SNP marker related to drought resistance of sesame and application thereof

By using the SNP marker G14583726C developed at the 14583726 locus on chromosome 11 of sesame, combined with KASP technology, the problem of weak research on drought resistance in sesame was solved, enabling rapid identification and screening of drought resistance traits in sesame and improving breeding efficiency.

CN116287417BActive Publication Date: 2026-06-02OIL CROPS RES INST CHINESE ACAD OF AGRI SCI +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
Filing Date
2023-04-10
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Current technologies have limited research on drought resistance in sesame, and traditional germplasm resource breeding methods have low selection rates and long cycles, making it difficult to meet the demand for high and stable sesame yields.

Method used

A SNP marker G14583726C located at the 14583726 locus on chromosome 11 of sesame was developed. Primers were designed using competitive allele-specific PCR (KASP) technology to detect genotypes. The fluorescent signals were used to distinguish genotypes and screen sesame materials with strong drought resistance.

Benefits of technology

This technology enables rapid and accurate identification and screening of drought-resistant traits in sesame, shortens the breeding cycle, and improves the efficiency of sesame breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116287417B_ABST
    Figure CN116287417B_ABST
Patent Text Reader

Abstract

The application discloses a SNP marker related to a sesame drought resistance trait and application thereof, the SNP marker is located at 802bp of a sequence as shown in SEQ ID NO.1 and has G / C polymorphism. The molecular marker provided by the application has a key regulation function on the drought resistance ability of sesame, and based on the molecular marker, the drought tolerance of sesame can be predicted or screened and identified, and the breeding process of sesame drought resistance materials can be accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular breeding technology, specifically relating to an SNP marker related to drought resistance in sesame and its application. Background Technology

[0002] Sesame (Sesamum indicum L.), belonging to the genus Sesamum in the family Pedaliaceae, is an annual herbaceous plant and one of my country's distinctive oilseed crops. Due to its high oil content (around 50%), protein (25%), and abundant antioxidants (sesamin, lignans, etc.), global demand for its seeds is increasing. Despite sesame's high yield potential, actual yields have been low and unstable in recent years, failing to meet domestic demand. This is related to the frequent biotic and abiotic stresses during sesame growth, including diseases, drought, waterlogging, and high salinity. Sesame is mainly grown in arid and semi-arid regions, making it susceptible to extreme and intermittent drought stress, which reduces yield and significantly impacts quality. Furthermore, drought has become widespread in sesame production both domestically and internationally in recent years, causing severe yield reductions. Therefore, improving sesame's drought resistance and promoting high and stable yields is essential for the development of the sesame industry.

[0003] Current research on drought resistance in sesame is relatively weak. Studies mainly focus on the effects of drought on sesame plant morphology, quality traits, yield traits, and physiological and biochemical properties, with limited research on molecular aspects. Traditional methods for breeding drought-resistant sesame germplasm resources suffer from low selection rates and long cycles. Marker-assisted selection (MAS) is an effective means to address these issues. MAS utilizes molecular markers associated with specific traits as an auxiliary means for selection breeding, offering advantages such as speed, accuracy, and independence from environmental influences. It reduces the workload of field testing personnel, shortens breeding timelines, and accelerates genetic improvement.

[0004] Single nucleotide polymorphisms (SNPs) refer to gene polymorphisms caused by mutations in a single nucleotide in the genomic DNA sequence. They are widely present in the genome and are often used in breeding practices via molecular marker analysis (MAS), playing a crucial role in the genetic improvement of important traits. Therefore, identifying SNP molecular markers related to drought resistance in sesame and using these markers to screen for drought-resistant sesame germplasm resources is an important foundation and reliable approach to improving the drought resistance of sesame. Summary of the Invention

[0005] In view of this, the present invention aims to provide a molecular marker related to drought resistance traits in sesame, in order to assist in the effective screening of drought-resistant sesame varieties and accelerate the sesame breeding process.

[0006] The specific technical solution of the present invention is as follows:

[0007] The present invention first provides an SNP marker related to drought resistance in sesame, specifically located at 802 bp of the sequence shown in SEQ ID NO.1, which has G / C polymorphism.

