Molecular markers, kits for diagnosing cancer and use thereof

Abstract

The present application relates to a kind of molecular marker for diagnosing cancer, kit and its application, belong to biotechnology field.The present application provides the m 6 A modification as a molecular marker for diagnosing cancer, the m 6 A modification site is A923, A930 and A955, 3 m 6 A modification site is regulated by demethylase FTO and ALKBH5, promotes HRAS protein expression and the proliferation and metastasis of cancer cell.The present application first identifies the epigenetic transcription modification of HRAS and clarifies relevant molecular mechanism, provides new single / combination targeting treatment theoretical basis for RAS this "difficult drug target".

Description

Technical Field

[0001] This invention relates to molecular markers, reagent kits, and their applications for diagnosing cancer, and belongs to the field of biotechnology. Background Technology

[0002] The occurrence and development of tumors is a multi-step, gradual evolutionary process. During the transformation of normal cells into tumor cells, cells gradually acquire characteristic features, including four major enabling features: genomic instability, mutation, non-mutant epigenetic modifications, and microbiome polymorphism. These enabling features enable normal cells to exhibit the phenotypic characteristics of tumor cells, ultimately leading to malignant lesions. Clearly, studying and inhibiting the enabling features of tumor cells can prevent the emergence and continued development of tumor cell phenotypic characteristics from the source. In-depth analysis of the enabling features of key regulatory genes in tumors is a key strategy for studying malignant cellular diseases.

[0003] The RAS gene family, including KRAS, HRAS, and NRAS, is one of the most important driver mutations in tumors. RAS protein, a product of RAS gene expression, is a monomeric GTP-binding protein composed of 190 amino acid residues. It is activated when binding to GTP and inactive when binding to GDP. RAS protein also acts as a switch protein for GTPases, controlling numerous downstream signaling pathways. Located on the inner side of the cell membrane, RAS protein can effectively receive extracellular growth signals. In the wild-type RAS gene, upregulation of epidermal growth factor receptor and other tyrosine kinases can lead to sustained RAS-GTP activation. Activated RAS... -GTP further regulates multiple downstream effector molecules, such as Raf kinase and PI3K kinase, thereby activating multiple cellular signaling pathways, including the classic RAS-Raf-MEK-ERK, RAS-PI3K-AKT, RAS-TIAM1-Rac, and RAS-PLCε-PKC. These activated signaling pathways endow tumors with various iconic phenotypic features such as cell proliferation and metastasis. It can be seen that RAS is an important "molecular switch" for signal transduction and mediating tumor formation. Expanding the research on the dysregulation mechanism of RAS gene in tumors and elucidating the main regulatory factors will undoubtedly provide a new theoretical basis for single / combination targeted therapy for this "difficult-to-drug target".

[0004] For decades, most research has focused on the impact of RAS mutations on protein activity, and the tumor phenotypes and regulatory molecular mechanisms resulting from RAS mutations. However, with advancements in research techniques, recent years have seen the discovery of novel, non-classical mechanisms by which the RAS signaling pathway regulates tumors. For example, oncogenic RAS signaling can reduce the amount of m molecules surrounding the translation start codon. 6A-methylation modification reduces ribosome initiation arrest, accelerates protein translation, and thus accelerates tumor growth; RAS signaling, by weakening the activity of the RNA-binding protein tri- and tetra-proline, inhibits its ability to degrade PD-L1 mRNA, thereby promoting PD-L1 expression levels and leading to tumor immune escape; studies have revealed that RAS proteins exist in different cellular compartments, producing different output signals, thereby controlling their ability to induce oncogenic transformation; more interestingly, wild-type RAS plays an inhibitory role in tumors with mutations of its own gene, while playing a pro-cancer role in tumors with mutations of the other two genes in the same family; thus, the process by which the RAS protein family drives tumors is multi-pathway and multi-modal, with background dependence and complexity, and its oncogenic signal transduction and role in cancer pathogenesis still need to be determined; therefore, further elucidating the background-dependent molecular regulatory signaling pathways of RAS proteins will provide a more complete molecular mechanism for the role of RAS proteins in tumor occurrence and development.

