Primers, kits and methods for identifying plants of the genus curcuma

Abstract

The application discloses a primer, a kit and a method for identifying Curcuma plants, and belongs to the technical field of species identification. The method comprises the following steps: (1) extracting DNA from Curcuma plants to be identified; (2) using the DNA obtained in step (1) as a template, performing PCR amplification on the template by using 26 pairs of primers to obtain amplification products; (3) performing fluorescence capillary electrophoresis detection on the amplification products obtained in step (2); and (4) analyzing the detection results obtained in step (3) by using data analysis software, performing cluster analysis on sample genotype data obtained in the analysis, determining whether the Curcuma plants to be identified can be clustered into one category with the Curcuma plants in a cluster map, and distinguishing different individuals of the Curcuma plants according to a cluster result. The primer and the kit can be used to realize rapid identification of the Curcuma plants, and can be used to identify Curcuma kwangsiensis, C. zedoaria, C. longa, C. wenyujin, C. rotundifolia and C. aromatica.

Description

Technical Field

[0001] This invention relates to the field of species identification technology, specifically to primers, reagent kits, and identification methods for identifying plants of the genus Curcuma. Background Technology

[0002] *Curcuma* L. is a genus of perennial herbs belonging to the ginger family (Zingiberaceae). These herbs have fleshy, aromatic rhizomes and very short (or absent) aerial stems. Leaves are basal, rarely narrowly linear. Inflorescences are spike-like or cymose, with filiform, nearly fleshy styles. The capsule is spherical with a membranous pericarp; seeds are small and have an aril.

[0003] Plants in this genus are the source of the traditional Chinese medicines "turmeric" or "curcuma zedoaria," while their tuberous roots are the source of "turmeric." They are pungent, bitter, and warm in nature, and enter the spleen and liver meridians. They have the functions of breaking up blood stasis, promoting qi circulation, regulating menstruation, and relieving pain. They are used for chest and abdominal pain due to qi stagnation and blood stasis, dysmenorrhea, and limb pain, often combined with Corydalis yanhusuo and Cyperus rotundus.

[0004] Plants in the genus Curcuma include Curcuma longa, Curcuma aromatica, Curcuma zedoaria, Curcuma yunnanensis, Curcuma yunnanensis with a bitter taste, Curcuma chuanxiong, Curcuma zedoaria, Curcuma zedoaria, Curcuma zedoaria, and Curcuma guangxiensis, etc.

[0005] Curcuma kwangsiensis, a perennial herb belonging to the genus Curcuma in the ginger family (Zingiberaceae), is mainly distributed in Qinzhou, Guigang, Nanning, Baise, Shangsi, and Yulin in Guangxi Province. It is a major authentic medicinal herb produced in Guangxi, with a long history of cultivation and a large production area. In 2021, it was selected as one of the "Ten Delicacies of Guangxi". Its dried rhizome, commonly known as "Gui E Zhu," has the effects of promoting qi circulation, breaking up blood stasis, eliminating stagnation, and relieving pain. Along with Curcuma zedoaria and Curcuma aromatica, it is one of the three source plants of Curcuma zedoaria listed in the Pharmacopoeia of the People's Republic of China (hereinafter referred to as the "Pharmacopoeia"). Among them, the dried tuberous root of Curcuma kwangsiensis, commonly known as "Gui Yu Jin," has the effects of promoting blood circulation, relieving pain, regulating qi, relieving depression, clearing the heart, and cooling the blood. It, along with Curcuma aromatica, Curcuma aromatica, and Curcuma zedoaria, is a source of Curcuma aromatica in the Pharmacopoeia. Modern pharmacological studies have shown that Curcuma zedoaria has antithrombotic, antitumor, antibacterial, anti-inflammatory, antiviral, blood sugar and blood lipid regulating effects, while Curcuma longa has hepatoprotective, hemostatic and anticoagulant, anti-inflammatory and analgesic, vasoconstrictive, antitumor, anti-liver fibrosis, choleretic and jaundice-reducing effects.

[0006] With the deepening research on the chemical composition, pharmacological effects, and clinical applications of Curcuma zedoaria in Guangxi, its domestic and international market demand is increasing daily. Artificial cultivation of Curcuma zedoaria has become the main source of medicinal materials, with the total planting area in Guangxi reaching nearly 30,000 mu in 2021. However, during artificial cultivation, unclear seed sources and mixed germplasm are common problems, leading to highly unstable quality of the medicinal material. This significantly affects the safety and efficacy of the medicinal material, and consequently impacts the establishment of the Guangxi Curcuma zedoaria brand and its market competitiveness. Accurate species identification is fundamental to the research, protection, and sustainable utilization of medicinal plant resources. To ensure correct cultivation and selection, and safe and effective clinical use, accurate identification of the original plant of Curcuma zedoaria urgently needs to be addressed.

