RNA polymerase β subunit mutant and its application

Abstract

The present invention belongs to the field of genetic engineering technology, and in particular to a RNA polymerase β subunit mutant and its application. The RNA polymerase β subunit mutant is obtained by deleting 6 amino acids from positions 215 to 220 based on the wild-type RNA polymerase β subunit (RpoC, NCBI Reference Sequences: NP_418415.1), and has the amino acid sequence shown in SEQ ID NO.1. It is applied to Escherichia coli producing 2'-fucosyllactose and 3-fucosyllactose, which can greatly increase the number of viable cells of the strain during fermentation, improve the tolerance of the strain in the fermentation environment, and the yield of 2'-fucosyllactose or 3-fucosyllactose is also greatly improved.

Description

Technical field:

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to an RNA polymerase beta subunit mutant and an application thereof. Background technology:

[0002] 2'-fucosyllactose (2'-FL) and 3-fucosyllactose (3-FL) are important components of human milk oligosaccharides (HMOs). They play an important role in regulating intestinal flora and immunity, and have broad market prospects.

[0003] Currently, methods for producing 2'-fucosyllactose and 3-fucosyllactose include chemical synthesis, enzymatic synthesis, and microbial fermentation. Microbial fermentation offers advantages such as environmental friendliness and low cost. Escherichia coli is a commonly used engineered strain for microbial fermentation due to its clear genetic background, robust metabolism, and rapid proliferation. The fermentation of various human milk oligosaccharides by E. coli involves multiple enzymes and transporters. The biosynthetic pathways of 2'-fucosyllactose and 3-fucosyllactose are similar. In order to improve the fermentation yield of 2'-fucosyllactose and 3-fucosyllactose, the editing methods of the related genes involved in the biosynthesis pathways of the two are also similar (Huang D, Yang KX, Liu J, et al. Metabolic engineering of Escherichia coli for the production of 2'-fucosyllactose and 3-fucosyllactose through modular pathway enhancement[J]. Metab Eng, 2017, 41: 23-38; Xu Zheng, Li Na, Chen Yingli, et al. Research progress on the biopreparation of human milk oligosaccharides 2'-FL and 3-FL[J]. Chinese Journal of Biotechnology, 2020, 36(12): 12.).

[0004] The field has a deep understanding of the de novo synthesis pathway and key enzymes of the salvage pathway of 2'-fucosyllactose, sugar efflux transporters, etc. (Zhu, YY, et al. Recent advances on 2'-fucosyllactose: physiological properties, applications, and production approaches. Critical Reviews in Food Science and Nutrition, DOI: 10.1080 / 10408398.2020.1850413), and by gene editing of genes encoding related enzymes or transporters, its effect on the fermentation yield of 2'-fucosyllactose and 3-fucosyllactose was investigated. According to reports, one or more of the following genes were knocked out: β-galactosidase encoding gene lacZ, UDP-glucose lipid carrier transferase encoding gene wcaJ, the regulatory gene lacI in the lactose lac operon sequence, L-fucose isomerase encoding gene fucI, L-fucokinase encoding gene fucK, L-fucose-1-phosphate aldolase encoding gene fucA (Ni ZJ, et al. Multi-Path Optimization for Efficient Production of 2′-Fucosyllactose in an Engineered Escherichia coli C41(DE3)Derivative[J]. Frontiers in Bioengineering and Biotechnology, 2020, 8); and / or overexpression of one or more of the following genes: GDP-fucose synthase encoding gene wcaG, GDP-mannose-4,6-dehydratase encoding gene gmd, β-galactosidase encoding gene lacY, phosphomannose isomerase encoding gene manA, phosphomannose mutase encoding gene manB, sugar efflux transporter A encoding gene setA, mannose-1-phosphate guanylyltransferase encoding gene manC, L-arabinose isomerase encoding gene araA, rhamnose isomerase encoding gene rhaA, 2'-fucosyllactose synthase encoding gene futC, L-fucokinase / GDP-L-fucose pyrophosphorylase encoding gene fkp is beneficial to improve the fermentation yield of 2'-fucosyllactose and 3-fucosyllactose. Among them, fucI, fucK, fucA, araA, rhaA, and fkp are involved in the salvage biosynthesis pathway of 2'-fucosyllactose. Due to the low activity and insoluble expression of α-(1,3)-fucosyltransferase (FutA), the fermentation yield of 3-fucosyllactose is lower than that of 2'-fucosyllactose.Therefore, further overexpression or insertion of the α-(1,3)-fucosyltransferase encoding gene futA or beneficial mutation of the α-(1,3)-fucosyltransferase encoding gene futA is more conducive to improving the fermentation yield of 3-fucosyllactose (Yun HC, Park BS, Seo J, et al. Biosynthesis of the human milk oligosaccharide 3-fucosyllactose in metabolically engineered Escherichia coli via the salvage pathway through increasing GTPsynthesis and β-galactosidase modification[J]. Biotechnology and Bioengineering, 2019.).

