Construction of a double gene deletion attenuated african swine fever virus strain and its application as a vaccine
By combining the deletion of MGF505-7R and I267L genes in the ASFV CN/GS 2018 virus strain, an attenuated African swine fever virus strain was constructed using homologous recombination technology. This solved the problems of insufficient safety and immune protection of existing vaccines, and achieved non-pathogenicity and effective immune protection at high doses.
Patent Information
- Application Number
- CN202310299205.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-24
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2043-03-24
AI Technical Summary
Existing African swine fever vaccines have shortcomings in terms of safety and immune protection efficacy. In particular, inactivated vaccines cannot provide effective immune protection, subunit vaccines have insufficient antigens, and gene deletion vaccines may result in low viral titers or pathogenic residues after multiple gene deletions. Existing gene knockout strategies have inconsistent effects and their safety needs to be verified.
By combining the nucleotide sequences of the MGF505-7R and I267L genes deleted in the African swine fever virus strain ASFV CN/GS 2018, an attenuated virus strain was constructed using homologous recombination technology. This prevented the expression of the proteins encoded by these two genes, thereby achieving an attenuated effect. The strain was then used to provide protection to pigs by intramuscular injection.
The constructed attenuated African swine fever virus strain is non-pathogenic at high doses, provides effective immune protection against the ASFV CN/GS/2018 isolate, and is suitable as a safe and effective vaccine candidate strain, significantly reducing the pathogenicity of the virus.
Smart Images

Figure CN116286686B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to the construction of a recombinant attenuated African swine fever virus strain Δ7R / I267L and its application as a vaccine. Background Technology
[0002] African swine fever (ASF) is an acute and highly contagious disease caused by the African swine fever virus (ASFV), characterized by fever and hemorrhage in internal organs of pigs, with a mortality rate as high as 100% in domestic pigs. The disease first broke out in Kenya in 1921 and subsequently spread widely among domestic and wild pigs throughout Africa. It entered Europe in the 1950s, and it took 40 years to eradicate the disease there. However, the disease re-emerged in Georgia from East Africa in 2007, subsequently spreading widely in Eastern Europe, and in 2017 it entered Irkutsk in the Russian Far East. Currently, there is no commercially available effective vaccine. Once an ASF outbreak occurs, it can only be controlled through culling, but this method not only results in economic losses but also cannot meet the needs of large-scale pig farming in my country. Therefore, vaccines, as the most effective and economical means of preventing and controlling viral infectious diseases, are crucial for the prevention and control of ASF under my country's large-scale pig farming model. However, African swine fever virus (ASFV) has a complex structure and a large genome, with most of its functions unknown. Its infection and pathogenesis mechanisms are unclear, and theoretical understanding of vaccine creation is limited. It has been prevalent for over a century, and currently only the Vietnamese government has approved the commercial application of a gene-deleted attenuated vaccine, but its safety and other information still require further verification.
[0003] Currently, there are three main methods for preparing African swine fever (ASF) vaccines: First, directly inactivating the original ASF virus to obtain an inactivated vaccine; second, screening for viral proteins that effectively induce an immune response, and then preparing subunit vaccines and live vector vaccines; and third, using gene deletion techniques to knock out virulence genes to obtain recombinant viral vaccines. The first method is the most common and direct approach to preparing viral vaccines. However, because the ASF virus encodes proteins that induce immunosuppression, immune tolerance, and antibody-dependent enhancement (ADE), inactivated vaccines cannot provide effective immune protection in immunized pigs. Secondly, the ASF virus has a complex structure, and the proteins that induce an immune response are not yet fully understood; the obtained antigens are insufficient to induce strong immune protection. The most promising vaccine for breakthrough development is the gene knockout vaccine. By knocking out virulence-related genes such as those involved in immunosuppression, tolerance, and ADE, candidate vaccine strains that possess both immunogenicity and reduced pathogenicity can be obtained, providing immune protection to immunized pigs.
[0004] When knocking out the virulence gene of swine fever virus, it is often necessary to consider the immune response and protection of pigs, as well as pathogenicity and safety. However, the following factors are also considered in the existing swine fever virus virulence gene knockout vaccine: (1) Whether the knocked-out virulence gene reduces the virus carriers and shedding, whether it causes tissue damage and affects production performance, etc., are important indicators of biosafety and also important indicators of the continuous improvement of the safety of gene deletion vaccines; (2) Different strains produce different effects from the deletion of the same gene, and insufficient deletion may result in residual virulence and pathogenicity; and the low viral titer caused by the deletion of multiple genes may also reduce the immunogenicity or protective effect of attenuated strains; (3) Although the whole genome sequencing of African swine fever has been completed, there are as many as 160 regulatory and structural genes that make up the African swine fever virus. Although the project is huge, the function of regulatory and structural genes is crucial to its pathogenic mechanism and vaccine development; (4) The selection of the combined knockout of virulence genes is crucial, and different selections will produce different or even opposite immune protection effects.