[0008] This invention screened 400 sesame materials with varying drought resistance from 7910 domestic and international resources preserved in the National Sesame Mid-term Database. Further, these 400 materials underwent resequencing. Combined with drought-resistant trait data, genotype data, and population structure within the drought-resistant populations of the germplasm resources, genome-wide association analysis was performed on sesame-related traits. At p=10... -6.79 A marker locus located at position 14583726 on chromosome 11 was detected that was significantly associated with sesame survival rate under drought stress. This molecular marker was named G14583726C.

[0009] Substances used to detect the aforementioned SNP markers also fall within the scope of protection of this invention. These substances can be detection kits, which should include a set of detection primers and other reagents and materials used to assist in detection.

[0010] In one embodiment of the present invention, a primer set for detecting the above-mentioned SNP marker was designed based on Kompetitive Allele-Specific PCR (KASP) technology. The primer set contains two upstream primers and one universal downstream primer, and the specific sequences are shown below:

[0011] KASP-F1: 5'-GCGATTCCGTCTGGCTTCCC-3' (SEQ ID NO. 2);

[0012] KASP-F2: 5'-GCGATTCCGTCTGGCTTCCG-3' (SEQ ID NO.3);

[0013] KASP-R: 5'-CCATAGCAGGACTGTAATGGTGGAA-3' (SEQ ID NO. 4).

[0014] Preferably, a fluorescent tag is attached to the 5' end of KASP-F1 / F2 to facilitate direct acquisition of the genotype of the PCR amplification product via fluorescence signal. In one embodiment of the present invention, the fluorescent tag attached to the 5' end of KASP-F1 is FAM, and the fluorescent tag attached to the 5' end of KASP-F2 is HEN, and their sequences are as follows:

[0015] FAM-KASP-F1: 5'- GAAGGTGACCAAGTTCATGCTGCGATTCCGTCTGGCTTCCC-3' (SEQ ID NO. 5, the underlined sequence is the fluorescent tag FAM);

[0016] HEX-KASP-F2: 5'- GAAGGTCGGAGTCAACGGATT GCGATTCCGTCTGGCTTCCG-3' (SEQ ID NO. 6, the underlined sequence is the fluorescent tag HEX).

[0017] The SNP marker and the substance for detecting the SNP marker provided by this invention can be used in any of the following aspects:

[0018] a1) To identify or assist in the identification of drought resistance traits in sesame;

[0019] a2) Predict the drought resistance of sesame materials;

[0020] a3) Screening of drought-resistant sesame germplasm;

[0021] a4) Improvement of drought-resistant sesame germplasm or marker-assisted breeding.

[0022] Based on the SNP marker developed in this invention, this invention further provides a method for identifying drought resistance traits in sesame, specifically: detecting the genotype of the material to be tested at the SNP marker, and the relationship between drought resistance and genotype is CC > GG.

[0023] Preferably, in the above method, the genotype detection process can be as follows: using the genome of the sesame material to be tested as a template, PCR amplification is performed using the primers shown in SEQ ID NO.2 to 4, and genotyping is performed based on the products.

[0024] More preferably, in the above method, when using the primers shown in SEQ ID NO.4 to 6 for genotype detection, the fluorescence signal of the product can be directly detected, and the genotype can be determined based on the fluorescence signal.

[0025] More preferably, in the above method, the PCR amplification reaction system is as follows: 1 μL total, 0.3 μL 20-50 ng / μL, 0.02 μL primer mix, 0.5 μL KASP Master Mix, and the remainder ddH2O; in the primer mix, each of the two upstream primers is 0.6 μM and the downstream primer is 1.5 μM.

[0026] Based on the SNP marker developed in this invention, this invention also provides a sesame breeding method, specifically: by detecting the SNP marker, sesame materials with the genotype CC are selected for assisted breeding.

[0027] The beneficial effects of this invention are as follows: The molecular marker G14583726C developed in this invention was significantly correlated with the survival rate trait under drought stress in 162 natural populations of materials, indicating that this marker plays a key role in the regulation of drought resistance in sesame. Primers designed based on this molecular marker can be used for map-based cloning and marker-assisted selection, thereby effectively screening sesame varieties with strong drought resistance traits. The detection is convenient and rapid, the breeding efficiency is high, and the sesame breeding process is accelerated. Attached Figure Description

[0028] Figure 1 This is a graph showing the genotyping results of 29 sesame samples at molecular marker G14583726C using the detection method provided in Example 2 in Example 3.

[0029] Figure 2 This is a diagram showing the genotyping results of 92 sesame materials from a natural population at the molecular marker G14583726C in Example 4.