[0005] Currently, the industrial production of 2'-fucosyllactose and 3-fucosyllactose is often hindered by high concentrations of these sugars in the fermentation environment, which can inhibit the strain's productivity. Therefore, the strain's environmental tolerance is crucial for efficient production. Further improvement of the strain to enhance its environmental tolerance and, in turn, to increase the yield of 2'-fucosyllactose and 3-fucosyllactose remains an ongoing challenge.

[0006] The rpoC gene encodes the β subunit of the Escherichia coli RNA polymerase. Its mutants can enhance the environmental tolerance of the strain by increasing the production of some metabolites, causing changes in the cell membrane, and enhancing the strain's ability to utilize specific metabolites. During the industrial production of 2'-fucosyllactose and 3-fucosyllactose, the high concentrations of 2'-fucosyllactose and 3-fucosyllactose in the fermentation environment will inhibit the production performance of the strain. Therefore, by introducing RpoC mutants, it is expected that the strain's tolerance to the fermentation environment can be improved, thereby achieving further improvement in the production of 2'-fucosyllactose and 3-fucosyllactose. The present invention will provide an RNA polymerase β subunit mutant to improve the strain's tolerance and use it for the production of 2'-fucosyllactose and 3-fucosyllactose. Summary of the invention:

[0007] To address the above technical issues, the present invention utilizes gene editing technology to edit the genes encoding various enzymes or transporters in Escherichia coli. Through gene editing, a mutant RNA polymerase β subunit was obtained that increases the yield of 2'-fucosyllactose and 3-fucosyllactose, and was applied to the production of 2'-fucosyllactose and 3-fucosyllactose.

[0008] One of the technical solutions provided by the present invention is an RNA polymerase β subunit mutant, which is obtained by deleting 6 amino acids from positions 215 to 220 based on the wild-type RNA polymerase β subunit (RpoC, NCBI Reference Sequences: NP_418415.1), and has the amino acid sequence shown in SEQ ID NO.1.

[0009] The second technical solution provided by the present invention is the application of the above-mentioned RNA polymerase β subunit mutant, especially in the production of 2'-fucosyllactose and 3-fucosyllactose.

[0010] The third technical solution provided by the present invention is a genetically engineered bacterium for producing 2'-fucosyllactose, wherein the genetically engineered bacterium is based on Escherichia coli K12 MG1655 as a starting strain, and the P in the lactose lac operon sequence of the starting strain is deleted. lac The promoter sequence and regulatory genes lacI and lacZ are followed by P trc The promoter overexpresses the wcaG, gmd, and lacY genes, thereby replacing the alcohol dehydrogenase encoding gene adhE with P trc The promoter overexpresses manA and manB, then knocks out the wcaJ gene on the genome, mutates the RNA polymerase β subunit gene rpoC on the genome into the RNA polymerase β subunit mutant gene shown in SEQ ID NO.2, and overexpresses the futC, manC and setA genes through the plasmid pTrc99a.

