SgRNA, vector and application targeting tgfbi gene

Abstract

This invention relates to a sgRNA targeting the TGFBI gene, a vector, and their applications. The multiple sgRNAs designed in this invention can specifically target the TGFBI gene and mediate efficient and specific editing by nucleases or base editors. By disrupting the expression process of the TGFBI gene, it can achieve the treatment of corneal dystrophy (CD) caused by TGFBI gene mutation, with the advantages of excellent therapeutic effect and low treatment frequency, and has potential application prospects.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to sgRNAs, vectors, and applications targeting the TGFBI gene. Background Technology

[0002] Corneal dystrophy (CD) is a group of hereditary, symmetrical, non-inflammatory corneal diseases. It is a common autosomal dominant inherited disease caused by a defect in the transforming growth factor β-inducible gene (TGFBI gene). Normal corneal tissue suffers progressive damage to its structure or function due to gene mutations. The characteristic manifestation is a slow, symmetrical loss of corneal transparency in both eyes, with deposits of varying morphology and nature appearing in the corneal tissue, further affecting corneal transparency and leading to decreased vision. Some types of corneal dystrophy can cause recurrent corneal erosion, resulting in pain, corneal leukoplakia, and ultimately severe vision loss, impacting not only the patient's quality of life and appearance but also placing a heavy burden on society. Currently, corneal transplantation is the most common treatment for this disease, but the treatment cost is extremely high and there is a varying degree of recurrence after surgery.

[0003] The product expressed by the TGFBI gene is called keratoepithelin (KE protein). KE protein is closely associated with laminin, fibronectin, and collagen I in the extracellular matrix. KE protein may induce apoptosis through an abnormal interaction with one of these proteins via the apoptosis-promoting factor caspase-3. Overexpression of KE protein disrupts this process, leading to the deposition of denaturing products and recurrent epithelial erosion. Malnutrition associated with TGFBI gene mutations includes: Avellino corneal dystrophy I, granular conneal dystrophy (GCD), Reis-Bücklers corneal dystrophy (RBCD), Thiel-Behnke corneal dystrophy (TBCD), and lattice corneal dystrophy (LCD).

[0004] Various types of corneal dystrophy associated with TGFBI gene mutations typically begin in adolescence, affecting both eyes, and progressing relatively slowly. Patients exhibit corneal deposits of glycoproteins secreted by epithelial cells, accumulating from the corneal epithelium to the stroma. The TGFBI gene is located on chromosome 5, 5q31, and has 16 coding exons, encoding a 683-amino acid corneal epithelial protein (keratoepithlin, KE). Domestic and international studies have shown that 92% of pathogenic mutations in the TGFBI gene occur in the leader sequence region and FASC-4 region of the KE protein, with arginine residues at positions 124 (Exon-4) and 555 (Exon-12) being mutation hotspots. Corneal dystrophy caused by TGFBI gene mutations is an autosomal dominant inherited condition with complete penetrance. The four most common mutation forms of the TGFBI gene are: granular corneal dystrophy type I (GCD I) caused by the R555W mutation, Thiel-Behnke corneal dystrophy (TBCD) caused by the R555Q mutation, Avellino corneal dystrophy (ACD) caused by the R124H mutation, and lattice corneal dystrophy type I (LCD I) caused by the R124C mutation.

[0005] Currently, most treatments involve medication or corneal transplantation. However, treatment with chemical or antibody drugs cannot completely cure the condition. Corneal transplantation also faces challenges such as donor shortages and the risk of rejection. Summary of the Invention

[0006] To address the limitations and defects of existing technologies, this invention provides an sgRNA targeting the TGFBI gene. Through CRISPR-Cas gene editing technology, it achieves a thorough, effective, and stable therapeutic effect by manipulating the gene level, avoiding the adverse reactions or high costs that may result from long-term treatment with various drugs or donor transplantation. It also has the advantages of convenient treatment and low cost.

[0007] This invention utilizes CRISPR-Cas technology to edit any site in the TGFBI gene, excluding the last intron in the open reading frame, that can generate a stop codon, forming a premature stop codon. This triggers the NMD mechanism, degrades the truncated pathogenic gene mRNA byproducts, and activates the compensatory function of the periosteal protein POSTN to enable the TGFBI gene to function in the cornea.

[0008] This invention targets mutations in the pathogenic gene TGFBI by editing specific sites within the open reading frame (these sites, after editing, form stop codons). The resulting premature termination codons trigger the nonsense-mediated mRNA decay (NMD) mechanism, an important RNA monitoring mechanism in eukaryotic cells that recognizes and degrades mRNAs containing premature termination codons (PTCs) within the open reading frame. The truncated pathogenic gene mRNA product is degraded, and the periosteal protein POSTN, associated with the pathogenic gene, compensates for the TGFBI gene's function in the cornea. Clinically, by delivering nucleases and specifically targeted sgRNAs to corneal cells using a specific delivery method (such as nanolipid delivery or viral vector delivery), the side effects of TGFBI gene mutations can be reduced or avoided, restoring corneal transparency, significantly delaying visual impairment, avoiding corneal transplantation, and achieving a cure.