[0005] Epigenetic transcriptional modification refers to chemical modifications present on RNA molecules, representing a novel post-transcriptional gene expression regulation mechanism; among which, m 6 RNA modification (A) is the most abundant type of RNA modification. It requires the synergistic action of three types of enzymes: writing proteins, erasing proteins, and reading proteins. These proteins influence gene expression levels or localization by regulating mRNA precursor processing, splicing, localization, stability, and translation. Studies have found that m... 6 A modification levels are generally dysregulated in human tumors, particularly enriched on the transcripts of tumor driver genes, regulating their expression levels to enhance their tumor-driving effects; for example, m 6 A modifier of the epidermal growth factor EGFR transcript promotes its protein expression by accelerating its translation efficiency, leading to tumorigenesis in lung cancer; m 6 A modifier enhances the expression level of the tumor driver gene MYC by promoting its mRNA stability, leading to tumorigenesis in various tumor types; targeting m... 6 A regulatory enzyme can screen for specific inhibitors or targeted drugs to prevent the dysregulation of tumor functional or driver genes from upstream of the molecular pathway; however, whether epigenetic transcriptional modifications affect the expression of RAS family genes, mediate their oncogenic effects, and the underlying molecular mechanisms remain to be determined. Summary of the Invention

[0006] To address the above problems, this invention provides a molecular marker for diagnosing cancer, wherein the molecular marker is the m-value of the 3'UTR region of the HRAS gene. 6 A modifies.

[0007] In one embodiment of the present invention, the nucleotide sequence of the 3'UTR region of the HRAS gene is shown in SEQ ID NO:1.

[0008] In one embodiment of the present invention, the m 6 A modifies the A923, A930, and A955 sites of HRAS.

[0009] In one embodiment of the present invention, the m 6 A is modified at bases 139, 146, and 171 of SEQ ID NO.1.

[0010] In one embodiment of the present invention, the molecular marker further includes at least one of the FTO gene or the ALKBH5 gene.

[0011] The present invention also provides the application of reagents for detecting the levels of the above-mentioned molecular markers in a sample for testing in the preparation of products for diagnosing cancer.

[0012] In one embodiment of the present invention, the reagent comprises m targeting the 3'UTR region of the HRAS gene. 6 A modified primer-probe set.

[0013] In one embodiment of the present invention, the reagent includes at least one of a primer-probe set targeting the FTO gene or a primer-probe set targeting the ALKBH5 gene.

[0014] The present invention also provides the use of inhibitors in the preparation of medicaments for the prevention and / or treatment of cancer, said inhibitors having at least one of the following uses:

[0015] (a) Inhibit the m in the 3'UTR region of the HRAS gene, the above-mentioned molecular marker in cells. 6 Modification of A;

[0016] (b) Inhibit the m-type gene in the 3'UTR region of the HRAS gene, a molecular marker found in the cell. 6 A complex of modification and FTO gene;

[0017] (c) Inhibit the m-type gene in the 3'UTR region of the HRAS gene, a molecular marker found in the above cells. 6 A complex of modification and the ALKBH5 gene; and / or,

[0018] (d) Inhibit the m in the 3'UTR region of the HRAS gene, the above-mentioned molecular marker in cells. 6 A complex of A-modified, FTO gene and ALKBH5 gene.

[0019] The present invention also provides a diagnostic kit for diagnosing cancer, the diagnostic kit comprising reagents for detecting the levels of the aforementioned molecular markers in a sample to be tested.

[0020] In one embodiment of the present invention, the reagent comprises m targeting the 3'UTR region of the HRAS gene. 6 A modified primer-probe set.

[0021] In one embodiment of the present invention, the reagent includes at least one of a primer-probe set targeting the FTO gene or a primer-probe set targeting the ALKBH5 gene.

[0022] In one embodiment of the present invention, the cancer is bladder cancer.