[0011] The fourth technical solution provided by the present invention is a genetically engineered bacterium for producing 3-fucosyllactose, wherein the genetically engineered bacterium is based on Escherichia coli K12 MG1655 as a starting strain, and the P in the lactose lac operon sequence of the starting strain is deleted. lac The promoter sequence and regulatory genes lacI and lacZ are followed by P trc The promoter overexpresses the wcaG, gmd, and lacY genes, thereby replacing the alcohol dehydrogenase encoding gene adhE with P trc The promoter overexpresses manA and manB, then knocks out the wcaJ gene on the genome, mutates the RNA polymerase β subunit gene rpoC on the genome into the RNA polymerase β subunit mutant gene shown in SEQ ID NO.2, and overexpresses the futA, manC and setA genes through the plasmid pTrc99a.

[0012] Furthermore, the Gene ID of lacI is 945007; the Gene ID of lacZ is 945006; the Gene ID of wcaG is 946563; the Gene ID of gmd is 946562; the Gene ID of lacY is 949083; the Gene ID of adhE is 945837; the Gene ID of manA is 944840; the Gene ID of manB is 946574; the Gene ID of wcaJ is 946583; the Gene ID of manC is 946580; the nucleotide sequence of futC is shown in SEQ ID NO: 8; the Gene ID of setA is 944793; and the nucleotide sequence of the futA gene is shown in SEQ ID NO: 6.

[0013] The fifth technical solution provided by the present invention is the application of the above-mentioned genetically engineered bacteria for producing 2'-fucosyllactose, or the application of the genetically engineered bacteria for producing 3-fucosyllactose.

[0014] Beneficial effects:

[0015] The present invention obtains an RNA polymerase β subunit mutant through gene editing technology, and applies it to Escherichia coli that produces 2'-fucosyllactose and 3-fucosyllactose. The mutant can significantly increase the number of viable cells of the strain during fermentation, improve the strain's tolerance to the late fermentation tank environment, and significantly increase the production of 2'-fucosyllactose or 3-fucosyllactose. Description of the drawings:

[0016] Figure 1 Strain W2△wcaJ first step homologous recombination verification;

[0017] Figure 2 Strain W2ΔwcaJ second-step homologous recombination verification;

[0018] Figure 3 Strain W3 first step homologous recombination verification;

[0019] Figure 4 Second-step homologous recombination verification of strain W3. Specific implementation method:

[0020] The present invention will be further described below by specific embodiments. Unless otherwise specified, the technical means, materials, etc. involved in the following embodiments may be well known to those skilled in the art, and appropriate ones may be selected from the known means and materials that can solve the corresponding technical problems. In addition, the embodiments are to be understood as illustrative rather than limiting the scope of the present invention, and the spirit and scope of the present invention are limited only by the claims. For those skilled in the art, without departing from the spirit and scope of the present invention, various changes or modifications made to the material composition and dosage in these embodiments also fall within the scope of protection of the present invention.

[0021] The RNA polymerase β subunit mutant involved in the present invention is obtained by deleting 6 amino acids from positions 215 to 220 based on the wild-type RNA polymerase β subunit (RpoC, NP_418415.1), and has the amino acid sequence shown in SEQ ID NO.1:

[0022]

[0023] The nucleotide sequence of the RNA polymerase β subunit mutant is shown in SEQ ID NO.2:

[0024]

[0025] The present invention will be further explained below through specific embodiments.

[0026] Example 1 Construction of strain W2ΔwcaJ

[0027] In Escherichia coli W2 (E.coli K12 MG1655△lacIZ::P trc -wcaG-gmd-lacY,△adhE::P trc -manB-manA), the UDP-glucose lipid carrier transferase encoding gene wcaJ was knocked out in the genome to construct strain W2△wcaJ.

[0028] Among them, Escherichia coli W2 was constructed based on Escherichia coli K12 MG1655 as the starting strain, and the P in the lactose lac operon sequence of the starting strain was knocked out. lac The promoter sequence and regulatory genes lacI and lacZ are replaced by P at the original lacZ site. trc The W1 strain was obtained by overexpressing wcaG, gmd, and lacY through the promoter, and then the alcohol dehydrogenase encoding gene adhE was replaced by P trc The W2 strain was obtained by overexpressing manA and manB by the promoter. The specific construction process of the W2 strain can be found in Examples 1 and 2 of CN112501106A.

