protein polyclonal antibody.

[0006] According to one aspect of the present invention, an antigenic polypeptide is provided, which comprises or is composed of the following amino acid sequence: TSGEETPHSVPPVDGTSQHSSPNVVRK (SEQ ID NO:1).

[0007] In one embodiment, the antigenic polypeptide of the present invention can be used to prepare a polyclonal antibody against TRIM66 protein, preferably a mouse TRIM66 protein polyclonal antibody.

[0008] In another embodiment, the nucleotide sequence encoding the antigenic polypeptide is as follows: ACATCTGGGGAGGAAACGCCTCACAGTGTCCCTCCAGTGGATGGCA CCTCCCAGCACTCTTCTCCAAATGTGGTGAGAAAG (SEQ ID NO:2).

[0009] In another preferred embodiment, the antigenic polypeptide further comprises an immune tag coupled to SEQ ID NO:1, preferably keyhole hemocyanin (KLH).

[0010] According to another aspect of the present invention, a TRIM66 protein polyclonal antibody, preferably a mouse TRIM66 protein polyclonal antibody, is provided, which is prepared using the antigenic polypeptide according to the above description.

[0011] In one embodiment, the TRIM66 protein polyclonal antibody of the present invention is obtained by immunizing an animal with an antigenic polypeptide according to any one of claims 1 to 4 above, preferably a mammal, more preferably a rabbit, and even more preferably a New Zealand white rabbit.

[0012] According to another aspect of the present invention, a method for preparing a TRIM66 protein polyclonal antibody is provided, comprising: immunizing an animal with an antigenic polypeptide according to the above-described method, and recovering and / or purifying the TRIM66 protein polyclonal antibody from the serum of the animal.

[0013] In one embodiment, in the method for preparing a polyclonal antibody against TRIM66 protein according to the present invention, the animal is a mammal, more preferably a rabbit, and even more preferably a New Zealand white rabbit; and / or the immunization is a multiple immunization, more preferably a booster immunization on day 14 after the primary immunization, with a booster immunization interval of 10 days and an immunization dose of 500 μg / animal per dose.

[0014] In one embodiment, the method for preparing a polyclonal antibody against the TRIM66 protein according to the present invention further includes detecting the antibody, preferably by Western blotting. Attached Figure Description

[0015] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, wherein:

[0016] Figure 1 Immunoblotting results showed the expression of TRIM66 in Trim66 KO, Trim66 WT, and Trim66 OE (overexpression) mESCs; and

[0017] Figure 2Western blot results show the expression of TRIM66 in GFP-TRIM66 OE mESCs (sample concentration decreased 4-fold in a gradient), with arrows indicating GFP-TRIM66 and TRIM66 proteins; and

[0018] Figure 3 Immunoblotting results show the expression of TRIM66 in GFP and GFP-TRIM66 OE mESC, with asterisks indicating GFP-TRIM66 protein. Detailed Implementation

[0019] Unless otherwise stated, the terms used herein have their general technical meanings as understood by those skilled in the art. For definitions and terms in this field, those skilled in the art are particularly recommended to refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).

[0020] The invention is further illustrated in the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the invention. All chemicals used in the following reactions are commercially available products unless otherwise specified.

[0021] Example 1: Preparation of polyclonal antibody against mouse TRIM66 protein

[0022] The full-length amino acid sequence of the mouse TRIM66 protein is as follows (GenBank Accession No. MGI:2152406):

[0023]

[0024]

[0025] By combining theoretical research and experimental methods, the inventors analyzed the sequence of mouse TRIM66 protein and selected polypeptide fragments of different structural domains for animal immunization to screen for specific antigen polypeptides that can be used to produce specific and highly sensitive polyclonal antibodies capable of successfully detecting TRIM66 protein in mESC.

[0026] After initial screening, the inventors prepared two peptides (both conserved in three mouse isotypes) to generate antibodies: 1) TSGEETPHSVPPVDGTSQHSSPNVVRK; 2) TEEHRHVPAPGGPLFARAQ. However, final experimental verification showed that only the antibody prepared from peptide 1) was usable; the antibody prepared from peptide 2 was ineffective.

[0027] The antigenic polypeptide selected for inducing polyclonal antibodies against mouse TRIM66 protein was named TRIM66-p, and it consists of the following amino acid sequence:

[0028] TSGEETPHSVPPVDGTSQHSSPNVVRK (SEQ ID NO: 1).

[0029] After synthesis (Jier Biochemical Co., Ltd. (Shanghai)), the above-mentioned polypeptides were purified by SDS-PAGE electrophoresis with a purity of ≥90% and conjugated with keyhole hemocyanin (KLH).