[0009] In a first aspect, the present invention provides an sgRNA targeting the TGFBI gene; said sgRNA targets the TGFBI gene to perform base editing and form a prematurely terminated codon.

[0010] Furthermore, the target sequence of the sgRNA comprises a sequence selected from any one of SEQ ID NO.1-68.

[0011] Preferably, the sgRNA has undergone base chemical modification; the modification is selected from one or more of methylation, methoxylation, fluorination or thiolation.

[0012] Furthermore, the present invention also includes variants of the above sequence with at least 66% identity.

[0013] In this paper, the term "at least 66% identity" refers to an identity of at least 66% with each reference sequence, which may be 66%, 67%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9%.

[0014] In some embodiments, the sgRNA variant has undergone base chemical modification; the modification is selected from one or more of methylation, methoxylation, fluorination, or thiolation.

[0015] In a second aspect, the present invention provides an sgRNA expression vector targeting the TGFBI gene, the expression vector comprising a nucleotide sequence encoding the sgRNA as described above.

[0016] A third aspect of the present invention provides a CRISPR-Cas system for targeted editing of the TGFBI gene.

[0017] This includes the gRNA described in the first aspect.

[0018] In a fourth aspect, the present invention provides a composition for targeted editing of the TGFBI gene, the composition comprising: a guide RNA system and a nuclease system or a base editor system.

[0019] The guide RNA system is selected from: the sgRNA described in the first aspect of the present invention, or the polynucleotide encoding the sgRNA.

[0020] Furthermore, the nuclease system is selected from Cas protein or polynucleotide encoding Cas protein.

[0021] Furthermore, the base editor system is selected from at least one of ABE and CBE.

[0022] Furthermore, the Cas protein is selected from Cas9 or its Cas9 homolog, Cas12 or its Cas12 homolog, CasX or its homolog, CasY or its homolog, Cpf1 or its homolog.

[0023] Furthermore, the base editor system is selected from at least one of ABE and CBE.

[0024] In some embodiments, the base editor system is ABE, and more specifically, the base editor system is ABE8e.

[0025] The fifth aspect of the present invention provides the use of the sgRNA described in the first aspect, the sgRNA expression vector described in the second aspect, the CRISPR-Cas system described in the third aspect, and the composition described in the fourth aspect in the preparation of a medicament for treating corneal dystrophy.

[0026] In a sixth aspect, the present invention provides a host cell comprising the composition described above.

[0027] Furthermore, the host cell is a corneal stromal cell, a corneal epithelial cell, or a posterior corneal fibrous membrane cell. Specifically, the host cell can be a subject cell.

[0028] A seventh aspect of the present invention provides a method for prevention and / or treatment, a diagnostic method, and a pharmaceutical use:

[0029] Specifically, it can be the use of sgRNA, compositions, vectors, CRISPR-Cas systems, recombinant cells, as described in the foregoing aspects of this invention, in the prevention and / or treatment of diseases, or in the diagnosis of diseases, or in the preparation of medicaments for the treatment of diseases.

[0030] The disease mentioned is a disease related to TGFBI, which can be corneal dystrophy, or more specifically, a corneal dystrophy-related disease that targets TGFBI.

[0031] It should be understood that the treatment described in this invention refers to using the sgRNA of this invention as a guide RNA to guide a nuclease or base editor to target the TGFBI gene of a diseased person, thereby altering its gene sequence and downregulating its expression by >5%, >10%, >15%, >20%, >30%, >40%, >50%, >60%, >70%, >80%, >85%, or >90%.

[0032] The sgRNA described in the first aspect of the present invention can also introduce double-strand breaks (DSBs) to repair the TGFBI gene in diseased patients through the NHEJ or HDR pathway, thereby downregulating its expression. Alternatively, the sgRNA of the first aspect of the present invention can be combined with a base editor (e.g., ABE, CBE, etc.) to achieve base substitution, thereby disrupting the function of the corresponding sequence and downregulating the expression of the TGFBI gene.

[0033] This invention uses RNA-guided endonucleases (RGENs, such as Cas9 and Cas12) to edit target base sequences, causing random base insertions or deletions with frameshift mutations, accompanied by the appearance of stop codons.

[0034] Preferably, the mRNA of the base editor is used to target the splicing sites of the intron and exon RNA of the TGFBI gene with the sgRNA described in the first aspect of the present invention.

[0035] Furthermore, the Cas protein in the base editor structure can be Cas9, which is derived from Streptococcus pneumoniae (SpCas9), Staphylococcus aureus (SaCas9), or Streptococcus thermophilus (GeoCas9), etc.

[0036] In other embodiments, other nucleases or mutants of nucleases may be used to replace Cas9, for example, Cas9 or other variants from other sources, Cas12 and its homologs, CasX or its homologs, CasY or its homologs, Cpf1 or its homologs.

[0037] In one specific embodiment of the present invention, ABE8e can be used to target and edit the RNA splicing site of the TGFBI gene to cause abnormal RNA splicing of the gene, thereby causing disordered extension or skipping of translation at the splicing site, accompanied by the appearance of premature termination codons.

[0038] In one specific embodiment of the present invention, the sgRNA target sequence used in the present invention is shown in Table 1:

[0039] Table 1. Target sequences contained in the sgRNA of this invention.

