Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

14 results about "Prostate cancer cell" patented technology

Prostate Cancer. Prostate cancer is a malignant tumor that begins in the prostate gland. Several types of cells are found in the prostate, but almost all prostate cancers develop from the gland cells (the cells that make the prostate fluid that is added to the semen). The medical term for a cancer that starts in gland cells is adenocarcinoma.

Application of ufsp2 as a target in preparation of prostate cancer treatment product

The application discloses application of UFSP2 as a target point in preparation of a prostate cancer treatment product. The application relates to the field of biological medicine, and research finds that UFM1 specific protease 2 (UFSP2) is highly expressed in prostate cancer tissues, and the protein level is higher than that of paracancerous tissues, and is positively correlated with the expression of proliferation related molecules c-Myc and CyclinD1. Function experiments further show that inhibition of UFSP2 expression can significantly inhibit the proliferation, clone formation and migration of prostate cancer cells, and inhibit the growth and metastasis of prostate cancer in vivo; on the contrary, overexpression of UFSP2 can promote the proliferation of prostate cancer cells, indicating that UFSP2 can be used as a prostate cancer treatment target and can be used for screening of anti-prostate cancer drugs. The application provides application of an UFSP2 expression inhibitor and / or a function inhibitor in preparation of a prostate cancer treatment product, and provides a new drug development direction and a targeted intervention strategy for prostate cancer treatment.
Owner:GUANGZHOU MEDICAL UNIV

Application of myrotoxin A in the preparation of drugs for treating prostate cancer

PendingCN122351221AProstate cancer cellDU145
This invention relates to the field of biopharmaceutical technology, and in particular to the application of myrotoxin A in the preparation of drugs for treating prostate cancer. This invention is the first to discover the function of myrotoxin A in inducing ferroptosis in DU145 prostate cancer cells by targeting and inhibiting ACSL3 protein, and its inhibitory effect on prostate cancer proliferation. Specific embodiments of this invention reveal for the first time that myrotoxin A can precisely utilize the unique metabolic vulnerability of prostate cancer cells, significantly downregulating the expression of ACSL3 protein in DU145 cells at the protein level. This, in turn, by relieving the inhibition of ferroptosis by ACSL3 protein, specifically induces ferroptosis in prostate cancer cells, ultimately effectively inhibiting tumor cell growth and achieving the therapeutic goal of targeting prostate cancer development.
Owner:FUJIAN PROVINCIAL HOSPITAL

Use of mylk3 gene inhibitor in preparation of drug for treating castration-resistant prostate cancer

The application belongs to the technical field of biological medicine, and discloses application of a MYLK3 gene inhibitor in preparation of a drug for treating castration-resistant prostate cancer. The biological function of MYLK3 in prostate cancer is confirmed for the first time, an intervention means with the gene as a target point is provided, and it is confirmed that the MYLK3 inhibitor can improve the sensitivity of castration-resistant prostate cancer to androgen receptor antagonists. A gene therapy drug with the human MYLK3 gene as a treatment target point is specially provided, which is suitable for the treatment of prostate cancer (especially castration-resistant prostate cancer), and can also be combined with other targeted drugs to improve the treatment effect. By designing a reasonable RNAi target sequence for the target gene, a retrovirus vector plasmid containing the target sequence is successfully constructed, which has a significant inhibitory effect on the proliferation ability of prostate cancer cells, and significantly increases the sensitivity of prostate cancer cells to AR antagonists.
Owner:GUANGZHOU CUNZHONG TECHNOLOGY SERVICE CO LTD

Use of convallatoxin in the preparation of drugs against prostate cancer

PendingCN122376608AProstate cancer cellPharmacy medicine
The application discloses application of convallatoxin in preparation of a medicine for resisting prostate cancer and belongs to the technical field of biological medicines. The application finds that the convallatoxin has the efficacy of resisting prostate cancer, and the increase of UPP1 expression can enhance the inhibiting effect or the apoptosis induction effect of the convallatoxin on prostate cancer cells. Compared with the group of using the convallatoxin alone, after the 22Rv1 cells overexpressing UPP1 are treated by the convallatoxin, the apoptosis rate of the cells is increased by about 4 times, which indicates that the increase of UPP1 expression can enhance the effect of the convallatoxin on inducing the apoptosis of the prostate cancer cells.
Owner:ZHEJIANG UNIV

A bicyclic peptide targeting degradation of foxa1 protein and preparation method and application thereof

