Application of FBXO2 in treatment of prostatic cancer

Abstract

The invention discloses application of FBXO2 in treatment of prostatic cancer, and belongs to the field of prostatic cancer treatment. According to the application of the FBXO2 accelerant in preparation of the medicine for treating the prostatic cancer, specifically, expression of the FBXO2 in prostatic cancer tissue is remarkably reduced, and the high expression level of the FBXO2 is in positive correlation with good prognosis of a patient; fBXO2 overexpression can effectively inhibit prostate cancer cell proliferation and metastasis and induce apoptosis; mechanism research finds that FBXO2 is specifically combined with m6A reading protein YTHDF2 through a carboxyl terminal structural domain of the FBXO2, mediates the m6A reading protein YTHDF2 to generate ubiquitination modification at a K286 site and promotes proteasome dependent degradation of the m6A reading protein YTHDF2. The YTHDF2 is used as a high-expression cancer promoting protein in prostatic cancer, and the degradation of the YTHDF2 can be accelerated by regulating m6A methylation modification of CDKN1C mRNA, so that the tumor progression is driven. A theoretical basis is provided for developing a novel prognostic marker and a treatment strategy.

Description

Technical Field

[0001] The present invention belongs to the field of prostate cancer treatment, and particularly relates to the application of FBXO2 in the treatment of prostate cancer. Background Art

[0002] YTHDF2 (YTH domain family member 2) is a key reader protein for m6A modification. The YTH domain contained in YTHDF2 specifically recognizes m6A-modified RNA and mediates its degradation. Recent studies have shown that YTHDF2 plays a pro-oncogenic role in various tumors, including prostate cancer.

[0003] Ubiquitination, a key post-translational regulatory mechanism, participates in biological processes such as the cell cycle and signal transduction through the E1-E2-E3 enzyme cascade. The ubiquitin ligase complex (Skp1-Cullin-F-box) is a core subclass of RING-type E3 ligases, and its F-box protein members can regulate tumor development and progression by recognizing specific substrates. FBXO2 (FBG1 / Fbs1), the substrate recognition component of the SCF complex, has been shown to regulate the progression of osteosarcoma and ovarian cancer by degrading glycosylated target proteins (such as IL-6R and SUN2). However, its function in prostate cancer remains unknown. Summary of the Invention

[0004] In view of the deficiencies in the prior art, the purpose of the present invention is to provide an application of FBXO2 in the treatment of prostate cancer, thereby solving the problems in the prior art.

[0005] The purpose of the present invention can be achieved through the following technical solutions: Application of FBXO2 promoter in the preparation of drugs for treating prostate cancer.

[0006] The method for treating prostate cancer comprises: mediating the ubiquitination modification of YTHDF2 at the K286 site and promoting the degradation of YTHDF.

[0007] Application of FBXO2 expression detection reagent in the preparation of prostate cancer diagnostic kit.

[0008] Application of FBXO2 expression detection reagent in the preparation of prostate cancer prognosis prediction kit.

[0009] A drug comprising an FBXO2 enhancer.

[0010] A kit includes a reagent for detecting the expression level of FBXO2.

[0011] Use of a reagent capable of mediating ubiquitination modification of YTHDF2 at the K286 site and promoting YTHDF degradation in the preparation of a drug for treating prostate cancer.

[0012] Use of YTHDF2 inhibitors in the preparation of drugs for treating prostate cancer.

[0013] Application of YTHDF2 expression detection reagent in the preparation of prostate cancer diagnostic kit.

[0014] A kit includes a YTHDF2 expression detection reagent.

[0015] The beneficial effects of the present invention are as follows: The present invention discovered that FBXO2 specifically binds to the m6A reader protein YTHDF2 through its carboxyl-terminal domain, mediating the latter's ubiquitination modification at lysine 286 (K286) and promoting its proteasome-dependent degradation. YTHDF2, as a pro-oncogenic protein highly expressed in prostate cancer, can accelerate the degradation of CDKN1C mRNA by regulating m6A methylation modification of the mRNA, thereby driving tumor progression. In addition, inhibiting YTHDF2 expression can reverse the inhibitory effect of FBXO2 on the malignant phenotype of prostate cancer. The present invention reveals for the first time the key role of the FBXO2-YTHDF2-CDKN1C signaling axis in prostate cancer, providing a theoretical basis for the development of new prognostic markers and treatment strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0017] Figure 1 Schematic diagram showing that FBXO2 is lowly expressed in prostate cancer and is associated with a good prognosis; Figure 2 Schematic diagram of how FBXO2 overexpression suppresses the malignant phenotype of prostate cancer cells; Figure 3 Schematic diagram showing that FBXO2 knockdown promotes the proliferation and metastasis of prostate cancer cells; Figure 4 Schematic diagram showing that YTHDF2 is highly expressed in prostate cancer and plays a tumor-promoting role; Figure 5 Schematic diagram of how FBXO2 targets YTHDF2 and promotes its ubiquitination and degradation; Figure 6 Schematic diagram of FBXO2-mediated ubiquitination modification of the K286 site of YTHDF2; Figure 7 Schematic diagram showing that YTHDF2 knockdown reverses the cancer-promoting effect of FBXO2 knockdown; Figure 8 Schematic diagram of YTHDF2 degrading CDKN1C mRNA in an m6A-dependent manner. DETAILED DESCRIPTION

[0018] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0019] Example 1 In this example, it was used to demonstrate that FBXO2 is lowly expressed in prostate cancer and is associated with a good prognosis; The experimental results are as follows Figure 1 As shown: Figure 1 Figure A shows the results of searching the GEPIA database, which included FBXO2 expression in 492 prostate tumor tissues and 152 prostate adjacent tissues. The results showed that FBXO2 expression in prostate cancer (PCa) tissues was significantly lower than that in normal tissues (p<0.05).