[0007] Curcuma zedoaria, Curcuma longa, Curcuma aromatica, and Curcuma wenyujin all belong to the genus Curcuma. Their morphological characteristics are similar, making them easily confused. Furthermore, there is significant intraspecific morphological variation, lacking stable morphological features. In addition, specimens with flowers and fruits are difficult to collect for most species, making traditional identification and classification challenging. Many scholars have used morphological, cytological, and chemical compositional classification methods to study Curcuma species, but these methods still face many difficulties in practical application, making it hard to achieve a unified standard.

[0008] With the rapid development of molecular biology techniques, there are increasing reports on the application of DNA molecular markers in plant identification and classification. To address the classification of Curcuma species, Chen Yuheng et al. (1999) used RAPD analysis combined with chemical and morphological data to study three Curcuma species: *Curcuma wenyu*, *Curcuma chuanxiong*, and *Curcuma hainanensis* (also known as *Curcuma cinnamon*), concluding that *Curcuma wenyu* and *Curcuma hainanensis* should be merged. Xiao Xiaohe et al. (2000) used RAPD analysis to classify and identify 10 Curcuma species. Li Min et al. (2006) used SRAP technology to perform cluster analysis on 6 Curcuma species. Li Yangyi et al. (2015) used RAMP to study 69 Curcuma materials, and in 2016, they further validated and explained their previous research based on ISSR molecular markers. Cao et al. (2010) analyzed the nuclear 18S of 18 Curcuma species. The rDNA and chloroplast trnK sequences were sequenced and a phylogenetic tree was constructed, suggesting that the trnK gene sequence is of great significance for the identification of Curcuma species. Chen et al. (2015) used four chloroplast genes (matK, rbcL, trnH-psbA, trnL-F) and one nuclear gene ITS2 from DNA barcodes to study 44 Curcuma species from China and Myanmar. They found that ITS2 had better recognition of Curcuma species compared to other barcodes, but the overall interspecific recognition was still too low. They suggested developing specific primers for Curcuma species research. Liang et al. (2020) used chloroplast genomes to study the phylogenetic relationships of 14 Curcuma species and found that the chloroplast genomes of Curcuma were highly similar. They speculated that this might be due to hybridization between similar species in the same region. More genetic data are needed to clarify the phylogenetic relationships of Curcuma.

[0009] Simple sequence repeats (SSRs), also known as microsatellites, are tandem repeat sequences with 2-5 nucleotides as basic repeating units, distributed in the genomes of both eukaryotic and prokaryotic organisms. As a representative of second-generation molecular markers, SSR molecular markers possess advantages such as rich polymorphism, simple operation, reliable results, good reproducibility, and multiple allelicity, and have been applied in medicinal plants such as Polygonatum multiflorum, Clausena lansium, and Lycium barbarum. Currently, the developed SSR molecular markers for Curcuma zedoaria from Guangxi are mainly used for analyzing phylogenetic relationships and genetic diversity among different varieties or origins within the same species; no SSR marker studies have been found specifically for identifying its provenance.

[0010] The development of traditional SSR (genomic-SSR) primers typically involves cumbersome steps such as genome library construction, probe hybridization, cloning, and sequencing. This process is not only time-consuming and labor-intensive, but also costly, inefficient, and prone to isotope contamination. In recent years, the rapid development of next-generation sequencing technologies has provided a new avenue for the development of SSR molecular markers (EST-SSR). Transcriptome sequencing offers a significantly larger data foundation for SSR marker development than before, thus accelerating the development of SSR markers, particularly those related to important traits or comparative mapping. The development of SSR molecular markers using transcriptome information has been widely applied in species and germplasm identification across various fields, with increasingly mature techniques and processes. Experiments in species such as Polygonatum multiflorum, Phellodendron amurense, Eucommia ulmoides, and Lycium barbarum have demonstrated the high efficiency of using transcriptome sequencing technology for molecular marker development, especially for non-model species lacking genomic background information. Summary of the Invention

[0011] This patent utilizes SSR sequencing sites and primers exhibiting polymorphism. By screening 26 pairs of microsatellite primers, it enables the identification of plants in the genus *Curcuma*. The method is as follows:

[0012] On one hand, embodiments of the present invention provide primers for identifying plants of the genus Curcuma, including 26 pairs of microsatellite primers, as detailed below:

[0013]

[0014] On the other hand, embodiments of the present invention also provide a kit for identifying plants of the genus Curcuma, including the aforementioned 26 pairs of microsatellite primers.