[0030] Rabbit polyclonal antibodies were prepared by immunizing adult female New Zealand white rabbits (adult weight 2-2.5 kg, provided by the Animal Resource Center of Beijing Institute of Life Sciences) with the "peptide-KLH" fusion protein. A booster immunization was performed on day 14 after the primary immunization, with a booster interval of 10 days. The immunization dose was 500 μg / rabbit per dose. Serum was generally collected after the third booster immunization. Preparation was entrusted to the NIBs Antibody Center. Polyclonal antibody specificity was validated using purified mouse TRIM66 protein. Based on the validation results, the optimal antiserum was selected for purification, yielding approximately 1.0 mg of antibody.

[0031] Since the antigenic polypeptide sequence used in this invention exists in all three isotypes of mouse TRIM66 protein in China, it is expected that the polyclonal antibody prepared from it can target the three isotypes of mouse TRIM66 protein and be used for related detection.

[0032] Example 2: Using a polyclonal antibody against mouse TRIM66 protein, the expression of TRIM66 in mouse embryonic stem cells (mESCs) was detected by Western blotting.

[0033] The specific steps are as follows:

[0034] 1. Cell line (mESC cell line E14Tg2a.IV, ATCC CRL-1821, purchased from ATCC); https: / / www.atcc.org:443 ; Trim66For the construction of KO (knock out), Trim66 WT (wild type), and Trim66 OE (overexpression) mESCs and GFP-TRIM66 OE ESCs, see Feifei Zuo et al., A TRIM66 / DAX1 / Dux axis suppresses the total 2-cell-like state in murine embryonic stem cells, Cell Stem Cell, VOLUME 29, ISSUE 6, pp. 948-961, JUNE 02, 2022). Collection: Cells were counted the day before collection to ensure a consistent total cell count (approximately 2.5 x 10⁻⁶). 6 (cells), when collecting cells, after aspirating the culture medium, wash once with pre-cooled PBS buffer, and then add 150 μL of 1xSDS loading buffer directly to the adherent cells to lyse the sample. The sample containing SDS loading buffer needs to be placed at 100℃ for 10 min to allow the protein to denature fully.

[0035] 2. Protein electrophoresis and separation: Prepare discontinuous SDS-polyacrylamide gels, and prepare 8% separating gel and 5% concentrated separating gel with a concentration of 8% and stacking gel with a concentration of 4%. Add 25 μL of sample lysis buffer to the sample wells. Electrophoresis conditions are 80V constant voltage for about 20 min, then change to 140V constant voltage. The electrophoresis time is determined by pre-stained protein markers to separate the target protein.

[0036] 3. Protein transfer: The protein in the gel was transferred to a methanol-activated PVDF membrane using the wet transfer method in the transfer buffer. The electrophoresis conditions were 300mA constant current for 150min.

[0037] 4. Blocking: The PVDF membrane after transfer was placed in a TBST solution containing 5% skim milk powder (150mM NaCl, 50mM Tris-HCl pH7.5, 0.1% Tween-20) and incubated on a horizontal shaker at room temperature for 1 hour to block the non-specific binding sites on the membrane.

[0038] 5. Antibody incubation: After blocking, add the mouse TRIM66 antibody of the present invention diluted with blocking buffer (1:500) and incubate overnight at 4°C on a horizontal shaker; after washing the membrane the next day, add horseradish peroxidase-labeled goat anti-rabbit IgG (H+L) antibody (Huaxingbio) and incubate at room temperature on a horizontal shaker for 1 hour.

[0039] 6. Protein color development: After washing the membrane, add ECL (chemiluminescent solution, Thermofisher, Cat#34095) and react for 3-5 minutes. Then expose for color development, fix the image, and scan the film.

[0040] See results Figure 1 and Figure 2 .

[0041] The above experimental results clearly demonstrate that the mouse TRIM66 protein polyclonal antibody prepared in this invention has excellent specificity (recognizing Trim66 WT mESCs, but not Trim66 KO mESCs) Figure 1 Furthermore, it can recognize GFP-TRIM66OE ESCs. Figure 2 This allows for successful application to the specific detection of TRIM66 and GFP-TRIM66 in mESCs.

[0042] The amino acid sequence of the GFP-TRIM66 protein is as follows:

[0043]

[0044]

[0045] Example 3: Application of mouse TRIM66 protein polyclonal antibody in the study of early mouse embryonic development and pluripotent stem cells.