[0029] P involved in the construction of E. coli W2 lac The promoter sequence is SEQ ID NO.3: caccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagtcaattcagggtggtgaat; the Gene ID of lacI is 945007; the Gene ID of lacZ is 945006; trcThe promoter sequence is SEQ ID NO.4: gcgcaacgcaattaatgtgagttagcgcgaattgatctggtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatcggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaattgtgagcggataacaatctcacacaggaaacagacc; the Gene ID of wcaG is 946563; the Gene ID of gmd is 946562; the Gene ID of lacY is 949083; the Gene ID of adhE is 945837; the Gene ID of manA is The gene ID of manB is 944840; the gene ID of manB is 946574.

[0030] Using strain W2 as the starting strain, wcaJ was knocked out using CRISPR / Cas9 technology (Gene ID is 946583). The CRISPR / Cas9 technology used in the experiment refers to previous research reports [Zhao D, et al. CRISPR / Cas9-assisted gRNA-free one-step genome editing with no sequence limitations and improved targeting efficiency. Sci Rep 7, 16624]. First, the first step homologous recombination fragment was constructed, comprising upstream and downstream homology arms, the chloramphenicol resistance gene cat, and a universal N20 sequence (TAGTCCATCGAACCGAAGTAAGG). The first step homologous recombination fragment was introduced into the W2 strain containing the pCAGO plasmid by electroporation for the first step of recombination. The pCAGO plasmid contains the recombinase gene, as well as cas9 and gRNA genes [Zhao D, et al. CRISPR / Cas9-assisted gRNA-free one-step genome editing with no sequence limitations and improved targeting efficiency. Sci Rep 7, 16624]. The correct clone was selected for a second homologous recombination. The correct clones after the second homologous recombination were picked and passaged to lose the pCAGO plasmid, thereby obtaining the W2△wcaJ strain with the wcaJ gene knocked out.

[0031] The following describes the specific method in detail:

[0032] (1) Construction of homologous recombination fragments. Using the genome of E. coli K12 MG1655 (GeneBank accession NO. NC_000913.3) as a template, primers up-1 and up-2, as well as primers down-1 and down-2 in Table 1, were used to PCR amplify the upstream and downstream homology arms of homologous recombination. Using an artificially synthesized vector containing the chloramphenicol resistance gene cat, cat's own promoter, and a fragment of the N20 sequence (cat-N20 sequence, the nucleotide sequence is shown in SEQ ID NO: 5) as a template, primers cat-1 and cat20-2 were used to perform PCR amplification to obtain a fragment with the cat-N20 sequence. Using the upstream and downstream homology arms, the fragment with the cat-N20 sequence, and these three fragments as templates, primers up-1 and down-2 were used to perform overlapping PCR amplification to obtain a homologous recombination fragment.

[0033] (2) The first step is homologous recombination. The pCAGO plasmid is transformed into the strain W2 using conventional plasmid transformation methods to obtain the strain W2 (pCAGO). The W2 (pCAGO) competent state is prepared using LB culture medium containing 1% glucose and 0.1mM IPTG (isopropyl-β-D-thiogalactoside). The homologous recombination fragment is introduced using the electroporation method. The transformed bacterial liquid is spread on an LB plate containing 100mg / L ampicillin and 25mg / L chloramphenicol, as well as 1% glucose, and cultured at 30°C. The transformants are picked for colony PCR identification. If the recombination is correct, the band size is 3400bp, and the verification result is as follows. Figure 1 As shown, the bands were correct and the first step homologous recombination strain was obtained.

[0034] (3) Second step homologous recombination. The first step homologous recombination strain was inoculated into LB liquid medium containing 100 mg / L ampicillin, 0.1 mM IPTG and 2 g / L arabinose, and cultured at 30 ° C for more than 6 hours. Single colonies were isolated by streaking on the plate. The clones that grew on the LB plate containing 100 mg / L ampicillin but did not grow on the LB plate containing 25 mg / L chloramphenicol were selected and verified by colony PCR. If the recombination was correct, the band size was 1300 bp. The verification results were as follows: Figure 2 The band was correct, and the PCR product of the band was sequenced and the sequencing results were correct, thus obtaining the second-step homologous recombination strain. The second-step homologous recombination strain was further cultured at 37°C to lose the pCAGO plasmid, thereby obtaining strain W2△wcaJ.