[0015] Furthermore, the kit for identifying Curcuma species in this embodiment also includes Master Mixture, Orange-500, and a positive control. The positive control serves as a positive quality control for the experiment and can be selected from one or more of the following as needed: Curcuma zedoaria, Curcuma longa, Curcuma aromatica, Curcuma aromatica var. yunnanensis, and Curcuma longa var. yunnanensis.

[0016] On another aspect, embodiments of the present invention also provide the application of the aforementioned 26 pairs of microsatellite primers or the aforementioned kit in the identification of Curcuma zedoaria, Curcuma zedoaria, Curcuma longa, Curcuma aromatica, Curcuma yunnanensis and Curcuma yunnanensis with a bitter taste, especially in the identification of Curcuma zedoaria.

[0017] In another aspect, embodiments of the present invention also provide a method for identifying plants of the genus Curcuma, the method comprising the following steps:

[0018] (1) DNA was extracted from the Curcuma species to be identified.

[0019] (2) Using the DNA obtained in step (1) as a template, perform PCR amplification with the aforementioned 26 pairs of primers to obtain the amplification product.

[0020] (3) The amplification products obtained in step (2) are detected by fluorescent capillary electrophoresis.

[0021] (4) The detection results obtained in step (3) are analyzed by data analysis software. The sample genotype data obtained from the analysis are clustered to determine whether the Curcuma species to be identified can be clustered with a certain type of Curcuma species in the cluster map. Individuals of different Curcuma species are distinguished based on the clustering results.

[0022] The cluster map is obtained by cluster analysis of the detection results of known Curcuma species obtained by steps (1)-(3) for different species of known Curcuma species.

[0023] The DNA extraction process is as follows:

[0024] 1) Take an appropriate amount of plant tissue (fresh weight 20mg-50mg) into a new grinding plate well, add steel balls into the grinding plate well, add 500μL of lysis buffer and 5μL of NaseA to the centrifuge tube, break it with a tissue homogenizer, place it at 65℃ for lysis for 30min, and shake to mix once every 10min.

[0025] 2) After the lysis begins, dispense each component (make sure to shake well before use) into different deep-well plates, and label them as follows: 500 μL / well for magnetic beads, 500 μL / well for washing solution I, 500 μL / well for washing solution II, 500 μL / well for washing solution III, and 100 μL / well for eluent.

[0026] 3) After lysis, centrifuge at 4000 rpm for 10 min, take 300 μL of supernatant and transfer it to a new deep-well plate (marked as ①) well, and then add 300 μL of isopropanol to each well.

[0027] 4) Place the No. ① deep well plate on station 1 of the nucleic acid extractor, and place the deep well plates containing magnetic beads, washing solution I, washing solution II, washing solution III and elution solution on stations 2-6 respectively, and run the zhiwu-nc program.

[0028] After the program ends, the instrument will automatically stop, and station 6 will enter the 4℃ preservation program to temporarily preserve the sample.

[0029] The PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 62-52℃ gradient annealing for 30 s, 72℃ extension for 30 s, for 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 30 s, for 25 cycles; 72℃ extension for 20 min, and finally storage at 4℃.

[0030] The fluorescence capillary electrophoresis detection program was set as follows: capillary: 36 / 50cm; Injection Voltage: 1.6 kV; Injection Time: 10s; Run Voltage: 15kV; Run Time: 1600s; Polymer: POP7.

[0031] The known turmeric species include turmeric, curcuma longa, ginger lily, warm turmeric, bitter turmeric, Sichuan turmeric, large turmeric, top-flowered turmeric, turmeric, and Guangxi turmeric, etc., and the number of known turmeric species is preferably greater than 20 (from multiple regions). The cluster map is obtained by classifying and archiving the detection results obtained in step (3) according to the detection sites, importing them into GeneMarker analysis software for analysis, and then performing cluster analysis using the unweighted group average method based on Nei genetic distance. The data analysis software is GeneMarker software.

[0032] Specifically, step (4) includes: classifying and archiving the detection results obtained in step (3) according to the detection sites, importing them into GeneMarker analysis software to obtain the genotype data of the samples, and then using the unweighted group average method based on Nei genetic distance to perform cluster analysis on the samples to be identified and known species samples to determine whether the Curcuma species to be identified can be clustered with a certain type of Curcuma species in the cluster map; if so, it is determined that the Curcuma species to be identified is the same as the species that can be clustered together.