[0020] Figure 1 B in the figure is the Kaplan-Meier survival curve, from which it can be seen that the overall survival (OS) of patients in the FBXO2 high expression group was significantly prolonged (Log-rank p<0.01).

[0021] Figure 1 C-1 to C-6 in the figure show the expression levels of FBXO2 in prostate cancer patients in the UALCAN database. Figure 1 As shown in C-1, the expression of FBXO2 in prostate cancer tissue is lower than that in normal tissue. Figure 1 C-2 in Figure 2 shows that FBXO2 expression is different in prostate cancer tissues of patients of different races. Figure 1 As shown in C-3, the expression of FBXO2 in prostate cancer patients with different Gleason scores is different. Figure 1 As shown in C-4, the expression level of FBXO2 in tumor patients is significantly correlated with the TP53 mutation status. Figure 1 From C-5, we can see that the expression level of FBXO2 in tumor patients is significantly correlated with lymph node metastasis. Figure 1 As shown in C-6, the FBXO2 expression level in tumor patients is significantly correlated with mixed expression mutations of other molecules.

[0022] Figure 1D in the figure is the immunohistochemistry (IHC) score of 60 clinical prostate cancer tissues to detect the expression of FBXO2 protein in tumor tissues. Figure 1 Figure E is a representative immunohistochemical staining experiment, the results of which showed that the expression of FBXO2 protein in 60 prostate cancer tissues was significantly lower than that in adjacent adjacent tissues (**p<0.01).

[0023] Figure 1 F in the figure is the Western blot detection result of FBXO2 in normal prostate epithelial cells and prostate cancer cells. The results showed that the expression of FBXO2 protein in normal prostate epithelial cells RWPE-1 was significantly higher than that in PC3, DU145 and 22RV1 cancer cell lines.

[0024] Figure 1 G represents the Western blot detection result of FBXO2 expression in fresh prostate cancer tissue, N represents adjacent normal tissue, and T represents prostate cancer tissue. The results show that the paired prostate cancer (T) and adjacent normal tissue (N) validation showed that FBXO2 protein was lowly expressed in prostate cancer tissue (***p<0.001).

[0025] Example 2 In this example, it is used to demonstrate that FBXO2 overexpression suppresses the malignant phenotype of prostate cancer cells; The experimental results are as follows Figure 2 As shown: Figure 2 Figure A shows the protein expression detection after overexpression of FBXO2. Flag-FBXO2 (flag-FBXO2) was stably transfected into PC3 / DU145 cells mediated by lentivirus, and the overexpression efficiency was verified by Western blot. It can be seen that FBXO2-overexpressing prostate cancer PC3 and DU145 stable cell lines were successfully constructed.

[0026] Figure 2 Figure B shows a CCK-8 cell proliferation experiment of prostate cancer PC3 and DU145 stably transfected cell lines overexpressing FBXO2. The OD values ​​at 450 nm of the cells were detected 1, 2, 3, and 4 times after overexpression of FBXO2. It can be seen that FBXO2 overexpression significantly inhibited cell proliferation (**p<0.01).

[0027] Figure 2 Figure C shows the cell colony formation experiment of prostate cancer PC3 and DU145 stable cell lines overexpressing FBXO2. It can be seen that FBXO2 overexpression significantly inhibited cell proliferation (**p<0.01).

[0028] Figure 2D in the figure is a Transwell chamber (a trademark of a specific culture device used for cell migration, invasion, co-culture, etc., manufactured by Corning, USA, referred to as Transwell chamber) invasion experiment of FBXO2-overexpressing prostate cancer PC3 and DU145 stable cell lines. The Transwell chamber was pre-coated with 1:8 diluted Matrigel, 10% FBS-containing medium was added to the lower chamber, and 3×10 4 Cells were cultured in serum-free medium. After 24 hours, non-invaded cells were removed with a cotton swab, fixed with 4% paraformaldehyde, and stained with crystal violet for counting. It can be seen that the number of cells penetrating the membrane decreased by 50% in the FBXO2 overexpression group (**p < 0.01).

[0029] Figure 2 Figure E shows Annexin V (phospholipid binding protein) / Propidium iodide (PI) double staining in PC3 and DU145 prostate cancer cell lines stably overexpressing FBXO2. Apoptosis rates were analyzed by flow cytometry using the Annexin V-FITC / PI Apoptosis Detection Kit. The cells were harvested, washed with pre-chilled PBS, resuspended in 500 μL of binding buffer, and incubated in the dark for 15 minutes with 5 μL of FITC Annexin V and 10 μL of PI (20 μg / mL). The cells were then analyzed by flow cytometry. FBXO2 overexpression induced a 2.5-fold increase in apoptosis (***p < 0.001).

[0030] Figure 2 F in the figure is: The subcutaneous transplantation model of prostate cancer cells overexpressing FBXO2 was confirmed in 6-week-old male BALB / c nude mice, which were subcutaneously injected with 5×10 6 DU145 cells (shNC / shFBXO2) were transfected. Tumor volume was measured every 5 days (formula: V = long diameter × short diameter² × 0.52). Mice were euthanized after 25 days, and the tumors were isolated and weighed. (F) is a photograph of the transplanted tumor, showing that the FBXO2-overexpressing prostate cancer cell transplanted tumors were smaller than those in the control group.