[0040]

[0041]

[0042]

[0043]

[0044] In some specific implementations, the sgRNA target sequence also includes variants that can perform the same function and have more than 66% identity with any of sgRNA-1 to 68.

[0045] The sgRNAs described in Table 1 can guide base editors (e.g., ABE8e) to cause changes in splice site bases at specific target sequence splice sites, thereby leading to abnormal RNA splicing, forming prematurely terminated codons, triggering nonsense-mediated mRNA decay (NMD) mechanisms, and minimizing the side effects of the pathogenic gene TGFBI mRNA.

[0046] In other embodiments, ABE8e can be used to target and edit the start codon site of the TGFBI gene to inhibit the transcription of the pathogenic gene mRNA, thereby minimizing the expression of the pathogenic gene. For example, a designed sgRNA can be used to guide ABE8e to target the start codon site of the TGFBI gene; furthermore, the sgRNAs shown in SEQ ID No. 1-68 in Table 1 can be used.

[0047] The sgRNA may also include chemical modifications of the bases, which can greatly improve the stability of the sgRNA and prevent it from being degraded by exonucleases in vivo. Compared with sgRNA without chemical modifications, the modification can significantly improve the editing efficiency. Preferably, the chemical modification is one or any combination of methylation, methoxylation, fluorination or thiolation.

[0048] In a preferred embodiment, the sgRNA includes chemical modification of any one or more bases at positions 1-n of the 5' end, and / or chemical modification of any one or more bases at positions 1-n of the 3' end; where n is selected from 2, 3, 4, 5, 6, 7, 8, 9, or 10. Preferably, the sgRNA includes chemical modification of one, two, three, four, or five bases at the 5' end, and / or chemical modification of one, two, three, four, or five bases at the 3' end.

[0049] For example, chemical modification may be performed on the 5' end of the sgRNA at the following bases: the 1st, 2nd, 3rd, 4th, and 5th bases, or the 1st-2nd, 1st-3rd, 1st-4th, and 1st-5th bases; and / or, chemical modification may be performed on the 3' end of the sgRNA at the following bases: the 1st, 2nd, 3rd, 4th, and 5th bases, or the 1st-2nd, 1st-3rd, 1st-4th, and 1st-5th bases. The chemical modification may be one or more of methylation, fluorination, or thiolation.

[0050] For example, in this invention, the 5' end three bases and the 3' end three bases of the designed sgRNA are thiolated and methylated.

[0051] Methods for introducing base editors and sgRNA into host cells include, but are not limited to, liposome delivery, nanoparticle delivery, vector, transfection, heat shock, electroporation, transduction, gene gun, and microinjection.

[0052] In one implementation, the base editor is selected as ABE8e, and an mRNA transfection reagent (e.g., Lipofectamine) is used. TM MessengerMAX TM The transfection reagent (Invitrogen, #LMRNA003) introduces a complex containing ABE8emRNA and sgRNA into the cells.

[0053] Furthermore, the molar ratio of ABE8e mRNA to sgRNA is 1:0.5-3, preferably 1:1-2, and more preferably 1:1.

[0054] Furthermore, the ABE8e mRNA and sgRNA form a complex through incubation; preferably, the incubation temperature is 20-50°C, more preferably, 25-37°C; preferably, the incubation time is 2-20 minutes, more preferably, 5-10 minutes.

[0055] Furthermore, the ratio of the complex containing ABE8e mRNA and sgRNA to cells is (10-2000 ng): (1 × 10⁻⁶ cells / cells) 2 -1×10 6 (1×10) , preferably 1000 ng of the complex: (1×10) 5 -3×10 5 (Number) cells.

[0056] Furthermore, the transfected cells were expanded and cultured for 3 days, and the genomic DNA of the cells obtained in the above steps was extracted for single-base editing identification to determine the editing efficiency. After the mutation was identified, the cells were expanded for another 3 days, RNA was extracted, reverse transcribed into cDNA, and the mRNA expression level of the TGFBI gene was detected by qPCR.

[0057] The present invention also provides cells modified by sgRNA targeting according to the first aspect of the present invention, said cells including ex vivo cells.

[0058] This invention protects the use of any of the methods described above, the sgRNA, or the recombinant cells in the preparation of products for treating and / or alleviating corneal dystrophy. Nucleases and specifically targeted sgRNAs can be delivered to corneal cells via various methods, including but not limited to nanolipid delivery, viral vector delivery, and transfection. This can reduce or avoid the side effects caused by TGFBI gene mutations, restore corneal transparency, significantly delay visual impairment, avoid corneal transplantation, and achieve a cure.

[0059] Beneficial effects of the present invention

[0060] (1) This invention designs highly sequence-specific sgRNAs targeting the intron and exon RNA splicing sites of the TGFBI gene, providing the possibility for more precise and flexible editing. Introducing the above-mentioned sgRNAs and base editors into cells can efficiently edit splicing sites. By editing the splicing sites with the maximum possible mutation through single-base editing, it leads to disordered RNA splicing translation and the appearance of premature termination codons. Under the action of the NMD mechanism, the pathogenic TGFBI mRNA byproducts are safely and efficiently degraded, and the periosteal protein POSTN associated with the pathogenic gene compensates for the function of the TGFBI gene in the cornea, which greatly alleviates and treats the symptoms of corneal dystrophy.