[0023] The technical solution of this invention has the following advantages:

[0024] This invention provides a molecular marker for diagnosing cancer, wherein the molecular marker is the m-value of the 3'UTR region of the HRAS gene. 6 A modification; through m between the cancer and adjacent normal groups 6 Differential analysis of methylation modifications identified the presence of m in the 3'UTR of HRAS. 6 A-modification was observed, and the levels in cancerous tissues of various tumors were significantly higher than in adjacent normal tissues, while KRAS and NRAS showed no significant m-modification. 6 A modification; through rescue experiments at the cellular level, m was found 6 A-modification also enhances H-Ras protein expression, promoting the occurrence and development of bladder cancer; by using the dCas13b-FTO / ALKBH5 demethylase system to specifically demethylate the HRAS 3'UTR, it was found that the A923, A930, and A955 sites have the function of regulating H-Ras protein; based on tumor patient sample data collected from multiple sources, the correlation between the expression levels of HRAS and related abnormal molecules and tumor prognosis and treatment efficacy was explored, as well as the m of HRAS. 6 The correlation between A modification level and its expression level, tumor prognosis, and the correlation between HRAS and the expression level of related abnormal molecules provide potential biomarkers and therapeutic targets for the diagnosis and treatment of tumors such as bladder cancer. Attached Figure Description

[0025] Figure 1 Identification of epigenetic transcriptional modifications of RAS family genes.

[0026] Figure 2 m on the HRAS gene 6 Site identification of A.

[0027] Figure 3 : In vitro (cell) determination of HRAS m 6 The function of the A modification site.

[0028] Figure 4 : Determining HRAS m in vivo (mice)6 The function of the A modification site. Detailed Implementation

[0029] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.

[0030] For any experimental steps or conditions not specified in the following examples, the operation or conditions of conventional experimental steps described in the literature in this field can be followed; for any reagents or instruments whose manufacturers are not specified, they are all conventional reagent products that can be obtained commercially.

[0031] The 5637, T24, and HepG2 cells used in the following examples were purchased from the Cell Bank of the Chinese Academy of Sciences; the renal cell carcinoma tissue and paired adjacent normal tissue were obtained from the General Hospital of the Chinese People's Liberation Army.

[0032] The siRNAs used in the following examples are RNA sequences synthesized by Suzhou Gemma Gene Co., Ltd., specifically:

[0033] si-FTO-1: 5'-AUAGCCGCUGCUUGUGAGATT-3' (SEQ ID NO: 2);

[0034] si-FTO-2: 5'-GCAGAAUGUCUGUGACGAUTT-3' (SEQ ID NO: 3);

[0035] si-ALKBH5-1: 5'-ACAAGUACUUCUUCGGCGATT-3' (SEQ ID NO: 4);

[0036] si-ALKBH5-2: 5'-GCGCCGUCAUCAACGACUATT-3' (SEQ ID NO: 5).

[0037] The gRNAs used in the following examples are RNA sequences synthesized by Suzhou Genewiz Biotechnology Co., Ltd., specifically:

[0038] gRNA1: 5'-CCATCCAATAATTTACTGTGATCCCATCTGTGCCCGACAA-3' (SEQ ID NO: 42);

[0039] gRNA2: 5'-CTTCCTGCATCCGGCACCTCCATGTCCTGAGCTTGTGCTG-3' (SEQ ID NO: 43).

[0040] Example 1: A molecular marker

[0041] This embodiment provides a molecular marker, wherein the molecular marker is the m-value of the 3'UTR region of the HRAS gene. 6 Modified by A, the m 6 The A modification sites are A923, A930, and A955, which are located at the 139th, 146th, and 171st bases of SEQ ID NO.1, respectively. The nucleotide sequence of the 3'UTR region of the HRAS gene is: 5'-CGCAGCACAAGCTCAGGACATGGAGGTGCCGGATGCAGGAAGGAGGTGCAGACGGAAGGAGGAAGGAAGGAAGGACGGAAGCAAGGAAGGAAGGAAGGAAGGCTGCTGGAGCCCAGTCACCCCGGGACCGTGGGCCGAGGTGACTGCAGACCCTCCCAGGGAGGCTGTGCACAGACTGTCTTGAACATCCCAAATGCCACCGGAACCCCAGCCCTTAGCTCCCCTCCCAGGCCTCTGTGGGCCCTTGTCGGGCACAGATGGGATCACAGTAAATTATTGGATGGTCTTGA-3' (SEQ ID NO: 1).