[0035] Table 1 Primers used to knock out the wcaJ gene

[0036] Primer name Primer sequences up-1 tcaccactttgtcgttctccatcactttc up-2 aacgatgacaaatctaaaaaagcgcg cat-1 tttttagatttgtcatcgttattaattaatctcgagtgtgacg cat20-2 gcgccataaggtgaaaccggccttacttcggttcgatggactattacgccccgccctgccac down-1 ccggtttcaccttatggcgcagcatgtagccttcaatgaggttcctgttattagccccttaccc down-2 aacgcggtcgctatcagcaaatcaacctg

[0037] Example 2 Construction of strain W3

[0038] The wild-type RNA polymerase β subunit amino acid sequence of Escherichia coli K12 MG1655 is NP_418415.1. Based on strain W2ΔwcaJ, the RNA polymerase β subunit gene rpoC on the genome was mutated using the same CRISPR / Cas9 technology described above, resulting in a deletion of six amino acids from positions 215 to 220 in the translated protein. The amino acid sequence corresponding to the mutated RNA polymerase β subunit is shown in SEQ ID NO: 1. The resulting strain was named W3. The specific construction method is as follows:

[0039] (1) Construction of homologous recombination fragments

[0040] Using the laboratory-maintained wild-type strain MG1655 as a template, PCR amplification of the upstream and downstream homology arms of homologous recombination was performed using the primer pairs RP-up-F / R and RP-down-F / R listed in Table 2, respectively. A fragment containing the cat-N20 sequence, obtained by PCR during the construction of strain W2ΔwcaJ, was used as a template and PCR amplification was performed using the primer pair RP-cat-F / R to obtain a new fragment containing the cat-N20 sequence. Overlapping PCR using these three fragments, the upstream and downstream homology arms, and the new fragment containing the cat-N20 sequence, was performed using primers RP-up-F and RP-down-R to obtain a homologous recombination fragment containing the mutation in the rpoC gene, namely, a deletion of six amino acids from positions 215 to 220 of the wild-type RpoC protein.

[0041] (2) First step: homologous recombination

[0042] The pCAGO plasmid was transformed into the strain W2△wcaJ using conventional plasmid transformation methods to obtain the strain W2△wcaJ (pCAGO). W2△wcaJ (pCAGO) competent cells were prepared using LB medium containing 1% glucose and 0.1mM IPTG. The homologous recombination fragments were introduced using electroporation. The transformed bacterial solution was spread on LB plates containing 100mg / L ampicillin and 25mg / L chloramphenicol, as well as 1% glucose, and cultured at 30°C. Transformants were picked for colony PCR verification. If the recombination was correct, the band size was about 2200bp. The verification results were as follows: Figure 3 As shown, the bands were correct and the first step homologous recombination strain was obtained.

[0043] (3) Second step homologous recombination

[0044] The same steps as the second step of homologous recombination when knocking out the wcaJ gene are used above. The grown single clones are verified by colony PCR. If the recombination is correct, the band size is about 1200bp. The verification result is as follows Figure 4 The band was correct, and the PCR product of this band was sequenced and the sequencing results were correct, obtaining the second-step homologous recombination strain. The second-step homologous recombination strain was further cultured at 37°C to lose the pCAGO plasmid, thereby obtaining a strain with the rpoC mutation (SEQ ID NO. 2), named W3.

[0045] Table 2 Primers used to construct rpoC gene mutant strains

[0046]

[0047]

[0048] Example 3 Construction of plasmid pTrc99a-P trc -futC-manC

[0049] Based on the plasmid pTrc99a-futC-manC (using P trc The promoter overexpresses the futC gene using the arabinose-inducible promoter P ara Overexpression of manC gene) to construct plasmid pTrc99a-P trc -futC-manC. The specific construction process of plasmid pTrc99a-futC-manC refers to Example 3 of CN112501106A.