[0061] (2) The sgRNA used in this invention is used to prepare drugs for corneal dystrophy. It has the advantages of long-lasting and stable efficacy, no obvious adverse reactions, low treatment frequency, good patient compliance and low treatment cost. The effective degradation efficiency of the treatment exceeds 50%. If a base editor is used, there is no risk of DNA double strand breakage and chromosome breakage. It can also efficiently restore corneal transparency and improve vision damage. Attached Figure Description

[0062] The accompanying drawings, which are included to provide a further understanding of this application and form part of this application, illustrate exemplary embodiments of this application and are used to explain this application, but do not constitute an undue limitation of this application. In the drawings:

[0063] Figure 1 This is a schematic diagram of the TGFBI gene RNA splicing site and the sgRNA-1 target location.

[0064] Figure 2 This is a schematic diagram of the Sanger sequencing results. The top image shows the blank control group 1; the bottom image shows the experimental group transfected with sgRNA-1.

[0065] Figure 3 The efficiency of deep sequencing of single-base mutations at the RNA splicing site of the TGFBI gene for sgRNA-3 targeted editing is shown, where the bolded bases represent substitutions.

[0066] Figure 4 This is a schematic diagram of qPCR showing the expression level of TGFBI in HepG2 cells after RNA splicing site mutation.

[0067] Figure 5 This is a schematic diagram of exon RT-PCR gel electrophoresis after RNA splicing site mutation in HepG2 cells. Detailed Implementation

[0068] The present invention will be further described in detail below with reference to the specific embodiments and accompanying drawings. The scope of protection of the present invention is not limited to the following embodiments. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in the present invention and are protected by the appended claims. The processes, conditions, reagents, experimental methods, etc., for carrying out the present invention, except as specifically mentioned below, are all common knowledge and general knowledge in the art, and the present invention does not have any particular limitations. As described in Sambrook et al., Molecular Cloning, Laboratory Manual, New York: ColdSpring Harbor Laboratory Press, 1989, or according to the manufacturer's recommended conditions.

[0069] This invention utilizes CRISPR-Cas single-base editing technology to design sgRNA that targets and edits the RNA splicing site of the TGFBI gene. The sgRNA can recognize and guide the base editor ABE8e to the target gene sequence, target and edit the TGFBI pathogenic gene RNA splicing site, form a prematurely terminated codon, correct RNA splicing abnormalities and translation disorders, trigger the NMD mechanism, and thus degrade the side effects of the pathogenic gene.

[0070] Unless otherwise specified, all reagents and materials used in the following examples are commercially available; all experimental methods, unless otherwise specified, are standard experimental methods in the art. The examples used HepG2 cells with normal TGFBI gene expression, which efficiently degrade the byproducts of the corneal dystrophic gene TGFBI within the cells.

[0071] Example 1: Design of sgRNA

[0072] The TGFBI gene was edited using the CRISPR-Cas editing method, and the gRNA targeting domain (with the same nucleotide sequence as the target sequence) was identified as either a promoter element or exon 2 of the TGFBI gene.

[0073] Based on the presence of a suitable PAM sequence at the TGFBI gene RNA splicing site, multiple sgRNAs were designed, including the sgRNA target sequences described in SEQ ID Nos. 1-68 in Table 1, as well as variants that can achieve the same function and have a nucleotide sequence identity of more than 66% with sgRNA-1 to 68.

[0074] Example 2: Preparation of sgRNA and ABE8e mRNA

[0075] 1. sgRNA preparation

[0076] sgRNA1-68 was chemically synthesized (by Platinum Biotech (Shanghai) Co., Ltd.), and sgRNAs were designed and oligonucleotides were synthesized based on the target sequence. The target sequence of the sgRNA used is shown in SEQ ID NO:1-68.

[0077] A CACC sequence was added to the 5' end of the upstream sequence of each sgRNA target sequence, and an AAAC sequence was added to the 5' end of the downstream sequence. After synthesis, the upstream and downstream sequences were annealed using a pre-defined program (95℃, 5 min; 95℃-85℃ at -2℃ / s; 85℃-25℃ at -0.1℃ / s; held at 4℃). The annealed products were then ligated into the lenti U6-sgRNA / EF1a-mCherry vector (Addgene, Plasmid#114199) linearized with BbsI (NEB, R3539S).

[0078] The system used in the construction of the sgRNA plasmid is as follows: The linearization system of the lenti U6-sgRNA / EF1a-mCherry vector is as follows: 3 μg vector; 6 μL buffer (NEB: R0539L); 2 μL BbsI; ddH2O to make up to 60 μL, digested overnight at 37℃.

[0079] The ligation system of the annealed sgRNA product and the linearized vector lenti U6-sgRNA / EF1a-mCherry vector is as follows: 1 μL T4 ligase buffer (NEB: M0202L), 20 ng linearized vector, 5 μL annealed oligo fragment (10 μM), 0.5 μL T4 ligase (NEB: M0202L), and ddH2O to bring the total volume to 10 μL. Ligation is carried out overnight at 16°C.

