A marker for diagnosis, treatment and / or prognosis of prostate cancer bone metastasis and application thereof
By using quantitative detection of the LCAL4 biomarker and gene silencing technology, the problem of early diagnosis and treatment of bone metastasis in prostate cancer has been solved, prolonging the bone metastasis-free survival time of patients and inhibiting bone metastasis of tumor cells.
Patent Information
- Application Number
- CN202310118991.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-18
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2043-01-18
AI Technical Summary
Current technologies lack effective screening methods and strategies, resulting in most patients with prostate cancer bone metastases being diagnosed at an advanced stage, having a short median survival, and lacking effective treatment options for bone metastases of prostate cancer, which seriously affects patients' quality of life.
Using LCAL4 as a biomarker, this study employed reagents for quantitative detection of LCAL4 and methods for inhibiting LCAL4 gene expression to aid in the diagnosis, treatment, and prognosis of bone metastases in prostate cancer. This included using quantitative real-time PCR to detect LCAL4 expression levels and designing ASO sequences to silence LCAL4 expression.
It enables early diagnosis of bone metastasis in prostate cancer, prolongs bone metastasis-free survival, and significantly inhibits the bone metastasis ability of tumor cells, providing an effective treatment method.
Smart Images

Figure HDA0004079430480000011 
Figure HDA0004079430480000012 
Figure HDA0004079430480000021
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biomedical technology, and particularly relates to a marker for diagnosis, treatment and / or prognosis of prostate cancer bone metastasis and application thereof. BACKGROUND
[0002] Tumor metastasis is the main cause of death in cancer patients. Bone is the most common metastatic site of malignant tumors such as prostate cancer and breast cancer. According to statistics, the incidence of bone metastasis in patients with advanced prostate cancer is as high as 65-75%; due to the lack of effective screening methods and strategies, many patients are diagnosed as advanced at the initial diagnosis, and can only be treated with palliative treatment, resulting in a median survival of only 53 months for patients with bone metastatic prostate cancer. At present, bone metastatic prostate cancer is still incurable and can cause a series of unique bone-related complications, which seriously reduce the quality of life of patients and even lead to death. Therefore, elucidating the specific molecular mechanism of tumor bone metastasis and developing effective prevention and treatment strategies accordingly is a major clinical problem that needs to be solved urgently and has important scientific significance.
[0003] LncRNA regulates the expression of genes in cells through complex and diverse mechanisms, and is involved in cell growth, invasion and metastasis, etc. LINC01614 can up-regulate the expression of FOXP1 by inhibiting miR-217, thereby promoting the growth of lung adenocarcinoma cells; therefore, LINC01614 is also named lung cancer-associated lncRNA 4 (LCAL4). Vishnubalaji et al. reported that LCAL4 tends to be more highly expressed in the HR+ / HER2+ molecular subtype in breast cancer, and is a marker of poor prognosis in patients, and high expression of LCAL4 is positively correlated with activation of signals such as TGFβ, FAK and CDH1. These studies show that LCAL4 may act as an important oncogene in tumors, but the clinical significance of LCAL4 in tumor metastasis and whether it can be used as a tumor diagnosis and treatment target are still unclear and need further research. SUMMARY
[0004] The purpose of the present application is to provide the application of LCAL4 as a biomarker in the preparation of a product for the diagnosis, treatment and / or prognosis of prostate cancer bone metastasis.
[0005] The technical solution adopted by the present application is as follows:
[0006] In a first aspect of the present application, the application of LCAL4 as a biomarker in the preparation of a product for the diagnosis, treatment and / or prognosis of prostate cancer bone metastasis is provided.
[0007] In a second aspect of the present application, the application of a reagent for quantitatively detecting LCAL4 in the preparation of a product for the diagnosis and prognosis of prostate cancer bone metastasis is provided.
[0008] In some embodiments of the present application, the reagent for quantitatively detecting LCAL4 comprises a reagent for quantitatively detecting LCAL4 at a gene level.
[0009] In some embodiments of the present application, the reagent for quantitatively detecting LCAL4 at a gene level comprises a reagent for detecting a marker gene expression level by a method of a sequencing technique, a nucleic acid hybridization technique, or a nucleic acid amplification technique.
[0010] In some embodiments of the present application, the reagent comprises a primer, a probe, a gene chip.