[0050] Plasmid pTrc99a-P trc -futC-manC build involved P trc The promoter nucleotide sequence is SEQ ID NO. 4; the Gene ID of the mannose-1-phosphate guanylyltransferase encoding gene manC is 946580; the nucleotide sequence of the 2'-fucosyllactose synthase encoding gene futC is shown in SEQ ID NO: 8:

[0051] atggcttttaaagtggtgcaaatttgcggagggcttgggaatcaaatgtttcaatacgctttcgctaaaagtttgcaaaaacactctaatacgcctgtgctgttagatattacttcttttgattggagcaataggaaaatgcaattagagcttttccctattgatttaccctatgcgaatgcaaaagaaatcgctatagctaaaatgcaacacctccccaagctagtaagagatacgctcaaatacatgggatttgatagggtgagtcaagaaatcgtgtttgaatacgagcctaaattgttaaagccaagccgcttgacttatttttatggctattttcaagatccacgatattttgatgctatatcccctttaatcaagcaaactttcaccctaccccacccccccccccccgaaaatggaaataataaaaaaaaagaggaagaataccaccgcaaacttgctttgattttagccgctcaaaacagcgtgtttgtgcatataagaagaggggattatgtggggattggctgtcagcttggcattgactatcaaaaaaaggcgcttgagtatatggcaaaacgcgtgccaaacatggaacttttcgtgttttgcgaagacttagaattcacgcaaaatcttgatcttggctacccttttatggacatgaccactagggatagagaagaagaggcgtattgggatatgctgctcatgcaatcctgtcagcatggcattatcgctaatagcacttatagctggtgggcggcttatttgatagaaaatccagaaaaaatcattattggccccaaacactggctttttgggcatgagaatatcctttgtgaggaatgggtgaaaatagaatcccattttgaggtaaaatcccaaaagtataacgcttaa。

[0052] PCR amplification was performed using plasmid pTrc99a-futC-manC as a template and Darac-F and Darac-R in Table 3 as primers to remove the arabinose promoter upstream of the manC gene in the pTrc99a-futC-manC plasmid and use only P trc The promoter overexpressed futC and manC genes, and the linear fragment pTrc99a-P was obtained after amplification. trc -futC-manC. The linear gene fragment obtained by PCR was purified and recovered using The recombinant plasmid was obtained by self-ligation using the Ⅱ Recombination Ligation Kit (Novozyme Biotechnology Co., Ltd.), transformed into Escherichia coli DH5α competent cells, cultured on LB plates containing 100 mg / L ampicillin, and the transformants were picked for colony PCR and sequencing verification to obtain the correct recombinant plasmid, which was named plasmid pTrc99a-P trc -futC-manC.

[0053] Table 3 Construction of plasmid pTrc99a-P trc -futC-manC primers used

[0054]

[0055]

[0056] Example 4 Construction of plasmid pTrc99a-P trc -futA-manC

[0057] The plasmid pTrc99a-P was replaced with the α-(1,3)-fucosyltransferase gene futA from Helicobacter pylori NCTC 11637. trc -futC in futC-manC, construct plasmid pTrc99a-P trc -futA-manC. FutA can catalyze the production of 3-fucosyllactose using GDP-fucose and lactose as substrates.

[0058] Plasmid pTrc99a-P trc The recovered PCR products were ligated using a recombination ligation kit (Novozyme Biotech Co., Ltd.), transformed into Escherichia coli DH5α competent cells, cultured on LB plates containing 100 mg / L ampicillin, and transformed cells were picked for colony PCR and sequencing verification to obtain the correct recombinant plasmid, which was named plasmid pTrc99a-P trc -futA-manC.

[0059] Table 4 Construction of plasmid pTrc99a-P trc -futA-manC primers used

[0060]

[0061]

[0062] Example 5 In plasmid pTrc99a-P trc Construction of plasmid overexpressing setA gene on -futC-manC

[0063] Furthermore, the sugar efflux transporter gene setA (Gene ID 944793) was overexpressed in the plasmid pTrc99a-P trc -futC-manC based on the promoter P J23110 (The nucleotide sequence is shown in SEQ ID NO: 7: GAATTCGCGGCCGCTTCTAGAGTTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTAC) overexpressing setA, and constructing plasmid pTrc99a-P trc -futC-manC-P J23110 -setA.

