Application of TRAPPC1 gene in the preparation of reagents for tumor diagnosis and / or prognosis

Abstract

This invention discloses the application of the TRAPPC1 gene in the preparation of reagents for tumor diagnosis and / or prognosis, and the application of TRAPPC1 gene inhibitors or pharmaceutical compositions containing TRAPPC1 gene inhibitors in the preparation of drugs for treating tumors. The reagents prepared from the TRAPPC1 gene exhibit high sensitivity and accuracy, providing reliable detection results; the drugs for treating tumors can significantly inhibit the proliferation of tumor cells, demonstrating excellent clinical application value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the TRAPPC1 gene in the preparation of reagents for the diagnosis and / or prognosis of glioblastoma. Background Technology

[0002] Gliomas are common primary tumors of the human central nervous system, with glioblastoma (GBM) being the most malignant and aggressive primary malignant tumor of the central nervous system, characterized by high incidence, high mortality, strong invasiveness, and poor prognosis. The average overall survival for newly diagnosed GBM patients remains <14.6 months, while the average overall survival for recurrent GBM patients is 6.9 months. Early-stage GBM is treated with radical surgery, but because early-stage GBM often presents with no obvious symptoms and lacks specific diagnostic indicators, most patients are diagnosed at an intermediate or advanced stage. Therefore, identifying key molecules for accurate early diagnosis and targeted therapy of GBM is urgently needed for GBM patients, and this is of great significance for the study of GBM mechanisms and for clinical diagnosis and treatment.

[0003] TRAPPC1 (Ensembl database ID: ENSG00000170043) is a protein-coding gene. It is primarily involved in the vesicle transport of intracellular proteins from the endoplasmic reticulum to the Golgi apparatus, maintaining cellular homeostasis. In current research, TRAPPC1 has only been found to potentially play a role in melanoma (PMID: 10582700). Summary of the Invention

[0004] To address the problem of low diagnostic accuracy for early-stage melanoma in existing technologies, this invention provides the application of biomarkers in the preparation of reagents for tumor diagnosis and / or prognosis.

[0005] In some implementations, the tumor is a glioblastoma.

[0006] The present invention further provides an application of a reagent kit in the preparation of a kit for tumor diagnosis and / or prognosis, the reagent kit comprising the TRAPPC1 gene and / or reagents for detecting the TRAPPC1 gene, the sequence of the TRAPPC1 gene being shown in SEQ ID NO: 1.

[0007] In some implementations, the tumor is a glioblastoma.

[0008] In some embodiments, the reagent kit further includes primer pairs for detecting the TRAPPC1 gene; and / or,

[0009] The reagent kit includes primer pairs for detecting the internal standard.

[0010] In some specific implementations, the internal standard is the GAPDH gene.

[0011] In some embodiments, the primer pair for detecting the TRAPPC1 gene includes an upstream primer and a downstream primer for the TRAPPC1 gene; and / or, the primer pair for detecting the internal standard includes an upstream primer and a downstream primer for the GAPDH gene.

[0012] In some specific implementations, the upstream primer sequence of the TRAPPC1 gene is shown in SEQ ID NO: 2, and the downstream primer sequence of the TRAPPC1 gene is shown in SEQ ID NO: 3.

[0013] In some specific implementations, the upstream primer sequence of the GAPDH gene is shown in SEQ ID NO: 4, and the downstream primer sequence of the GAPDH gene is shown in SEQ ID NO: 5.

[0014] In some implementations, the diagnostic and / or prognostic samples are selected from one or more of cells, serum, or plasma.

[0015] The present invention further provides a TRAPPC1 gene inhibitor, wherein the sequence of the TRAPPC1 gene is shown in SEQ ID NO: 1.

[0016] In some implementations, the TRAPPC1 gene inhibitor is siRNA.

[0017] In some specific implementations, the siRNA sequence is SEQ ID NO: 6 and / or SEQ ID NO: 7.

[0018] The present invention further provides a pharmaceutical composition comprising the aforementioned TRAPPC1 gene inhibitor.

[0019] In some embodiments, the pharmaceutical composition further includes a pharmaceutically acceptable carrier.

[0020] The present invention also provides the use of the TRAPPC1 gene inhibitor or the pharmaceutical composition thereof in the preparation of a medicament for treating tumors.

[0021] In some implementations, the tumor is a glioblastoma.

[0022] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0023] The reagents and raw materials used in this invention are all commercially available.