[0011] In some embodiments of the present application, the sequence of the primer comprises:
[0012] LCAL4-F: AACCAAGAGCGAAGCCAAGA (SEQ ID NO: 1);
[0013] LCAL4-R: GCTTGGACACAGACCCTAGC (SEQ ID NO: 2).
[0014] In some embodiments of the present application, the product comprises a reagent, a kit, a test paper, a chip.
[0015] In a third aspect of the present application, a product is provided, which comprises the reagent for quantitatively detecting LCAL4 according to the first aspect of the present application.
[0016] In some embodiments of the present application, the reagent for quantitatively detecting LCAL4 comprises a reagent for quantitatively detecting LCAL4 at a gene level.
[0017] In some embodiments of the present application, the reagent for quantitatively detecting LCAL4 at a gene level comprises a reagent for detecting a marker gene expression level by a method of a sequencing technique, a nucleic acid hybridization technique, or a nucleic acid amplification technique.
[0018] In some embodiments of the present application, the reagent comprises a primer, a probe, a gene chip.
[0019] In some embodiments of the present application, the sequence of the primer comprises:
[0020] LCAL4-F: AACCAAGAGCGAAGCCAAGA (SEQ ID NO: 1);
[0021] LCAL4-R: GCTTGGACACAGACCCTAGC (SEQ ID NO: 2).
[0022] In some embodiments of the present application, the product further comprises a primer sequence of a reference gene, specifically as follows:
[0023] GAPDH-F: TCTCCTCTGACTTCAACAGCG (SEQ ID NO: 3);
[0024] GAPDH-R: CACCCTGTTGCTGTAGCCAA (SEQ ID NO: 4).
[0025] In some embodiments of the present application, the product comprises a reagent, a kit, a test paper, a chip.
[0026] In a fourth aspect of the present application, there is provided a use of a reagent for inhibiting expression of LCAL4 gene in the preparation of a drug for treating bone metastasis of prostate cancer.
[0027] In some embodiments of the present application, the reagent for inhibiting expression of LCAL4 gene comprises an ASO, shRNA, antisense oligonucleotide, and a sequence specifically interfering with LCAL4 directed against LCAL4 gene.
[0028] In some embodiments of the present application, the sequence of the ASO comprises:
[0029] LCAL4-Ri#1: CCGTACGGTACTGCT (SEQ ID NO: 5); and / or
[0030] LCAL4-Ri#2: GATTCCACTGCGTGT (SEQ ID NO: 6).
[0031] In some embodiments of the present application, the ASO has at least one modification; the modification is selected from one or more of an internucleoside linkage modification, a methylation modification, or a cholesterol modification.
[0032] In a fifth aspect of the present application, there is provided a drug comprising the reagent for inhibiting expression of LCAL4 gene according to the fourth aspect of the present application.
[0033] In some embodiments of the present application, the reagent for inhibiting expression of LCAL4 gene comprises an ASO, shRNA, antisense oligonucleotide, and a sequence specifically interfering with LCAL4 directed against LCAL4 gene.
[0034] In some embodiments of the present application, the sequence of the ASO comprises:
[0035] LCAL4-Ri#1: CCGTACGGTACTGCT (SEQ ID NO: 5); and / or
[0036] LCAL4-Ri#2: GATTCCACTGCGTGT (SEQ ID NO: 6).
[0037] In some embodiments of the present application, the ASO has at least one modification; the modification is selected from one or more of an internucleoside linkage modification, a methylation modification, or a cholesterol modification.
[0038] In some embodiments of the present application, the drug further comprises a pharmaceutically acceptable excipient.
[0039] In some embodiments of the present application, the pharmaceutically acceptable excipient comprises at least one of a diluent, a binder, a wetting agent, a lubricant, a disintegrant, a solvent, an emulsifier, a cosolvent, a solubilizer, a preservative, a pH adjuster, an osmotic pressure adjuster, a surfactant, a coating material, an antioxidant, a bacteriostatic agent, or a buffer.
[0040] In some embodiments of the present application, the dosage form of the drug comprises at least one of a suspension, a granule, a capsule, a powder, a tablet, an emulsion, a solution, a dripping pill, an injection, an oral agent, a suppository, an enema, an aerosol, a patch, or a drop.
[0041] In some embodiments of the present application, the administration route of the drug comprises at least one of intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, oral administration, sublingual administration, nasal administration, atomization administration, or transdermal administration.