[0031] Figure 2 G in the figure represents the separation and weighing of the tumor. It can be seen that the tumor weight of the FBXO2-overexpressing prostate cancer cell transplanted tumor group was 40% lower than that of the control group (***p<0.001).

[0032] Figure 2 H represents the transplanted tumor volume growth curve. Tumor volume was measured every 5 days (formula: V = long diameter × short diameter² × 0.52), and the transplanted tumor volume growth curve was plotted. It can be seen that the tumor volume in the FBXO2 overexpression group decreased by 40% compared with the control group (***p<0.001).

[0033] Figure 2 In Figure 1, Western blotting was used to detect the expression of FBXO2 in transplanted tumor tissues. It can be seen that the expression of FBXO2 protein in the tumor tissue of the FBXO2 overexpression group was significantly higher than that in the control group.

[0034] Example 3 In this example, it was used to demonstrate that FBXO2 knockdown promoted the proliferation and metastasis of prostate cancer cells; The experimental results are as follows Figure 3 As shown; Figure 3 Figure A shows shRNA knockdown of FBXO2 protein expression in PC3 / DU145 cells (nucleotide sequence shown in SEQ ID NO. 4). ShRNA targeting FBXO2 and an empty vector plasmid were co-transfected with the lentiviral packaging plasmid into human embryonic kidney HEK293T cells. 48 hours after transfection, the viral supernatant was collected, filtered through a 0.45 μm filter, and co-incubated with prostate cancer cells. 48 hours after infection, cells were selected in medium containing 2 μg / mL puromycin for 3 days. Gene expression levels were verified by RT-qPCR and Western blot. The results showed successful knockdown of FBXO2 protein expression in PC3 / DU145 cells.

[0035] Figure 3 Figure B is a CCK-8 proliferation assay, from which it can be seen that the cell proliferation activity in the FBXO2 knockdown group increased by 1.8 times (**p<0.01).

[0036] Figure 3 Figure C is a cell colony formation experiment, from which it can be seen that the cell proliferation activity in the FBXO2 knockdown group increased by 1.8 times (**p<0.01).

[0037] Figure 3 D in the figure is a Transwell chamber experiment. The Transwell chamber was pre-coated with 1:8 diluted Matrigel, 10% FBS medium was added to the lower chamber, and 3×10 4 Cells expressing FBXO2 were knocked down (in serum-free culture medium). After 24 hours, non-invading cells were removed with a cotton swab, fixed with 4% paraformaldehyde, and stained with crystal violet before counting. As can be seen, the number of invasive cells increased 2.2-fold in the FBXO2 knockdown group (***p < 0.001).

[0038] Figure 3 Panel E is a Western blot experiment of PC3 / DU145 cells after transient knockdown of FBXO2, which shows that FBXO2 protein expression was successfully knocked down.

[0039] Figure 3Figure F shows flow cytometric analysis of PC3 / DU145 cells after transient knockdown of FBXO2. Apoptosis rates were analyzed using the Annexin V-FITC / PI Apoptosis Detection Kit. The cells were harvested, washed with pre-chilled PBS, resuspended in 500 μL of binding buffer, and incubated in the dark for 15 minutes with 5 μL of FITC Annexin V and 10 μL of PI (20 μg / mL). The cells were then analyzed using a flow cytometer. As shown in Figure 5, transient knockdown of FBXO2 by siRNA reduced the apoptosis rate of prostate cancer cells by 35% (*p < 0.05).

[0040] Example 4 In this example, YTHDF2 is highly expressed in prostate cancer and has a tumor-promoting effect; Figure 4 A in the figure is the immunohistochemical score of 60 prostate cancer tissues, showing that the expression of YTHDF2 protein was significantly higher than that in adjacent tissues (***p<0.001).

[0041] Figure 4 B in the figure shows that proteins of RWPE-1 normal cells and PC3 / DU145 prostate cancer cells were extracted and tested by Western blot. It can be seen that Western blot detection shows that YTHDF2 is lowly expressed in RWPE-1 normal cells, but highly expressed in PC3 / DU145 prostate cancer cells.

[0042] Figure 4 Figure C shows the YTHDF2 mRNA expression level in PC3 / DU145 prostate cancer cells after knockdown of YTHDF2 (nucleotide sequence shown in SEQ ID NO. 5). It can be seen that shYTHDF2 effectively knocked down the mRNA level (reduced by 80%). Figure 4 D in the figure shows the protein expression of prostate cancer cells after knocking down YTHDF2. Protein was extracted from PC3 / DU145 prostate cancer cells and analyzed by Western blot. It can be seen that shYTHDF2 effectively knocked down the protein level (reduced by 75%) (***p<0.001).

[0043] Figure 4 Figure E shows the proliferation rate of PC3 / DU145 prostate cancer cells after knocking down YTHDF2 (CCK-8 assay). It can be seen that: YTHDF2 knockdown leads to a 40% decrease in cell proliferation activity; Figure 4 Figure F shows a colony formation assay after knocking down YTHDF2 in PC3 / DU145 prostate cancer cells. It can be seen that YTHDF2 knockdown resulted in a 55% decrease in the number of colonies formed. Figure 4 G shows the Transwell invasion ability assay after knocking down YTHDF2 in PC3 / DU145 prostate cancer cells. It can be seen that the Transwell invasion ability decreased by 60% after YTHDF2 knockdown (**p<0.01).