[0080] The ligation vector was transformed into *E. coli* DH5α competent cells (Weidi Bio, DL1001). The specific procedure is as follows: DH5α competent cells were removed from -80℃ and immediately placed on ice. After 5 minutes, once the bacterial block had thawed, the ligation product was added, and the mixture was gently stirred by tapping the bottom of the centrifuge tube. The cells were then incubated on ice for 25 minutes. A heat shock was performed at 42℃ for 45 seconds, followed by immediate return to ice and incubation for 2 minutes. 700 μl of antibiotic-free sterile LB medium was added to the centrifuge tube, mixed, and incubated at 37℃, 200 rpm for 60 minutes. The cells were harvested by centrifugation at 5000 rpm for one minute. Approximately 100 μl of the supernatant was collected, gently resuspended by pipetting, and spread onto LB medium containing Amp antibiotics. The plates were inverted and incubated overnight at 37℃. Single colonies were picked, confirmed by sequencing, and positive clones were shaken and plasmids (TIANGEN: DP120-01) were extracted and their concentration determined. The plasmids were then stored at -20℃ for later use.

[0081] 2. The ABE8e plasmid was purchased from Addgene (Plasmid, #138489) and ABE8emRNA was prepared by in vitro transcription (IVT) for later use.

[0082] The amino acid sequence of ABE8e is as follows:

[0083]

[0084]

[0085] In this sequence, bolded sequences represent sequences derived from nCas9; italic sequences represent adapter sequences; double-underlined sequences represent nuclear localization sequences (NLS); single-underlined sequences represent ecTadA* deaminase sequences; and a * at the C-terminus indicates the position of a stop codon.

[0086] Correspondingly, the ABE8e nucleotide sequence is as follows:

[0087] atgaaacggacagccgacggaagcgagttcgagtcaccaaagaagaagcggaaagtctctgaggtggagttttcccacgagtactggatgagacatgcc

[0088] ctgaccctggccaagagggcacgggatgagagggaggtgcctgtgggagccgtgctggtgctgaacaatagagtgatcggcgagggctggaacagagccat

[0089] cggcctgcacgacccaacagcccatgccgaaattatggccctgagacagggcggcctggtcatgcagaactacagactgattgacgccaccctgtacgtgacat

[0090] tcgagccttgcgtgatgtgcgccggcgccatgatccactctaggatcggccgcgtggtgtttggcgtgaggaactcaaaaagaggcgccgcaggctccctgatg

[0091] aacgtgctgaactaccccggcatgaatcaccgcgtcgaaattaccgagggaatcctggcagatgaatgtgccgccctgctgtgcgatttctatcggatgcctagac

[0092] aggtgttcaatgctcagaagaaggcccagagctccatcaactccggaggatctagcggaggctcctctggctctgagacacctggcacaagcgagagcgcaac

[0093] acctgaaagcagcgggggcagcagcggggggtcagacaagaagtacagcatcggcctggccatcggcaccaactctgtgggctgggccgtgatcaccgacg

[0094] agtacaaggtgcccagcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccctgctgttcgacagcggcgaaa

[0095] cagccgaggccacccggctgaagagaaccgccagaagaagatacaccagacggaagaaccggatctgctatctgcaagagatcttcagcaacgagatggcca

[0096] aggtggacgacagcttcttccacagactggaagagtccttcctggtggaagaggataagaagcacgagcggcaccccatcttcggcaacatcgtggacgaggtg

[0097] gcctaccacgagaagtaccccaccatctaccacctgagaaagaaactggtggacagcaccgacaaggccgacctgcggctgatctatctggccctggcccacat

[0098] gatcaagttccggggccacttcctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatccagctggtgcagacctacaaccagctgtt

[0099] cgaggaaaaccccatcaacgccagcggcgtggacgccaaggccatcctgtctgccagactgagcaagagcagacggctggaaaatctgatcgcccagctgcc

[0100] cggcgagaagaagaatggcctgttcggaaacctgattgccctgagcctgggcctgacccccaacttcaagagcaacttcgacctggccgaggatgccaaactgc

[0101] agctgagcaaggacacctacgacgacgacctggacaacctgctggcccagatcggcgaccagtacgccgacctgtttctggccgccaagaacctgtccgacgc

[0102] catcctgctgagcgacatcctgagagtgaacaccgagatcaccaaggcccccctgagcgcctctatgatcaagagatacgacgagcaccaccaggacctgacc

[0103] ctgctgaaagctctcgtgcggcagcagctgcctgagaagtacaaagagattttcttcgaccagagcaagaacggctacgccggctacattgacggcggagccag

[0104] ccaggaagagttctacaagttcatcaagcccatcctggaaaagatggacggcaccgaggaactgctcgtgaagctgaacagagaggacctgctgcggaagcag

[0105] cggaccttcgacaacggcagcatcccccaccagatccacctgggagagctgcacgccattctgcggcggcaggaagatttttacccattcctgaaggacaaccg

[0106] ggaaaagatcgagaagatcctgaccttccgcatcccctactacgtgggccctctggccaggggaaacagcagattcgcctggatgaccagaaagagcgaggaa