[0005] Therefore, although knocking out virulence genes is a strategy for constructing attenuated African swine fever (ASF) strains, knocking out the same gene in different viruses can lead to significant differences in efficacy. Furthermore, the selection of virulence genes is crucial in combined knockout processes; not all combined knockouts of virulence genes will achieve attenuation and protection. For example, ① knocking out the NL gene (i.e., the DP71L gene) in different types of ASF viruses yielded varying degrees of shoulder protection. Specifically, knocking out the E70NL gene resulted in a completely absent virulence in the ASF virus strain; knocking out the NL gene in Pr4 resulted in the Pr4-ΔN-SL strain, which showed attenuation and protection within 10... 2 TCID 50 At the specified dosage, although it delayed the time to death and onset of disease in pigs, it had a mortality rate of nearly 86%; the Mal-△NL strain obtained by knocking out the NL gene in Mal still maintained extremely high virulence, at 10 2 TCID 50The lethality at the given dose was 100%. The DP148R gene-deleted Benin 97 / 1 strain also sufficiently attenuated the virus, with a 100% survival rate after immunization of pigs. However, the survival rate of immunized pigs with the DP148R gene-deleted Chinese epidemic strain was only 0%. ② Although it has been disclosed that combined knockout of MGF505 / 530 family genes and MGF360 family genes can produce a certain attenuation and protection effect, combined knockout of MGF360 with MGF505 / 530 and B119L does not have an attenuation and protection effect. Furthermore, in E70△NL (E70 strain with NL gene knockout), combined deletion of several members of MGF360 / 505 actually leads to increased virulence of the attenuated strain (E70△NL). ③ Currently, the most commonly disclosed [discussions] are related to CD2v and MGF360. The combined knockout of 0 / 505 family genes, such as the combined knockout of CD2v with MGF360-12L, MGF360-13L, and MGF360-14L, the complete deletion of the MGF360 / 505 gene, and the combined deletion of CD2v with the complete deletion of the MGF360 / 505 gene; however, although the obtained attenuated strains provide some immune protection, the virus can still be detected in the serum of pigs after immunization, and safety issues remain; moreover, the inventors found that the recombinant virus constructed by the combined deletion of the MGF505-7R, MGF110-9L, DP71L, and DP148R genes has poor immune protection, with a protection rate of only 50%.
[0006] To address the above, this invention, by combining the deletion of the MGF505-7R and I267L genes, obtained a relatively safe attenuated African swine fever virus strain; intramuscular injection of a high dose of the attenuated African swine fever virus strain (10 4 HAD 50 The fact that none of the pigs developed the disease after intramuscular injection of the strain indicates that the strain cannot cause disease and death in pigs. The challenge experiment showed that the attenuated African swine fever virus strain has a high immunoprotective efficiency against the virulent strain isolated from ASFV CN / GS / 2018. Therefore, it can be used as a safe and effective vaccine for the prevention and control of African swine fever in China and has great social value. Summary of the Invention
[0007] To address the aforementioned technical problems, this invention provides a strategy for constructing an attenuated African swine fever virus strain. The strategy involves combining the complete nucleotide sequence of the MGF505-7R gene and a partial nucleotide sequence of the I267L gene from the parental strain, thereby preventing the normal expression of the proteins encoded by these two genes and resulting in the loss of their protein function.
[0008] Based on common knowledge in the art, in addition to the gene editing methods mentioned above, other gene editing methods can be used to simultaneously lose the function of the proteins encoded by the MGF505-7R and I267L genes, thus successfully constructing attenuated African swine fever virus strains. These methods include frameshift mutations, point mutations, deletions, or insertions of nucleotide sequences.
[0009] The specific technical solutions include:
[0010] In a first aspect, the present invention provides an application for preparing an attenuated African swine fever virus strain by combining a deleted gene fragment in the type II African swine fever virus strain ASFV CN / GS 2018, wherein the gene fragment includes all or part of the nucleotide sequence of the MGF505-7R gene and all or part of the nucleotide sequence of the I267L gene; the type II African swine fever virus strain ASFV CN / GS 2018 is deposited at the China Center for Type Culture Collection, with accession number CCTCC NO: V202096. The loss of function of the encoded proteins can be achieved by deleting the complete nucleotide sequences of the MGF505-7R and I267L genes, or by deleting only part of the nucleotide sequences of the MGF505-7R and I267L genes (including the promoter sequences of the MGF505-7R and I267L genes), the proteins encoded by the MGF505-7R and I267L genes cannot be expressed, resulting in the loss of their encoded protein function. Based on common knowledge in the art, in addition to the gene editing methods mentioned above, other gene editing methods can be used to simultaneously cause the proteins encoded by the MGF505-7R and I267L genes to lose their function, such as frameshift mutations, point mutations, frameshift deletions, and insertion of nucleotide sequences.
[0011] Preferably, the missing gene fragment is positions 40752-42335 and 169821-170380 of the full-length sequence of the type II African swine fever virus strain ASFV CN / GS 2018.