[0044] Example 5 In this example, it is used to illustrate that FBXO2 targets YTHDF2 and promotes its ubiquitination and degradation; The experimental results are as follows Figure 5 As shown: Figure 5 Figure A shows that DU145 cells were transfected with the empty vector pcDNA3.1 and Flag-FBXO2, respectively. Flag-FBXO2 immunoprecipitation combined with mass spectrometry identified YTHDF2 as an interacting protein. Coomassie brilliant blue staining showed a specific band at the 40 kDa position. It can be seen that both the pcDNA3.1 and Flag-FBXO2 groups can display the light and heavy chains of immunoglobulins, and the Flag-FBXO2 group showed a unique band at the 40 kDa position, indicating that the Flag-FBXO2 protein was successfully pulled down.

[0045] Figure 5 Figure B is an endogenous immunoprecipitation experiment (Co-IP). FBXO2 protein was immunoprecipitated using an antibody against FBXO2 protein pre-immobilized on magnetic beads, and then incubated and developed with an anti-YTHDF2 antibody. It can be seen that endogenous Co-IP confirmed that FBXO2 and YTHDF2 bind to each other in PC3 / DU145 cells.

[0046] Figure 5 Figure C shows an exogenous immunoprecipitation experiment. DU145 and PC3 cells were transfected with a Myc-tagged YTHDF2 plasmid (the nucleotide sequence encoding YTHDF2 is shown in SEQ ID NO. 1) and a Flag-tagged FBXO2 plasmid (the nucleotide sequence encoding FBXO2 is shown in SEQ ID NO. 3), respectively. Pull-down was performed using Flag- or Myc-tagged magnetic beads, followed by SDS-PAGE electrophoresis. Following co-transfection of exogenous Flag-FBXO2 and Myc-YTHDF2, immunoprecipitation confirmed direct interaction, demonstrating direct binding of exogenous FBXO2 and YTHDF2 within prostate cancer cells, DU145 and PC3.

[0047] Figure 5Figure D shows an immunofluorescence assay, in which cells were incubated with mouse anti-FBXO2 and rabbit anti-YTHDF2 primary antibodies, followed by incubation with green-fluorescent goat anti-mouse and red-fluorescent goat anti-rabbit secondary antibodies. Immunofluorescence analysis revealed that FBXO2 (green) and YTHDF2 (red) colocalized in the cytoplasm (nuclei were labeled with DAPI; scale bar 20 μm). Immunofluorescence analysis revealed that FBXO2 (green) and YTHDF2 (red) colocalized in the cytoplasm (yellow), suggesting a possible interaction between the two.

[0048] Figure 5 E in the figure shows the expression of YTHDF2 protein detected by Western blot after overexpression of FBXO2 in HEK293T cells. It can be seen that overexpression of FBXO2 reduces the level of YTHDF2 protein.

[0049] Figure 5 Figure F shows the expression of YTHDF2 protein detected by Western blot after overexpression of FBXO2 in DU145 and PC3 prostate cancer cells. It can be seen that overexpression of FBXO2 reduces the level of YTHDF2 protein.

[0050] Figure 5 Panel G shows the RT-qPCR analysis of YTHDF2 mRNA levels in DU145 and PC3 prostate cancer cells after overexpression of FBXO2. It can be seen that FBXO2 overexpression did not alter YTHDF2 mRNA levels (***p<0.001).

[0051] Figure 5 H in the figure is the Western blot detection of YTHDF2 protein expression after FBXO2 knockout in DU145 and PC3 prostate cancer cells. It can be seen that FBXO2 knockdown upregulates YTHDF2 protein level.

[0052] Figure 5 Figure I shows YTHDF2 mRNA expression detected by PCR after FBXO2 knockdown in DU145 and PC3 prostate cancer cells. It can be seen that FBXO2 knockdown did not change YTHDF2 mRNA levels (***p<0.001).

[0053] Example 6 In this example, it is used to illustrate that FBXO2 mediates the ubiquitination modification of the K286 site of YTHDF2; The experimental results are as follows Figure 6 As shown: Figure 6Figure A shows the protein expression level of YTHDF2 at 0 h, 4 h, 8 h, 12 h, and 16 h after FBXO2 knockdown in DU145 cells. It can be seen that FBXO2 knockdown prolongs the half-life of YTHDF2 protein.

[0054] Figure 6 Panel B shows the cycloheximide (CHX) tracking experiment at 0 h, 4 h, 8 h, 12 h, and 16 h after FBXO2 knockdown in DU145 cells. It can be seen that the cycloheximide (CHX) tracking experiment shows that FBXO2 knockdown prolongs the half-life of YTHDF2 (***p<0.001).

[0055] Figure 6 Figure C reflects that after prostate cancer DU145 and PC3 cells overexpressed FBXO2, the proteasome inhibitor MG132 was added to detect the expression of YTHDF2 protein. It can be seen that the proteasome inhibitor MG132 reversed the degradation effect of FBXO2 on YTHDF2.

[0056] Figure 6 D in the figure shows that Flag-FBXO2, His-Ub and Myc-YTHDF2 plasmids were co-transfected into 293t cells, and IP / IB detection was performed. It can be seen that after Flag-FBXO2, His-Ub and Myc-YTHDF2 plasmids were co-transfected into 293T cells, immunoprecipitation / immunoblotting (IP / IB) detection confirmed that FBXO2 promoted the ubiquitination modification of YTHDF2.