[0033] This patent utilizes SSR sequencing sites and primers that exhibit polymorphism. By screening 26 pairs of microsatellite primers, it enables the identification of plants in the genus *Curcuma*. It can identify *Curcuma zedoaria*, *Curcuma zedoaria*, *Curcuma longa*, *Curcuma aromatica*, and *Curcuma aromatica var. wenyu*, contributing to the identification and research of *Curcuma* species and resources. Attached Figure Description

[0034] Figure 1 This is a flowchart of the experiment.

[0035] Figure 2 Electrophoretic gel image of the extracted DNA portion;

[0036] Figure 3 This is a schematic diagram of DNA marker band extraction.

[0037] Figure 4 This is a gel image for detecting PCR products via gel electrophoresis.

[0038] Figure 5 This is a schematic diagram of marker bands detected by gel electrophoresis of PCR products.

[0039] Figure 6 The original genotype data are exported in Excel format, categorized by locus name.

[0040] Figure 7 PDF typographic peak diagram;

[0041] Figure 8 This is a clustering result diagram for 26 samples. Detailed Implementation

[0042] The scope of protection of this invention is not limited to the following embodiments. Those skilled in the art can make adjustments to one or more steps, and all such adjustments are within the scope of protection of this application without departing from the essence of this invention.

[0043] I. Principle of this Patent

[0044] The number of repeat units in microsatellites exhibits high variability, manifesting as euploidy in the number of microsatellite units or potential sequence inconsistencies within the repeat unit sequences, thus causing site polymorphism. Specific primers were designed based on conserved microsatellite sequences, and fluorescent groups were added for fluorescent PCR amplification. The amplified products with fluorescent signals were then detected by 3730 capillary fluorescent electrophoresis. Fragments with different numbers of repeat units showed peaks at different positions. Different alleles were identified based on the peak readings.

[0045] II. Instruments and Reagents

[0046] 2.1 The experimental apparatus is shown in Table 1:

[0047] Table 1

[0048] .

[0049] 2.2 The experimental reagents and consumables are shown in Table 2:

[0050] Table 2

[0051] .

[0052] III. Primer Screening and Validation Experiments

[0053] 3.1 Test Materials

[0054] Sample materials from 26 species of the genus Curcuma, totaling 10 species, are shown in Table 3:

[0055] Table 3

[0056] .

[0057] Table 3 lists 10 species: turmeric, turmeric root, ginger lotus flower, warm turmeric root, bitter turmeric root, Sichuan turmeric root, large turmeric root, top-flowered turmeric root, turmeric root, and Guangxi turmeric root.

[0058] 3.2 DNA Extraction

[0059] Nucleic acid extraction was performed on Curcuma zedoaria samples using a magnetic bead-based plant genome extraction kit and an automated workstation. The steps are as follows:

[0060] 1) Take an appropriate amount of plant tissue (fresh weight 20mg-50mg) into a new grinding plate well, add steel balls into the grinding plate well, add 500μL of lysis buffer and 5μL of NaseA to the centrifuge tube, break it with a tissue homogenizer, place it at 65℃ for lysis for 30min, and shake to mix once every 10min.

[0061] 2) After the lysis begins, dispense each component (make sure to shake well before use) into different deep-well plates, and label them as follows: 500 μL / well for magnetic beads, 500 μL / well for washing solution I, 500 μL / well for washing solution II, 500 μL / well for washing solution III, and 100 μL / well for eluent.

[0062] 3) After lysis, centrifuge at 4000 rpm for 10 min, take 300 μL of supernatant and transfer it to a new deep-well plate (marked as ①) well, and then add 300 μL of isopropanol to each well.

[0063] 5) Place the No. ① deep well plate on station 1 of the nucleic acid extractor, and place the deep well plates containing magnetic beads, washing solution I, washing solution II, washing solution III and elution solution on stations 2-6 respectively, and run the zhiwu-nc program.

[0064] After the program ends, the instrument will automatically stop, and station 6 will enter the 4℃ preservation program to temporarily preserve the sample.

[0065] 3.3 DNA testing

[0066] 3.3.1 Gel electrophoresis detection

[0067] 3.3.1.1 Pretreatment: Take 2uL of DNA sample and add 2uL of 6×Loading Buffer.

[0068] 3.3.1.2 Detection parameters: agarose gel concentration 1%, voltage 120V, electrophoresis time: 20min.