[0107] accatcaccccctggaacttcgaggaagtggtggacaagggcgcttccgcccagagcttcatcgagcggatgaccaacttcgataagaacctgcccaacgagaa

[0108] ggtgctgcccaagcacagcctgctgtacgagtacttcaccgtgtataacgagctgaccaaagtgaaatacgtgaccgagggaatgagaaagcccgccttcctga

[0109] gcggcgagcagaaaaaggccatcgtggacctgctgttcaagaccaaccggaaagtgaccgtgaagcagctgaaagaggactacttcaagaaaatcgagtgctt

[0110] cgactccgtggaaatctccggcgtggaagatcggttcaacgcctccctgggcacataccacgatctgctgaaaattatcaaggacaaggacttcctggacaatgag

[0111] gaaaacgaggacattctggaagatatcgtgctgaccctgacactgtttgaggacagagagatgatcgaggaacggctgaaaacctatgcccacctgttcgacgac

[0112] aaagtgatgaagcagctgaagcggcggagatacaccggctggggcaggctgagccggaagctgatcaacggcatccgggacaagcagtccggcaagacaat

[0113] cctggatttcctgaagtccgacggcttcgccaacagaaacttcatgcagctgatccacgacgacagcctgacctttaaagaggacatccagaaagcccaggtgtcc

[0114] ggccagggcgatagcctgcacgagcacattgccaatctggccggcagccccgccattaagaagggcatcctgcagacagtgaaggtggtggacgagctcgtg

[0115] aaagtgatgggccggcacaagcccgagaacatcgtgatcgaaatggccagagagaaccagaccacccagaagggacagaagaacagccgcgagagaatga

[0116] agcggatcgaagagggcatcaaagagctgggcagccagatcctgaaagaacaccccgtggaaaacacccagctgcagaacgagaagctgtacctgtactacc

[0117] tgcagaatgggcgggatatgtacgtggaccaggaactggacatcaaccggctgtccgactacgatgtggaccatatcgtgcctcagagctttctgaaggacgact

[0118] ccatcgacaacaaggtgctgaccagaagcgacaagaaccggggcaagagcgacaacgtgccctccgaagaggtcgtgaagaagatgaagaactactggcgg

[0119] cagctgctgaacgccaagctgattacccagagaaagttcgacaatctgaccaaggccgagagaggcggcctgagcgaactggataaggccggcttcatcaaga

[0120] gacagctggtggaaacccggcagatcacaaagcacgtggcacagatcctggactcccggatgaacactaagtacgacgagaatgacaagctgatccgggaag

[0121] tgaaagtgatcaccctgaagtccaagctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatcaacaactaccaccacgcccacgacgccta

[0122] cctgaacgccgtcgtgggaaccgccctgatcaaaaagtaccctaagctggaaagcgagttcgtgtacggcgactacaaggtgtacgacgtgcggaagatgatcg

[0123] ccaagagcgagcaggaaatcggcaaggctaccgccaagtacttcttctacagcaacatcatgaactttttcaagaccgagattaccctggccaacggcgagatcc

[0124] ggaagcggcctctgatcgagacaaacggcgaaaccggggagatcgtgtgggataagggccgggattttgccaccgtgcggaaagtgctgagcatgccccaag

[0125] tgaatatcgtgaaaaagaccgaggtgcagacaggcggcttcagcaaagagtctatcctgcccaagaggaacagcgataagctgatcgccagaaagaaggactg

[0126] ggaccctaagaagtacggcggcttcgacagccccaccgtggcctattctgtgctggtggtggccaaagtggaaaagggcaagtccaagaaactgaagagtgtg

[0127] aaagagctgctggggatcaccatcatggaaagaagcagcttcgagaagaatcccatcgactttctggaagccaagggctacaaagaagtgaaaaaggacctgat

[0128] catcaagctgcctaagtactccctgttcgagctggaaaacggccggaagagaatgctggcctctgccggcgaactgcagaagggaaacgaactggccctgccct

[0129] ccaaatatgtgaacttcctgtacctggccagccactatgagaagctgaagggctcccccgaggataatgagcagaaacagctgtttgtggaacagcacaagcact

[0130] acctggacgagatcatcgagcagatcagcgagttctccaagagagtgatcctggccgacgctaatctggacaaagtgctgtccgcctacaacaagcaccgggat

[0131] aagcccatcagagagcaggccgagaatatcatccacctgtttaccctgaccaatctgggagcccctgccgccttcaagtactttgacaccaccatcgaccggaagaggtacaccagcaccaaagaggtgctggacgcc accctgatccaccagagcatcaccggcctgtacgagacggatcgacctgtctcagctgggaggtgactctggcggctcaaaaagaaccgccgacggcagcgaattcgagcccaagaagaagaggaaagtctaa(SEQ ID NO:78)

[0132] Example 3: Validation of the editing effect of sgRNA targeting the TGFBI gene

[0133] (1) Cell transfection of sgRNA and ABE8e mRNA

[0134] Two sets of experiments were designed, including an experimental group and a blank control group. The specific experimental procedures are as follows:

[0135] a. Experimental Group

[0136] The day before transfection, the cultured HepG2 cells were passaged and seeded into plates. HepG2 cells at approximately 90% confluence in 48-well plates were digested with 0.25% trypsin at 37°C for 5 min. After removing the trypsin, culture medium containing fetal bovine serum was added, and the cells were thoroughly mixed and seeded at a 1:4 ratio, with approximately 2 × 10⁶ cells per well. 5 They are cultivated overnight for transfection.