[0012] Secondly, this invention provides an application for preparing an African swine fever vaccine by combining a deleted gene fragment in the type II African swine fever virus strain ASFV CN / GS 2018. The gene fragment includes all or part of the nucleotide sequence of the MGF505-7R gene and all or part of the nucleotide sequence of the I267L gene. The type II African swine fever virus strain ASFV CN / GS2018 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: V202096. The loss of function of the encoded proteins can be achieved by deleting the complete nucleotide sequences of the MGF505-7R and I267L genes, or by deleting only part of the nucleotide sequences of the MGF505-7R and I267L genes (including the promoter sequences of the MGF505-7R and I267L genes), the proteins encoded by the MGF505-7R and I267L genes cannot be expressed, resulting in the loss of their encoded protein function. Based on common knowledge in the art, in addition to the gene editing methods mentioned above, other gene editing methods can be used to simultaneously cause the proteins encoded by the MGF505-7R and I267L genes to lose their function, such as frameshift mutations, point mutations, frameshift deletions, and insertion of nucleotide sequences.
[0013] Preferably, the missing gene fragment is positions 40752-42335 and 169821-170380 of the full-length sequence of the type II African swine fever virus strain ASFV CN / GS 2018.
[0014] Thirdly, this invention provides a gene-deleted attenuated African swine fever virus strain, which is a type II African swine fever virus strain ASFV CN / GS 2018 with a gene fragment deletion; the gene fragment includes all or part of the nucleotide sequence of the MGF505-7R gene and all or part of the nucleotide sequence of the I267L gene; the type II African swine fever virus strain ASFV CN / GS 2018 is deposited at the China Center for Type Culture Collection, with accession number CCTCCNO: V202096. The loss of function of the encoded protein can be caused by deleting the entire nucleotide sequence of the MGF505-7R and I267L genes, or by deleting only part of the nucleotide sequence of the MGF505-7R and I267L genes (including the promoter sequences of the MGF505-7R and I267L genes), the proteins encoded by the MGF505-7R and I267L genes cannot be expressed, resulting in the loss of their encoded protein function. Based on common knowledge in the art, in addition to the gene editing methods mentioned above, other gene editing methods can be used to simultaneously cause the proteins encoded by the MGF505-7R and I267L genes to lose their function, such as frameshift mutations, point mutations, frameshift deletions, and insertion of nucleotide sequences.
[0015] Preferably, the missing gene fragment is positions 40752-42335 and 169821-170380 of the full-length sequence of the type II African swine fever virus strain ASFV CN / GS 2018.
[0016] Fourthly, the present invention provides an African swine fever vaccine, wherein the African swine fever vaccine comprises the gene-deleted attenuated African swine fever virus strain described in the third aspect above.
[0017] Fifthly, the present invention provides a method for preparing the gene-deleted attenuated African swine fever virus strain described in the third aspect above. The method involves deleting all or part of the nucleotide sequence of the MGF505-7R gene and all or part of the nucleotide sequence of the I267L gene in the original type II African swine fever virus strain ASFV CN / GS2018 through genetic engineering.
[0018] Preferably, the method is homologous recombination technology.
[0019] Preferably, the method includes the following steps:
[0020] (1) Design 1.0 kb upstream and downstream sequences of the MGF505-7R gene as left and right homologous recombination arms. Simultaneously clone the left and right homologous recombination arm genes and the eGFP gene selection expression cassette gene fragment p72-eGFP-SV40 polyA into the pUC57 vector to obtain the recombinant plasmid p7R-eGFP.
[0021] (2) Design 1.0 kb upstream and downstream sequences of the I267L gene as left and right homologous recombination arms. Simultaneously clone the left and right homologous recombination arms and the mCherry gene selection expression cassette gene fragment p72-mCherry-BGH polyA into the pUC57 vector to obtain the recombinant plasmid pI267L-mCherry.
[0022] (3) The recombinant plasmids p7R-eGFP and pI267L-mCherry were sequentially transfected into BMDM cells infected with the original ASFV strain to construct an attenuated African swine fever virus Δ7R / I267L with the MGF505-7R and I267L genes jointly deleted.
[0023] The beneficial effects of this invention are as follows: By combining the loss of function of the proteins encoded by the MGF505-7R and I267L genes, this invention obtains an attenuated African swine fever virus strain; the virulence of the attenuated African swine fever virus strain is significantly weakened, and high doses do not produce morbidity or mortality; after immunization with this attenuated African swine fever virus strain, pigs have a good protective effect against the parent strain ASFV CN / GS / 2018 isolate, making it suitable as a candidate strain for a vaccine to prevent African swine fever. Attached Figure Description
[0024] Figure 1 A schematic diagram of the ASFV MGF505-7R gene deletion strategy;
[0025] Figure 2 A schematic diagram of the ASFV I267L gene deletion strategy;
[0026] Figure 3 Image showing the purity test results of attenuated African swine fever virus strain Δ7R / I267L;
[0027] Figure 4 A graph showing the change in body temperature of animals after immunization with attenuated African swine fever virus strain Δ7R / I267L. Each curve represents an animal, with the horizontal axis representing the number of days after immunization and the vertical axis representing body temperature.
[0028] Figure 5 Survival rate of experimental pigs immunized with attenuated African swine fever virus strain Δ7R / I267L, with the horizontal axis representing the number of days after immunization and the vertical axis representing the survival rate;
[0029] Figure 6 The graph shows the results of p72 antibody detection in the blood of animals immunized with attenuated African swine fever virus strain Δ7R / I267L. Each point represents an animal, the horizontal axis represents the number of days after immunization, and the vertical axis represents the p72 antibody blocking rate.