[0069] 3.3.1.3 Spot the gel from left to right, ensuring at least one DNA marker is spotted in each well of the gel as a reference. After electrophoresis, place the gel block into a gel imaging analyzer for gel imaging and save the image.

[0070] 3.3.1.4 DNA sample electrophoresis gel image as shown Figure 2 and Figure 3 As shown.

[0071] * A good DNA electrophoresis result should be:

[0072] 1. The main strap is bright and clear, with no slack, and the main strap size is around 10kb.

[0073] 2. If the main band becomes wider and darker, it indicates slight DNA degradation. If it becomes a diffuse DNA band, it indicates severe DNA degradation.

[0074] 3. If there is no band on electrophoresis, it indicates that the total amount and concentration of extracted DNA are extremely low, which may lead to PCR amplification failure.

[0075] 3.3.2 Absorbance Detection

[0076] 3.3.2.1 Take 2 μL of DNA sample and use a NanoDROP 8000 micro-volume spectrophotometer to detect nucleic acid concentration and purity. A good DNA detection result should be:

[0077] 1. The concentration (ng / ul) should be ≥30ng / ul. Too low a concentration is not conducive to subsequent PCR experiments.

[0078] 2. A260 / A280 = 1.8-2.0. A ratio less than 1.8 indicates protein contamination, while a ratio greater than 2.0 indicates RNA contamination.

[0079] 3.4 Genotyping Primer Synthesis

[0080] Based on the transcriptome sequence analysis of Curcuma spp. obtained in the previous phase of the project, SSR primers were designed, resulting in 192 primer pairs. (Note: The 192 primer pairs were derived by selecting samples from three different species in the sampled population for transcriptome sequencing; primers were initially screened based on design parameters and results, selecting sites and primers showing polymorphism at the same SSR loci, and removing sites and primers unfavorable to result interpretation and amplification experiments. 192 primer pairs suitable for genotyping were randomly selected for labeling and screening experiments.) Primers were synthesized using the adapter method, which involves adding a 21bp adapter sequence (specifically, GAAGGTGACCAAGTTCATGCT) to the upstream primer. During PCR amplification using the adapter method, in the first step, the upstream and downstream primers with the adapter bind to the template, yielding a PCR product with the adapter sequence. In the second step, the adapter primer with the fluorescent group binds to the downstream primer, yielding a PCR product with both the fluorescent group and the 21bp adapter sequence.

[0081] 3.5 Fluorescent PCR Amplification

[0082] 3.5.17 samples were screened using 192 primer pairs.

[0083] In the initial stage, 192 primer pairs were amplified from 7 samples (selected from 7 out of 10 species) using a Veriti 384 PCR instrument. The PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, gradient annealing from 62-52℃ for 30 s, extension at 72℃ for 30 s, for 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, extension at 72℃ for 30 s, for 25 cycles; 72℃ extension for 20 min, and final storage at 4℃. After the PCR reaction, the amplified products were detected by fluorescent capillary electrophoresis. The results were analyzed using GeneMarker software, and 26 primer pairs were selected.

[0084] 3.5.226 samples were amplified using 26 pairs of primers.

[0085] Twenty-six samples (as shown in Table 3) were amplified using the 26 primer pairs screened in the previous step. The reaction was performed on a Veriti 384 PCR instrument. The PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, gradient annealing from 62-52℃ for 30 s, extension at 72℃ for 30 s, for 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, extension at 72℃ for 30 s, for 25 cycles; 72℃ extension for 20 min, and final storage at 4℃. After the PCR reaction, the amplification products were detected by fluorescent capillary electrophoresis. The raw data in .fsa format was exported from the ABI 3730xl instrument, classified and archived according to the detection sites, and then imported into GeneMarker analysis software for genotyping data reading. Excel genotyping raw data and PDF genotyping peak plot files were exported separately according to the site names. Figure 6 and 7 The images show partial genotypes and peak diagrams of the CpV005 primer.

[0086] The results were then processed using GeneMarker software, and cluster analysis was performed. The results are as follows: Figure 8 As shown. From Figure 8 As can be seen from the data, *Curcuma zedoaria*, *Curcuma zedoaria*, *Curcuma longa*, *Curcuma aromatica*, *Curcuma warmensis*, and *Curcuma longa* with a bitter taste can all be clustered separately for differentiation. Information on the 26 primer pairs is shown in Table 4.

[0087] Table 4

[0088] .