[0057] Figure 6 Panel E is a schematic diagram of the FBXO2 and YTHDF2 deletion mutants used.

[0058] Figure 6 F in the figure indicates that HEK293T cells were transfected with the appropriate plasmids and treated with MG132 (10 μM) for 12 hours. Western blot analysis of IPs and whole cell lysates (WCL) showed that FBXO2 binds to YTHDF2 through its C-terminal domain.

[0059] Figure 6 G in the figure indicates that HEK293T cells were transfected with appropriate plasmids and treated with MG132 (10 μM) for 12 hours. Western blot analysis of IPs and WCL showed that YTHDF2 binds to FBXO2 through its N-terminal domain.

[0060] Figure 6The experimental process corresponding to H in the figure is as follows: 293T cells were co-transfected with His-Ub, Myc-YTHDF2, Flag-FBXO2 or Flag-FBXO2-mutant plasmids, MG132 (10 μM) was added, and YTHDF2 was immunoprecipitated with anti-myc antibody 12 hours later. The ubiquitination of YTHDF2 was detected by immunoblotting. It can be seen that FBXO2 promotes the ubiquitination of YTHDF2 through its C-terminal domain.

[0061] Figure 6 Figure I represents 293T cells co-transfected with Flag-FBXO2, His-Ub, and Myc-YTHDF2 (WT (wild type), K286R (lysine (K) at position 286 mutated to arginine (R)), K401R (lysine (K) at position 401 mutated to arginine (R)), K503R (lysine (K) at position 503 mutated to arginine (R)), K521R (lysine (K) at position 521 mutated to arginine (R)), K536R (lysine (K) at position 536 mutated to arginine (R)), and K571R (lysine (K) at position 571 mutated to arginine (R))) plasmids, aiming to more precisely locate the lysine residues modified by FBXO2-mediated YTHDF2 ubiquitination. Cell lysates were immunoprecipitated using Myc antibodies. Ubiquitination experiments confirmed that FBXO2 promoted the ubiquitination modification of YTHDF2 through its C-terminal domain, with the K286 site being a key modification site. Mutating lysine (K) at position 286 of YTHDF2 to arginine (R) (i.e., the K286R mutant) eliminated the ubiquitination signal (indicating that the K286R mutant could not be degraded by FBXO2-mediated ubiquitination modification). The nucleotide sequence encoding the K286R mutant is shown in SEQ ID NO. 2.

[0062] Example 7 In this example, it is used to illustrate that YTHDF2 knockdown reverses the cancer-promoting effect of FBXO2 knockdown; The experimental results are as follows Figure 7 As shown: Figure 7 Figure A shows the construction of a double knockdown shFBXO2+shYTHDF2 cell model (Western blot verification). It can be seen that in PC3 and DU145 cells, shFBXO2 effectively knocked down FBXO2 protein expression, and shYTHDF2 effectively knocked down YTHDF2 protein expression, successfully constructing a FBXO2 and YTHDF2 double knockdown cell model.

[0063] Figure 7Figure B is a CCK-8 cell proliferation experiment after the construction of a double knockdown shFBXO2+shYTHDF2 cell model. It can be seen that YTHDF2 knockdown partially reversed the cell proliferation / ability enhancement caused by FBXO2 knockdown (reduced by 50%, **p<0.01).

[0064] Figure 7 Figure C is a cell colony formation experiment after the construction of a double knockdown shFBXO2+shYTHDF2 cell model. It can be seen that YTHDF2 knockdown partially reversed the enhanced proliferation caused by FBXO2 knockdown.

[0065] Figure 7 Figure D shows the Transwell invasion experiment after the double knockdown shFBXO2+shYTHDF2 cell model was constructed. It can be seen that YTHDF2 knockdown partially reversed the enhanced invasion caused by FBXO2 knockdown.

[0066] Figure 7 The E in Figure 7 From the quantitative graph in C, it can be seen that YTHDF2 knockdown partially reversed the enhanced proliferation caused by FBXO2 knockdown (reduced by 50%, **p<0.01).

[0067] Figure 7 F in Figure 7 From the quantitative graph in D, we can see that YTHDF2 knockdown partially reversed the enhanced invasion caused by FBXO2 knockdown (reduced by 50%, **p<0.01).

[0068] Figure 7 G represents the construction of subcutaneous xenograft tumor models in nude mice using shFBXO2 (FBXO2 knockdown sequences are shown in SEQ ID NOs. 4 and 5), shYTHDF2 (YTHDF2 knockdown sequences are shown in SEQ ID NOs. 6 and 7), and shFBXO2 + shYTHDF2 (double knockdown). Mice were sacrificed 25 days later, and subcutaneous xenograft tumors were dissected. Results showed that the nude mouse xenograft tumor model confirmed that tumor size in the double knockdown group was significantly reduced compared to the shFBXO2 single knockdown group.

[0069] Figure 7 H in the figure is a graph showing the weight changes of nude mouse subcutaneous transplanted tumors dissected out in the nude mouse subcutaneous transplanted tumor experiment; it can be seen that: over time, the tumor weight of the double knockdown group decreased significantly by 30% compared with the shFBXO2 single knockdown group (**p<0.01).

[0070] Figure 7The I in the figure is a diagram showing the volume changes of the subcutaneous transplanted tumors of nude mice dissected out in the subcutaneous transplanted tumor experiment of nude mice. It can be seen that the nude mouse transplanted tumor model confirmed that the tumor volume of the double knockdown group was significantly reduced by 30% compared with the shFBXO2 single knockdown group (**p<0.01).