[0042] Experimental Example 1: Identification of Epigenetic Transcriptional Modifications in RAS Family Genes

[0043] This experimental example provides an identification experiment for epigenetic transcriptional modifications of RAS family genes. The experimental procedure is as follows:

[0044] Experiment 1: A systematic search was performed in the GEO database to screen for m-data containing both cancerous and adjacent cancerous cells for four types of cancer: ovarian cancer (GSE119168), endometrial cancer (GSE93911), liver cancer (GSE120860), and colon cancer (GSE179042). 6AmeRIP sequencing data were downloaded, and the raw sequencing files were filtered using cutadapt v2.10 software to remove low-quality reads and reads shorter than 20 bases. Then, tophat v2.1.1 was used to align high-quality reads to the human GRCh37.87 reference genome and transcriptome, resulting in the accepted_hits.bam file. Finally, the exomePeak software package was used to analyze cancer and adjacent normal samples. 6 A-peak difference analysis; the accepted_hits.bam file was converted to BigWig format using bedtools genomecov and bedGraphToBigWig, and then imported into Integrative Genomics Viewer (IGV) to view the m-peak differences of the target gene. 6 A modifies the situation.

[0045] Experiment 2: Using 5637 cells, T24 cells, HepG2 cells, and clear cell renal cell carcinoma tissue and paired adjacent normal tissue, m 6 A-RIP experiments were conducted to verify that the 3'UTR of HRAS has m 6 A-modified RNA was extracted using 1 mL of Trizol (Thermo Fisher Scientific) and then processed using TURBO. TM The DNase kit (Thermo Fisher Scientific) was used to remove contaminating genomic DNA, and the RNA fragmentation reagents kit (Thermo Fisher Scientific) was used to break down the RNA, resulting in fragmented RNA samples; 5 μg of m... 6 Antibody A (Synaptic Systems) was conjugated with 30 μL of A / G magnetic beads (Thermo Fisher Scientific), and then incubated with 100 ng of fragmented RNA sample at 4°C for 6 hours (10 ng of RNA was used as input). 18 μL of proteinase K was added and the mixture was incubated at 55°C for 30 min to digest the RNA, resulting in immunoprecipitated RNA. The immunoprecipitated RNA was purified and recovered using 0.5 mL of Trizol to obtain the IP sample. 5 μL of both the input and IP samples were reverse transcribed and qRT-PCR was performed using Taq Pro Universal SYBRqPCR Master Mix (Nanjing Novizan Biotechnology Co., Ltd.) to verify the HRAS 3'UTRm. 6 The difference in modification levels between cancerous and adjacent tissues.

[0046] To identify whether epigenetic transcriptional modifications exist in RAS family gene transcripts, this invention primarily focuses on m 6 Modification of A, download m containing cancerous and adjacent tissues 6 AMeRIP sequencing data were used to differentiate between the cancer and adjacent normal tissue groups. 6 A. Differential analysis of methylation modifications; Figure 1 A showed the effects of HRAS, KRAS, and NRAS in ovarian cancer, liver cancer, endometrial cancer, and colon cancer. 6 At the A modification level, the 3'UTR of the HRAS transcript was significantly enriched in all four types of tumor tissues analyzed. 6 A modification, while neither the KRAS nor NRAS transcripts showed significant m modification. 6 A modifies.

[0047] Figure 1 B shows the 3'UTR of HRAS, KRAS, and NRAS in three cancer cell lines: 5637, HepG2, and T24. 6 At the A-level modification level, the 3'UTR of HRAS was significantly enriched in all three cancer cell lines. 6 A modification, while neither the KRAS nor NRAS transcripts showed significant m modification. 6 A modifies; Figure 1 C shows the 3'UTR of HRAS, KRAS, and NRAS in cancerous and adjacent tissues of clear cell renal cell carcinoma. 6 At the A modification level, compared to adjacent normal tissue, the 3'UTR of HRAS in clear cell renal cell carcinoma tissue was m 6 The level of modification A increased significantly.

[0048] Example 2-1: FTO knockdown cell group

[0049] This experimental example provides a cell group with FTO knockdown, which includes 5637, T24 and HepG2 cells. The method for knocking down FTO is as follows: the target cells are knocked down using siRNA (SEQ ID NO: 2) targeting the FTO gene, and the FTO knockdown cell group is obtained after 72 hours.