[0137] Remove the culture medium before transfection and add 400 μl of fresh culture medium. Add 15 μl of serum-free DMEM to an EP tube. Add the synthesized chemically modified sgRNA (thiolated and methylated at the 5' and 3' ends of the sgRNA) and ABE8e mRNA to the DMEM at a molar ratio of 1:1 (total 500 ng) and incubate at room temperature for 5 min to obtain solution A. Take another EP tube, add 15 μl of serum-free DMEM, and add 1 μl of Lipofectamine mRNA transfection reagent. TM MessengerMAX TM The transfection reagent (Thermo Fisher, #LMRNA015) was incubated at room temperature for 5 min to obtain solution B; then solutions A and B were mixed and incubated at room temperature for 5 min to prepare a complex of sgRNA, ABE8emRNA and mRNA transfection reagent; then the complex was gently dripped into HepG2 cells in 48-well plates, with 0.5 μL added to each well, and the cells were further amplified and cultured for 3 days after transfection.

[0138] b. Blank control group

[0139] The procedure was carried out according to the method of group a, using HepG2 cells, with the difference that the sgRNA was replaced with an equal volume of water and co-transfected into HepG2 cells with ABE8e mRNA (250 ng).

[0140] (2) Evaluation of the effect of single-base editing at the target splice site

[0141] a. Identification of mutations in genomic DNA

[0142] After 3 days of amplification and culture, a suitable amount of HepG2 cells was collected for genomic DNA extraction. Following PCR amplification, Sanger sequencing and deep sequencing were performed to detect single-base editing efficiency (i.e., the efficiency of donor disruption at the TGFBI RNA splicing site). The remaining cells were further cultured, and the results were as follows: Figure 2 and Figure 3 As shown.

[0143] The primer sequences for PCR amplification, Sanger sequencing, and deep sequencing are as follows:

[0144] TGFBI-check-1F: GGAGTGAGTACGGTGTGC GTACACGGACCGCACGGAGA(SEQ ID No.69);

[0145] TGFBI-check-1R: GAGTTGGATGCTGGATGG TGACTGCAGACTCCCATTCA (SEQ ID No. 70).

[0146] Figure 2 As shown in the figure above, the blank control group 1 (wild-type HepG2 cells, without any sgRNA transfection) has a normal sequencing peak. The experimental group in the figure below, transfected with the sgRNA-1 and ABE8e mRNA complex, shows a base change of A>G in the sgRNA sequence editing window.

[0147] Sequencing results were analyzed using EditR to determine the editing efficiency (%) of sgRNA target sequence sites from A to G. Figure 3 The results showed that, compared with wild-type cells, the cells transfected with sgRNA-1 as shown in SEQ ID No. 1 had a higher effective single-base editing efficiency at the target splice site (up to 42.11%) (the method for calculating the editing efficiency is described in Kluesner MG, Nedveck DA, Lahr WS, Garbe JR, Abrahante JE, Webber BR, Moriarity BS. EditR: A Method to Quantify Base Editing from Sanger Sequencing. CRISPR J. 2018 Jun; 1(3):239-250. doi:10.1089 / crispr.2018.0014.PMID:31021262;PMCID:PMC6694769).

[0148] Similarly, the inventors used sgRNA-2 and sgRNA-3, respectively, to transfect cells with ABE8e mRNA using the above method. Editing efficiency tests showed that the editing efficiency using sgRNA-3 and ABE8e was as high as 62% (see [link to original text]). Figure 3 The base editing efficiency using sgRNA2 and ABE8e is approximately 51%.

[0149] Therefore, the sgRNA1 to sgRNA3 designed in this invention are all highly efficient (editing efficiency of up to 42.11% or more).

[0150] Furthermore, the inventors used sgRNA4-68 and ABE8e mRNA respectively to transfect cells using the above method. After editing efficiency testing, they obtained a significant base editing efficiency, and both were able to achieve effective editing.

[0151] b. The inventors also analyzed cells edited with pathogenic gene RNA splicing sites using q-PCR. TGFBI Gene expression The quantity was tested.

[0152] Once the target site mutation is confirmed by Sanger sequencing, cells can be collected to extract RNA and obtain cDNA through reverse transcription. q-PCR analysis will then be used to analyze the changes in TGFBI mRNA expression levels in cells after the mutation at the pathogenic gene RNA splicing site.

[0153] The primer pairs used for q-PCR specific detection of β-actin internal control and TGFBI are as follows:

[0154] actin-qPCR-F: AGCTCACCATGGATGATGATATCGC (SEQ ID No. 71);

[0155] actin-qPCR-R: CACATAGGAATCCTCTGACCCAT (SEQ ID No. 72);

[0156] TGFBI-qPCR-F: AGGCCTTCGAGAAGATCCCT (SEQ ID No. 73);

[0157] TGFBI-qPCR-R: CAACGATGGCTTCAGCACAC (SEQ ID No. 74).