[0089] In Table 4, CpV005 corresponds to SEQ ID NO:1 and SEQ ID NO:2 in the embodiments, and so on, to achieve a one-to-one correspondence.

[0090] 3.5.35-sample blind test validation

[0091] Five samples were randomly selected (species information known, randomly selected from those listed in Table 3) and 26 primer pairs were amplified. The reaction was performed on a Veriti 384 PCR instrument. The PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, gradient annealing from 62-52℃ for 30 s, extension at 72℃ for 30 s, for 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, extension at 72℃ for 30 s, for 25 cycles; 72℃ extension for 20 min, and final storage at 4℃. After the PCR reaction, the amplification products were detected by fluorescent capillary electrophoresis. The results were processed using GeneMarker software, and the 26 samples were clustered together. The results of the blind test were consistent with the species information.

[0092] IV. Specific methods for using primers

[0093] 4.1 The PCR amplification system and amplification program are shown in Table 5:

[0094] Table 5

[0095] .

[0096] 4.2 Electrophoretic identification and dilution of fluorescent PCR products

[0097] To ensure the specificity of fluorescent PCR amplification and the uniformity of sample concentration for sequencing, after fluorescent PCR amplification, 2 μL of PCR product was subjected to agarose gel electrophoresis (1% concentration). The band pattern of the PCR product was used to determine the amplification specificity of each SSR primer, and the brightness of the PCR product bands was used to determine the amplification efficiency of each SSR primer. The fluorescent PCR products were diluted according to the required concentration for sequencing to obtain a uniform concentration, which was then used for sequencing. The electrophoresis results are shown below. Figure 4 and 5 As shown.

[0098] 4.3 Fluorescent capillary electrophoresis detection

[0099] 4.3.1 Following the experimental protocol in the experimental information management system, add the fluorescent PCR products diluted to a uniform concentration to the test plate, and add the test reagents according to the system shown in Table 6:

[0100] Table 6

[0101] .

[0102] 4.3.2 After centrifuging the plate containing the sample and reagents, place it on a PCR instrument and run the denaturation program (95℃, 3 min). Cool it immediately after denaturation is complete.

[0103] 4.3.3 Refer to the ABI 3730xl operating procedure, select the test file corresponding to the name of the board to be tested, and run the SSR sample analysis test program.

[0104] 4.4 Raw Data Analysis

[0105] Raw data in .fsa format was exported from the ABI 3730xl instrument, categorized and archived according to detection sites, and then imported into GeneMarker analysis software for genotyping data reading. Excel genotyping raw data and PDF genotyping peak plot files were then exported separately according to site name. The results are as follows: Figure 6 and 7 As shown.

[0106] 4.5 Genetic distance

[0107] Cluster analysis was performed using the unweighted group average method (UPGMA) based on Nei genetic distance.

[0108] V. Reagent Kit Preparation

[0109] 5.1 Reagent Storage

[0110] Upon receiving the kit, if not immediately used, please store it at -15 to -25°C (the kit has a shelf life of 1 year). After use, store the kit at 2-8°C, avoiding repeated freeze-thaw cycles, and protect it from light.

[0111] 5.2 Preparation of PCR system

[0112] Thaw the 2×Master Mixture and Curcuma Zedoary Appraisal Primers (representing the 26 primer pairs of this patent) before use, vortex for 10 seconds, and then briefly centrifuge. Add the corresponding reagents sequentially according to the PCR reaction system in the table, centrifuge at 1500 rpm / min for 30 seconds, tighten the gel pad, and then place on a thermal cycler. The PCR reaction procedure is shown in Table 7:

[0113] Table 7

[0114] .

[0115] Note: The kit contains 6 sets of Curcuma Zedoary Appraisal Primers. The reaction system for each set is the same as above. Please refer to Table 11 for details. In this example, we take the identification of turmeric as an example. Control DNA ZWY02 (turmeric) is used as a positive control for turmeric.

[0116] 5.3 Amplification Procedure

[0117] Place the PCR plate from the previous step into the thermal cycler, and run the instrument after setting the parameters as shown in Table 8.

[0118] Table 8

[0119] .

[0120] 5.4 Sequencing Instrument On-Machine Testing

[0121] 5.4.1 The computer system is shown in Table 9:

[0122] Table 9

[0123] .

[0124] Based on the PCR product concentration and sequencer sensitivity, dilute the PCR product obtained in the previous step to an appropriate concentration, then add 1 μL to the internal standard mixture, heat at 95℃ for 3 minutes before sequencing, and cool at 4-16℃ for 2 minutes.