[0042] The beneficial effects of the present application are:
[0043] The present application provides a biomarker LCAL4 for tumor bone metastasis diagnosis, treatment and / or prognosis, and discloses the relationship between LCAL4 and prostate cancer bone metastasis for the first time. The present application verifies the high expression of LCAL4 in bone metastatic tumor tissues by using fluorescent quantitative PCR, and predicts a shorter bone metastasis-free survival time; and the in vivo and in vitro experiments also confirm that the down-regulation of LCAL4 gene expression can significantly inhibit the "stem cell characteristics" of prostate cancer cells, thereby inhibiting the bone metastasis of tumor cells; the present application also designs an ASO sequence for inhibiting the expression of LCAL4 gene, and uses a gene therapy method to silence the expression of LCAL4 at the cancerous site, which can be used for preparing a drug for preventing and / or treating prostate cancer bone metastasis. BRIEF DESCRIPTION OF DRAWINGS
[0044] Figure 1LCAL4 is highly expressed in bone metastatic prostate cancer tissues: A, LCAL4 expression in clinical tissue samples was detected by quantitative PCR, and LCAL4 was highly expressed in prostate cancer tissues with bone metastasis compared with normal prostate tissues and non-bone metastatic prostate cancer tissues; B, the results of quantitative PCR experiments showed that the expression of the LCAL4 gene was significantly up-regulated in bone metastatic prostate cancer cell lines 22RV1, C4-2B, PC-3 and VCaP compared with normal prostate epithelial cells HPrEC, RWPE-1 and non-bone metastatic tumor prostate cancer cell lines LNCaP, MDA PCa 2b.
[0045] Figure 2 LCAL4 high expression is closely related to the prognosis of bone metastatic prostate cancer: A, Kaplan-Meier analysis of bone metastasis-free survival (BMFS) of prostate cancer patients (n=106; log-rank test), LCAL4 high expression in prostate cancer patients, the bone metastasis-free survival time was significantly shorter; B, ROC curve analysis was used according to LCAL4 expression and bone metastasis of prostate cancer patients as variables to determine the optimal cutoff value of LCAL4 expression, and the patients were divided into LCAL4 high expression group (n=45) and LCAL4 high expression group (n=61); AUC=0.720.
[0046] Figure 3 Silencing LCAL4 expression can inhibit the malignant phenotype of prostate cancer cells in vitro: A-B, silencing LCAL4 can inhibit the size and number of prostate cancer cells forming spheroids in low attachment culture dishes in stem cell medium; C, silencing LCAL4 can significantly down-regulate the gene expression of stem cell markers.
[0047] Figure 4 Silencing LCAL4 expression can inhibit bone metastasis of prostate cancer cells in vivo: dynamic detection (A-B), X-ray image acquisition (C) and H&E staining analysis (D-E) by in vivo fluorescence detection system confirmed that silencing LCAL4 can significantly inhibit the bone metastasis ability of prostate cancer cells. DETAILED DESCRIPTION
[0048] The concept and technical effects of the present application will be described below in conjunction with the embodiments to fully understand the purpose, features and effects of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all embodiments, and based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.
[0049] Gene therapy refers to taking relevant treatment strategies according to different disease conditions, such as gene correction, gene replacement and gene inactivation, to correct or compensate for diseases caused by defective and abnormal genes, so as to achieve the purpose of treatment. For oncogenes, antisense oligonucleotides (ASOs) can be used, which are short, chemically synthesized single-stranded oligonucleotides. Through modification of their backbone and sugar groups, their stability, pharmacological properties and binding to targets can be increased, and they usually have less toxicity. It is a newly discovered nucleotide derivative, which has higher thermal stability, better molecular hybridization ability, stronger resistance to nuclease degradation, better lipid solubility and lower cytotoxicity compared to other oligonucleotides. It is commonly used for gene function research in cells and animals and development of ASO nucleic acid drugs, etc.