[0030] Figure 7 A graph showing the change in body temperature of animals after immunization with attenuated African swine fever virus strain Δ7R / I267L. Each curve represents an animal, with the horizontal axis representing the number of days after immunization and the vertical axis representing body temperature.
[0031] Figure 8 Survival rate of experimental pigs after immunization with attenuated African swine fever virus strain Δ7R / I267L, where the horizontal axis represents the number of days after immunization and the vertical axis represents the survival rate. Detailed Implementation
[0032] To make the technical means, creative features, objectives, and effects of this invention easier to understand, the invention is further described below in conjunction with specific embodiments. However, the scope of protection of this invention is not limited to the embodiments described below.
[0033] The experiments described in the following examples obtained biosafety clearance and African swine fever laboratory activity clearance:
[0034] In accordance with the requirements for a Biosafety Level 3 (BSL-3) laboratory and related biosafety for African swine fever, the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, through a hierarchical reporting process involving the Lanzhou Veterinary Research Institute's Biosafety Committee, Laboratory Animal Ethics Committee, the Chinese Academy of Agricultural Sciences' Biosafety Committee, the Lanzhou Veterinary Research Institute's Laboratory Animal Ethics Committee, and the Lanzhou Veterinary Research Institute's Biosafety Committee, obtained permission from the Ministry of Agriculture to conduct research on highly pathogenic ASFV pathogens and related animals. This permit has been registered with the Ministry of Agriculture and Rural Affairs and meets the national biosafety level requirements.
[0035] The experimental cells, viruses, and plasmids described in the following examples are from:
[0036] Primary porcine alveolar macrophages (PAM) and primary bone marrow macrophages (BMDM) were obtained from healthy pigs aged 2-4 months. After aseptic collection, red blood cells were removed using erythrocyte lysis buffer (Biosharp). After low-speed centrifugation, the supernatant was discarded, and the cell pellet was resuspended in RPMI 1640 complete medium (Gibco) containing 10% FBS (PAN) and cultured at 37°C in a 5% CO2 incubator. For BMDM cell culture, an additional 10 ng / mL of recombinant porcine GM-CSF (R&D Systems) was added to the RPMI 1640 complete medium. Induction was performed at 37°C in a 5% CO2 incubator, with washing every 2-3 days. Non-adherent cells were centrifuged and re-added to new cell culture dishes, the medium was changed, and induction continued for 3-7 days before cryopreservation or use. PAM cells were used to propagate ASFV and for viral titration. BMDM cells were used for plasmid transfection and viral recombination experiments.
[0037] The African swine fever virus strain CN / GS 2018, type II, originated from the National African Swine Fever Regional Laboratory (Lanzhou). It belongs to genotype II and has a viral titer of 1×10⁻⁶. 5 HAD 50 / mL, which is the 4th generation seed virus after PAM cell propagation, was deposited at the China Center for Type Culture Collection on December 21, 2020, with accession number CCTCC NO: V202096; deposit address: Wuhan University, Wuhan, China; contact number: 027-68752319.
[0038] The peGFP-N1 vector, pUC57 and pcDNA-mCherry vector were purchased from Lanzhou Ruibolai Biotechnology Co., Ltd.; the endotoxin-free plasmid extraction kit was purchased from OMEGA.
[0039] Unless otherwise specified, all procedures performed in the experiment are known in the field.
[0040] definition
[0041] The term "loss of protein function" refers to the loss of function of a protein encoded by knocking out, mutating, or inserting a portion of the gene into a protein-encoding gene segment, resulting in a frameshift mutation.
[0042] The term "gene deletion" refers to the loss of a segment of a chromosome along with its associated gene, resulting in a mutation.
[0043] The term "gene mutation" refers to a change in the composition or sequence of base pairs in the structure of a gene. In other words, a new gene suddenly appears at a certain site, replacing the original gene. This gene is called a mutated gene. Gene mutations lead to the sudden appearance of new traits in offspring that have never been seen before.
[0044] Gene deletion methods generally refer to gene knockout, which is a foreign DNA introduction technology that uses a DNA fragment containing a known sequence to undergo homologous recombination with a gene in the recipient cell's genome that has the same or similar sequence, integrating into the recipient cell's genome and being expressed. Gene knockout methods generally include: homologous recombination technology, random insertion mutation technology, and RNA interference technology. Among them, homologous recombination technology, also known as gene targeting, refers to the recombination between foreign DNA and homologous sequences on the recipient cell's chromosomal DNA, integrating into a predetermined position, thereby altering certain genetic characteristics. The purpose of recombination is to knock out a specific gene. Random insertion mutation technology refers to using certain viruses, bacteria, or other gene vectors that can randomly insert gene sequences to create a cell library of randomly inserted mutations in the target cell's genome, and then selecting corresponding gene knockout cells through appropriate markers. RNA interference technology is a reverse genetics technology that specifically induces the degradation of target mRNA by double-stranded RNA homologous to the mRNA of the endogenous target gene in the organism, leading to the silencing of the target gene expression.