[0030] Figure 3 This is a diagram showing the genotyping results of 70 sesame materials from a natural population at the molecular marker G14583726C in Example 4. Detailed Implementation

[0031] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments.

[0032] Unless otherwise specified, the following examples are conducted under standard experimental conditions or conditions recommended in the manufacturer's instructions.

[0033] Example 1: Development of molecular markers associated with drought resistance in sesame

[0034] This invention selects 400 sesame materials with different drought resistance for resequencing analysis from 7,910 domestic and foreign resources preserved in the National Sesame Mid-term Bank, based on the phenotypic, geographical origin and genetic diversity detection results of drought resistance-related traits.

[0035] The resequencing analysis steps were as follows: First, using the Illumina Hiseq2500 sequencing platform, low-coverage whole-genome resequencing was performed on 400 sesame materials using the 2x76 paired-end sequencing method, yielding 2.6-fold coverage genome sequences. Then, combining drought-resistant trait data, genotype data, and population structure from the drought-resistant population of germplasm resources, genome-wide association analysis (GWAS) was performed on sesame-related traits using the EMMAX software package and the Peal program. Finally, at P=10... -6.79A marker locus, G14583726C, located at position 14583726 on chromosome 11, was detected that was significantly associated with sesame survival rate under drought stress, explaining 7.7% of the phenotypic variation.

[0036] After aligning the DNA sequence of the molecular marker G14583726C with the sesame genome reference sequence, a 1601bp sequence was obtained by extending both ends. This sequence corresponds to the DNA sequence shown in SEQ ID NO.1, with the orientation from 5'→3'.

[0037] The molecular marker G14583726C is a SNP site in the sesame genome, located at position 14583726 on chromosome 11 of sesame, specifically corresponding to position 802 of the sequence shown in SEQ ID NO.1, and the base type of this nucleotide site is G or C.

[0038] The genotype of molecular marker G14583726C is GG, CC, or GC, with the preferred allele being CC. The GG genotype is homozygous for G14583726C in the sesame genome, the CC genotype is homozygous for C14583726C, and the GC genotype is heterozygous for both G and C14583726C in the sesame genome.

[0039] Example 2: Construction of a detection method for the molecular marker G14583726C

[0040] The method for detecting the molecular marker G14583726C constructed in this example specifically includes the following steps:

[0041] (1) Obtaining detection primers.

[0042] A complete KASP primer set was designed targeting the two alleles of the target molecular marker G14583726C, consisting of two upstream primers and one universal downstream primer. The specific sequences are as follows:

[0043] KASP-F1: 5'-GCGATTCCGTCTGGCTTCCC-3' (SEQ ID NO. 2);

[0044] KASP-F2: 5'-GCGATTCCGTCTGGCTTCCG-3' (SEQ ID NO.3);

[0045] KASP-R: 5'-CCATAGCAGGACTGTAATGGTGGAA-3' (SEQ ID NO. 4).

[0046] To facilitate direct differentiation of product genotypes via fluorescence signals, fluorescent tags FAM and HEX were added to the 5' ends of the upstream primers KASP-F1 / F2, respectively. The sequences of the resulting single-stranded DNA molecules are shown below:

[0047] FAM-KASP-F1: 5'- GAAGGTGACCAAGTTCATGCT GCGATTCCGTCTGGCTTCCC-3' (the underlined sequence is the fluorescent tag FAM, SEQ ID NO.5);

[0048] HEX-KASP-F2: 5'-GAAGGTCGGAGTCAACGGATTGCGATTCCGTCTGGCTTCCG-3' (the underlined sequence is the fluorescent tag HEX, SEQ ID NO.6).

[0049] The combination of FAM-KASP-F1 and KASP-R amplifies the fragment with the genotype GG (i.e., the molecular marker G14583726C is homozygous for G) at the SNP site. The product of PCR amplification carrying the FAM sequence shows blue fluorescence when illuminated.

[0050] The combination of FAM-KASP-F2 and KASP-R amplifies the fragment with the genotype CC (i.e., the homozygous molecular marker G14583726C is C) at the SNP site. The PCR product carrying the HEX sequence shows a red color when irradiated with fluorescence.

[0051] (2) Based on the above primers, establish a fluorescent PCR detection system and detection conditions.

[0052] ① DNA was extracted from sesame samples using the CTAB method combined with a DNA purification kit.