[0050] The inventors found that LCAL4 gene was highly expressed in bone metastatic prostate cancer tissues by detecting the RNA expression level of LCAL4 (Gene ID: 105373869) in prostate cancer tissues by quantitative PCR, and high expression of LCAL4 predicts poor overall survival time and bone metastasis-free survival time. Further experiments found that LCAL4 gene was highly expressed in bone metastatic prostate cancer cell lines 22Rv1, C4-2B, PC-3 and VCaP, while the relative expression was lower in androgen-sensitive prostate cancer cell lines MDA PCa 2b and LNCaP and normal prostate epithelial cells HPrEC and RWPE-1. The inventors further designed and synthesized fluorescent quantitative PCR primer and probe sequences for detecting the RNA expression level of LCAL4 gene for the diagnosis of bone metastatic prostate cancer; also designed and synthesized two ASO sequences (LCAL4-Ri#1 and LCAL4-Ri#2) targeting LCAL4 gene; the inventors also designed cholesterol modification at the end of the ASO sequence targeting LCAL4. The two ASO sequences targeting LCAL4 provided by the present application can be used for the treatment of bone metastasis of prostate cancer.
[0051] The present application will be further described in conjunction with specific embodiments, but is not limited thereto.
[0052] Example 1: Up-regulation of LCAL4 expression in bone metastatic prostate cancer tissues
[0053] Quantitative PCR was used to detect the RNA expression level of LCAL4 in bone metastatic and non-bone metastatic prostate cancer tissues.
[0054] Methods:
[0055] 1) Prostate cancer tissue source: 5 cases of normal prostate tissues, 72 cases of non-bone metastatic and 34 cases of bone metastatic prostate cancer tissues were collected from the Seventh Affiliated Hospital of Sun Yat-sen University.
[0056] 2) Prostate cancer cell lines: normal prostate epithelial cells HPrEC, RWPE-1, non- bone metastatic tumor prostate cancer cell lines LNCaP, MDA PCa 2b, bone metastatic prostate cancer cell lines 22RV1, C4-2B, PC-3 and VCaP.
[0057] 3) Real-time fluorescent quantitative PCR: collect the above tissues, extract RNA using Trizol, synthesize cDNA using MMLV reverse transcriptase (Promega), and detect the expression level of LCAL4 in each group of cells using 2x SYBR mix (Roche).
[0058] GAPDH was used as an internal reference. The q-PCR primers used were:
[0059] LCAL4-F: AACCAAGAGCGAAGCCAAGA (SEQ ID NO: 1);
[0060] LCAL4-R: GCTTGGACACAGACCCTAGC (SEQ ID NO: 2);
[0061] GAPDH-F: TCTCCTCTGACTTCAACAGCG (SEQ ID NO: 3);
[0062] GAPDH-R: CACCCTGTTGCTGTAGCCAA (SEQ ID NO: 4);
[0063] Subtract the Ct value of the internal reference gene GAPDH from the Ct value of the LCAL4 gene obtained for each sample to obtain △Ct, and the result is expressed as 2-△Ct. The higher the △Ct value, the lower the expression level of the gene.
[0064] Results: Quantitative PCR results show that LCAL4 is significantly upregulated in bone metastatic tumor tissues compared to non-bone metastatic prostate cancer ( Figure 1 A); and LCAL4 is significantly upregulated in bone metastatic prostate cancer cell lines 22RV1, C4-2B, PC-3 and VCaP compared to normal prostate epithelial cells HPrEC, RWPE-1 and non-bone metastatic tumor prostate cancer cell lines LNCaP, MDA PCa 2b ( Figure 1 B).
[0065] Example 2: High expression of LCAL4 gene in prostate cancer tissues is closely related to poor prognosis of patients:
[0066] 1) Prostate cancer tissue source: 106 cases of prostate cancer tissues were collected from the Seventh Affiliated Hospital of Sun Yat-sen University.
[0067] 2) Analysis of the relationship between the expression of LCAL4 gene and the prognosis of patients. Kaplan-Meier analysis of the bone metastasis-free survival prognosis of prostate cancer patients (n=106; log-rank test), using ROC curve analysis with LCAL4 expression and bone metastasis results of prostate cancer patients as variables to determine the optimal cutoff value of LCAL4 expression, dividing patients into LCAL4 high expression group (n=45) and LCAL4 high expression group (n=61); AUC=0.720.
[0068] Results: LCAL4 high expression of prostate cancer patients, their bone metastasis-free survival time is significantly shorter than that of patients with low expression, and their AUC=0.720, with diagnostic significance Figure 2 ).