[0046] In mice, zygotic genome activation (ZGA) occurs during the 2-cell stage of early embryonic development, a stage where any events related to gene transcriptional regulation are crucial for overall embryonic development. Interestingly, a small subset of mouse embryonic stem cells (mESCs) transiently expresses transcripts including the Zscan4 gene cluster and the endogenous retrovirus (ERV) MERVL, demonstrating the similarity of these cells to mouse 2-cell embryonic blastomeres. Therefore, these cells were named 2-cell-like cells (2CLCs) and used to investigate the mechanisms of zygotic genome activation under in vitro culture conditions. 2CLCs comprise only about 1% of the total number of cells in mESCs. However, the mechanisms underlying their generation remain not fully understood.

[0047] TRIM66 was found to be an important inhibitor of 2CLCs. This was achieved by using the mouse TRIM66 protein polyclonal antibody of the present invention (see [link to invention]). Figure 3Because it can specifically detect the GFP-TRIM66 fusion protein in mESCs, the expression of TRIM66 protein and the GFP-TRIM66 fusion protein can be identified by immunoblotting. Combined with high-throughput sequencing analysis, mass spectrometry, and structural biology, the inventors revealed the molecular mechanism by which TRIM66 regulates the number of 2CLCs by recognizing histone modifications H3K4-K9me3-K18ac and forming a complex with DAX1 protein, thereby inhibiting DUX, an important regulator in ZGA activation. This study, by discovering the TRIM66 / DAX1 / Dux mechanism that inhibits the transformation of mESCs into 2CLCs, provides new insights for the research and practical application of early embryonic development and pluripotent stem cells. For more experimental details and results, see: Feifei Zuo et al., A TRIM66 / DAX1 / Dux axis suppresses the totipotent 2-cell-like state in murine embryonic stem cells, Cell Stem Cell, VOLUME29, ISSUE 6, P948-961, JUNE 02, 2022.

[0048] This embodiment demonstrates that the mouse TRIM66 protein polyclonal antibody of the present invention can be widely used as a research tool for the detection of TRIM66 protein in early mouse embryonic development and pluripotent stem cell research.

[0049] Those skilled in the art should understand that although the present invention has been specifically described with reference to the above embodiments, the present invention is not limited to these specific embodiments. Based on the methods and technical solutions taught in this invention, those skilled in the art can make appropriate modifications or improvements without departing from the spirit of the present invention, and the equivalent embodiments obtained therefrom are all within the scope of the present invention.

Claims

1. An antigenic polypeptide comprising the following amino acid sequence: SEQ ID NO: 1: TSGEETPHSVPPVDGTSQHSSPNVVRK.

2. The antigenic polypeptide according to claim 1 can be used to prepare a polyclonal antibody against mouse TRIM66 protein.

3. The antigenic polypeptide according to claim 1 or 2, wherein the nucleotide sequence encoding the antigenic polypeptide is as follows: SEQ ID NO: 2:ACATCTGGGGAGGAAACGCCTCACAGTGTCCCTCCAGTGGATGGCACCTCCCAGCACTCTTCTCCAAATGTGGTGAGAAAG.

4. The antigenic polypeptide according to claim 1 or 2, wherein the antigenic polypeptide further comprises an immune tag coupled to SEQ ID NO:

1.

5. The antigenic polypeptide according to claim 4, wherein the immune tag is keyhole hemocyanin.

6. A mouse TRIM66 protein polyclonal antibody, which is prepared using an antigenic polypeptide according to any one of claims 1 to 5.

7. The mouse TRIM66 protein polyclonal antibody according to claim 6, which is obtained by immunizing an animal with the antigenic polypeptide according to any one of claims 1 to 5, wherein the animal is a rabbit.

8. The mouse TRIM66 protein polyclonal antibody according to claim 7, wherein the animal is a New Zealand white rabbit.

9. The use of the mouse TRIM66 protein polyclonal antibody according to any one of claims 6-8 in the preparation of reagents for detecting mouse TRIM66 protein.

10. A method of preparing polyclonal antibodies against murine TRIM66 protein, comprising: An animal is immunized with the antigenic polypeptide according to any one of claims 1 to 5, and the mouse TRIM66 protein polyclonal antibody is recovered and / or purified from the serum of the animal, wherein the animal is a rabbit.

11. The method of claim 10, wherein the animal is a New Zealand white rabbit.

12. The method of claim 10, wherein the immunization is a series of immunizations.

13. The method according to claim 12, wherein a booster immunization is performed on the 14th day after the initial immunization, the interval between booster immunizations is 10 days, and the immunization dose is 500 μg / animal.

14. The method according to any one of claims 10-13, further comprising detecting the antibody.

15. The method of claim 14, wherein the detection method is Western blot hybridization.

Images