[0045] The purpose of this invention is to construct an attenuated African swine fever virus with lost function of the MGF505-7R and I267L gene-encoded proteins by knocking out the nucleotide sequences of the MGF505-7R and I267L genes in the African swine fever virus, and to use it in the production of African swine fever vaccines.
[0046] Since MGF505-7R and I267L are two non-adjacent genes, the p72-eGFP-SV40 polyA and p72-mCherry-BGH polyA elements can be replaced by two homologous recombination targeting vectors, respectively, so that the proteins encoded by these two genes cannot be expressed normally, resulting in the loss of their encoded protein function.
[0047] Based on common knowledge in the art, in addition to the gene editing methods mentioned above, other gene editing techniques can be used to eliminate the original properties of the proteins encoded by the MGF505-7R and I267L genes, thereby constructing attenuated recombinant African swine fever viruses. Examples include gene deletion, gene mutation, base insertion, and RNA interference technology.
[0048] Although this invention only knocks out the MGF505-7R and I267L genes using homologous recombination technology, the above-mentioned random insertion mutation technology and RNA interference technology can also knock out the I267L genes.
[0049] This invention involves the combined deletion of the MGF505-7R and I267L genes in the type II African swine fever virus strain ASFV CN / GS 2018. The MGF505-7R gene sequence is located at positions 40752-42335 of the full-length sequence of the type II African swine fever virus strain ASFV CN / GS 2018 (as shown in SEQ ID NO. 1); the I267L gene sequence is located at positions 169671-170474 of the full-length sequence of the type II African swine fever virus strain ASFV CN / GS 2018 (its gene expression sequence is located on the negative strand of the ASFV CN / GS 2018 genome, therefore its sequence is shown in SEQ ID NO. 2). This invention also involves the combined deletion of the entire nucleotide sequence of the MGF505-7R gene in the ASFV CN / GS 2018 strain (type II African swine fever virus strain ASFV CN / GS). The deletion of the MGF505-7R and I267L gene deletions (positions 40752-42335 of the full-length sequence of 2018) and partial nucleotide sequences of I267L (positions 169821-170380 of the full-length sequence of type II African swine fever virus strain ASFV CN / GS 2018) resulted in the functional loss of these two viral proteins. This led to the successful construction of an attenuated African swine fever virus strain with the MGF505-7R and I267L gene deletions, which was then used as a candidate strain for a vaccine.
[0050] The term "vaccine" refers to a biological agent capable of providing a protective response in animals, wherein the vaccine has been delivered and does not cause serious disease. The vaccine of this invention is a genetically engineered gene-deleted attenuated viral vaccine, wherein the deleted genes are MGF505-7R and I267L; mutation is understood as a change in the genetic information of the wild-type or unmodified MGF505-7R and I267L genes in the type II African swine fever virus strain ASFV CN / GS2018. It should be understood that recombinant mutants obtained from mutations in the MGF505-7R and I267L genes can also be used to prepare African swine fever vaccines.
[0051] The African swine fever vaccine of the present invention optionally further comprises one or more adjuvants, excipients, carriers, and diluents. The adjuvant can be any suitable adjuvant, including chemical adjuvants such as aluminum hydroxide, Freund's adjuvant, mineral oil, Span, etc.; microbial adjuvants such as mycobacteria, lipopolysaccharides, muramyl dipeptides, cytokines, lipid-soluble wax D, and short rod-shaped bacteria; and plant-based adjuvants, mostly polysaccharides extracted from plants or macrofungi, such as Poria cocos polysaccharides, safflower polysaccharides, and traditional Chinese medicines. Biochemical adjuvants include thymosin, transfer factor, and interleukins. Preferred adjuvants may be nano-adjuvants, biological adjuvants, interleukins, etc.
[0052] The African swine fever vaccine disclosed in this invention can also be used to prepare combination vaccines, such as those for pigs, but the focus is on live attenuated vaccines, especially the integration of viral genes, such as bivalent and trivalent vaccines. Combination vaccines can contain multiple attenuated African swine fever viruses of different genotypes, thus inducing cross-protective immune responses against multiple African swine fever virus genotypes.
[0053] The African swine fever vaccine of the present invention can be administered via convenient routes, such as intramuscular injection, intranasal administration, oral administration, subcutaneous administration, transdermal administration, and vaginal administration. The attenuated vaccine of the present invention is preferably administered via intramuscular injection. The vaccine can be administered after a primary immunization-boost regimen. For example, after the first vaccination, the subject can receive a second booster dose after a period of time (e.g., approximately 7, 14, 21, or 28 days). Typically, the booster dose is the same as or lower than the primary immunization dose. Furthermore, a third booster immunization can also be performed, for example, 2-3 months, 6 months, or one year after immunization.
[0054] Example 1: Construction, purification, and identification of attenuated African swine fever virus strain
[0055] 1. Construction of expression boxes
[0056] To facilitate screening, expression cassettes for screening marker genes were constructed.