[0069] Example 3: Silencing LCAL4 using ASO in vitro can inhibit the malignant phenotype of prostate cancer cells:
[0070] (1) Cell culture and stable strain construction
[0071] Prostate cancer cells C4-2B and PC-3 were treated with negative control ASO (Control) and ASO that can silence LCAL4 (LCAL4-Ri#1, LCAL4-Ri#2), respectively, with a working concentration of 5nM. qRT-PCR verification was performed by collecting the corresponding RNA.
[0072] The sequence of LCAL4-Ri#1 is: CCGTACGGTACTGCT (SEQ ID NO: 5);
[0073] The sequence of LCAL4-Ri#2 is: GATTCCACTGCGTGT (SEQ ID NO: 6);
[0074] (2) Spheroid formation experiment
[0075] Methods: Cells were seeded into ultra-low attachment 6-well plates (Corning) at 500 cells per well, and cultured in DMEM / F12 serum-free medium containing 2% B27 (Invitrogen), 20 ng / ml EGF (PeproTech, Rocky Hill, NJ, USA), 20 ng / ml bFGF (PeproTech), 0.4% BSA (Sigma-Aldrich) and 5 μg / ml insulin (Sigma-Aldrich); after 10 days, take pictures and count the spheroids.
[0076] Results: As shown in Figure 3 A-B, silencing LCAL4 can inhibit the size and number of spheroids formed by tumor cells in low attachment culture dish stem cell culture medium.
[0077] (3) Real-time quantitative PCR
[0078] Methods: Cells from each group were collected, RNA was extracted using Trizol, and cDNA was synthesized by reverse transcription using MMLV reverse transcriptase (Promega). The expression level of LCAL4 in each group of cells was detected by qRT-PCR using 2×SYBR mix (Roche) to detect the gene expression of stem cell markers.
[0079] Result: As Figure 3 As shown in C, silencing LCAL4 can significantly downregulate the gene expression of stem cell markers.
[0080] Example 4: Using ASO to silence LCAL4 can inhibit bone metastasis of tumor cells in vivo.
[0081] (1) Nude mouse bone transfer model experiment
[0082] Methods: A mouse in vivo cancer model was constructed, and 1×10 6 PC-3 tumor cells were subcutaneously injected into mice and treated with ASO of Control and LCAL4-Ri#1, respectively. The cells were injected intraperitoneally every three days at a dose of 100 nmol / kg. After 6 weeks, the fluorescence intensity was observed using an in vivo imaging system, and the tumor weight was measured by dissection of the animals.
[0083] Result: As Figure 4 As shown, through dynamic detection using a live fluorescence detection system, X-ray image acquisition, and H&E staining analysis, it was confirmed that silencing LCAL4 can significantly inhibit the bone metastasis ability of tumor cells.
[0084] The above detailed embodiments have provided a comprehensive description of the present invention. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, unless otherwise specified, the embodiments of the present invention and the features thereof can be combined with each other.
Claims
1. Use of a reagent for quantitatively detecting LCAL4 in the preparation of a product for diagnosing and prognosing prostate cancer bone metastasis.
2. Use according to claim 1, characterized in that, The reagent for quantitatively detecting LCAL4 includes a reagent for detecting the expression level of a marker gene by a sequencing technique, a nucleic acid hybridization technique, or a nucleic acid amplification technique.
3. Use according to claim 2, characterized in that, The reagent includes a primer, a probe, a gene chip; the sequence of the primer is: LCAL4-F: AACCAAGAGCGAAGCCAAGA (SEQ ID NO: 1); and LCAL4-R: GCTTGGACACAGACCCTAGC (SEQ ID NO: 2).
4. Use of a reagent for inhibiting the expression of LCAL4 gene in the preparation of a drug for preventing and / or treating prostate cancer bone metastasis; The reagent for inhibiting the expression of LCAL4 gene includes an ASO against the LCAL4 gene; The sequence of the ASO is: LCAL4-Ri#1: CCGTACGGTACTGCT (SEQ ID NO: 5); and / or LCAL4-Ri#2: GATTCCACTGCGTGT (SEQ ID NO: 6).
5. Use according to claim 4, characterized in that, The ASO has at least one modification; the modification is selected from one or more of an internucleoside bond modification, a methylation modification, or a cholesteryl modification.
Citation Information
Patent Citations
Biomarker for bone metastasis in prostatic cancer
CN110643711A
ShRNA molecule for silencing human LINC01614 expression and application thereof
CN114181937A