[0125] 5.4.2 Electrophoresis Parameter Settings

[0126] Instrument model: ABI-3730xL; Capillary: 36 / 50cm; Injection Voltage: 1.6 kV; Injection Time: 10s; Run Voltage: 15kV; Run Time: 1600s; Polymer: POP7. The raw data from the fluorescent capillary electrophoresis were analyzed to determine the genotype. The kit components are shown in Table 10.

[0127] Table 10

[0128] .

[0129] The sizes of the internal index Orange-500 fragments are: 50, 75, 100, 139, 150, 160, 200, 300, 340, 350, 400, 450, 490, 500.

[0130] Taking turmeric as an example, the classification information of turmeric is shown in Table 11:

[0131] Table 11

[0132] .

[0133] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Primers for identifying plants of the genus Curcuma, characterized in that, It includes 26 pairs of microsatellite primers, as follows: Primer pair 1: Upstream primer is SEQ ID NO:1, downstream primer is SEQ ID NO:2; Primer pair 2: Upstream primer is SEQ ID NO:3, downstream primer is SEQ ID NO:4; Primer pair 3: Upstream primer is SEQ ID NO:5, downstream primer is SEQ ID NO:6; Primer pair 4: Upstream primer is SEQ ID NO:7, downstream primer is SEQ ID NO:8; Primer pair 5: Upstream primer is SEQ ID NO:9, downstream primer is SEQ ID NO:10; Primer pair 6: Upstream primer is SEQ ID NO:11, downstream primer is SEQ ID NO:12; Primer pair 7: Upstream primer is SEQ ID NO:13, downstream primer is SEQ ID NO:14; Primer pair 8: Upstream primer is SEQ ID NO:15, downstream primer is SEQ ID NO:16; Primer pair 9: Upstream primer is SEQ ID NO:17, downstream primer is SEQ ID NO:18; Primer pair 10: Upstream primer is SEQ ID NO:19, downstream primer is SEQ ID NO:20; Primer pair 11: Upstream primer is SEQ ID NO:21, downstream primer is SEQ ID NO:22; Primer pair 12: Upstream primer is SEQ ID NO:23, downstream primer is SEQ ID NO:24; Primer pair 13: Upstream primer is SEQ ID NO:25, downstream primer is SEQ ID NO:26; Primer pair 14: Upstream primer is SEQ ID NO:27, downstream primer is SEQ ID NO:28; Primer pair 15: Upstream primer is SEQ ID NO:29, downstream primer is SEQ ID NO:30; Primer pair 16: Upstream primer is SEQ ID NO:31, downstream primer is SEQ ID NO:32; Primer pair 17: Upstream primer is SEQ ID NO:33, downstream primer is SEQ ID NO:34; Primer pair 18: Upstream primer is SEQ ID NO:35, downstream primer is SEQ ID NO:36; Primer pair 19: Upstream primer is SEQ ID NO:37, downstream primer is SEQ ID NO:38; Primer pair 20: Upstream primer is SEQ ID NO:39, downstream primer is SEQ ID NO:40; Primer pair 21: Upstream primer is SEQ ID NO:41, downstream primer is SEQ ID NO:42; Primer pair 22: Upstream primer is SEQ ID NO:43, downstream primer is SEQ ID NO:44; Primer pair 23: Upstream primer is SEQ ID NO:45, downstream primer is SEQ ID NO:46; Primer pair 24: Upstream primer is SEQ ID NO:47, downstream primer is SEQ ID NO:48; Primer pair 25: Upstream primer is SEQ ID NO:49, downstream primer is SEQ ID NO:50; Primer pair 26: Upstream primer is SEQ ID NO:51, downstream primer is SEQ ID NO:

52.

2. A kit for identifying plants of the genus Curcuma, characterized in that, Includes the 26 pairs of microsatellite primers as described in claim 1.