[0050] Example 2-2: FTO knockdown cell group

[0051] This experimental example provides a cell group with FTO knockout, which includes 5637, T24 and HepG2 cells. The method of knocking out FTO is as follows: based on Example 2-1, the siRNA (SEQ ID NO: 3) targeting different positions of FTO is replaced to obtain the cell group with FTO knockout.

[0052] Examples 2-3: Cell groups with ALKBH5 knockdown

[0053] This experimental example provides a cell group with ALKBH5 knockdown, which includes 5637, T24 and HepG2 cells. The method for knocking down ALKBH5 is as follows: the target cells are knocked down using siRNA (SEQ ID NO: 4) targeting the ALKBH5 gene. After 72 hours, the cell group with ALKBH5 knockdown is obtained.

[0054] Examples 2-4: Cell groups with ALKBH5 knockdown

[0055] This experimental example provides a cell group with ALKBH5 knockdown, which includes 5637, T24 and HepG2 cells. The method of knocking down ALKBH5 is as follows: based on Examples 2-3, the siRNA (SEQ ID NO: 5) targeting different positions of ALKBH5 is replaced to obtain the cell group with ALKBH5 knockdown.

[0056] Comparative Example 2-1: Cell Group

[0057] This comparative example provides cell groups that have not undergone knockdown treatment, including 5637, T24, and HepG2 cells.

[0058] Experimental Example 2: m on the HRAS gene 6 A Modification Site Identification

[0059] This experimental example provides functional m on the HRAS gene. 6 Site identification of A, based on m 6 A motif RRACH (R = G / A; H = A / C / U) finds 3 GGAC, 3 AGAC, 2 GAAC, and 1 nonclassical TGAC potential m in the 3'UTR of HRAS. 6 A-modified motifs; in 9 potential m 6 Primer sequences were designed at both ends of the A base modified with A to identify m on the HRAS gene. 6 A modification site, the primer sequence of which was customized from Suzhou Genewiz Biotechnology Co., Ltd., the experimental procedure is as follows:

[0060] RNA was extracted from cells by mixing 1 mL of Trizol with cell groups from Examples 2-1 to 2-4 and Comparative Example 2-1 in a 10 cm dish. 1 μg of the RNA sample, 40 nM of the upstream and downstream primers shown in Table 2, 5 μM of dNTPs, and 17 μL of 1×CutSmart buffer (NEB) were mixed to prepare the SELECT-qPCR sample. The SELECT-qPCR reaction samples were incubated using a PCR instrument (ABI, USA) at 90°C for 1 minute, 80°C for 1 minute, 70°C for 1 minute, 60°C for 1 minute, 50°C for 1 minute, and 40°C for 6 minutes to obtain a sample with RNA-primer specific binding. The sample was then removed and 3 μL of a mixture containing 0.01 U Bst 2.0 DNA polymerase, 0.5 U Splint R ligase, and 10 nM ATP was added. The mixture was then returned to its original state. In a PCR instrument (ABI, USA), the reaction was carried out at 40°C for 20 minutes and at 80°C for 20 minutes. Then, qRT-PCR detection was performed using Taq Pro Universal SYBR qPCR Master Mix (Nanjing Novizan Biotechnology Co., Ltd.).

[0061] Table 2. Potential m 6 Primer sequence listing for A-modified A bases

[0062]

[0063]

[0064] Figure 2 In this study, siNC served as the control group, siFTO.1 was the FTO knockdown cell group from Example 2-1, siFTO.2 was the FTO knockdown cell group from Example 2-2, siALK5.1 was the ALKBH5 knockdown cell group from Example 2-3, and siALK5.2 was the ALKBH5 knockdown cell group from Example 2-4; 9 potential m 6 Of the A-modified A base sites, only A923, A930, and A955 showed positive results, such as Figure 2 As shown, the three sites A923, A930, and A955 have different m values ​​in three cell lines that knock down the demethylases FTO and ALKBH5. 6 The level of modification A increased significantly, indicating that m 6 The A modification is located at positions A923, A930, and A955 of HRAS, specifically at bases 139, 146, and 171 of SEQ ID NO. 1; therefore, HRAS has three potential m 6 A modification site.