[0053] ②Using the Replikator instrument, DNA samples were transferred from 96-well plates to 384-well plates, and finally to 1536-well plates.

[0054] ③Dry the DNA in the 1536-well plate in an oven.

[0055] ④ The PCR system was constructed using a Meridian instrument on the dried 1536-well plate. Only 1 μL of reaction system was required for each reaction (see Table 1).

[0056] Table 1 PCR reaction system

[0057]

[0058] The primer mix in Table 1 consists of FAM-KASP-F1, HEX-KASP-F2 and KASP-R, with final concentrations of 0.6 μM for FAM-KASP-F1, 0.6 μM for HEX-KASP-F2 and 1.5 μM for KASP-R.

[0059] ⑤ Seal the well plate containing the reaction mixture and centrifuge at low speed.

[0060] ⑥ After centrifugation, perform the PCR reaction in a water bath.

[0061] ⑦ After the reaction is completed, dry and cool the plate, read it on the Pherastar microplate reader to generate a tif file, use software to convert it into data signal values, and then use the SNPviewer genotyping software for genotyping. The genotype of blue fluorescence is GG, and the genotype of red fluorescence is CC.

[0062] Example 3: Genotyping of Sesame Samples

[0063] In this example, the fluorescence detection method and sequencing method constructed in Example 2 were used to detect 29 sesame samples.

[0064] The sequencing method is as follows: DNA is extracted from each sesame sample, and PCR amplification is performed using primers D1P1F / R as a template to obtain the target fragment, which is then sequenced. The sequence of primers D1P1F / R is as follows:

[0065] D1P1F: 5'-AGGGAAGCATTATCCGACAC-3' (SEQ ID NO. 7);

[0066] D1P1R: 5'-TTTATGGACACGGGCACAGC-3' (SEQ ID NO. 8).

[0067] The results of the fluorescence detection method are as follows Figure 1 As shown: Figure 1 The variety with the molecular marker G14583726C and genotype CC is shown in the upper left corner. Figure 1 The lower right corner shows varieties with the molecular marker G14583726C genotype GG. Further comparison of the above detection results with those obtained by sequencing methods is shown in Table 2, demonstrating consistency and proving that the detection primers and detection method developed in Example 2 can achieve genotyping of the molecular marker G14583726C.

[0068] Table 2 Comparison of fluorescent PCR genotyping results and sequencing genotyping results

[0069] Sesame sample X Y Fluorescent PCR typing Sequencing and Genotyping Consistency of test results ZZM1839 1.564 0.366 G:G G:G Consistent ZZM1867 1.571 0.371 G:G G:G Consistent ZZM0968 1.621 0.348 G:G G:G Consistent ZZM3027 1.565 0.361 G:G G:G Consistent ZZM2974 1.640 0.398 G:G G:G Consistent ZZM3759 1.758 0.391 G:G G:G Consistent ZZM0939 1.637 0.378 G:G G:G Consistent ZZM1277 1.691 0.376 G:G G:G Consistent ZZM3536 1.687 0.391 G:G G:G Consistent WZM4219 1.560 0.364 G:G G:G Consistent ZZM3412 1.663 0.384 G:G G:G Consistent ZZM0795 1.790 0.411 G:G G:G Consistent ZZM4092 1.576 0.372 G:G G:G Consistent ZZM0524 1.682 0.359 G:G G:G Consistent ZZM2289 1.788 0.406 G:G G:G Consistent ZZM0095 1.599 0.377 G:G G:G Consistent ZZM2693 1.688 0.378 G:G G:G Consistent HNG545 1.547 0.393 G:G G:G Consistent ZZM2370 1.580 0.394 G:G G:G Consistent ZZM3537 1.515 0.340 G:G G:G Consistent ZZM2871 1.679 0.401 G:G G:G Consistent WZM1556 1.777 0.408 G:G G:G Consistent WZM3111 0.084 1.328 C:C C:C Consistent ZZM0692 1.700 0.390 G:G G:G Consistent HNG547 0.683 0.804 C:G C:G Consistent WZM1529 0.175 1.188 C:C C:C Consistent ZZM0489 1.697 0.377 G:G G:G Consistent ZZM1766 1.790 0.432 G:G G:G Consistent ZZM5446 0.076 1.315 C:C C:C Consistent

[0070] Note: X represents... Figure 1 The horizontal axis is Y, which is Figure 1 The vertical axis.