ActiveCN121471317BProstate cancer cellCyclic peptide
This invention relates to the field of biomedical technology, specifically disclosing a bicyclic peptide for targeted degradation of FOXA1 protein, its preparation method, and its applications. The amino acid sequence of the bicyclic peptide for targeted degradation of FOXA1 protein is shown in SEQ ID NO.1. The bicyclic peptide for targeted degradation of FOXA1 protein provided by this invention can effectively degrade FOXA1 protein and exhibits the ability to significantly inhibit the proliferation of prostate cancer cells.
Owner:XI AN JIAOTONG UNIV

An intracellular imaging system for simultaneously detecting UDG and miR-375 expression levels and its application

PendingCN122081492Aimprove accuracyhigh imaging specificityMicrobiological testing/measurementDNA/RNA fragmentationProstate cancer cellCancer cell
This invention discloses an intracellular imaging system for simultaneously detecting UDG and miR-375 expression levels and its applications. The intracellular imaging system uses a tetrahedral DNA nanostructure as a carrier, loading a HAT-UDG probe with an on / off conformation, and coupling it with a split CRISPR / Cas12a detection component for recognizing miR-375. The split CRISPR / Cas12a detection component includes at least Cas12a protein, scaffold RNA, spacer RNA / equivalent split crRNA components, and a fluorescent reporter substrate. This invention is the first to perform a logical AND operation between two key indicators: UDG enzyme activity and miR-375 expression level. The system can only ultimately trigger a complete fluorescence signal when both are simultaneously highly expressed. This multi-target synergistic activation design constructs a precise molecular recognition logic gate, enabling extremely accurate differentiation between prostate cancer cells (RV-1) and normal cells (293T), as well as other cancer cells (5637) that highly express UDG, fundamentally avoiding misjudgments caused by fluctuations in a single indicator or non-specific expression, resulting in extremely high imaging specificity.
Owner:TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH

Immunotherapeutic for prostate cancer treatment

ActiveUS12648985B2Hormone peptidesPeptide/protein ingredientsProstate cancer cellAmphipathic helix
The present disclosure describes a GnRH therapeutic for neutralizing GnRH levels in subjects which can reduce testosterone levels to attenuate or eliminate prostate cancer cell growth and / or metastasis. The therapeutic is produced synthetically. The GnRH therapeutic includes a hapten carrier (hC) comprising a monomeric peptide (MP), synthesized separately from the GnRH peptide, and following self-assembly of the hC, GnRH is covalently coupled to form a GnRH-hC conjugate which can serve as a therapeutic. The MP includes heptad repeats following a specific pattern. The hC can include a GnRH peptide attached to a monomeric peptide prior to self-assembly to form a therapeutic. Optionally, the GnRH-hC conjugate further includes one or more T-cell epitopes at the N- and / or C-terminus of the one or more amphipathic alpha-helices. The present disclosure also describes compositions including immunogenic compositions including the therapeutics described herein.
Owner:HEXAMER THERAPEUTICS INC

Use of a mimetic inhibitor of nna10-k148 in the preparation of a medicament for the treatment of prostate cancer

PendingCN122097597AOrganic active ingredientsUrinary disorderProstate cancer cellOncology
The application belongs to the technical field of biological medicine, and particularly relates to application of a NAA10-K148 neosynthesis inhibitor in preparation of a preparation for treating prostate cancer, wherein the NAA10-K148 neosynthesis inhibitor refers to an RNA interference reagent for reducing neosynthesis level of the 148th lysine of NAA10; the amino acid sequence of NAA10 is shown as SEQ ID NO. 10. Through targeted NAA10-K148 neosynthesis modification, the application can effectively block the UBE2M-NAA10 oncogenic axis, reduce the NAA10 protein stability, inhibit the cancer-promoting function, and then significantly inhibit the proliferation, migration and invasion ability of prostate cancer cells. Therefore, the NAA10-K148 neosynthesis inhibitor can play a role in treating prostate cancer by specifically interfering with the modification site, and provides a brand-new treatment strategy for clinic.
Owner:SHANDONG FIRST MEDICAL UNIV & SHANDONG ACADEMY OF MEDICAL SCI

An engineered anti-PSMA-TAT@celinixostat exosome and a preparation method and application thereof

PendingCN122440854AProstate cancer cellTat peptide
The application discloses an engineered anti-PSMA-TAT@celinexor exosome for treating castration-resistant prostate cancer and a preparation method and application thereof. The exosome is constructed by gene engineering and chemical modification technology, and an anti-PSMA antibody fragment with prostate-specific membrane antigen targeting function and a cell-penetrating peptide TAT are co-displayed on the surface of the exosome, and an anticancer drug celinexor is efficiently loaded, so that a novel targeted drug delivery system is constructed. The system realizes the enrichment of the exosome in the prostate cancer tissue site by using anti-PSMA, and further realizes the double precise targeting from the tissue to the cell and then to the nucleus by the aid of the TAT peptide to promote the drug to penetrate the cell membrane and further target the nucleus. The strategy not only significantly enhances the accumulation and efficacy of celinexor in the nucleus of the prostate cancer, but also effectively reduces the toxic side effects of celinexor on normal tissues through the natural biocompatibility and targeted delivery characteristics of the exosome, thereby improving the treatment safety.
Owner:THE SECOND AFFILIATED HOSPITAL OF KUNMING MEDICAL UNIV (YUNNAN PROVINCIAL UROLOGY HOSPITAL YUNNAN PROVINCIAL HEPATOBILIARY & PANCREATIC SURGERY HOSPITAL)