[0065] Example 3-1: 5637 cells specifically demethylated by HRAS 3'UTR

[0066] This embodiment provides 5637 cells with HRAS 3'UTR-specific demethylation. The demethylation method is as follows: referring to the method described in the literature Liu, J., Dou, X., Chen, C., Chen, C., Liu, C., Xu, MM, Zhao, S., Shen, B., Gao, Y., Han, D. & He, CN (6)-methyladenosine of chromosome-associated regulatory RNAregulates chromatin state and transcription. Science (New York, NY) 367, 580-586, doi:10.1126 / science.aay6018 (2020), a dCas13b-FTO demethylase system was constructed; referring to the method described in the literature Li, J., Chen, Z., Chen, F., Xie, G., Ling, Y., Peng, Y., Lin, Y., Luo, N., Chiang, CM & Wang, H. Targeted mRNA demethylation using an engineered dCas13b-ALKBH5 fusion protein. Nucleic Acids Res 48,5684-5694, doi:10.1093 / nar / gkaa269 (2020) constructed a dCas13b-ALKBH5 demethylase system. The dCas13b-FTO, the dCas13b-ALKBH5 demethylase system, and gRNA1 (SEQ ID NO: 43) targeting HRAS were co-transfected into 5637 cells using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific). After 48 hours, 5637 cells with HRAS 3'UTR-specific demethylation were obtained.

[0067] Example 3-2: 5637 cells specifically demethylated by HRAS 3'UTR

[0068] This embodiment provides 5637 cells with HRAS 3'UTR-specific demethylation. The demethylation method is as follows: based on Example 3-1, gRNA1 is replaced with gRNA2 (SEQ ID NO: 44) that targets different positions of HRAS to obtain 5637 cells with HRAS 3'UTR-specific demethylation.

[0069] Comparative Example 3-1: 5637 cells

[0070] This comparative example provided 5637 cells that had not been treated with past methyltransferases.

[0071] Experimental Example 3: HRAS m 6 Functional determination of A modification sites

[0072] This experimental example provides the m of HRAS 3'UTR. 6 The effect of A modification on molecular regulation was investigated experimentally as follows:

[0073] Experiment 1: 1 mL of Trizol was mixed with cells from Examples 2-1 to 2-4 and Comparative Example 2-1 in a 10 cm dish to extract RNA, obtaining RNA samples. 1 μg of the RNA sample, 40 nM of the upstream and downstream primers shown in Table 1, 5 μM of dNTPs, and 17 μL of 1×CutSmart buffer (NEB) were mixed to prepare the SELECT-qPCR reaction sample. The SELECT-qPCR reaction samples were incubated using a PCR instrument (ABI, USA) at 90°C for 1 minute, 80°C for 1 minute, 70°C for 1 minute, 60°C for 1 minute, 50°C for 1 minute, and 40°C for 6 minutes to obtain RNA-primer-specific binding reaction samples. These samples were then removed and 3 μL of a mixture containing 0.01 U Bst 2.0 DNA polymerase, 0.5 U SplintR ligase, and 10 nM ATP was added. The mixture was incubated at 40°C for 20 minutes, followed by 80°C for 20 minutes. qRT-PCR detection was performed using Taq Pro Universal SYBR qPCR Master Mix (Nanjing Novizan Biotechnology Co., Ltd.) to confirm the m at loci A923, A930, and A955. 6 A modifies.

[0074] Experiment 2: Cell groups from Examples 2-1 to 2-4 and Comparative Example 2-1 were lysed on ice for 15 minutes using Western blotting and IP cell lysis buffer (Beyotime Biotechnology Co., Ltd.). After centrifugation at 13,000 rpm, the supernatant was collected, 5x loading buffer was added, and the cells were denatured at 100 degrees Celsius for 10 minutes before Western blot experiments were performed.

[0075] Experiment 3: Cell proliferation ability was detected using the CELL TITER-GLO chemiluminescence assay kit (Promega), following the instructions in the manufacturer's manual; cell migration ability was detected using the Transwell chamber (Corning), following the instructions in the manufacturer's manual.