[0057] Construction of Enhanced Green Fluorescent Protein (eGFP) Gene Selection Expression Kit: Referring to the literature (O'Donnell V. African Swine Fever Virus Georgia 2007 with a Deletion of Virulence-Associated Gene 9GL (B119L), when Administered at LowDoses, Leads to Virus Attenuation in Swine and Induces an Effective Protection against Homologous Challenge. JVirol. 2015;89(16): 8556-66), the p72 promoter (from -196nt upstream of the p72 gene to before +17nt) was amplified by PCR and prepared for use; the amplification primers were: forward primer 5'-TTATAAAACATATGTTCATAAAAAGGGTCGCCGGAGGAAAAGTC-3' (SEQ ID NO.7) and reverse primer 5'-CTCCTCGCCCTTGCTCACCATATATAATGTTATAAAAATAATT-3' (SEQ ID NO.7). (Shown NO.8); Using the peGFP-N1 vector as a template, the eGFP gene was amplified for later use. The amplification primers were: forward primer 5'-ATGGTGAGCAAGGGCGAGGAG-3' (shown SEQ ID NO.9) and reverse primer 5'-ACCACAACTAGAATGCAGTG-3' (shown SEQ ID NO.10); Referring to the literature (Borca MV. CRISPR-Cas9, a tool to efficiently increase the development of recombinant African swine fever viruses. Sci Rep. 2018;8(1):3154), the p72 promoter and the two genes eGFP obtained by the above steps were ligated by fusion PCR to obtain the eGFP selection expression cassette gene fragment, named p72-eGFP-SV40polyA. The expression cassette sequence contains the SV40polyA termination sequence.
[0058] Construction of the mCherry selection expression cassette for the red fluorescent protein gene: Using the pcDNA3-mCherry vector as a template, the mCherry gene for the red fluorescent protein was amplified using forward primer 5'-ATGGTGAGCAAGGGCGAGGAG-3' (SEQ ID NO.11) and reverse primer 5'-TTACTTGTACAGCTCGTCCATGC-3' (SEQ ID NO.12). Referring to the literature (BorcaMV, CRISPR-Cas9, a tool to efficiently increase the development of recombinant African swine fever viruses. Sci Rep. 2018;8(1):3154.), the p72 promoter and the mCherry gene obtained in the above steps were ligated by fusion PCR to obtain the mCherry selection expression cassette gene fragment, named p72-mCherry-bGHpolyA. This expression cassette sequence contains the bGHpolyA termination sequence.
[0059] 2. Construction of homologous recombination transfer vectors
[0060] Using the pUC57 vector as a backbone vector, a homologous recombination transfer vector for knocking out the ASFV MGF505-7R gene was constructed. The deleted gene sequence is located at positions 40752-42335 of the full genome sequence of the ASFV CN / GS / 2018 isolate. When designing the targeting vector for the MGF505-7R gene, the coding region of this gene was deleted. The sequences upstream and downstream of the coding region of the MGF505-7R gene were used as left and right homologous arms (shown in SEQ ID NO.3 and right arm, respectively), and cloned into the pUC57 vector to obtain a recombinant transfer vector of the MGF505-7R genome fragment. Then, a p72-eGFP selection cassette gene fragment was inserted into the middle of the gene sequences of the left and right homologous arms of this vector. After correct sequencing, the homologous recombination transfer vector was named p7R-eGFP. DNA was extracted using an endotoxin-free plasmid extraction kit, and the concentration was determined. The DNA was stored at -20℃ for later use. For detailed construction strategies, see [link to specific details]. Figure 1 .
[0061] A homologous recombination transfer vector for ASFV I267L gene knockout was constructed using the pUC57 vector as the backbone vector. The deleted gene sequence is located at positions 169821-170380 of the whole genome sequence of the ASFV CN / GS / 2018 isolate. The upstream and downstream sequences of the I267L gene fragment were used as left and right homologous arms (SEQ ID NO.5 and SEQ ID NO.6, respectively), and cloned into the pUC57 vector to obtain the I267L gene recombination transfer vector. The mCherry selection expression cassette gene fragment p72-mCherry-bGHpolyA was inserted into the middle of the gene sequences of the left and right arms of this recombination transfer vector. After correct sequencing, the homologous recombination transfer vector was named pI267L-mCherry. DNA was extracted using an endotoxin-free plasmid extraction kit, the concentration was determined, and the DNA was stored at -20℃ for later use. For detailed construction strategies, see [link to specific details]. Figure 2 .
[0062] 3. Cell transfection and recombinant virus screening
[0063] Homologous recombination transfer vector p7R-eGFP and JetPEI ® - The Macrophage DNA transfection reagent was thoroughly mixed and co-transfected into healthy bone marrow macrophage (BMDM) cells taken from healthy pigs aged 2-4 months. The purified virus strain ASFVCN / GS / 2018 was directly infected to obtain ASFV recombinant virus Δ7R with the ASFV MGF505-7R gene deleted. Subsequently, using the ASFV recombinant virus Δ7R as the parent strain, pI267L-mCherry was transfected into BMDM cells to infect ASFV recombinant virus Δ7R. The virus strain was purified to obtain the attenuated African swine fever virus strain Δ7R / I267L with the I267L gene deleted.