Lentivirus product with prostate cancer inhibiting effect and construction method thereof

ActiveCN116445550BOrganic active ingredientsSpecial deliveryProstate cancer cellLentivirus
The present application relates to the field of biotechnology, specifically to a lentivirus product with prostate cancer inhibiting effect and a construction method thereof, at least carrying one of RNAi target sequence RNAi-21904, RNAi-21905 and RNAi-21906, wherein the RNAi-21904, RNAi-21905 and RNAi-21906 fragment coding sequences are respectively: AAGGACATGGCCACAGAAACA, CTTGATATTGGGCTAGAATTA, ATTGGATAAGCTTGTCAATGA; under the support of Shanghai Natural Foundation (project number 19ZR1454800), the applicant effectively inhibits the expression, proliferation, migration and transformation of prostate cancer cells by carrying specific RNAi target sequences, and provides a new direction for symptom relief and subsequent treatment of patients.
Owner:SHANGHAI YIBEIRUI BIOMEDICAL SCIENCE & TECHNOLOGY CO LTD

Expanded metabolic pathway for androgen production by commensal bacteria

PendingUS20260177553A1Biological material analysisOxidoreductasesProstate cancer cellSymbiotic bacteria
Provided herein is the first commensal microbial gene encoding an enzyme that catalyzes the conversion of androstenedione to epitestosterone in the gut bacterium Clostridium scindens (desF). Also provided is an important and unrecognized capability for epitestosterone in androgen receptor-dependent prostate cancer cell proliferation and the potential clinical relevance of this bacterial enzymatic pathway (desF) in prostate cancer. Additionally, it was discovered that bacterial isolates from urine or prostatectomy tissue are capable of androgen production and that urinary tract bacteria can exhibit 17β-hydroxysteroid dehydrogenase activity The gene in urinary isolates encoding 17β-hydroxysteroid dehydrogenase that catalyzes the conversion of androstenedione to testosterone was identified and named desG.
Owner:THE BRD OF TRUSTEES OF THE UNIVERSITY OF ILLINOIS

Application of ufsp2 as a target in preparation of prostate cancer treatment product

ActiveCN122171802BProstate cancer cellCyclin D1
This invention discloses the application of UFSP2 as a target in the preparation of prostate cancer therapeutic products. This invention relates to the biomedical field, and research has found that UFM1-specific protease 2 (UFSP2) is highly expressed in prostate cancer tissues, with protein levels higher than in adjacent normal tissues, and is positively correlated with the expression of proliferation-related molecules c-Myc and Cyclin D1. Functional experiments further show that inhibiting UFSP2 expression significantly inhibits the proliferation, colony formation, and migration of prostate cancer cells, and inhibits in vivo tumor growth and metastasis; conversely, overexpression of UFSP2 promotes prostate cancer cell proliferation, indicating that UFSP2 can serve as a therapeutic target for prostate cancer and can be used to screen anti-prostate cancer drugs. This invention provides the application of UFSP2 expression inhibitors and / or functional inhibitors in the preparation of prostate cancer therapeutic products, offering a new direction for drug development and targeted intervention strategies for prostate cancer treatment.
Owner:GUANGZHOU MEDICAL UNIV

4-aminopyrimidine lrh-1 receptor antagonists and uses thereof

PendingCN122301783ADiseaseProstate cancer cell
This invention discloses 4-aminopyrimidine LRH-1 receptor antagonists and their applications, belonging to the field of pharmaceutical technology. This invention provides the application of 4-aminopyrimidine compounds and their derivatives, with the general structural formula shown in Formula (I), in the preparation of antitumor drugs. These compounds, as LRH-1 antagonists, exhibit significant downstream transcriptional repression activity against LRH-1 and have a high affinity for LRH-1 LBD protein, effectively inhibiting the proliferation of growth-dependent LRH-1 tumors such as breast cancer, colon cancer, pancreatic cancer, and prostate cancer cell lines. Therefore, these compounds can be applied to the treatment of diseases related to abnormal LRH-1 expression, including but not limited to the treatment of breast cancer, colon cancer, pancreatic cancer, and prostate cancer.
Owner:ZHEJIANG UNIV