[0024] The positive and progressive effects of this invention are as follows:

[0025] This invention discloses the application of the TRAPPC1 gene in the preparation of reagents for tumor diagnosis and / or prognosis, and the application of TRAPPC1 gene inhibitors or pharmaceutical compositions containing TRAPPC1 gene inhibitors in the preparation of drugs for treating tumors. The reagents prepared from the TRAPPC1 gene exhibit high sensitivity and accuracy, providing reliable detection results; the drugs for treating tumors can significantly inhibit the proliferation of tumor cells, demonstrating excellent clinical application value. Attached Figure Description

[0026] Figure 1 The differential expression of TRAPPC1 in GBM patient samples and normal control samples.

[0027] Figure 2 ROC curve of TRAPPC1 detection results in GBM patient samples.

[0028] Figure 3 Correlation analysis of TRAPPC1 with prognosis in GBM patients.

[0029] Figure 4 The differential expression of TRAPPC1 in normal control cells and GBM cell line is shown.

[0030] Figure 5 The differential expression of TRAPPC1 in blood samples from healthy controls and GBM patients was shown.

[0031] Figure 6 The results of qPCR were used to detect the transfection efficiency of TRAPPC1 gene siRNA in GBM cells.

[0032] Figure 7 To investigate the effect of inhibiting TRAPPC1 gene expression on GBM cell proliferation using the CCK8 assay. Detailed Implementation

[0033] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0034] Example 1: Differential expression and prognostic correlation analysis of TRAPPC1 gene in GBM tissue and normal control tissue.

[0035] The nucleotide sequence of TRAPPC1 described in this invention is shown in SEQ ID NO: 1.

[0036] Using the TCGA database, high-throughput sequencing results from 156 GBM patient samples and 5 normal control samples were analyzed to obtain differential gene expression profiles in GBM. Among them, the gene TRAPPC1 was significantly overexpressed in the GBM patient group (e.g., Figure 1 As shown), the area under the ROC curve (AUC) is equal to 0.888 (as shown). Figure 2 (As shown).

[0037] As is well known to those skilled in the art, when the area under the ROC curve is between 1.0 and 0.5, and AUC > 0.5, the closer the AUC is to 1, the better the diagnostic effect. AUC between 0.5 and 0.7 indicates lower accuracy, AUC between 0.7 and 0.9 indicates some accuracy, and AUC above 0.9 indicates high accuracy. A value greater than 0.7 indicates that the detection target can serve as a specific marker for this type of detection.

[0038] A correlation analysis was performed on TRAPPC1 expression levels and patient prognosis in 156 GBM samples from the TCGA database. Levels above the median expression were defined as high expression, and levels below the median expression were defined as low expression. Grouping the 156 GBM patients by TRAPPC1 expression level revealed that the overall survival of GBM patients in the low TRAPPC1 expression group was significantly longer than that in the high TRAPPC1 expression group, and TRAPPC1 was significantly negatively correlated with GBM prognosis (e.g., ...). Figure 3 (As shown).

[0039] Example 2: Differential expression of the TRAPPC1 gene in normal control cells and GBM cell line

[0040] Cell culture: Human normal astrocytes (NHA) and human GBM cell lines (A172, TG-905, U251) were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin antibiotics at 37°C, 5% CO2 and 90% relative humidity, with the medium changed every 2-3 days.

[0041] RNA extraction: Collect cultured cells and perform total RNA extraction according to the instructions of the total RNA extraction kit (purchased from Shanghai Feijie Biotechnology Co., Ltd.).

[0042] Reverse transcription: cDNA was synthesized by reverse transcription according to the instructions of the HiFiScript cDNA First Strand Synthesis Kit (purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd.).

[0043] Quantitative PCR amplification assay, the reaction system is as follows:

[0044]

[0045]

[0046] The reaction procedure was as follows: pre-denaturation at 95℃ for 10 min, followed by denaturation at 95℃ for 15 s, annealing at 55℃ for 30 s, and extension at 72℃ for 30 s, for a total of 38 cycles.

[0047] The ABI 7500 real-time PCR instrument was programmed with a selected melting curve, and fluorescence signals from the samples were continuously collected during the ramp-up process to obtain the melting curve. Real-Time PCR was performed using 2... -ΔΔCt Relative quantitative analysis was performed using the method. The primer sequences for TRAPPC1 and GAPDH are shown in Table 1.

[0048] Table 1. Specific amplification primer sequences and related information

[0049]

[0050] Figure 4 The differential expression of TRAPPC1 in normal control cells and GBM cell line is shown. Figure 6 As shown, compared with normal human astrocytes (NHA), the TRAPPC1 gene was upregulated in human GBM cell lines (A172, TG-905, U251), and the difference was statistically significant (P < 0.05).

[0051] Example 3: Differential expression of the TRAPPC1 gene in blood samples from healthy controls and GBM patients

[0052] Sample collection and processing: 10 blood samples were collected from GBM patients and 10 from healthy controls. The blood samples were centrifuged at room temperature to obtain plasma.