[0064] Plasmid pTrc99a-P trc -futC-manC was used as a template, and pTrc-F and pTrc-110-R in Table 5 were used as primers for PCR amplification to obtain pTrc99a-P trc -futC-manC linear vector fragment. Using the E. coli MG1655 genome as a template and setA-110-F and setA-R as primers, PCR amplification was performed to obtain a fragment with P J23110 , setA gene fragments. J23110 , setA gene fragment, and pTrc99a-P obtained by PCR trc -futC-manC linear vector fragment was purified and recovered, and used Ⅱ Recombination Ligation Kit (Novozyme Biotechnology Co., Ltd.)J23110 , setA gene fragment and pTrc99a-P trc The -futC-manC linear vector fragment was ligated and transformed into Escherichia coli DH5α competent cells. The cells were cultured on LB plates containing 100 mg / L ampicillin. Transformants were picked for colony PCR and sequencing verification to obtain the correct recombinant plasmid, which was named plasmid pTrc99a-P trc -futC-manC-P J23110 -setA.

[0065] Table 5 Construction of plasmid pTrc99a-P trc -futC-manC-P J23110 - Primers used for setA

[0066] Primer name Primer sequences pTrc-F tcaaacgtctttaacctttgc pTrc-110-R caaaggttaaagacgtttgagtagaacaactgttcaccgttac setA-110-F atcagggttgtagctagcattgtacctaggactgagctagccgtaaatgcgtttctacaaactcttt setA-R atgctagctacaaccctgataaatgcttctagagaaagaggagaaatactagatgatctggataatgacgatg

[0067] Example 6 In plasmid pTrc99a-P trc Construction of plasmid overexpressing setA gene on futA-manC

[0068] In plasmid pTrc99a-P trc -futA-manC based on the promoter P J23110 Overexpression of setA to construct plasmid pTrc99a-P trc -futA-manC-P J23110 -setA.

[0069] Plasmid pTrc99a-P trc -futA-manC was used as a template, and pTrc-F and pTrc-110-R in Table 5 were used as primers to perform PCR amplification to obtain a linear vector fragment. The E. coli MG1655 genome was used as a template, and setA-110-F and setA-R were used as primers to perform PCR amplification to obtain a linear vector fragment. J23110 , setA gene fragments. J23110 , setA gene fragment, pTrc99a-P trc -futA-manC linear vector fragment was purified and recovered, and used Ⅱ Recombination Ligation Kit (Novozyme Biotechnology Co., Ltd.) J23110 , setA gene fragment and pTrc99a-P trc The -futA-manC linear vector fragment was ligated and transformed into Escherichia coli DH5α competent cells. The cells were cultured on LB plates containing 100 mg / L ampicillin. Transformants were picked for colony PCR and sequencing verification to obtain the correct recombinant plasmid, which was named plasmid pTrc99a-Ptrc -futA-manC-P J23110 -setA.

[0070] Example 7 Construction and fermentation test of 2'-fucosyllactose producing strain

[0071] The plasmid pTrc99a-P was transformed into trc -futC-manC-P J23110 -setA and pTrc99a-P trc -futA-manC-P J23110 -setA were introduced into W2△wcaJ and W3, respectively, to construct the 2'-fucosyllactose-producing strain W2△wcaJ (pTrc99a-P trc -futC-manC-P J23110 -setA) and W3(pTrc99a-P trc -futC-manC-P J23110 -setA), and 3-fucosyllactose-producing strain W2ΔwcaJ (pTrc99a-P trc -futA-manC-P J23110 -setA) and W3(pTrc99a-P trc -futA-manC-P J23110 -setA). Test the fermentation production level of the above strains.

[0072] The culture medium used was:

[0073] LB medium: NaCl 10 g / L, yeast powder 5 g / L, peptone 10 g / L, pH 7.0.

[0074] Fermentation medium: KH2PO4 3 g / L, yeast powder 8 g / L, (NH4)2SO4 4 g / L, citric acid 1.7 g / L, MgSO4·7H2O 2 g / L, thiamine 10 mg / L, glycerol 10 g / L, lactose 5 g / L, 1 ml / L trace elements (FeCl3·6H2O 25 g / L, MnCl2·4H2O 9.8 g / L, CoCl2·6H2O 1.6 g / L, CuCl2·H2O 1 g / L, H3BO3 1.9 g / L, ZnCl2 2.6 g / L, Na2MOO4·2H2O 1.1 g / L, Na2SeO3 1.5 g / L, NiSO4·6H2O 1.5 g / L), pH adjusted to 7.2 with aqueous ammonia.