[0071] Example 8 like Figure 8 As shown, in this example, it is used to illustrate that YTHDF2 degrades CDKN1C mRNA in an m6A-dependent manner; Figure 8 A in Figure 1 is a picture of RNA dot blot hybridization experiment.

[0072] The experimental steps are as follows: (1) Total RNA was extracted using Trizol (total RNA extraction reagent) and the RNA concentration of each treatment group was adjusted to a uniform level after quantification by the instrument.

[0073] (2) Prepare denaturation buffer by mixing SSC (sodium citrate) buffer and 37% deionized formaldehyde in a ratio of 3:2. Mix the solution with RNA in a ratio of 1:1 and denature the nucleic acid in a PCR instrument (95°C × 5 min).

[0074] (3) The sample was carefully spotted on a nitrocellulose membrane and then UV cross-linked at a wavelength of 302 nm for 30 min.

[0075] (4) Block the membrane with skim milk at room temperature for 2 h, wash the membrane with TBST (membrane washing buffer) for 5 min, and add mAb antibody and incubate at 4°C for 12 h.

[0076] (5) Wash the membrane with TBST (3 times × 5 min), add the corresponding secondary antibody and incubate at room temperature for 2 h, and wash the membrane as before (3 times × 5 min).

[0077] (6) ECL (electrochemiluminescence) chemiluminescence method is used to develop the target band.

[0078] (7) Prepare the methylene blue-stained membrane in parallel: stain for 10-30 min → wash with TBST until the background is clear → image the entire membrane and quantify.

[0079] The developed portion on the left side of the image represents the total amount of m6A, and the methylene blue-stained portion on the right side of the image represents the RNA internal control. RNA dot blot hybridization results indicate that FBXO2 expression levels affect global m6A modification levels (methylene blue was used as a control for RNA loading).

[0080] Figure 8Figure B shows the main enrichment area of ​​m6A peaks in PC3 cells analyzed by MeRIP-seq (RNA methylation immunoprecipitation) data. It can be seen that MeRIP-seq combined with motif analysis identified that the main enrichment of m6A peaks was in the 3'UTR region.

[0081] Figure 8 C in the figure indicates that the consensus m6A sequence "GGACU" was identified in PC3 cells by MeRIP-seq data analysis. It can be seen that MeRIP-seq combined with motif analysis identified that the CDKN1C mRNA 3'UTR region contained the conserved m6A site "GGACU".

[0082] Figure 8 D in the figure is the analysis result of Linked Omics online analysis software. A list of genes positively correlated with FBXO2 and negatively correlated with YTHDF2 was obtained from the TCGA database. On this basis, the differential gene list obtained by MeRIP-seq (RNA methylation immunoprecipitation), mRNA-seq, and RIP-seq sequencing data of YTHDF2 knockdown cells was integrated for comprehensive analysis. It can be seen that: 14 common target genes were finally identified, including CDKN1C, which is a known tumor suppressor in prostate cancer.

[0083] Figure 8 E in the figure is RT-qPCR verification of the transcription level of CDKN1C mRNA, a potential downstream substrate, in prostate cancer cell lines with YTHDF2 knockdown. It can be seen that YTHDF2 knockdown upregulated CDKN1C mRNA (qRT-PCR, ***p<0.001).

[0084] Figure 8 F in the figure represents the transcription level of CDKN1C mRNA, a potential downstream substrate, in prostate cancer cell lines overexpressing FBXO2 verified by RT-qPCR. It can be seen that FBXO2 overexpression upregulates CDKN1C mRNA (qRT-PCR, ***p<0.001).

[0085] Figure 8 Figure G shows the treatment of the control group and the YTHDF2-knockdown prostate cancer stable cell line with the transcription inhibitor Actinomycin D. It can be seen that after Actinomycin D blocked transcription, YTHDF2 knockdown prolonged the CDKN1C mRNA half-life (t1 / 2 was extended by 2 times, **p<0.01).

[0086] Figure 8H in the figure represents the treatment of prostate cancer cells with a global methylation inhibitor (DAA). It can be seen that after treating prostate cancer cells with the m6A demethylase DAA, the CDKN1C mRNA degradation mediated by YTHDF2 through recognition of m6A modification was blocked.

[0087] Figure 8 I in the figure represents RIP experiments using m6A antibodies and RIP kits.

[0088] The experimental steps are as follows: (1) Cell lysis and nuclease treatment: Collect the cell suspension, wash twice with 2 mL of pre-chilled PBS buffer, and centrifuge at 1000 × g for 5 minutes at room temperature to obtain the cell pellet. Add 0.9 mL of Polysome Lysis Buffer and 9 μL of RNase inhibitor, and mix thoroughly by vortexing. Place the mixture on ice for 20 minutes, vortexing every 5 minutes to enhance lysis efficiency.

[0089] (2) Genomic DNA cleanup: 4.5 μL of DNase salt stock and 10 μL of DNase were added to the lysate, followed by incubation at 37°C for 10 minutes. After an ice bath for 20 minutes, 4.5 μL of EDTA, 1.8 μL of EGTA, and DTT were added and mixed. Finally, the supernatant was collected by high-speed centrifugation at 4°C for 10 minutes, and transferred to a sterile EP tube for later use.

[0090] (3) Affinity purification using Protein A / G magnetic beads: Take 20 μL of magnetic bead suspension, wash twice with 0.5 mL of polysome lysis buffer (place on a magnetic separation rack and discard the supernatant), and finally resuspend the magnetic beads with 20 μL of polysome lysis buffer for later use.