[0053] Total RNA extraction from samples: Total RNA was extracted from samples using the ImiJet Plasma RNA Extraction Kit, following the instructions in the kit's manual.

[0054] Same as in Example 2, reverse transcription and quantitative PCR amplification were performed for verification.

[0055] Figure 5 The differential expression of TRAPPC1 in blood samples from healthy controls and GBM patients is shown. Figure 7 As shown, compared with blood samples from healthy controls, the TRAPPC1 gene was upregulated in blood samples from GBM patients, and the difference was statistically significant (P < 0.05).

[0056] Example 4: Repression of TRAPPC1 gene expression

[0057] Cell culture, the specific steps are the same as in Example 2.

[0058] The siRNA was designed using an online siRNA design tool, resulting in two siRNAs for TRAPPC1.

[0059] siRNA#1: TTCCAAACTAGCCGTTACAAACT (SEQ ID NO.6);

[0060] siRNA#2: AGCACAGAATAAACTTTTTGTCA (SEQ ID NO. 7).

[0061] GBM A172 cells were transfected into three groups: a blank control group (transfected with no significant siRNA), siRNA group #1 (transfected with siRNA #1), and siRNA group #2 (transfected with siRNA #2). The siRNA concentration was 50 nM, and the medium was changed 6 hours after transfection.

[0062] Total RNA was extracted and TRAPPCI expression was detected and analyzed. Cell samples were collected 48 hours later, and subsequent steps were the same as in Example 2.

[0063] The results are as follows Figure 6 As shown, compared with the control group, TRAPPC1 was significantly downregulated in the transfected specific siRNA group, and the difference was statistically significant (P < 0.05).

[0064] Example 5: Downregulating TRAPPC1 expression significantly inhibits GBM cell proliferation.

[0065] The effect of TRAPPC1 on the proliferation ability of GBM cells was detected using the CCK-8 assay (Dojindo, cat#CK04-11). The steps are as follows:

[0066] 1. The cell culture and transfection steps are the same as in Example 4.

[0067] 2. After trypsin digestion and resuspension, cell concentration was adjusted and the cells were seeded at a concentration of 3000 cells / well in 96-well plates, with 3 accessory wells in each group.

[0068] 3. After the cells reach the corresponding time points (24h, 48h, 72h, 96h), treat the cells according to the method recommended in the instructions and then measure their absorbance value at a wavelength of 450nm using an ELISA reader.

[0069] 4. Results

[0070] The results are as follows Figure 7 As shown, compared with the control group, the proliferation ability of GBM cells in the siRNA group was significantly inhibited.

Claims

1. The use of a reagent for detecting the expression level of the TRAPPC1 gene in the preparation of reagents for tumor diagnosis and / or prognosis, wherein the sequence of the TRAPPC1 gene is shown in SEQ ID NO: 1; The tumor in question is a glioblastoma.

2. The application of a reagent kit in the preparation of a tumor diagnostic and / or prognostic kit, characterized in that, The reagent kit includes reagents for detecting the expression level of the TRAPPC1 gene, the sequence of which is shown in SEQ ID NO: 1; The tumor in question is a glioblastoma.

3. The application as described in claim 2, wherein the reagent for detecting TRAPPC1 gene expression level further includes a primer pair for detecting the TRAPPC1 gene; and / or, The reagent kit also includes primer pairs for detecting internal standards.

4. The use of claim 3, wherein, The internal standard is the GAPDH gene.

5. The application as described in claim 3, wherein, The primer pair for detecting the TRAPPC1 gene includes an upstream primer and a downstream primer for the TRAPPC1 gene; and / or, The primer pair for detecting the internal standard includes an upstream primer for the GAPDH gene and a downstream primer for the GAPDH gene.

6. The use of claim 5, wherein, The upstream primer sequence of the TRAPPC1 gene is shown in SEQ ID NO: 2, and the downstream primer sequence of the TRAPPC1 gene is shown in SEQ ID NO: 3; and / or, the upstream primer sequence of the GAPDH gene is shown in SEQ ID NO: 4, and the downstream primer sequence of the GAPDH gene is shown in SEQ ID NO:

5.

7. The application as described in any one of claims 1-6, wherein the diagnostic and / or prognostic sample is selected from one or more of cells, serum, or plasma.

8. The application of a TRAPPC1 gene inhibitor in the preparation of drugs for treating tumors; The TRAPPC1 gene inhibitor is siRNA; The siRNA sequence is SEQ ID NO: 6 and / or SEQ ID NO: 7; wherein The tumor is a glioblastoma.

Images