[0075] The fermentation test process is:

[0076] Single colonies of the 2'-fucosyllactose-producing strain and the 3-fucosyllactose-producing strain were picked separately and cultured overnight in LB liquid medium containing 50 mg / L ampicillin at 37°C and 220 rpm / min. The bacterial solution cultured overnight was used as seed solution and transferred to a 24-well plate containing 2 mL of fermentation medium at a 1% inoculation volume. The fermentation medium contained 50 mg / L ampicillin and 0.1 mmol / L IPTG. Fermentation was carried out at 37°C and 800 rpm / min. Three samples were cultured in parallel for each strain. During the fermentation process, the growth of the bacteria (OD 600 ), 2'-fucosyllactose or 3-fucosyllactose content, and calculate the number of viable cells (by appropriately diluting the bacterial solution with LB liquid medium, coating LB solid plates, and counting the number of single colonies grown on the plates). The concentration of 2'-fucosyllactose or 3-fucosyllactose in the sample was detected by HPLC. The HPLC analysis used a Carbohydrate ES 5u 250mm*4.6mm column, an evaporative light detector, a mobile phase of 70% acetonitrile (acetonitrile:water), a flow rate of 0.8mL / min, a column temperature of 30°C, and an injection volume of 5μL. The sample concentration was quantified using a 2'-fucosyllactose or 3-fucosyllactose standard. The results are shown in Tables 6 and 7:

[0077] Table 6 Fermentation test results of 2'-fucosyllactose producing strains

[0078]

[0079] Table 7 Fermentation test results of 3-fucosyllactose producing strains

[0080]

[0081] As can be seen from Tables 6 and 7, the deletion of 6 amino acids from amino acid position 215 to amino acid 220 of the RpoC protein significantly increased the number of viable cells of the strain at 48 h of fermentation, improved its tolerance to the late fermentation tank environment, and significantly increased the production of 2'-fucosyllactose or 3-fucosyllactose.

[0082] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various changes, modifications, substitutions and variations in form and details to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. A genetically engineered bacterium for producing 2'-fucosyllactose, characterized in that: The engineering bacteria uses Escherichia coli K12MG1655 as the starting strain, and knocks out the P in the lactose lac operon sequence of the starting strain. lac Promoter sequences and regulatory genes lacI and lacZ , in the original lacZ P trc Promoter overexpression wcaG、gmd and lacY gene, and then the gene encoding alcohol dehydrogenase adhE Replace with P trc Promoter overexpression manA and manB , and then knock out the wxya gene, RNA polymerase β subunit gene on the genome rpoC The mutant gene of RNA polymerase β subunit was mutated to SEQ ID NO.2 and overexpressed via plasmid pTrc99a. futC、manC as well as setA Genetic acquisition.

2. A genetically engineered bacterium for producing 3-fucosyllactose, characterized in that: The engineering bacteria uses Escherichia coli K12MG1655 as the starting strain, and knocks out the P in the lactose lac operon sequence of the starting strain. lac Promoter sequences and regulatory genes lacI and lacZ , in the original lacZ P trc Promoter overexpression wcaG、gmd and lacY gene, and then the gene encoding alcohol dehydrogenase adhE Replace with P trc Promoter overexpression manA and manB , and then knock out the wxya gene, RNA polymerase β subunit gene on the genome rpoC The mutant gene of RNA polymerase β subunit was mutated to SEQ ID NO.2 and overexpressed via plasmid pTrc99a. futA、manC as well as setA Genetic acquisition.

3. The engineered bacteria according to claim 1 or 2, wherein futC The nucleotide sequence is shown in SEQ ID NO: 8; futA The nucleotide sequence of the gene is shown in SEQ ID NO:

6.

4. Use of the genetically engineered bacteria according to claim 1 in the production of 2'-fucosyllactose.

5. Use of the genetically engineered bacteria according to claim 2 in the production of 3-fucosyllactose.

Images