3. A method for identifying plants of the genus Curcuma, characterized in that, Includes the following steps: (1) Extracting DNA from the Curcuma species to be identified; (2) Using the DNA obtained in step (1) as a template, PCR amplification was performed using 26 pairs of microsatellite primers to obtain the amplification product; (3) The amplification products obtained in step (2) are detected by fluorescent capillary electrophoresis; (4) The detection results obtained in step (3) are analyzed by data analysis software. The sample genotype data obtained from the analysis are clustered to determine whether the Curcuma species to be identified can be clustered with a certain type of Curcuma species in the cluster map. Individuals of different Curcuma species are distinguished based on the clustering results. The cluster map is obtained by cluster analysis of the detection results of known Curcuma species obtained by steps (1)-(3) for different species of known Curcuma species. The Curcuma species to be identified and the known Curcuma species are Curcuma zedoaria, Curcuma zedoaria, Curcuma longa, Curcuma aromatica, Curcuma yunnanensis and Curcuma yunnanensis with a bitter taste; The 26 pairs of microsatellite primers are as follows: Primer pair 1: Upstream primer is SEQ ID NO:1, downstream primer is SEQ ID NO:2; Primer pair 2: Upstream primer is SEQ ID NO:3, downstream primer is SEQ ID NO:4; Primer pair 3: Upstream primer is SEQ ID NO:5, downstream primer is SEQ ID NO:6; Primer pair 4: Upstream primer is SEQ ID NO:7, downstream primer is SEQ ID NO:8; Primer pair 5: Upstream primer is SEQ ID NO:9, downstream primer is SEQ ID NO:10; Primer pair 6: Upstream primer is SEQ ID NO:11, downstream primer is SEQ ID NO:12; Primer pair 7: Upstream primer is SEQ ID NO:13, downstream primer is SEQ ID NO:14; Primer pair 8: Upstream primer is SEQ ID NO:15, downstream primer is SEQ ID NO:16; Primer pair 9: Upstream primer is SEQ ID NO:17, downstream primer is SEQ ID NO:18; Primer pair 10: Upstream primer is SEQ ID NO:19, downstream primer is SEQ ID NO:20; Primer pair 11: Upstream primer is SEQ ID NO:21, downstream primer is SEQ ID NO:22; Primer pair 12: Upstream primer is SEQ ID NO:23, downstream primer is SEQ ID NO:24; Primer pair 13: Upstream primer is SEQ ID NO:25, downstream primer is SEQ ID NO:26; Primer pair 14: Upstream primer is SEQ ID NO:27, downstream primer is SEQ ID NO:28; Primer pair 15: Upstream primer is SEQ ID NO:29, downstream primer is SEQ ID NO:30; Primer pair 16: Upstream primer is SEQ ID NO:31, downstream primer is SEQ ID NO:32; Primer pair 17: Upstream primer is SEQ ID NO:33, downstream primer is SEQ ID NO:34; Primer pair 18: Upstream primer is SEQ ID NO:35, downstream primer is SEQ ID NO:36; Primer pair 19: Upstream primer is SEQ ID NO:37, downstream primer is SEQ ID NO:38; Primer pair 20: Upstream primer is SEQ ID NO:39, downstream primer is SEQ ID NO:40; Primer pair 21: Upstream primer is SEQ ID NO:41, downstream primer is SEQ ID NO:42; Primer pair 22: Upstream primer is SEQ ID NO:43, downstream primer is SEQ ID NO:44; Primer pair 23: Upstream primer is SEQ ID NO:45, downstream primer is SEQ ID NO:46; Primer pair 24: Upstream primer is SEQ ID NO:47, downstream primer is SEQ ID NO:48; Primer pair 25: Upstream primer is SEQ ID NO:49, downstream primer is SEQ ID NO:50; Primer pair 26: Upstream primer is SEQ ID NO:51, downstream primer is SEQ ID NO:

52.

4. The identification method according to claim 3, characterized in that, The PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 62-52℃ gradient annealing for 30 s, 72℃ extension for 30 s, for 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 30 s, for 25 cycles; 72℃ extension for 20 min, and finally storage at 4℃.

5. The identification method according to claim 3, characterized in that, The fluorescence capillary electrophoresis detection program was set as follows: capillary: 36 / 50cm; Injection Voltage: 1.6 kV; Injection Time: 10s; Run Voltage: 15kV; RunTime: 1600s; Polymer: POP7.

6. The identification method according to claim 3, characterized in that, The cluster map is obtained by classifying and archiving the detection results obtained in step (3) according to the detection sites, importing them into GeneMarker analysis software for analysis, and then performing cluster analysis using the unweighted group average method based on Nei genetic distance; the data analysis software is GeneMarker software.

7. The identification method according to claim 3, characterized in that, Step (4) specifically includes: classifying and archiving the detection results obtained in step (3) according to the detection sites, importing them into GeneMarker analysis software to obtain the genotype data of the samples, and then using the unweighted group average method based on Nei genetic distance to perform cluster analysis on the samples to be identified and known species samples to determine whether the Curcuma species to be identified can be clustered with a certain type of Curcuma species in the cluster map; if so, it is determined that the Curcuma species to be identified is the same as the species that can be clustered together.

Images