[0071] Example 4: Validation of molecular marker G14583726C in a natural population

[0072] The experiment, conducted in 2015-2016 under drought stress, identified the survival traits of 162 materials from natural populations.

[0073] The experiment was conducted in a dry greenhouse at the Yangluo Base of the Oil Crops Research Institute, Chinese Academy of Agricultural Sciences. It was a completely randomized partitioned design with six replicates. The survival rate of each plant was measured at the end of the flowering period.

[0074] DNA was extracted from 162 samples using the CTAB method, and the 162 DNA samples were genotyped according to the primers and methods in Example 2.

[0075] Molecular marker typing results are shown in Table 3 and Figures 2-3 As shown: Among the molecular marker G14583726C, 27 materials (16.67%) had the genotype CC; 87 materials (53.70%) had the genotype GG; 38 materials (23.46%) had the genotype CG; and 10 materials (6.17%) had the deletion.

[0076] Table 3 Genotyping of 162 sesame materials under drought stress

[0077]

[0078]

[0079]

[0080] Note: X represents... Figure 2 or Figure 3 The horizontal axis is Y, which is Figure 2 or Figure 3 The vertical axis, "--" indicates missing.

[0081] According to SNP typing results, sesame lines with the genotype CC and molecular marker G14583726C all belonged to the extreme drought-resistant type, and their phenotypes were consistent over two years. The screening efficiency for extreme drought-resistant lines among 162 accessions was 70.37%. The results indicate that in a natural population of 162 accessions, the molecular marker provided by this invention was significantly correlated with the survival rate trait of sesame under drought stress, consistent with the experimental results. Therefore, this molecular marker can be used for assisted selection of the survival rate trait of sesame under drought stress.

[0082] In summary, the SNP marker G14583726C provided by this invention plays a key regulatory role in the strength of drought resistance in sesame. Based on this SNP marker, the drought resistance of sesame can be predicted or screened, and the identification method is simple, which can accelerate the breeding process of drought-resistant sesame materials.

[0083] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.

Claims

1. A reagent for specifically detecting SNP markers associated with drought resistance traits in sesame, characterized in that, The SNP marker is located at 802 bp of the sequence shown in SEQ ID NO.1 and exhibits G / C polymorphism.

2. The reagent according to claim 1, characterized in that, The reagent includes a primer set containing two upstream primers and one universal downstream primer. The two upstream primers are as shown in SEQ ID NO. 2-3 or are derivatives of the single-stranded DNA molecules shown in SEQ ID NO. 2-3. The downstream primer is as shown in SEQ ID NO.

4. The derivative is obtained by attaching a fluorescent tag to the 5' end of the single-stranded DNA molecules shown in SEQ ID NO. 2-3.

3. The application of the reagent as described in claim 1 or 2 in detecting or identifying drought resistance traits in sesame.

4. The application of the reagent as described in claim 1 or 2 in sesame breeding, wherein the sesame breeding utilizes SNP markers to assist in the selection of materials with drought resistance characteristics.

5. A method for identifying drought resistance traits in sesame, characterized in that, The genotype of the test material at the SNP marker associated with drought resistance in sesame was detected. The SNP marker is located at 802 bp of the sequence shown in SEQ ID NO. 1 and has G / C polymorphism. The relationship between the genotype and drought resistance is CC > GG.

6. The method for identifying drought resistance traits in sesame according to claim 5, characterized in that, The method for detecting the genotype is as follows: using the genome of the sesame material to be tested as a template, PCR amplification is performed using the primer set described in claim 2, and genotyping is performed based on the fluorescence signal.

7. The method for identifying drought resistance traits in sesame according to claim 6, characterized in that, The PCR reaction system consisted of: 1 μL total volume, 0.3 μL 20–50 ng / μL, 0.02 μL primer mix, 0.5 μL KASP Master Mix, and the remainder ddH2O; in the primer mix, each of the two upstream primers was 0.6 μM and the downstream primer was 1.5 μM.

8. A sesame breeding method, characterized in that, The sesame breeding method utilizes SNP markers to assist in the selection of materials with drought resistance characteristics. The SNP marker is located at the 802 bp of the sequence shown in SEQ ID NO.1 and has G / C polymorphism. The method is as follows: by detecting the SNP marker, sesame materials with the genotype CC are selected for drought-resistant variety breeding.