[0091] (4) Immunoprecipitation: Divide the lysate into an IP group and a total input group. Add an appropriate amount of antibody (1–5 μg, refer to the antibody manual) to the IP group lysate and incubate at 4°C for 16 hours using a vertical mixer. Add the equilibrated magnetic beads and incubate at 4°C for 1 hour. Discard the supernatant on the magnetic stand. Wash three times with 0.5 mL Polysome Washing Buffer 1 + 5 μL DTT, shaking at 4°C for 5 minutes each time. Wash twice with 0.5 mL Polysome Washing Buffer 2 + 5 μL DTT, following the same procedure as above. Add 100 μL Polysome elution buffer, mix well, and set aside.

[0092] (5) RNA extraction: Add 1 mL of Trizol to each of the IP and internal control samples and place on ice for 5 minutes. Add 200 μL of chloroform, shake the mixture vigorously, place it in an ice bath for 2 minutes, keep it at 4°C, centrifuge it at 13,000 g for 10 minutes, and collect the upper aqueous phase. Then, add 1 μL of glycogen, 50 μL of sodium acetate, and 1 mL of anhydrous ethanol. Precipitate at -80°C for 3 hours or overnight. Centrifuge at 16,100 g for 30 minutes at 4°C and discard the supernatant. Wash with 75% ethanol, centrifuge, air-dry, dissolve in 30 μL of RNase-free water, and store at -80°C.

[0093] (6) qPCR verification results.

[0094] It can be seen that compared with the control group using IgG antibody, CDKN1C mRNA was significantly enriched in the YTHDF2 immunoprecipitation group, indicating that YTHDF2 protein has a direct interaction with CDKN1C mRNA.

[0095] Figure 8 The J in the figure indicates sites predicted by SRAMP using MeRIP-qPCR. Using the m6A site prediction tool SRAMP, 14 potential m6A sites were predicted within the CDKN1C 3'UTR region. Primers were designed based on these sites, and MeRIP-qPCR was performed to validate these predicted sites. MeRIP-qPCR confirmed elevated m6A modification levels at two predicted sites in the CDKN1C mRNA 3'UTR (sites 999-1134 and 2534) compared to the IgG control. The m6A antibody specifically enriched CDKN1C mRNA fragments modified at these two sites.

[0096] Figure 8 K in the figure shows the base sequences near the m6A modification sites 999-1134 (left) and 2534 (right) in the 3'UTR region of CDKN1C mRNA, respectively. The red-marked parts are the base sequences corresponding to the primers used in the MeRIP-qPCR validation experiment.

[0097] In summary, FBXO2 mediates ubiquitination of YTHDF2 at K286 and promotes its proteasomal degradation, thereby relieving YTHDF2's m6A-dependent degradation of CDKN1C mRNA and inhibiting prostate cancer progression. Clinical data analysis combined with functional experiments confirms that the FBXO2-YTHDF2-CDKN1C signaling axis plays a key role in the development and progression of prostate cancer, providing new avenues for targeted therapy.

[0098] As a substrate-recognition subunit of the SCF E3 ubiquitin ligase complex, FBXO2 exhibits tissue-specific functions in tumors. Although previous studies have reported that FBXO2 promotes the progression of ovarian cancer and osteosarcoma by degrading proteins such as SUN2 and IL-6R, this study found that FBXO2 expression is significantly low in prostate cancer, and its high expression is positively correlated with a favorable prognosis (a significant 40% improvement in overall survival, **p<0.01). This discrepancy suggests that FBXO2 may exert a "double-edged sword" effect through tissue-specific substrate regulation. Through the construction of a conditional knockout mouse model and validation in a clinical cohort, it was found that FBXO2 overexpression inhibited prostate cancer cell proliferation (reduced IC50 by 50%) and metastasis (reduced the number of lung metastases by 60%), and induced apoptosis (increased the apoptosis rate by 2.5-fold), confirming its tumor suppressor function in prostate cancer.

[0099] YTHDF2, an m6A reader protein, has its expression dynamically regulated by ubiquitination. This study, using co-immunoprecipitation-mass spectrometry (Co-IP-MS) combined with site-specific mutagenesis, revealed for the first time that FBXO2 binds to the N-terminal domain (1-384) of YTHDF2, specifically mediating its ubiquitination and degradation at K286. This discovery expands the substrate spectrum of the SCF complex and elucidates a novel regulatory mechanism for YTHDF2 protein stability. Notably, YTHDF2 exhibits oncogenic properties in prostate cancer, with knockdown inhibiting cell proliferation (a 45% decrease in the rate of EdU-positive cells) and invasion (a 55% decrease in the number of cells penetrating the membrane). FBXO2 deficiency, on the other hand, drives a malignant phenotype by upregulating YTHDF2 protein levels. This finding contrasts with the tumor suppressor role of YTHDF2 in hepatocellular carcinoma, suggesting that its function is highly context-dependent.

[0100] Further mechanistic analysis revealed that YTHDF2 recognizes the m6A modification (motif "GGACU") in the 3'UTR region of CDKN1C mRNA, accelerating its degradation (mRNA half-life is shortened by 50%). Kip2 As a negative regulator of the cell cycle, the protein's expression level is significantly negatively correlated with prostate cancer stage (**p<0.01). This study demonstrates that FBXO2 overexpression or YTHDF2 knockdown significantly elevates CDKN1C mRNA levels, and the m6A dependency of this regulation is verified by DAA demethylation and MeRIP-qPCR. These findings complement the finding that CDKN1C promoter hypermethylation silences expression in prostate cancer, revealing a network of intertwined epitranscriptional and epigenetic regulation.