[0064] Purity testing: The following primer pairs were selected to test the purity of each gene:
[0065] MGF505-7R-check-F: TTTGGGAAAATCCCGCGGAAAGAA (shown in SEQ ID NO. 13);
[0066] MGF505-7R-check-R:TCCTGTAGGGAGAACATTTTCTCT (as shown in SEQ ID NO.14);
[0067] I267L-check-F: AGGGTGAATGGATACGAAGTTTCA (shown in SEQ ID NO.15);
[0068] I267L-check-R:ACATGTGTGGTAAACAACATATGG (shown in SEQ ID NO. 16).
[0069] Meanwhile, p72 in the viral genome was selected as an internal reference gene to ensure the quality of the detected viral genome. The primers for detecting p72 were p72-F: CGGGGGTTTTAATCGCATTGC (SEQ ID NO.17) and p72-R: CGGGGGTTTTAATCGCATTGC (SEQ ID NO.18).
[0070] The results are as follows Figure 3 As shown, WT is the ASFV CN / GS 2018 isolate, and NC is the negative control using water as a template. The results indicate that the MGF505-7R and I267L gene fragments were undetectable in the genome of the gene-deleted attenuated African swine fever virus, indicating successful knockout of the MGF505-7R and I267L genes. These results demonstrate that the double-gene-deleted attenuated African swine fever virus strain has been successfully constructed and purified, and named Δ7R / I267L.
[0071] In summary, this invention successfully constructed an attenuated African swine fever virus with lost-function proteins encoded by the MGF505-7R and I267L genes using homologous recombination technology. Based on common knowledge in the art, besides the gene editing methods described above, other gene editing techniques can also be used to simultaneously cause the proteins encoded by the MGF505-7R and I267L genes to lose their function, such as frameshift mutations, point mutations, frameshift deletions, and nucleotide sequence insertions.
[0072] This invention is not limited to homologous recombination technology. Based on this invention, other technical means are used to obtain attenuated African swine fever virus strains that lose the function of proteins encoded by the MGF505-7R and I267L genes.
[0073] Example 2: Determination of Viral Titer
[0074] African swine fever virus titers are determined using the half-maximal hemolymph adsorption (HAD) method. 50 ) indicates that HAD 50The specific experimental procedures are detailed in the literature (Borca MV. Development of a highly effective Africanswine fever virus vaccine by deletion of the I177L gene results in sterileimmunity against the current epidemic Eurasia strain. JVirol. 2020. pii:JVI.02017-19), with appropriate adjustments made: in a 96-well plate, approximately 1×10 5 Primary PAM cells were seeded into each well of a 96-well plate. The recombinant viral virus to be tested was serially diluted 10-fold (7 dilutions total), with 8 wells per dilution. 100 μL of the diluted virus was added to each well of the PAM plate, followed by the addition of erythrocytes. This process was repeated three times. Viral infection was determined by the rosette-like pattern of erythrocytes around infected cells. Observations were performed for 6 days, and the number of positive wells was counted. The half-maximal hemocytopenic purpura (HAD) was calculated. 50 If the titer test is satisfactory, pathogenicity evaluation will be conducted.
[0075] Example 3: Virulence evaluation of gene-deleted attenuated African swine fever virus strain
[0076] To test the virulence of the gene-deleted attenuated African swine fever virus strain, this experiment used 10 4 HAD 50 The toxicity of the drug was evaluated by intramuscular injection into piglets.
[0077] This experiment used 17 healthy Landrace piglets that were negative for African swine fever antigen and antibodies. They were divided into three groups: an immunization group (9 piglets with gene-deleted attenuated ASFV strain Δ7R / I267L), a cohabitation group (3 piglets with gene-deleted attenuated ASFV strain Δ7R / I267L), and an immunization group (5 piglets with wild-type ASFV CN / GS / 2018). Body temperature changes were measured daily after immunization. Peripheral blood and saliva were collected. Following the literature (King DP. Development of a TaqMan PCR assay with internal amplification control for the detection of African swine fever virus. J Virol Methods 107:53-61), the ASFV virus content in the blood was determined using quantitative real-time PCR. The assay continued for 19 days. Body temperature changes and mortality rates were statistically analyzed in both the immunized and cohabitation groups. The body temperature change results are shown below. Figure 4 As shown, the mortality rate results are as follows: Figure 5 As shown, the results indicate that after intramuscular injection of the gene-deleted attenuated African swine fever virus strain Δ7R / I267L, the body temperature of pigs in both the ASFV Δ7R / I267L group and the cohabiting animal group was normal, with no sustained high fever or death, and the survival rate was 100%. However, after intramuscular injection of wild-type ASFV CN / GS / 2018, the body temperature of the experimental pigs continued to rise, and they died on the 5th day after immunization, with all of them dying by the 8th day, resulting in a survival rate of 0%.
[0078] The results of the detection of ASFV p72 antibody levels in the blood are as follows: Figure 6 As shown, after injection of the gene-deleted attenuated African swine fever virus strain Δ7R / I267L, the p72 antibody level in the blood of the immunized pigs (ASFV Δ7R / I267L) began to increase significantly 13 days after immunization, and reached a high level by 19 days. The p72 antibody level in the blood of the cohabiting pigs (contact) did not increase significantly after immunization, and only one pig showed a slight increase in antibody level at the end of the experiment.