[0076] Figure 3 In this context, Con represents 5637 cells from Comparative Example 3-1, gRNA1 represents 5637 cells from Example 3-1 with HRAS 3'UTR-specific demethylation, and gRNA2 represents 5637 cells from Example 3-2 with HRAS 3'UTR-specific demethylation; as... Figure 3 As shown in Figure A, the three sites A923, A930, and A955 on the HRAS 3'UTR are specifically demethylated in m of 5637 cells. 6 The significantly reduced level of A-methyl modification verified that sites A923, A930, and A955 possess m 6 A modifies.

[0077] like Figure 3 As shown in B, after removing A923, A930, and A955, m... 6 After modification with A, the protein level of H-Ras was downregulated, indicating that these three sites have the function of regulating H-Ras protein.

[0078] After specific demethylation of HRAS 3'UTR, such as Figure 3 As shown in the line graph on the left side of C-D, the proliferation ability of cells 5637 is weakened; as Figure 3 The representative microscopic images between C and D and the quantitative diagram on the right show that the migration ability of 5637 cells is weakened.

[0079] Experimental Example 4: m of HRAS 3'UTR 6 Functional evaluation of modification A

[0080] This experimental example provides the m of HRAS 3'UTR. 6 The effect of A modification on molecular regulation was investigated experimentally as follows:

[0081] Experiment 1: Three groups of cells from Example 2-1, Comparative Example 2-1, and Comparative Example 2-2 were subcutaneously injected into the axilla of NSG mice. The injection volume was 3 cells per 10cm dish per mouse. The tumor volume was observed and recorded. After 25 days, the mice were dissected and the tumor tissue was removed. After weighing, the removed tumor tissue was fixed in 5% (m / v, g / 100mL) formaldehyde solution. The tissue was embedded in paraffin, sectioned, and then immunohistochemical experiments were performed using H-Ras and p-ERK antibodies to detect the expression levels of H-Ras and p-ERK.

[0082] Experiment 2: Three groups of cells from Example 2-1, Comparative Example 2-1, and Comparative Example 2-2 were injected into the tail vein of NSG mice at a dose of 3 cells per 10cm dish per mouse. After one month, the mice began to lose weight. The mice were dissected and lung tissue was removed. The tissue was embedded in paraffin, sectioned, stained with hematoxylin and eosin (HE), and the number of lung metastases was observed under a microscope to assess the metastatic ability of the mice's tumors.

[0083] Figure 4 In the table, Con represents 5637 cells from Comparative Example 3-1, gRNA1 represents 5637 cells from Example 3-1 with HRAS 3'UTR-specific demethylation, and gRNA2 represents 5637 cells from Example 3-2 with HRAS 3'UTR-specific demethylation; the results of Experiment 1 are as follows: Figure 4 As shown in A-E, injection of cells specifically demethylated by HRAS 3'UTR significantly reduced tumor growth volume and weight in mice. Figure 4 The expression levels of H-Ras and p-ERK were significantly reduced (A~C). Figure 4 (D~E); Results of Experiment 2 are as follows Figure 4 As shown in F, the number of lung metastases is significantly reduced, indicating a decreased metastatic potential.

[0084] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. The application of a reagent for detecting the level of molecular markers in a test sample in the preparation of products for diagnosing bladder cancer, characterized in that, The molecular marker is the m region of the 3'UTR of the HRAS gene. 6 A modification; the nucleotide sequence of the 3'UTR region of the HRAS gene is shown in SEQ ID NO:1, the m 6 The A modification sites are A923, A930, and A955, which are located at the 139th, 146th, and 171st bases of SEQ ID NO.1, respectively.

2. The application as described in claim 1, characterized in that, The reagent includes m targeting the 3'UTR region of the HRAS gene. 6 A modified primer-probe set.

3. The application of inhibitors of intracellular molecular markers in the preparation of drugs for treating bladder cancer, characterized in that, The molecular marker is the m region of the 3'UTR of the HRAS gene. 6 A modification; the nucleotide sequence of the 3'UTR region of the HRAS gene is shown in SEQ ID NO:1, the m 6 The A modification sites are A923, A930, and A955, which are located at bases 139, 146, and 171 of SEQ ID NO. 1, respectively; the inhibitors include the dCas13b-FTO demethylase system, the dCas13b-ALKBH5 demethylase system, and gRNA targeting HRAS; the nucleotide sequence of the gRNA targeting HRAS is shown in SEQ ID NO: 42 or SEQ ID NO: 43.

Images