[0101] Based on the above analysis, the present invention systematically elucidates the tumor suppressor mechanism of the FBXO2-YTHDF2-CDKN1C axis in prostate cancer: FBXO2 degrades YTHDF2 through ubiquitination, relieving its m6A-dependent degradation inhibition of CDKN1C mRNA, thereby arresting cell cycle progression and inducing apoptosis. The discovery of this signaling axis not only provides a novel prognostic marker for prostate cancer (low FBXO2 expression / high YTHDF2 expression), but also suggests that targeting the SCF complex (specifically FBXO2)-YTHDF2 protein interaction or the m6A-modified microenvironment may be a potential therapeutic strategy for high-risk prostate cancer. Future studies will further validate its clinical translational potential through the development of FBXO2 promoters.

[0102] The nucleotide sequence encoding YTHDF2 is shown in SEQ ID NO. 1; specifically: gagttcgagcttgcatgcctgcaggtcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggactctagaggatccggtactagaggaactgaaaaaccagaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgcctttacttctaggcctgtacggaagtgttacttctgctctaaaagctgcggaattgtacccgcgggcccaccatggcatcaatggagcagaagctgatctcagaggaggacctgcttatggcca The nucleotide sequence for encoding the K286R mutant is shown in SEQ ID NO.2, specifically: gagttcgagcttgcatgcctgcaggtcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggactctagaggatccggtactagaggaactgaaaaaccagaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgcctttacttctaggcctgtacggaagtgttacttctgctctaaaagctgcggaattgtacccgcgggcccaccatggcatcaatggagcagaagctgatctcagaggaggacctgcttatggcca The nucleotide sequence encoding FBXO2 is shown in SEQ ID NO.3, specifically: atggacggagacggtgacccagagagcgtgggccagcccgaggaggcaagcccggaggagcagccagaggaggcgagtgctgaggaggagcggccggaggaccagcaggaggaggaggcggcggccgccgccgcgtacctggacgagctgcccgagccgctgctgctgcgcgtgctggccgcactgccggccgccgagctggtgcaggcctgccgcctggtgtgcctgcgctggaaggagctggtggacggcgcccgctgtggctgctcaagtgccagcaggaggggctggtgcccgagggcggcgtggaggaggagcgcgaccactggcagcagttctacttcctgagcaagcggcgccgcaaccttctgcgtaacccgtgtggggaagaggacttggaaggctggtgtgacgtggagcatggtggggacggctggagggtggaggagctgcctggagacagtggggtggagttcacccacgatgagagcgtcaagaagtacttcgcctcctcctttgagtggtgtcgcaaagcacaggtcattgacctgcaggctgagggctactgggaggagctgctggacacgactcagccggccatcgtggtgaaggactggtactcgggccgcagcgacgctggttgcctctacgagctcaccgttaagctactgtccgagcacgagaacgtgctggctgagttcagcagcgggcaggtggcagtgccccaagacagtgacggcgggggctggatggagatctcccacaccttcaccgactacgggccgggcgtccgcttcgtccgcttcgagcacggggggcaggactccgtctactggaagggctggttcggggcccgggtgaccaacagcagcgtgtgggtagaaccctga The nucleotide sequence of knockdown shFBXO2 is specifically: shFBXO2-1 (SEQ ID NO.4): caccgttaagctactgtccgagcacgagaacgtgctggctgagttcagcatttttt shFBXO2-2 (SEQ ID NO.5): tcgtggtgaaggactggtactcgggccgcagcgacgctggttgcctctacttttt The specific nucleotide sequence for knocking down shYTHDF2 is: shYTHDF2-1 (SEQ ID NO.6): agttggctattgggaacgtccttcaagagaggacgttcccaatagccaacttttttt shYTHDF2-2 (SEQ ID NO.7): gcacagaagttgcaagcaatgttcaagagacattgcttgcaacttctgtgctttttt Throughout this specification, references to terms such as "one embodiment," "example," or "specific example" indicate that the specific features, structures, materials, or characteristics described in conjunction with that embodiment or example are included in at least one embodiment or example of the present invention. In this specification, schematic representations of these terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

[0103] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention, and such changes and modifications fall within the scope of the invention as claimed.

Claims

1. Application of FBXO2 promoter in the preparation of drugs for the treatment of prostate cancer.

2. The use according to claim 1, characterized in that The method for treating prostate cancer comprises: mediating the ubiquitination modification of YTHDF2 at the K286 site and promoting the degradation of YTHDF.

3. Application of FBXO2 expression detection reagent in the preparation of prostate cancer diagnostic kit.

4. Application of FBXO2 expression detection reagent in the preparation of prostate cancer prognosis prediction kit.

5. A drug, characterized in that Includes FBXO2 accelerator.

6. A kit, characterized in that Includes FBXO2 expression detection reagent.

7. The use of reagents that can mediate ubiquitination modification of YTHDF2 at the K286 site and promote YTHDF degradation in the preparation of drugs for the treatment of prostate cancer.

8. Application of YTHDF2 inhibitors in the preparation of drugs for the treatment of prostate cancer.

9. Application of YTHDF2 expression detection reagent in the preparation of prostate cancer diagnostic kit.

10. A kit, characterized in that Includes YTHDF2 expression detection reagent.

Images