[0079] The above experimental results show that after the ASFV MGF505-7R and I267L gene-encoded proteins were deactivated in the parental ASFVCN / GS / 2018 isolate, the virulence of the obtained gene-deleted attenuated African swine fever virus strain was significantly weakened, and the safety was good.
[0080] Example 4: Evaluation of the immunoprotective effect of gene-deleted attenuated African swine fever virus strain
[0081] To test the immunoprotective effect of gene-deleted attenuated African swine fever virus strains, this experiment used 100 HAD... 50 The parental ASFV CN / GS 2018 isolate was used to challenge three unimmunized control pigs and nine immunized pigs (nine pigs) immunized with the gene-deleted attenuated African swine fever virus strain Δ7R / I267L in Example 3.
[0082] Following viral challenge, body temperature changes were measured daily, and peripheral blood was collected. Observation continued for 19 days. The results of body temperature changes are as follows: Figure 7 As shown, the survival rate results after virus challenge are as follows: Figure 8As shown: immunized pigs (ASFV Δ7R / I267L immunized) after being challenged with the parental ASFV CN / GS 2018 isolate did not exhibit typical symptoms of fever, and the survival rate reached over 78% (2 / 9); while unimmunized control pigs (Control) experienced a sharp rise in body temperature after being challenged with the parental ASFV CN / GS 2018 isolate, and died on day 8 after challenge, with all dying by day 9, resulting in a survival rate of 0%.
[0083] The above results indicate that after challenge with the parental ASFV CN / GS 2018 isolate, the pigs immunized with the gene-deleted attenuated African swine fever virus strain Δ7R / I267L had normal body temperature and a high survival rate. That is, the gene-deleted attenuated African swine fever virus strain Δ7R / I267L has a high immunoprotective effect against the parental ASFV CN / GS 2018 isolate.
Claims
1. The application of preparing an attenuated African swine fever virus strain by combining a deleted gene fragment with the type II African swine fever virus strain ASFV CN / GS2018, characterized in that, The gene fragment is positions 40752-42335 and 169821-170380 of the full-length sequence of the type II African swine fever virus strain ASFV CN / GS2018; the type II African swine fever virus strain ASFV CN / GS2018 is deposited at the China Center for Type Culture Collection, with accession number CCTCC NO: V202096.
2. Use of the combined deletion of gene segments for the preparation of an African swine fever vaccine in a strain of African swine fever virus type II ASFV CN / GS2018, characterized in that, The gene fragment is positions 40752-42335 and 169821-170380 of the full-length sequence of the type II African swine fever virus strain ASFV CN / GS2018; the type II African swine fever virus strain ASFV CN / GS2018 is deposited at the China Center for Type Culture Collection, with accession number CCTCC NO: V202096.
3. A genetically deleted attenuated strain of African swine fever virus, characterized in that, The gene-deleted attenuated African swine fever virus strain is the type II African swine fever virus strain ASFV CN / GS2018 with a gene fragment deletion; the gene fragment is positions 40752-42335 and 169821-170380 of the full-length sequence of type II African swine fever virus strain ASFV CN / GS2018; the type II African swine fever virus strain ASFV CN / GS2018 is deposited at the China Center for Type Culture Collection, with accession number CCTCC NO: V202096.
4. An African swine fever vaccine, characterized in that, The African swine fever vaccine comprises the gene-deleted attenuated African swine fever virus strain as described in claim 3.
5. A method of preparing the genetically deleted attenuated strain of the African swine fever virus according to claim 3, characterized by, The method described involves using genetic engineering to delete nucleotides from positions 40752-42335 and 169821-170380 of the full-length sequence of the original type II African swine fever virus strain ASFV CN / GS2018.
6. The method of claim 5, wherein, The method is homologous recombination technology.
7. A method of preparing the genetically deleted attenuated strain of the African swine fever virus according to claim 3, characterized by, The method includes the following steps: (1) Design 1.0kb upstream and downstream sequences of the MGF505-7R gene as left and right homologous recombination arms. Simultaneously clone the left and right homologous recombination arm genes and the eGFP gene selection expression cassette gene fragment p72-eGFP-SV40 polyA into the pUC57 vector to obtain the recombinant plasmid p7R-eGFP. (2) Design 1.0kb upstream and downstream sequences of the I267L gene as left and right homologous recombination arms. Simultaneously clone the left and right homologous recombination arms and the mCherry gene selection expression cassette gene fragment p72-mCherry-BGHpolyA into the pUC57 vector to obtain the recombinant plasmid pI267L-mCherry. (3) The recombinant plasmids p7R-eGFP and pI267L-mCherry were sequentially transfected into BMDM cells infected with the original ASFV strain to construct an attenuated African swine fever virus Δ7R / I267L with the MGF505-7R and I267L genes jointly deleted.
Citation Information
Patent Citations
Attenuated and live vaccine of African swine fever with deletion of E66L and I267L genes
CN111996175A
Construction of attenuated African swine fever virus strain without ten genes and application of attenuated African swine fever virus strain as vaccine
CN114015660A