[0158] RT-PCR was used to specifically detect the splicing site of the sgRNA mutation shown in SEQ ID No. 1. The primer sequences used are as follows:

[0159] Exon1-F:TTGCCCGTCGGTCGCTAGCT (SEQ ID No. 75);

[0160] Exon5-R:CTGGATGTTGGAATTCTGGTA (SEQ ID No. 76).

[0161] Result: As Figure 4 As shown, compared with wild-type cells, the mRNA level of TGFBI in cells after single-base editing of ABE8e guided by sgRNA-1 (shown in SEQ ID No. 1) was significantly downregulated, decreasing to below 10%, compared with the internal control β-actin. Figure 4 It can be seen that using sgRNA-2 to 3 as guide RNA can also significantly downregulate the mRNA expression level of TGFBI, reducing it to below 20% compared to the internal control β-actin, thus achieving effective editing.

[0162] like Figure 5As shown, the products of TGFBI gene exon RT-PCR after precursor RNA splicing were also detected by 1% agarose gel electrophoresis: after editing with sgRNA-1 as the guide RNA base editor, compared with the normal splicing results of wild-type WT, about 150 bp of coding fragment was lost. Based on the characteristics of abnormal RNA splicing, there may be a loss of 161 bp of exon 4 after sgRNA editing as shown in SEQ ID No. 1. Figure 5 The segment indicated by the middle arrow may be the 161bp segment lost in the fourth exon of the TGFBI gene.

[0163] Depend on Figure 2 , Figure 3 It is known that the targeted editing efficiency of sgRNA-1 as a guide RNA exceeds 50%, which is sufficient to prove that the base editing targeted by this sgRNA disrupts the RNA splicing site. The stop codon generated after editing significantly inhibits the expression of the TGFBI gene. The nonsense-mediated RNA degradation (NMD) mechanism can degrade prematurely terminated codons to form truncated pathogenic gene mRNA as a byproduct. In this application, the periosteal protein POSTN associated with the pathogenic gene compensates for the function of the TGFBI gene in the cornea, effectively treating corneal dystrophy. In this embodiment, the target sequence of the sgRNA is only a display sequence. The following sequences can also be used as sgRNA: CCCCTACCCCATTAGGATAG (SEQ ID No. 4), CCTTACCCGAAGGGTCTCAA (SEQ ID No. 5), GCTCACCTCTCAGGGCTTCT (SEQ ID No. 6), TGCTCACCTCTCAGGGCTTC (SEQ ID No. 7), CTCTTCAGCCAACAGACCTC (SEQ ID No. 8), and other sgRNA sequences in Table 1. In the sgRNA sequence, the base "AC" is the RNA splicing donor, the base "GT" is the reverse complementary sequence, and the base "AG" is the RNA splicing acceptor sequence.

[0164] In another embodiment, nucleases such as those from the Cas9 family and Cas12 family are used to target specific sites on the TGFBI gene. By cutting the target site, DNA double-strand breaks can be generated, which will lead to sequence deletions in the original DNA sequence, resulting in a large proportion of frameshift mutations. This causes gene expression to terminate due to the premature appearance of the stop codon, thus achieving the therapeutic purpose.

[0165] Contents not described in detail in this specification are prior art known to those skilled in the art. The above descriptions are merely embodiments of this application and are not intended to limit the scope of this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the scope of the claims of this application.

Claims

1. An sgRNA targeting the intron-exon RNA splice site of the TGFBI gene, characterized in that, The sgRNA is used to guide the base editor to perform base editing on the RNA splicing site targeting the TGFBI gene to form a prematurely terminated codon. The target sequence of the sgRNA sequence is the sequence shown in SEQ ID NO.

1.

2. The sgRNA according to claim 1, wherein the sgRNA has undergone base chemical modification; the modification is selected from one or any combination of methylation modification, methoxy modification, fluorination modification or thio modification.

3. An sgRNA expression vector targeting the TGFBI gene, said expression vector comprising a nucleotide sequence encoding the sgRNA as described in any one of claims 1-2.

4. A composition for targeted editing of a TGFBI gene, comprising: Guide RNA system and base editor system, said guide RNA system comprising sgRNA as described in any one of claims 1-2, or a polynucleotide encoding sgRNA as described in any one of claims 1-2.

5. The composition for targeted editing of the TGFBI gene according to claim 4, wherein the guide RNA system comprises the sgRNA according to any one of claims 1-2; and the base editor system is ABE8e.

6. Use of the sgRNA of any one of claims 1-2, the expression vector of claim 3, or the composition of any one of claims 4-5 in the preparation of a medicament for treating TGFBI gene-related corneal dystrophy, wherein the treatment is achieved by the sgRNA guiding a base editor to edit the RNA splicing site of the TGFBI gene, triggering nonsense-mediated mRNA degradation.

7. A host cell comprising the composition of any one of claims 4-5.

8. The host cell as described in claim 7, wherein the host cell is an ocular corneal stromal cell, an ocular corneal epithelial cell, or an ocular posterior corneal fibrous membrane cell.

Images